#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
UBAP2L	9898	genome.wustl.edu	37	1	154223752	154223752	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:154223752G>C	ENST00000361546.2	+	12	1491	c.1449G>C	c.(1447-1449)caG>caC	p.Q483H	UBAP2L_ENST00000343815.6_Missense_Mutation_p.Q483H|UBAP2L_ENST00000428931.1_Missense_Mutation_p.Q483H|UBAP2L_ENST00000271877.7_Missense_Mutation_p.Q494H			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	483					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.Q483H(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CGGCTCAGCAGAAACTGAAAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	65.0	64.0					1																	154223752		2203	4300	6503	152490376	SO:0001583	missense	9898			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1449G>C	1.37:g.154223752G>C	ENSP00000355343:p.Gln483His		152490376	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	-	p.Q483H	ENST00000361546.2	37	c.1449	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255065	0.59321	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000361546	T;T;T;T	0.12672	2.67;2.67;2.66;2.67	5.65	-2.67	0.06059	.	0.000000	0.85682	D	0.000000	T	0.08403	0.0209	N	0.08118	0	0.35991	D	0.836705	D;D;D;D;D	0.89917	0.99;1.0;0.994;0.994;0.99	D;D;D;D;D	0.81914	0.979;0.995;0.991;0.991;0.979	T	0.07693	-1.0759	10	0.72032	D	0.01	-2.1592	14.2947	0.66304	0.2947:0.0:0.7053:0.0	.	397;494;476;483;483	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	H	483;483;494;483	ENSP00000345308:Q483H;ENSP00000389445:Q483H;ENSP00000271877:Q494H;ENSP00000355343:Q483H	ENSP00000271877:Q494H	Q	+	3	2	UBAP2L	152490376	0.999000	0.42202	0.945000	0.38365	0.983000	0.72400	0.567000	0.23608	-0.355000	0.08199	-0.137000	0.14449	CAG	-	NULL		0.488	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	protein_coding	OTTHUMT00000087673.1	G	NM_014847		152490376	1	no_errors	NM_014847	genbank	human	validated	54_36p	missense	SNP	1	C
LMNA	4000	genome.wustl.edu	37	1	156096688	156096688	+	Intron	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:156096688C>T	ENST00000368300.4	+	2	568				LMNA_ENST00000347559.2_Intron|LMNA_ENST00000368301.2_Intron|LMNA_ENST00000448611.2_Intron|LMNA_ENST00000392353.3_Missense_Mutation_p.A32V|LMNA_ENST00000368297.1_Missense_Mutation_p.A32V|LMNA_ENST00000361308.4_Intron|LMNA_ENST00000368299.3_Intron|LMNA_ENST00000473598.2_Intron	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					AGGACACGGGCGAAGCCAGGG	0.642									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																																							0			1											19.0	18.0	18.0					1																	156096688		875	1990	2865	154363312	SO:0001627	intron_variant	4000	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.357-3720C>T	1.37:g.156096688C>T			154363312	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	-	p.A32V	ENST00000368300.4	37	c.95	CCDS1129.1	1	.	.	.	.	.	.	.	.	.	.	C	2.922	-0.223002	0.06061	.	.	ENSG00000160789	ENST00000368297;ENST00000392353	D;D	0.82619	-1.63;-1.63	4.92	-0.752	0.11072	.	.	.	.	.	T	0.38772	0.1053	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15752	-1.0426	8	0.17369	T	0.5	.	0.9172	0.01307	0.2908:0.3683:0.1503:0.1907	.	32	Q5TCI8	.	V	32	ENSP00000357280:A32V;ENSP00000376164:A32V	ENSP00000357280:A32V	A	+	2	0	LMNA	154363312	0.008000	0.16893	0.000000	0.03702	0.018000	0.09664	0.119000	0.15626	-0.307000	0.08804	0.561000	0.74099	GCG	-	NULL		0.642	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNA	protein_coding	OTTHUMT00000039200.2	C	NM_170707		154363312	1	no_errors	ENST00000368297	ensembl	human	known	54_36p	missense	SNP	0.1	T
NCF2	4688	genome.wustl.edu	37	1	183543675	183543675	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:183543675T>C	ENST00000367535.3	-	4	699	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	NCF2_ENST00000418089.1_Intron|NCF2_ENST00000367536.1_Missense_Mutation_p.M150V|NCF2_ENST00000413720.1_Intron	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	150					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)	p.M150V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	TCAGACTTCATGCTCGTGGCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											322.0	286.0	298.0					1																	183543675		2203	4300	6503	181810298	SO:0001583	missense	4688			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.448A>G	1.37:g.183543675T>C	ENSP00000356505:p.Met150Val		181810298	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	HMMPfam_PB1;HMMPfam_TPR_1;HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_TPR-like;superfamily_CAD  PB1 domains	p.M150V	ENST00000367535.3	37	c.448	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	T	7.945	0.743577	0.15642	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000367535	T;T	0.64991	-0.13;-0.13	5.32	2.84	0.33178	Tetratricopeptide-like helical (1);	0.356073	0.34460	N	0.003945	T	0.48804	0.1520	L	0.54323	1.7	0.42751	D	0.993777	B	0.27700	0.186	B	0.23852	0.049	T	0.26573	-1.0099	10	0.15499	T	0.54	-22.9273	6.2955	0.21083	0.314:0.0:0.2308:0.4552	.	150	P19878	NCF2_HUMAN	V	150;178;150	ENSP00000356506:M150V;ENSP00000356505:M150V	ENSP00000356505:M150V	M	-	1	0	NCF2	181810298	0.997000	0.39634	0.528000	0.27938	0.439000	0.31926	0.794000	0.26958	0.345000	0.23873	0.533000	0.62120	ATG	-	HMMPfam_TPR_1		0.453	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	protein_coding	OTTHUMT00000085483.1	T	NM_000433		181810298	-1	no_errors	NM_000433	genbank	human	reviewed	54_36p	missense	SNP	0.81	C
KIF17	57576	genome.wustl.edu	37	1	20992729	20992729	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:20992729G>T	ENST00000247986.2	-	14	3199	c.2889C>A	c.(2887-2889)agC>agA	p.S963R	KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Missense_Mutation_p.S962R|KIF17_ENST00000375044.1_Missense_Mutation_p.S863R			Q9P2E2	KIF17_HUMAN	kinesin family member 17	963					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.S963R(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGGCGTCTGTGCTGAGGATCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											179.0	150.0	160.0					1																	20992729		2203	4300	6503	20865316	SO:0001583	missense	57576			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2889C>A	1.37:g.20992729G>T	ENSP00000247986:p.Ser963Arg		20865316	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	HMMPfam_Kinesin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S963R	ENST00000247986.2	37	c.2889	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.730874	0.30684	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.70986	-0.53;-0.42;-0.42	5.95	3.12	0.35913	.	.	.	.	.	T	0.65428	0.2690	L	0.55481	1.735	0.23762	N	0.996916	B;B;B	0.30146	0.177;0.27;0.177	B;B;B	0.32289	0.036;0.143;0.068	T	0.53215	-0.8470	9	0.35671	T	0.21	.	10.7608	0.46264	0.2077:0.0:0.7923:0.0	.	963;962;963	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	R	863;962;963;344	ENSP00000364184:S863R;ENSP00000383311:S962R;ENSP00000247986:S963R	ENSP00000247986:S963R	S	-	3	2	KIF17	20865316	0.026000	0.19158	0.817000	0.32601	0.168000	0.22595	0.343000	0.19944	0.437000	0.26423	-0.244000	0.11960	AGC	-	NULL		0.577	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	protein_coding	OTTHUMT00000276995.1	G	NM_020816		20865316	-1	no_errors	NM_020816	genbank	human	validated	54_36p	missense	SNP	1	T
TPR	7175	genome.wustl.edu	37	1	186328958	186328958	+	Silent	SNP	T	T	C	rs201691804	byFrequency	TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:186328958T>C	ENST00000367478.4	-	12	1658	c.1362A>G	c.(1360-1362)ttA>ttG	p.L454L	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	454	Necessary for association to the NPC.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.L455L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCTTAACAGATAAACTTGCTA	0.368			T	NTRK1	papillary thyroid								T|||	12	0.00239617	0.0	0.0014	5008	,	,		16823	0.0		0.001	False		,,,				2504	0.0102						Dom	yes		1	1q25	7175	translocated promoter region		E	1	Substitution - coding silent(1)	ovary(1)	1						T		1,3697		0,1,1848	142.0	125.0	130.0		1362	0.9	1.0	1		130	12,8192		0,12,4090	no	coding-synonymous	TPR	NM_003292.2		0,13,5938	CC,CT,TT		0.1463,0.027,0.1092		454/2364	186328958	13,11889	1849	4102	5951	184595581	SO:0001819	synonymous_variant	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1362A>G	1.37:g.186328958T>C			184595581	Q15655|Q5SWY0|Q99968	Silent	SNP	-	p.L454	ENST00000367478.4	37	c.1362	CCDS41446.1	1																																																																																			-	NULL		0.368	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	protein_coding	OTTHUMT00000086353.2	T	NM_003292		184595581	-1	no_errors	NM_003292	genbank	human	reviewed	54_36p	silent	SNP	0.99	C
TRIM67	440730	genome.wustl.edu	37	1	231342437	231342437	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:231342437G>A	ENST00000366653.5	+	7	1720	c.1720G>A	c.(1720-1722)Ggt>Agt	p.G574S	TRIM67_ENST00000444294.3_Missense_Mutation_p.G572S|TRIM67_ENST00000366652.2_Missense_Mutation_p.G574S|TRIM67_ENST00000449018.3_Missense_Mutation_p.G512S			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	574	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.G574S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TACCATCGACGGTCTTCACTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	85.0	83.0					1																	231342437		2067	4223	6290	229409060	SO:0001583	missense	440730			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1720G>A	1.37:g.231342437G>A	ENSP00000355613:p.Gly574Ser		229409060	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	-	p.G574S	ENST00000366653.5	37	c.1720	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544569	0.86022	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.58892	0.2154	M	0.89534	3.04	0.80722	D	1	P	0.51057	0.941	P	0.48677	0.586	T	0.69194	-0.5209	10	0.72032	D	0.01	.	19.7611	0.96319	0.0:0.0:1.0:0.0	.	574	Q6ZTA4	TRI67_HUMAN	S	572;574;512;574	ENSP00000412124:G572S;ENSP00000355612:G574S;ENSP00000400163:G512S;ENSP00000355613:G574S	ENSP00000355612:G574S	G	+	1	0	TRIM67	229409060	1.000000	0.71417	0.463000	0.27130	0.747000	0.42532	9.658000	0.98594	2.741000	0.93983	0.655000	0.94253	GGT	-	NULL		0.502	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	protein_coding	OTTHUMT00000092649.3	G	NM_001004342		229409060	1	no_errors	NM_001004342	genbank	human	validated	54_36p	missense	SNP	1	A
MDS2	259283	genome.wustl.edu	37	1	23966170	23966170	+	Splice_Site	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:23966170C>A	ENST00000374555.3	+	6	734	c.147C>A	c.(145-147)agC>agA	p.S49R	MDS2_ENST00000477916.1_3'UTR			Q8NDY4	MDS2_HUMAN	myelodysplastic syndrome 2 translocation associated	49						extracellular space (GO:0005615)		p.S49R(1)		breast(1)|ovary(2)	3						TTTCTTGCAGCTGCAGTGTTC	0.592			T	ETV6	MDS																																		Dom	yes		1	1p36	259283	myelodysplastic syndrome 2		L	1	Substitution - Missense(1)	ovary(1)	1											11.0	10.0	10.0					1																	23966170		874	1987	2861	23838757	SO:0001630	splice_region_variant	259283			AJ310434		1p36	2008-02-05			ENSG00000197880	ENSG00000197880			29633	protein-coding gene	gene with protein product		607305				12203785	Standard	NR_027042		Approved		uc001bhi.3	Q8NDY4	OTTHUMG00000002927	ENST00000374555.3:c.147-1C>A	1.37:g.23966170C>A			23838757		Missense_Mutation	SNP	-	p.S49R	ENST00000374555.3	37	c.147		1	.	.	.	.	.	.	.	.	.	.	C	7.960	0.746868	0.15710	.	.	ENSG00000197880	ENST00000374555	.	.	.	1.36	1.36	0.22044	.	.	.	.	.	T	0.26376	0.0644	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21518	-1.0243	4	.	.	.	.	6.1259	0.20180	0.0:1.0:0.0:0.0	.	.	.	.	R	49	.	.	S	+	3	2	MDS2	23838757	0.001000	0.12720	0.021000	0.16686	0.007000	0.05969	0.027000	0.13621	1.047000	0.40274	0.411000	0.27672	AGC	-	NULL		0.592	MDS2-001	KNOWN	basic|appris_principal	protein_coding	MDS2	protein_coding	OTTHUMT00000008172.1	C	NM_148895	Missense_Mutation	23838757	1	no_errors	ENST00000374555	ensembl	human	known	54_36p	missense	SNP	0.03	A
LYST	1130	genome.wustl.edu	37	1	235966296	235966296	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:235966296C>A	ENST00000389794.3	-	8	3798	c.3624G>T	c.(3622-3624)caG>caT	p.Q1208H	LYST_ENST00000536965.1_Missense_Mutation_p.Q1208H|LYST_ENST00000389793.2_Missense_Mutation_p.Q1208H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1208					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Q1208H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AACTACAACACTGAGAATCCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	80.0	83.0					1																	235966296		2203	4300	6503	234032919	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.3624G>T	1.37:g.235966296C>A	ENSP00000374444:p.Gln1208His		234032919	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	-	p.Q1208H	ENST00000389794.3	37	c.3624	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055219	0.36277	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.63255	-0.03;-0.03;1.05	4.48	1.4	0.22301	.	0.334685	0.32703	N	0.005755	T	0.45094	0.1325	L	0.28740	0.885	0.43394	D	0.995518	B;B	0.18610	0.029;0.019	B;B	0.18561	0.022;0.014	T	0.20107	-1.0285	10	0.37606	T	0.19	.	8.2726	0.31853	0.0:0.7215:0.1295:0.149	.	1208;1208	Q99698-3;Q99698	.;LYST_HUMAN	H	1208	ENSP00000374444:Q1208H;ENSP00000374443:Q1208H;ENSP00000438315:Q1208H	ENSP00000374443:Q1208H	Q	-	3	2	LYST	234032919	0.886000	0.30341	0.972000	0.41901	0.986000	0.74619	0.394000	0.20834	0.198000	0.20407	0.655000	0.94253	CAG	-	NULL		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	protein_coding	OTTHUMT00000097533.5	C			234032919	-1	no_errors	NM_000081	genbank	human	reviewed	54_36p	missense	SNP	1	A
FMN2	56776	genome.wustl.edu	37	1	240370537	240370537	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:240370537C>A	ENST00000319653.9	+	5	2655	c.2425C>A	c.(2425-2427)Cag>Aag	p.Q809K		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	809	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.Q952K(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GAGCATCTCACAGCCTCCACC	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	66.0	67.0					1																	240370537		2203	4300	6503	238437160	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2425C>A	1.37:g.240370537C>A	ENSP00000318884:p.Gln809Lys		238437160	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	-	p.Q952K	ENST00000319653.9	37	c.2854	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	6.204	0.405825	0.11754	.	.	ENSG00000155816	ENST00000319653	T	0.32988	1.43	4.65	3.74	0.42951	Actin-binding FH2/DRF autoregulatory (1);	0.368136	0.23351	N	0.049131	T	0.34308	0.0893	L	0.60455	1.87	0.80722	D	1	P	0.50443	0.935	P	0.45753	0.492	T	0.12066	-1.0562	9	.	.	.	.	12.7689	0.57408	0.0:0.9207:0.0:0.0793	.	809	Q9NZ56	FMN2_HUMAN	K	809	ENSP00000318884:Q809K	.	Q	+	1	0	FMN2	238437160	1.000000	0.71417	0.007000	0.13788	0.057000	0.15508	3.102000	0.50291	1.184000	0.42957	0.650000	0.86243	CAG	-	NULL		0.532	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	protein_coding	OTTHUMT00000096217.2	C	XM_371352		238437160	1	no_errors	NM_020066	genbank	human	validated	54_36p	missense	SNP	0.6	A
FH	2271	genome.wustl.edu	37	1	241663802	241663802	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:241663802G>C	ENST00000366560.3	-	9	1363	c.1325C>G	c.(1324-1326)aCa>aGa	p.T442R		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	442					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)	p.T442R(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		GATCCTTTCTGTATTGGCCTG	0.398			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												Melanoma(148;1573 2486 7381 46575)	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	1	Substitution - Missense(1)	ovary(1)	1											153.0	147.0	149.0					1																	241663802		2203	4300	6503	239730425	SO:0001583	missense	2271	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1325C>G	1.37:g.241663802G>C	ENSP00000355518:p.Thr442Arg		239730425	B1ANK7	Missense_Mutation	SNP	Lyase_1;HMMPfam_Lyase_1	p.T442R	ENST00000366560.3	37	c.1325	CCDS1617.1	1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415363	0.25552	.	.	ENSG00000091483	ENST00000366560	D	0.99552	-6.15	5.71	3.8	0.43715	L-Aspartase-like (1);	0.498928	0.22500	N	0.059256	D	0.95050	0.8397	N	0.01146	-0.985	0.58432	D	0.999998	B	0.02656	0.0	B	0.08055	0.003	D	0.93512	0.6854	10	0.02654	T	1	-17.6664	9.3499	0.38131	0.0776:0.0:0.7794:0.143	.	442	P07954	FUMH_HUMAN	R	442	ENSP00000355518:T442R	ENSP00000355518:T442R	T	-	2	0	FH	239730425	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.156000	0.58138	1.386000	0.46466	0.655000	0.94253	ACA	-	NULL		0.398	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FH	protein_coding	OTTHUMT00000095490.1	G	NM_000143		239730425	-1	no_errors	NM_000143	genbank	human	reviewed	54_36p	missense	SNP	1	C
CAMTA1	23261	genome.wustl.edu	37	1	7723427	7723427	+	Missense_Mutation	SNP	G	G	A	rs77267405		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:7723427G>A	ENST00000303635.7	+	9	1027	c.820G>A	c.(820-822)Gtg>Atg	p.V274M	CAMTA1_ENST00000439411.2_Missense_Mutation_p.V274M	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V274M(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TGGCGGCAGCGTGCATCACAA	0.597			T	WWTR1	epitheliod hemangioendothelioma								G|||	1	0.000199681	0.0	0.0	5008	,	,		20408	0.0		0.001	False		,,,				2504	0.0						Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	1	Substitution - Missense(1)	ovary(1)	1											127.0	125.0	126.0					1																	7723427		2203	4300	6503	7646014	SO:0001583	missense	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.820G>A	1.37:g.7723427G>A	ENSP00000306522:p.Val274Met		7646014	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_TIG;HMMPfam_CG-1;superfamily_E set domains;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V274M	ENST00000303635.7	37	c.820	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	g	12.83	2.056042	0.36277	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.54675	0.56;0.56	4.89	3.97	0.46021	.	0.069722	0.56097	D	0.000023	T	0.64994	0.2649	L	0.50333	1.59	0.47123	D	0.99932	D	0.89917	1.0	D	0.80764	0.994	T	0.64609	-0.6367	10	0.46703	T	0.11	-11.4612	12.9368	0.58319	0.0784:0.0:0.9216:0.0	.	274	Q9Y6Y1	CMTA1_HUMAN	M	274	ENSP00000306522:V274M;ENSP00000402561:V274M	ENSP00000306522:V274M	V	+	1	0	CAMTA1	7646014	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	4.044000	0.57361	1.065000	0.40693	0.549000	0.68633	GTG	-	NULL		0.597	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	protein_coding	OTTHUMT00000003588.3	G	NM_015215		7646014	1	no_errors	NM_015215	genbank	human	validated	54_36p	missense	SNP	1	A
OR2AK2	391191	genome.wustl.edu	37	1	248128699	248128699	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:248128699T>A	ENST00000366480.3	+	1	165	c.66T>A	c.(64-66)agT>agA	p.S22R	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S22R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GAAATCAAAGTTTTGGGACAG	0.368																																					Melanoma(45;390 1181 23848 28461 41504)											1	Substitution - Missense(1)	ovary(1)	1											131.0	126.0	128.0					1																	248128699		2203	4300	6503	246195322	SO:0001583	missense	391191			BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.66T>A	1.37:g.248128699T>A	ENSP00000355436:p.Ser22Arg		246195322	B2RND1|Q6IF05	Missense_Mutation	SNP	-	p.S22R	ENST00000366480.3	37	c.66	CCDS31102.1	1	.	.	.	.	.	.	.	.	.	.	.	13.54	2.268956	0.40095	.	.	ENSG00000187080	ENST00000366480	T	0.54479	0.57	3.22	-3.84	0.04256	.	.	.	.	.	T	0.50531	0.1621	M	0.74546	2.27	0.09310	N	1	P	0.51791	0.948	P	0.48270	0.572	T	0.48317	-0.9046	9	0.87932	D	0	.	2.24	0.04017	0.1354:0.3808:0.1379:0.3459	.	22	Q8NG84	O2AK2_HUMAN	R	22	ENSP00000355436:S22R	ENSP00000355436:S22R	S	+	3	2	OR2AK2	246195322	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.380000	0.07427	-0.697000	0.05092	-0.473000	0.04963	AGT	-	NULL		0.368	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AK2	protein_coding	OTTHUMT00000096858.2	T	NM_001004491		246195322	1	no_errors	NM_001004491	genbank	human	provisional	54_36p	missense	SNP		A
KIAA1462	57608	genome.wustl.edu	37	10	30315774	30315774	+	Silent	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr10:30315774C>T	ENST00000375377.1	-	3	3404	c.3303G>A	c.(3301-3303)ccG>ccA	p.P1101P		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1101					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.P1101P(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TCCGGATGCCCGGCAGGAGGG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	10											62.0	64.0	63.0					10																	30315774		1950	4163	6113	30355780	SO:0001819	synonymous_variant	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3303G>A	10.37:g.30315774C>T			30355780	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	-	p.P1101	ENST00000375377.1	37	c.3303	CCDS41500.1	10																																																																																			-	NULL		0.632	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	C	NM_020848		30355780	-1	no_errors	NM_020848	genbank	human	validated	54_36p	silent	SNP		T
P4HA1	5033	genome.wustl.edu	37	10	74810982	74810982	+	Silent	SNP	A	A	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr10:74810982A>T	ENST00000307116.2	-	7	845	c.729T>A	c.(727-729)ggT>ggA	p.G243G	P4HA1_ENST00000412021.2_Silent_p.G243G|P4HA1_ENST00000263556.3_Silent_p.G243G|P4HA1_ENST00000394890.2_Silent_p.G243G|P4HA1_ENST00000440381.1_Silent_p.G243G|P4HA1_ENST00000373008.2_Silent_p.G243G			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	243					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)	p.G243G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ATTTTAAGTTACCATTAGCTC	0.318																																					Colon(147;367 2405 2662 52127)											1	Substitution - coding silent(1)	ovary(1)	10											69.0	71.0	70.0					10																	74810982		2203	4300	6503	74480988	SO:0001819	synonymous_variant	5033				CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.729T>A	10.37:g.74810982A>T			74480988	C9JL12|Q15082|Q15083|Q5VSQ5	Silent	SNP	HMMPfam_2OG-FeII_Oxy;HMMPfam_TPR_2;HMMPfam_P4Ha_N;superfamily_TPR-like	p.G243	ENST00000307116.2	37	c.729		10																																																																																			-	NULL		0.318	P4HA1-001	KNOWN	basic	protein_coding	P4HA1	protein_coding	OTTHUMT00000048601.1	A	NM_000917		74480988	-1	no_errors	NM_000917	genbank	human	reviewed	54_36p	silent	SNP	1	T
VAX1	11023	genome.wustl.edu	37	10	118891748	118891748	+	IGR	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr10:118891748G>T	ENST00000369206.5	-	0	1723				VAX1_ENST00000277905.2_Missense_Mutation_p.S178Y	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1						axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S178Y(1)		endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		TCTGCCCCCGGAGTCCCCACG	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											50.0	62.0	58.0					10																	118891748		2203	4300	6503	118881738	SO:0001628	intergenic_variant	11023			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117		10.37:g.118891748G>T			118881738	B1AVW5|Q6ZSX0	Missense_Mutation	SNP	-	p.S178Y	ENST00000369206.5	37	c.533	CCDS44483.1	10	.	.	.	.	.	.	.	.	.	.	G	11.27	1.587894	0.28268	.	.	ENSG00000148704	ENST00000277905	D	0.86769	-2.17	4.69	-2.03	0.07365	.	.	.	.	.	T	0.74935	0.3782	.	.	.	0.09310	N	1	B	0.27068	0.167	B	0.25987	0.065	T	0.61187	-0.7113	8	0.45353	T	0.12	.	1.0468	0.01571	0.2607:0.2847:0.3088:0.1459	.	178	Q5SQQ9-2	.	Y	178	ENSP00000277905:S178Y	ENSP00000277905:S178Y	S	-	2	0	VAX1	118881738	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.510000	0.22723	-0.491000	0.06697	-0.175000	0.13238	TCC	-	NULL		0.522	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	protein_coding	OTTHUMT00000050559.3	G	XM_301242		118881738	-1	no_errors	NM_199131	genbank	human	reviewed	54_36p	missense	SNP		T
MMP13	4322	genome.wustl.edu	37	11	102815027	102815027	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:102815027C>T	ENST00000260302.3	-	10	1412	c.1384G>A	c.(1384-1386)Gtc>Atc	p.V462I		NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	462	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V462I(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GCTGGCATGACGCGAACAATA	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											138.0	150.0	146.0					11																	102815027		2202	4299	6501	102320237	SO:0001583	missense	4322			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1384G>A	11.37:g.102815027C>T	ENSP00000260302:p.Val462Ile		102320237	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	"HMMPfam_Hemopexin;superfamily_Hemopexin-like domain;HMMPfam_Peptidase_M10;HMMPfam_PG_binding_1;superfamily_PGBD-like;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.V462I	ENST00000260302.3	37	c.1384	CCDS8324.1	11	.	.	.	.	.	.	.	.	.	.	C	3.486	-0.104955	0.06967	.	.	ENSG00000137745	ENST00000260302	T	0.02446	4.29	5.99	5.09	0.68999	Hemopexin/matrixin (2);	.	.	.	.	T	0.02267	0.0070	N	0.17379	0.485	0.80722	D	1	B	0.24426	0.103	B	0.25614	0.062	T	0.57136	-0.7863	9	0.18710	T	0.47	.	10.1943	0.43045	0.0:0.7944:0.0:0.2056	.	462	P45452	MMP13_HUMAN	I	462	ENSP00000260302:V462I	ENSP00000260302:V462I	V	-	1	0	MMP13	102320237	0.611000	0.26992	0.875000	0.34327	0.345000	0.29048	1.086000	0.30853	1.549000	0.49425	0.655000	0.94253	GTC	-	HMMPfam_Hemopexin		0.363	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	protein_coding	OTTHUMT00000386648.1	C	NM_002427		102320237	-1	no_errors	NM_002427	genbank	human	reviewed	54_36p	missense	SNP	0.92	T
PPFIBP2	8495	genome.wustl.edu	37	11	7661073	7661073	+	Silent	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:7661073C>T	ENST00000299492.4	+	15	1735	c.1347C>T	c.(1345-1347)gaC>gaT	p.D449D	PPFIBP2_ENST00000528883.1_Silent_p.D337D|PPFIBP2_ENST00000530181.1_Silent_p.D306D|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Silent_p.D291D	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	449					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.D449D(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GCCAGCCTGACGCCACGGGGA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	11											77.0	78.0	78.0					11																	7661073		2201	4296	6497	7617649	SO:0001819	synonymous_variant	8495			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1347C>T	11.37:g.7661073C>T			7617649	B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	-	p.D449	ENST00000299492.4	37	c.1347	CCDS31419.1	11	.	.	.	.	.	.	.	.	.	.	C	0.043	-1.276828	0.01410	.	.	ENSG00000166387	ENST00000534409	.	.	.	5.37	-4.73	0.03259	.	.	.	.	.	T	0.16385	0.0394	.	.	.	0.20975	N	0.999815	.	.	.	.	.	.	T	0.28073	-1.0055	4	.	.	.	-12.5771	1.0042	0.01483	0.2446:0.2108:0.1204:0.4242	.	.	.	.	C	129	.	.	R	+	1	0	PPFIBP2	7617649	0.007000	0.16637	0.009000	0.14445	0.052000	0.14988	-0.157000	0.10085	-0.461000	0.06993	-0.979000	0.02580	CGC	-	NULL		0.572	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	protein_coding	OTTHUMT00000385345.2	C	NM_003621		7617649	1	no_errors	NM_003621	genbank	human	validated	54_36p	silent	SNP	0.08	T
SOX6	55553	genome.wustl.edu	37	11	16010675	16010675	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:16010675G>A	ENST00000352083.6	-	14	1911	c.1834C>T	c.(1834-1836)Cgc>Tgc	p.R612C	SOX6_ENST00000528429.1_Missense_Mutation_p.R612C|SOX6_ENST00000316399.6_Missense_Mutation_p.R592C|SOX6_ENST00000396356.3_Missense_Mutation_p.R592C|SOX6_ENST00000528252.1_Missense_Mutation_p.R585C|SOX6_ENST00000527619.1_Missense_Mutation_p.R588C			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	612					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R592C(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GCACGGCCGCGGGCGTCCCTG	0.522											OREG0020800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											141.0	136.0	138.0					11																	16010675		2200	4294	6494	15967251	SO:0001583	missense	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1834C>T	11.37:g.16010675G>A	ENSP00000339876:p.Arg612Cys	707	15967251	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	-	p.R592C	ENST00000352083.6	37	c.1774		11	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034538	0.75617	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98264	-4.82;-4.8;-4.82;-4.83;-4.83;-4.8	5.72	5.72	0.89469	High mobility group, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98454	0.9485	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.995	D	0.99904	1.1171	10	0.87932	D	0	.	19.879	0.96888	0.0:0.0:1.0:0.0	.	592;612;588	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	C	592;612;592;585;588;612	ENSP00000324948:R592C;ENSP00000339876:R612C;ENSP00000379644:R592C;ENSP00000432134:R585C;ENSP00000434455:R588C;ENSP00000433233:R612C	ENSP00000324948:R592C	R	-	1	0	SOX6	15967251	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.531000	0.60602	2.695000	0.91970	0.655000	0.94253	CGC	-	NULL		0.522	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	SOX6	protein_coding	OTTHUMT00000386811.1	G	NM_033326		15967251	-1	no_errors	NM_033326	genbank	human	reviewed	54_36p	missense	SNP	1	A
NUP160	23279	genome.wustl.edu	37	11	47869846	47869846	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:47869846G>A	ENST00000378460.2	-	1	173	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	NUP160_ENST00000526870.1_Missense_Mutation_p.R43W|NUP160_ENST00000532747.1_Missense_Mutation_p.R9W|NUP160_ENST00000530326.1_De_novo_Start_OutOfFrame	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	43					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.R43W(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						ACGAAGCTCCGTTCCAGGGCT	0.682																																																1	Substitution - Missense(1)	ovary(1)	11											39.0	44.0	42.0					11																	47869846		2201	4298	6499	47826422	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.127C>T	11.37:g.47869846G>A	ENSP00000367721:p.Arg43Trp		47826422	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	superfamily_TPR-like	p.R43W	ENST00000378460.2	37	c.127	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075970	0.55646	.	.	ENSG00000030066	ENST00000378460;ENST00000532747;ENST00000526870	T;T;T	0.59083	1.1;0.29;0.29	4.85	3.87	0.44632	.	0.083760	0.45606	D	0.000349	T	0.60104	0.2243	N	0.19112	0.55	0.32620	N	0.52341	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.914	T	0.66952	-0.5793	10	0.49607	T	0.09	.	12.201	0.54326	0.0:0.0:0.7254:0.2746	.	43;43	Q12769-2;Q12769	.;NU160_HUMAN	W	43;9;43	ENSP00000367721:R43W;ENSP00000432437:R9W;ENSP00000431495:R43W	ENSP00000367721:R43W	R	-	1	2	NUP160	47826422	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	3.257000	0.51500	2.404000	0.81709	0.491000	0.48974	CGG	-	NULL		0.682	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	protein_coding	OTTHUMT00000390239.2	G	NM_015231		47826422	-1	no_errors	NM_015231	genbank	human	validated	54_36p	missense	SNP	0.57	A
OR5AK2	390181	genome.wustl.edu	37	11	56756974	56756974	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:56756974A>G	ENST00000326855.2	+	1	628	c.586A>G	c.(586-588)Atc>Gtc	p.I196V		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I196V(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TGACATCAACATCATGCTACT	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											322.0	285.0	298.0					11																	56756974		2201	4296	6497	56513550	SO:0001583	missense	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.586A>G	11.37:g.56756974A>G	ENSP00000322784:p.Ile196Val		56513550	B2RNZ9	Missense_Mutation	SNP	-	p.I196V	ENST00000326855.2	37	c.586	CCDS31538.1	11	.	.	.	.	.	.	.	.	.	.	A	2.243	-0.373308	0.05034	.	.	ENSG00000181273	ENST00000326855	T	0.00058	8.79	3.85	-7.01	0.01594	GPCR, rhodopsin-like superfamily (1);	0.581630	0.14288	N	0.329118	T	0.00039	0.0001	N	0.04090	-0.28	0.09310	N	1	B	0.06786	0.001	B	0.17722	0.019	T	0.40757	-0.9546	10	0.66056	D	0.02	-18.6514	2.4558	0.04529	0.1774:0.1289:0.4246:0.2691	.	196	Q8NH90	O5AK2_HUMAN	V	196	ENSP00000322784:I196V	ENSP00000322784:I196V	I	+	1	0	OR5AK2	56513550	0.000000	0.05858	0.028000	0.17463	0.012000	0.07955	-1.024000	0.03603	-1.481000	0.01863	-1.341000	0.01249	ATC	-	NULL		0.413	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	protein_coding	OTTHUMT00000392446.1	A	NM_001005323		56513550	1	no_errors	NM_001005323	genbank	human	provisional	54_36p	missense	SNP		G
NXPE2	120406	genome.wustl.edu	37	11	114569224	114569224	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr11:114569224G>A	ENST00000389586.4	+	3	780	c.590G>A	c.(589-591)aGt>aAt	p.S197N	NXPE2_ENST00000375475.5_Missense_Mutation_p.S197N	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	197						integral component of membrane (GO:0016021)		p.S197N(1)									ATCCACCCCAGTGAAGGGGTA	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											83.0	91.0	89.0					11																	114569224		692	1591	2283	114074434	SO:0001583	missense	120406			AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.590G>A	11.37:g.114569224G>A	ENSP00000374237:p.Ser197Asn		114074434	Q2NKI8	Missense_Mutation	SNP	superfamily_E set domains	p.S197N	ENST00000389586.4	37	c.590	CCDS44738.1	11	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004220	0.74932	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.29397	2.22;1.57	4.66	3.73	0.42828	.	0.000000	0.64402	D	0.000001	T	0.65417	0.2689	H	0.95437	3.67	0.39962	D	0.974676	D	0.89917	1.0	D	0.87578	0.998	T	0.75795	-0.3192	10	0.62326	D	0.03	.	12.4603	0.55729	0.0:0.1704:0.8296:0.0	.	197	Q96DL1	FA55B_HUMAN	N	197	ENSP00000374237:S197N;ENSP00000364624:S197N	ENSP00000364624:S197N	S	+	2	0	FAM55B	114074434	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.143000	0.71756	0.928000	0.37168	0.591000	0.81541	AGT	-	NULL		0.527	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM55B	protein_coding	OTTHUMT00000399181.1	G	NM_182495		114074434	1	no_errors	ENST00000375475	ensembl	human	known	54_36p	missense	SNP	1	A
FANCD2P2	101929530	genome.wustl.edu	37	3	11925053	11925053	+	IGR	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:11925053G>T								TAMM41 (36660 upstream) : RN7SL147P (69210 downstream)																							CTTCCTGAAGGAATGGGTTGG	0.448																																																0			3																																								11900053	SO:0001628	intergenic_variant	100129929																															3.37:g.11925053G>T			11900053		Nonsense_Mutation	SNP	-	p.E239*		37	c.715		3																																																																																			-	NULL	0	0.448					LOC100129929			G			11900053	1	no_errors	XM_001716291	genbank	human	model	54_36p	nonsense	SNP	1	T
CRACR2A	84766	genome.wustl.edu	37	12	3768784	3768784	+	Silent	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr12:3768784G>T	ENST00000252322.1	-	8	1176	c.708C>A	c.(706-708)ctC>ctA	p.L236L	EFCAB4B_ENST00000444507.1_Silent_p.L236L|EFCAB4B_ENST00000440314.2_Silent_p.L236L	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		236					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L236L(1)		breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TCTCCTCATAGAGATGCTGGA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	12											183.0	155.0	164.0					12																	3768784		2203	4300	6503	3639045	SO:0001819	synonymous_variant	84766																														ENST00000252322.1:c.708C>A	12.37:g.3768784G>T			3639045	B4E1X0|B9EK63	Silent	SNP	-	p.L236	ENST00000252322.1	37	c.708	CCDS8522.1	12																																																																																			-	NULL		0.483	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	protein_coding	OTTHUMT00000398673.1	G			3639045	-1	no_errors	NM_032680	genbank	human	validated	54_36p	silent	SNP	0.96	T
REP15	387849	genome.wustl.edu	37	12	27849550	27849550	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr12:27849550G>A	ENST00000310791.2	+	1	123	c.55G>A	c.(55-57)Gtc>Atc	p.V19I	RP11-1060J15.4_ENST00000536317.1_RNA|RP11-1060J15.4_ENST00000536922.1_RNA|RP11-1060J15.4_ENST00000542660.1_RNA	NM_001029874.1	NP_001025045.1	Q6BDI9	REP15_HUMAN	RAB15 effector protein	19					receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	endosome membrane (GO:0010008)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)		p.V19I(1)		breast(1)|cervix(1)|large_intestine(2)|lung(4)|ovary(1)	9	Lung SC(9;0.0873)					AGAGGTGCCCGTCGTCTGTGA	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											85.0	72.0	76.0					12																	27849550		2203	4300	6503	27740817	SO:0001583	missense	387849			BC140921	CCDS31762.1	12p11.22	2010-09-02			ENSG00000174236	ENSG00000174236			33748	protein-coding gene	gene with protein product		610848				16195351	Standard	NM_001029874		Approved	RAB15EP	uc001rig.1	Q6BDI9		ENST00000310791.2:c.55G>A	12.37:g.27849550G>A	ENSP00000310335:p.Val19Ile		27740817	B2RU16	Missense_Mutation	SNP	-	p.V19I	ENST00000310791.2	37	c.55	CCDS31762.1	12	.	.	.	.	.	.	.	.	.	.	G	6.760	0.509149	0.12883	.	.	ENSG00000174236	ENST00000310791	T	0.29655	1.56	4.99	-9.98	0.00438	.	1.784800	0.03098	N	0.160664	T	0.11922	0.0290	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.10776	-1.0615	10	0.20046	T	0.44	-6.0538	6.0293	0.19671	0.2411:0.2396:0.4401:0.0793	.	19	Q6BDI9	REP15_HUMAN	I	19	ENSP00000310335:V19I	ENSP00000310335:V19I	V	+	1	0	REP15	27740817	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.449000	0.06812	-2.469000	0.00531	-1.193000	0.01689	GTC	-	NULL		0.478	REP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REP15	protein_coding	OTTHUMT00000402894.1	G	NM_001029874		27740817	1	no_errors	NM_001029874	genbank	human	provisional	54_36p	missense	SNP		A
FGD4	121512	genome.wustl.edu	37	12	32735390	32735390	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr12:32735390C>T	ENST00000427716.2	+	4	1013	c.589C>T	c.(589-591)Cat>Tat	p.H197Y	FGD4_ENST00000472289.1_Missense_Mutation_p.H197Y|FGD4_ENST00000534526.2_Missense_Mutation_p.H334Y|FGD4_ENST00000531134.1_Missense_Mutation_p.H282Y|FGD4_ENST00000546442.1_Missense_Mutation_p.H104Y|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000525053.1_Missense_Mutation_p.H309Y	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	197					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.H197Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GGACCAGCACCATGAGATGAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											42.0	43.0	43.0					12																	32735390		2203	4300	6503	32626657	SO:0001583	missense	121512			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.589C>T	12.37:g.32735390C>T	ENSP00000394487:p.His197Tyr		32626657	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	-	p.H197Y	ENST00000427716.2	37	c.589	CCDS8727.1	12	.	.	.	.	.	.	.	.	.	.	C	9.131	1.011442	0.19277	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000472289;ENST00000427716;ENST00000546442;ENST00000525053;ENST00000395742	T;T;T;T;T	0.70282	-0.47;-0.46;-0.46;1.61;-0.46	5.04	1.91	0.25777	Dbl homology (DH) domain (1);	2.378200	0.01570	N	0.020534	T	0.60431	0.2268	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.32620	0.106;0.106;0.105;0.378	B;B;B;B	0.33339	0.162;0.105;0.026;0.128	T	0.55673	-0.8104	10	0.56958	D	0.05	3.205	8.0618	0.30638	0.1609:0.411:0.4281:0.0	.	309;282;197;197	E9PJX4;B7Z493;Q96M96;E9PQT1	.;.;FGD4_HUMAN;.	Y	334;282;197;197;104;309;178	ENSP00000449273:H334Y;ENSP00000431323:H282Y;ENSP00000394487:H197Y;ENSP00000446695:H104Y;ENSP00000433666:H309Y	ENSP00000379089:H197Y	H	+	1	0	FGD4	32626657	0.005000	0.15991	0.311000	0.25182	0.771000	0.43674	1.245000	0.32790	1.088000	0.41272	0.563000	0.77884	CAT	-	NULL		0.478	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	protein_coding	OTTHUMT00000268017.1	C	NM_139241		32626657	1	no_errors	NM_139241	genbank	human	reviewed	54_36p	missense	SNP		T
TROAP	10024	genome.wustl.edu	37	12	49724346	49724346	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr12:49724346A>G	ENST00000257909.3	+	13	1794	c.1718A>G	c.(1717-1719)gAa>gGa	p.E573G	TROAP_ENST00000551245.1_Missense_Mutation_p.E573G|TROAP_ENST00000547923.1_Missense_Mutation_p.E281G	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	573	4 X 33 AA approximate tandem repeats.|Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.E573G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TCTCGCCAGGAACAGCTTGAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											72.0	69.0	70.0					12																	49724346		2203	4300	6503	48010613	SO:0001583	missense	10024			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1718A>G	12.37:g.49724346A>G	ENSP00000257909:p.Glu573Gly		48010613	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	-	p.E573G	ENST00000257909.3	37	c.1718	CCDS8784.1	12	.	.	.	.	.	.	.	.	.	.	A	9.293	1.051081	0.19827	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	2.69	-3.03	0.05429	.	.	.	.	.	T	0.16514	0.0397	N	0.22421	0.69	0.09310	N	1	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.08055	0.003;0.002;0.003	T	0.24512	-1.0158	8	0.23891	T	0.37	.	0.3863	0.00403	0.2916:0.2082:0.2953:0.2049	.	573;281;573	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	G	573;573;281	.	ENSP00000257909:E573G	E	+	2	0	TROAP	48010613	0.000000	0.05858	0.000000	0.03702	0.174000	0.22865	-2.066000	0.01385	-0.520000	0.06435	0.402000	0.26972	GAA	-	NULL		0.592	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	protein_coding	OTTHUMT00000404300.1	A	NM_005480		48010613	1	no_errors	NM_005480	genbank	human	validated	54_36p	missense	SNP	0.02	G
CUX2	23316	genome.wustl.edu	37	12	111785395	111785395	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr12:111785395G>C	ENST00000261726.6	+	22	3881	c.3727G>C	c.(3727-3729)Ggt>Cgt	p.G1243R		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1243					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.G1243R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TCCAAGCGGGGGTCCTGGAAT	0.662																																																1	Substitution - Missense(1)	ovary(1)	12											58.0	67.0	64.0					12																	111785395		1902	4111	6013	110269778	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3727G>C	12.37:g.111785395G>C	ENSP00000261726:p.Gly1243Arg		110269778	A7E2Y4	Missense_Mutation	SNP	HMMPfam_Homeobox;HMMPfam_CUT;superfamily_Prefoldin;superfamily_Homeodomain-like	p.G1243R	ENST00000261726.6	37	c.3727	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236864	0.39498	.	.	ENSG00000111249	ENST00000261726	T	0.44881	0.91	5.78	4.81	0.61882	.	0.173828	0.39544	N	0.001340	T	0.42291	0.1196	L	0.29908	0.895	0.33612	D	0.603661	D	0.60575	0.988	P	0.55222	0.771	T	0.44636	-0.9315	10	0.23891	T	0.37	-6.8542	12.8375	0.57782	0.0:0.0:0.767:0.233	.	1243	O14529	CUX2_HUMAN	R	1243	ENSP00000261726:G1243R	ENSP00000261726:G1243R	G	+	1	0	CUX2	110269778	0.604000	0.26932	0.990000	0.47175	0.924000	0.55760	2.050000	0.41297	2.729000	0.93468	0.650000	0.86243	GGT	-	NULL		0.662	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	protein_coding	OTTHUMT00000404765.1	G	NM_015267		110269778	1	no_errors	NM_015267	genbank	human	validated	54_36p	missense	SNP	0.93	C
OR11H12	440153	genome.wustl.edu	37	14	19377878	19377878	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr14:19377878G>T	ENST00000550708.1	+	1	357	c.285G>T	c.(283-285)aaG>aaT	p.K95N		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K95N(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CAGTTCCCAAGATGTTGGTCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											5.0	5.0	5.0					14																	19377878		1166	2726	3892	18447878	SO:0001583	missense	440153				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.285G>T	14.37:g.19377878G>T	ENSP00000449002:p.Lys95Asn		18447878		Missense_Mutation	SNP	-	p.K95N	ENST00000550708.1	37	c.285	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	g	0	-2.632051	0.00115	.	.	ENSG00000257115	ENST00000550708	T	0.03330	3.97	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.767664	0.10851	N	0.627168	T	0.02649	0.0080	L	0.37850	1.14	0.24192	N	0.99555	B	0.12630	0.006	B	0.10450	0.005	T	0.44832	-0.9302	9	0.09084	T	0.74	.	3.7193	0.08450	0.0:1.0E-4:0.5702:0.4297	.	95	B2RN74	O11HC_HUMAN	N	95	ENSP00000449002:K95N	ENSP00000449002:K95N	K	+	3	2	CR383656.1	18447878	0.000000	0.05858	0.990000	0.47175	0.276000	0.26787	-2.263000	0.01174	0.619000	0.30197	0.064000	0.15345	AAG	-	NULL		0.408	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	protein_coding	OTTHUMT00000408402.1	G	NM_001013354		18447878	1	no_errors	NM_001013354	genbank	human	provisional	54_36p	missense	SNP	0.05	T
PNP	4860	genome.wustl.edu	37	14	20943361	20943361	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr14:20943361A>T	ENST00000361505.5	+	5	748	c.602A>T	c.(601-603)gAg>gTg	p.E201V	RP11-203M5.8_ENST00000554678.1_lincRNA	NM_000270.3	NP_000261.2	P01298	PAHO_HUMAN	purine nucleoside phosphorylase	0					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.E201V(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(2)	10						CCCAGCTTTGAGACTGTGGCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	14											89.0	84.0	86.0					14																	20943361		2203	4300	6503	20013201	SO:0001583	missense	4860				CCDS9552.1	14q11.2	2014-09-17	2009-12-02	2009-12-02	ENSG00000198805	ENSG00000198805	2.4.2.1		7892	protein-coding gene	gene with protein product		164050	"""nucleoside phosphorylase"""	NP		6087295	Standard	NM_000270		Approved	PUNP	uc001vxo.4	P00491	OTTHUMG00000029546	ENST00000361505.5:c.602A>T	14.37:g.20943361A>T	ENSP00000354532:p.Glu201Val		20013201		Missense_Mutation	SNP	HMMPfam_Mtap_PNP;superfamily_Purine and uridine phosphorylases	p.E201V	ENST00000361505.5	37	c.602	CCDS9552.1	14	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967990	0.74131	.	.	ENSG00000198805	ENST00000361505;ENST00000554469	D	0.89485	-2.52	5.91	5.91	0.95273	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	D	0.96297	0.8792	H	0.96430	3.82	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.97483	1.0048	10	0.87932	D	0	-15.0541	15.3309	0.74208	1.0:0.0:0.0:0.0	.	201	P00491	PNPH_HUMAN	V	201;133	ENSP00000354532:E201V	ENSP00000354532:E201V	E	+	2	0	PNP	20013201	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	8.690000	0.91272	2.254000	0.74563	0.533000	0.62120	GAG	-	HMMPfam_Mtap_PNP		0.552	PNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NP	protein_coding	OTTHUMT00000073646.2	A	NM_000270.2		20013201	1	no_errors	NM_000270	genbank	human	reviewed	54_36p	missense	SNP	1	T
SLC8A3	6547	genome.wustl.edu	37	14	70518707	70518707	+	Splice_Site	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr14:70518707C>A	ENST00000381269.2	-	5	2784	c.2031G>T	c.(2029-2031)aaG>aaT	p.K677N	SLC8A3_ENST00000528359.1_Splice_Site_p.K675N|SLC8A3_ENST00000394330.2_Splice_Site_p.K34N|SLC8A3_ENST00000533541.1_Splice_Site_p.K34N|SLC8A3_ENST00000216568.7_Splice_Site_p.K48N|SLC8A3_ENST00000357887.3_Splice_Site_p.K675N|SLC8A3_ENST00000534137.1_Splice_Site_p.K674N|SLC8A3_ENST00000356921.2_Splice_Site_p.K671N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	677					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.K677N(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTTGCCTGACCTTGAACTCAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	14											129.0	112.0	118.0					14																	70518707		2203	4300	6503	69588460	SO:0001630	splice_region_variant	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2031+1G>T	14.37:g.70518707C>A			69588460	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex;HMMPfam_Calx-beta	p.K677N	ENST00000381269.2	37	c.2031	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453618	0.84209	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000216568;ENST00000394330;ENST00000534137;ENST00000528359;ENST00000533541	T;T;T;T;T;T;T;T	0.72051	1.62;1.62;1.62;-0.62;-0.61;1.62;1.62;0.74	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.84840	0.5561	M	0.79343	2.45	0.80722	D	1	D;D;D;D;D;D	0.76494	0.997;0.999;0.999;0.993;0.997;0.997	D;D;D;D;D;D	0.80764	0.979;0.994;0.991;0.971;0.98;0.951	D	0.84549	0.0643	9	.	.	.	.	19.5956	0.95536	0.0:1.0:0.0:0.0	.	34;671;677;675;674;48	F2Z391;P57103-2;P57103;Q96QG2;Q96QG1;Q5K3P6	.;.;NAC3_HUMAN;.;.;.	N	671;677;675;48;34;674;675;34	ENSP00000349392:K671N;ENSP00000370669:K677N;ENSP00000350560:K675N;ENSP00000216568:K48N;ENSP00000377863:K34N;ENSP00000436688:K674N;ENSP00000433531:K675N;ENSP00000437103:K34N	.	K	-	3	2	SLC8A3	69588460	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.773000	0.85462	2.715000	0.92844	0.650000	0.86243	AAG	-	NULL		0.418	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	C		Missense_Mutation	69588460	-1	no_errors	NM_183002	genbank	human	reviewed	54_36p	missense	SNP	1	A
RP11-782C8.2	0	genome.wustl.edu	37	1	143209933	143209933	+	lincRNA	SNP	A	A	C	rs79564330		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:143209933A>C	ENST00000412204.2	-	0	1137				RP11-782C8.1_ENST00000438000.1_lincRNA																							GTACGGAAACATCTTGTGTTC	0.323																																																0			1																																								142051456			401131																															1.37:g.143209933A>C			142051456		RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.323	RP11-782C8.2-004	KNOWN	basic	lincRNA	LOC401131	lincRNA	OTTHUMT00000037567.2	A			142051456	-1	no_errors	XR_017704	genbank	human	model	54_36p	rna	SNP	0.85	C
STARD5	80765	genome.wustl.edu	37	15	81605705	81605705	+	Silent	SNP	G	G	T	rs200366069		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr15:81605705G>T	ENST00000302824.6	-	6	559	c.534C>A	c.(532-534)acC>acA	p.T178T		NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	178	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)	p.T178T(1)		large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						CGCTGAGGTCGGTATGGAAGA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	15											196.0	167.0	177.0					15																	81605705		2203	4300	6503	79392760	SO:0001819	synonymous_variant	80765			AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.534C>A	15.37:g.81605705G>T			79392760	P59094	Silent	SNP	-	p.T178	ENST00000302824.6	37	c.534	CCDS10318.1	15																																																																																			-	NULL		0.557	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD5	protein_coding	OTTHUMT00000303950.2	G			79392760	-1	no_errors	NM_181900	genbank	human	validated	54_36p	silent	SNP	0.93	T
CPEB1	64506	genome.wustl.edu	37	15	83240144	83240144	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr15:83240144G>T	ENST00000562019.1	-	3	645	c.329C>A	c.(328-330)cCc>cAc	p.P110H	CPEB1_ENST00000568128.1_Missense_Mutation_p.P110H|CPEB1_ENST00000563800.1_Missense_Mutation_p.P137H|CPEB1_ENST00000398592.2_5'UTR|CPEB1_ENST00000568757.1_Missense_Mutation_p.P35H|CPEB1_ENST00000423133.2_Missense_Mutation_p.P35H|CPEB1_ENST00000261723.6_Missense_Mutation_p.P113H|CPEB1_ENST00000564522.1_Missense_Mutation_p.P35H|CPEB1_ENST00000398591.2_Missense_Mutation_p.P35H|CPEB1_ENST00000450751.2_Missense_Mutation_p.P35H			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	110					cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.P35H(1)		breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			GGTGCTCCAGGGTCGGTCCCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											94.0	98.0	97.0					15																	83240144		1992	4172	6164	81037199	SO:0001583	missense	64506			AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.329C>A	15.37:g.83240144G>T	ENSP00000457836:p.Pro110His		81037199	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	-	p.P110H	ENST00000562019.1	37	c.329		15	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552289	0.86127	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	U	0.000000	T	0.67887	0.2941	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.70970	-0.4727	9	0.87932	D	0	-9.6672	19.8535	0.96748	0.0:0.0:1.0:0.0	.	113;110;110;110	B7Z237;Q9BZB8-3;Q9BZB8;E7ET70	.;.;CPEB1_HUMAN;.	H	110;110;35;35;113	.	ENSP00000261723:P113H	P	-	2	0	CPEB1	81037199	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.479000	0.81095	2.694000	0.91930	0.557000	0.71058	CCC	-	NULL		0.597	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	CPEB1	protein_coding	OTTHUMT00000421102.1	G	NM_030594		81037199	-1	no_errors	NM_030594	genbank	human	reviewed	54_36p	missense	SNP	1	T
AP3B2	8120	genome.wustl.edu	37	15	83331513	83331513	+	Silent	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr15:83331513G>T	ENST00000261722.3	-	22	2916	c.2709C>A	c.(2707-2709)atC>atA	p.I903I	AP3B2_ENST00000535348.1_Silent_p.I871I|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Silent_p.I922I	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	903					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.I902I(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCAGGCCCTTGATGGGGGTAT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	15											38.0	42.0	41.0					15																	83331513		1990	4155	6145	81128568	SO:0001819	synonymous_variant	8120			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2709C>A	15.37:g.83331513G>T			81128568	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Nonsense_Mutation	SNP	-	p.S903*	ENST00000261722.3	37	c.2708	CCDS45331.1	15																																																																																			-	NULL		0.582	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B2	protein_coding	OTTHUMT00000397463.1	G			81128568	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_004644	genbank	human	validated	54_36p	nonsense	SNP	1	T
KRT16P2	400578	genome.wustl.edu	37	17	16735070	16735070	+	RNA	SNP	T	T	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr17:16735070T>G	ENST00000579062.1	-	0	382									keratin 16 pseudogene 2									p.Q157P(1)									CAAAATGGGCTGCGCATTCTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	17																																								16675795			400578					17p11.2	2010-02-25			ENSG00000227300	ENSG00000227300			37807	pseudogene	pseudogene							Standard	NR_029392		Approved		uc010vwr.1		OTTHUMG00000059177		17.37:g.16735070T>G			16675795		RNA	SNP	-	NULL	ENST00000579062.1	37	NULL		17																																																																																			-	-		0.557	KRT16P2-002	KNOWN	basic	processed_transcript	LOC400578	pseudogene	OTTHUMT00000444288.2	T	NR_029392		16675795	-1	no_errors	XR_017543	genbank	human	model	54_36p	rna	SNP	0.012	G
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000413465.2_Missense_Mutation_p.C176Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000420246.2_Missense_Mutation_p.C176Y|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000445888.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	17											49.0	49.0	49.0					17																	7578403		2203	4300	6503	7519128	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr		7519128	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.C176Y	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	-	HMMPfam_P53		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519128	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	T
AOC2	314	genome.wustl.edu	37	17	40997575	40997575	+	Missense_Mutation	SNP	C	C	T	rs142697203		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr17:40997575C>T	ENST00000253799.3	+	1	959	c.932C>T	c.(931-933)tCg>tTg	p.S311L	AOC2_ENST00000452774.2_Missense_Mutation_p.S311L	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	311					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.S311L(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CTTCAGTTCTCGCCCCAGGGT	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		19702	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	17						C	LEU/SER,LEU/SER	0,4406		0,0,2203	90.0	92.0	91.0		932,932	1.4	0.0	17	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	AOC2	NM_001158.3,NM_009590.2	145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	311/730,311/757	40997575	1,13005	2203	4300	6503	38251101	SO:0001583	missense	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.932C>T	17.37:g.40997575C>T	ENSP00000253799:p.Ser311Leu		38251101	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	HMMPfam_Cu_amine_oxid;superfamily_Amine oxidase catalytic domain;HMMPfam_Cu_amine_oxidN2;HMMPfam_Cu_amine_oxidN3;superfamily_Amine oxidase N-terminal region	p.S311L	ENST00000253799.3	37	c.932	CCDS11443.1	17	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597324	0.28445	0.0	1.16E-4	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03951	3.75;3.75	5.69	1.36	0.22044	Copper amine oxidase, C-terminal (3);	0.790355	0.11554	N	0.552456	T	0.05090	0.0136	L	0.50333	1.59	0.23765	N	0.996907	B;B	0.16166	0.016;0.012	B;B	0.15484	0.013;0.008	T	0.41360	-0.9513	10	0.72032	D	0.01	-16.3637	2.5934	0.04848	0.3835:0.3737:0.1047:0.138	.	311;311	O75106;O75106-2	AOC2_HUMAN;.	L	311	ENSP00000253799:S311L;ENSP00000406134:S311L	ENSP00000253799:S311L	S	+	2	0	AOC2	38251101	0.582000	0.26749	0.003000	0.11579	0.841000	0.47740	4.520000	0.60524	0.049000	0.15920	0.511000	0.50034	TCG	-	HMMPfam_Cu_amine_oxid		0.557	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC2	protein_coding	OTTHUMT00000452442.1	C	NM_009590, NM_001158		38251101	1	no_errors	NM_009590	genbank	human	reviewed	54_36p	missense	SNP	0.53	T
DSG4	147409	genome.wustl.edu	37	18	28993336	28993336	+	Missense_Mutation	SNP	A	A	T	rs151254406	byFrequency	TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr18:28993336A>T	ENST00000308128.4	+	16	3036	c.2901A>T	c.(2899-2901)agA>agT	p.R967S	DSG4_ENST00000359747.4_Missense_Mutation_p.R986S|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	967					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R967S(1)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ATGCTGAGAGAGTACTGGCTA	0.443																																																1	Substitution - Missense(1)	ovary(1)	18											179.0	164.0	169.0					18																	28993336		2203	4300	6503	27247334	SO:0001583	missense	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2901A>T	18.37:g.28993336A>T	ENSP00000311859:p.Arg967Ser		27247334	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	HMMPfam_Cadherin,superfamily_Cadherin-like	p.R967S	ENST00000308128.4	37	c.2901	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555427	0.65425	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	D;D	0.82619	-1.63;-1.63	5.24	-0.997	0.10215	.	0.000000	0.37809	N	0.001936	D	0.87501	0.6193	M	0.75777	2.31	0.34820	D	0.738578	D;D	0.69078	0.997;0.997	D;P	0.65010	0.931;0.905	D	0.88931	0.3373	10	0.87932	D	0	.	10.8061	0.46518	0.5849:0.0:0.4151:0.0	.	986;967	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	S	967;986	ENSP00000311859:R967S;ENSP00000352785:R986S	ENSP00000311859:R967S	R	+	3	2	DSG4	27247334	0.977000	0.34250	0.914000	0.36105	0.960000	0.62799	0.127000	0.15790	0.025000	0.15241	0.533000	0.62120	AGA	-	NULL		0.443	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	protein_coding	OTTHUMT00000254941.1	A	NM_177986		27247334	1	no_errors	NM_177986	genbank	human	validated	54_36p	missense	SNP	0.981	T
SMARCA4	6597	genome.wustl.edu	37	19	11129635	11129635	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:11129635C>A	ENST00000429416.3	+	18	2722	c.2441C>A	c.(2440-2442)aCg>aAg	p.T814K	SMARCA4_ENST00000541122.2_Missense_Mutation_p.T814K|SMARCA4_ENST00000358026.2_Missense_Mutation_p.T814K|SMARCA4_ENST00000413806.3_Missense_Mutation_p.T814K|SMARCA4_ENST00000589677.1_Missense_Mutation_p.T814K|SMARCA4_ENST00000444061.3_Missense_Mutation_p.T814K|SMARCA4_ENST00000450717.3_Missense_Mutation_p.T814K|SMARCA4_ENST00000344626.4_Missense_Mutation_p.T814K|SMARCA4_ENST00000590574.1_Missense_Mutation_p.T814K|CTC-215O4.4_ENST00000587831.1_RNA	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	814	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)|p.T814K(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TCCATCAGAACGCTGTCCAAC	0.547			"""F, N, Mis"""		NSCLC																																		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|lung(1)	19											183.0	156.0	166.0					19																	11129635		2203	4300	6503	10990635	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2441C>A	19.37:g.11129635C>A	ENSP00000395654:p.Thr814Lys		10990635	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	HMMPfam_SNF2_N;HMMPfam_Bromodomain;HMMPfam_Helicase_C;HMMPfam_HSA;HMMPfam_TCH;HMMPfam_QLQ;superfamily_Bromodomain;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T814K	ENST00000429416.3	37	c.2441	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671694	0.88348	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	4.95	4.95	0.65309	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98009	0.9344	H	0.97340	3.985	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0;0.999;0.999	D	0.99349	1.0914	10	0.87932	D	0	-35.1325	17.1079	0.86668	0.0:1.0:0.0:0.0	.	814;814;814;814;814;814;814	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	K	814;814;878;814;814;814;814;814	ENSP00000395654:T814K;ENSP00000350720:T814K;ENSP00000343896:T814K;ENSP00000445036:T814K;ENSP00000392837:T814K;ENSP00000397783:T814K;ENSP00000414727:T814K	ENSP00000343896:T814K	T	+	2	0	SMARCA4	10990635	1.000000	0.71417	0.341000	0.25589	0.054000	0.15201	7.627000	0.83176	2.571000	0.86741	0.591000	0.81541	ACG	-	HMMPfam_SNF2_N		0.547	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	protein_coding	OTTHUMT00000452638.2	C	NM_003072		10990635	1	no_errors	NM_003072	genbank	human	reviewed	54_36p	missense	SNP	1	A
MAN2B1	4125	genome.wustl.edu	37	19	12776302	12776302	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:12776302G>C	ENST00000456935.2	-	3	340	c.300C>G	c.(298-300)atC>atG	p.I100M	CTD-2192J16.24_ENST00000597961.1_Missense_Mutation_p.I97M|WDR83_ENST00000418543.3_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.I100M	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	100					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.I100M(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCGAGTCCAGGATGTACTGCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											119.0	118.0	118.0					19																	12776302		2203	4300	6503	12637302	SO:0001583	missense	4125				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.300C>G	19.37:g.12776302G>C	ENSP00000395473:p.Ile100Met		12637302	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_38;superfamily_Galactose mutarotase-like;superfamily_Glycoside hydrolase/deacetylase;HMMPfam_Glyco_hydro_38C;HMMPfam_Alpha-mann_mid;superfamily_Families 57/38 glycoside transferase middle domain	p.I100M	ENST00000456935.2	37	c.300	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857195	0.51376	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	T;T	0.76186	-1.0;-1.0	5.86	4.82	0.62117	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.50627	D	0.000110	D	0.90511	0.7027	H	0.96943	3.91	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93413	0.6770	10	0.87932	D	0	-62.3424	14.2791	0.66199	0.0:0.0:0.8502:0.1498	.	100;100	G5E928;O00754	.;MA2B1_HUMAN	M	100;39;100	ENSP00000395473:I100M;ENSP00000221363:I100M	ENSP00000221363:I100M	I	-	3	3	MAN2B1	12637302	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	3.577000	0.53885	1.481000	0.48307	-0.152000	0.13540	ATC	-	HMMPfam_Glyco_hydro_38		0.542	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	protein_coding	OTTHUMT00000344062.1	G			12637302	-1	no_errors	NM_000528	genbank	human	reviewed	54_36p	missense	SNP	1	C
CACNA1A	773	genome.wustl.edu	37	19	13325133	13325133	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:13325133C>T	ENST00000360228.5	-	40	5853	c.5854G>A	c.(5854-5856)Gtg>Atg	p.V1952M	CACNA1A_ENST00000573710.2_Missense_Mutation_p.V1953M	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1953					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.V1953M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	ATCTTCCCCACGGTGAGGTCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	38.0	37.0					19																	13325133		2157	4259	6416	13186133	SO:0001583	missense	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5854G>A	19.37:g.13325133C>T	ENSP00000353362:p.Val1952Met		13186133	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ,superfamily_Voltage-gated potassium channels	p.V1953M	ENST00000360228.5	37	c.5857	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332350	0.60853	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.85088	-1.94	4.72	4.72	0.59763	Voltage-dependent calcium channel, alpha-1 subunit, IQ domain (1);	0.000000	0.64402	D	0.000005	D	0.92420	0.7594	M	0.82056	2.57	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	D	0.93643	0.6966	10	0.87932	D	0	.	16.4549	0.84009	0.0:1.0:0.0:0.0	.	1953;1958;1952;1953	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	M	1952;1958;1953;1953	ENSP00000353362:V1952M	ENSP00000317661:V1953M	V	-	1	0	CACNA1A	13186133	1.000000	0.71417	0.974000	0.42286	0.956000	0.61745	7.394000	0.79862	2.184000	0.69523	0.491000	0.48974	GTG	-	HMMPfam_Ca_chan_IQ		0.632	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	C	NM_000068		13186133	-1	no_errors	ENST00000325084	ensembl	human	known	54_36p	missense	SNP	0.997	T
EMR3	84658	genome.wustl.edu	37	19	14758092	14758092	+	Silent	SNP	A	A	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:14758092A>G	ENST00000253673.5	-	8	883	c.783T>C	c.(781-783)gaT>gaC	p.D261D	EMR3_ENST00000443157.2_Silent_p.D135D|EMR3_ENST00000344373.4_Silent_p.D209D|EMR3_ENST00000599900.1_Silent_p.D46D	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	261					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.D261D(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						GATACACTTGATCTTTCTTAT	0.428																																																1	Substitution - coding silent(1)	ovary(1)	19											167.0	138.0	148.0					19																	14758092		2203	4300	6503	14619092	SO:0001819	synonymous_variant	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.783T>C	19.37:g.14758092A>G			14619092		Silent	SNP	HMMPfam_GPS;HMMPfam_7tm_2;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Family A G protein-coupled receptor-like	p.D261	ENST00000253673.5	37	c.783	CCDS12315.1	19																																																																																			-	NULL		0.428	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	protein_coding	OTTHUMT00000466488.1	A	NM_032571		14619092	-1	no_errors	NM_032571	genbank	human	reviewed	54_36p	silent	SNP		G
EPS15L1	58513	genome.wustl.edu	37	19	16495995	16495995	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:16495995C>G	ENST00000248070.6	-	21	2331	c.2192G>C	c.(2191-2193)gGa>gCa	p.G731A	EPS15L1_ENST00000594975.1_Missense_Mutation_p.G733A|EPS15L1_ENST00000455140.2_Missense_Mutation_p.G731A|EPS15L1_ENST00000535753.2_Missense_Mutation_p.G731A	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	731	15 X 3 AA repeats of D-P-F.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G731A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						GGACCCACTTCCGAAGGGATC	0.532																																																1	Substitution - Missense(1)	ovary(1)	19											110.0	115.0	114.0					19																	16495995		2203	4300	6503	16356995	SO:0001583	missense	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.2192G>C	19.37:g.16495995C>G	ENSP00000248070:p.Gly731Ala		16356995	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	HMMPfam_efhand;superfamily_Prefoldin;superfamily_Ferritin-like;superfamily_EF-hand	p.G731A	ENST00000248070.6	37	c.2192	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018971	0.54576	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.31247	1.92;1.85;1.5	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	L	0.41027	1.25	0.80722	D	1	D;P;B;B	0.58268	0.982;0.489;0.035;0.152	P;B;B;B	0.46543	0.52;0.118;0.038;0.065	T	0.01762	-1.1279	10	0.21540	T	0.41	.	18.5423	0.91033	0.0:1.0:0.0:0.0	.	733;731;731;731	A8K5P4;A2RRF3;Q9UBC2;G3V0H2	.;.;EP15R_HUMAN;.	A	731	ENSP00000393313:G731A;ENSP00000248070:G731A;ENSP00000440103:G731A	ENSP00000248070:G731A	G	-	2	0	EPS15L1	16356995	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	6.500000	0.73687	2.642000	0.89623	0.460000	0.39030	GGA	-	NULL		0.532	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	protein_coding	OTTHUMT00000461040.1	C	NM_021235		16356995	-1	no_errors	NM_021235	genbank	human	provisional	54_36p	missense	SNP	1	G
ZNF285	26974	genome.wustl.edu	37	19	44896566	44896566	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:44896566T>C	ENST00000330997.4	-	3	144	c.80A>G	c.(79-81)aAa>aGa	p.K27R	CTC-512J12.4_ENST00000588655.1_RNA|ZNF285_ENST00000544719.2_Missense_Mutation_p.K27R|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.K34R	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K27R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TATCTGGGCTTTATCCAATAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	19											153.0	134.0	141.0					19																	44896566		2203	4300	6503	49588406	SO:0001583	missense	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.80A>G	19.37:g.44896566T>C	ENSP00000333595:p.Lys27Arg		49588406	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.K27R	ENST00000330997.4	37	c.80	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	T	14.35	2.510326	0.44660	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.01745	4.66	3.07	-5.9	0.02275	Krueppel-associated box (4);	.	.	.	.	T	0.01523	0.0049	N	0.20986	0.625	0.09310	N	1	P;B	0.37914	0.611;0.348	B;B	0.40444	0.329;0.329	T	0.41305	-0.9516	9	0.37606	T	0.19	.	8.0968	0.30833	0.1273:0.0:0.5555:0.3171	.	51;27	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	R	50;27	ENSP00000333595:K27R	ENSP00000333595:K27R	K	-	2	0	ZNF285	49588406	0.000000	0.05858	0.000000	0.03702	0.885000	0.51271	-1.842000	0.01681	-0.979000	0.03529	0.369000	0.22263	AAA	-	HMMPfam_KRAB		0.458	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285A	protein_coding	OTTHUMT00000443600.1	T	NM_152354		49588406	-1	no_errors	NM_152354	genbank	human	validated	54_36p	missense	SNP		C
MYO1F	4542	genome.wustl.edu	37	19	8620639	8620639	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:8620639C>G	ENST00000338257.8	-	2	312	c.45G>C	c.(43-45)aaG>aaC	p.K15N		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	15					defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K15N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CGCCGCTCTGCTTCACGTTGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											79.0	86.0	84.0					19																	8620639		2086	4208	6294	8526639	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.45G>C	19.37:g.8620639C>G	ENSP00000344871:p.Lys15Asn		8526639	Q8WWN7	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_Myosin_head;HMMPfam_Myosin_TH1;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K15N	ENST00000338257.8	37	c.45	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	C	18.94	3.728826	0.69074	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.95342	-3.68	3.98	0.387	0.16259	Myosin head, motor domain (1);	0.000000	0.85682	D	0.000000	D	0.95443	0.8520	M	0.82630	2.6	0.58432	D	0.999997	P;D;D	0.56287	0.849;0.975;0.975	P;P;P	0.57468	0.544;0.821;0.821	D	0.93487	0.6832	10	0.66056	D	0.02	.	7.3467	0.26668	0.0:0.5715:0.0:0.4285	.	15;15;15	B4DVP3;B0I1T1;O00160	.;.;MYO1F_HUMAN	N	60;15	ENSP00000344871:K15N	ENSP00000304899:K60N	K	-	3	2	MYO1F	8526639	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.827000	0.27421	0.339000	0.23719	0.455000	0.32223	AAG	-	NULL		0.632	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	protein_coding	OTTHUMT00000342716.2	C			8526639	-1	no_errors	NM_012335	genbank	human	provisional	54_36p	missense	SNP	1	G
ARHGAP35	2909	genome.wustl.edu	37	19	47424187	47424187	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr19:47424187G>T	ENST00000404338.3	+	1	2255	c.2255G>T	c.(2254-2256)aGt>aTt	p.S752I		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	752					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.S752I(1)									AAGCAAATCAGTCAAGTTTTG	0.433																																																1	Substitution - Missense(1)	ovary(1)	19											91.0	88.0	89.0					19																	47424187		1950	4155	6105	52116027	SO:0001583	missense	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2255G>T	19.37:g.47424187G>T	ENSP00000385720:p.Ser752Ile		52116027	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_FF;superfamily_FF domain;superfamily_GTPase activation domain GAP;HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S752I	ENST00000404338.3	37	c.2255	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149011	0.37923	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.45668	0.89	5.39	4.28	0.50868	.	0.081164	0.85682	D	0.000000	T	0.37571	0.1008	L	0.39898	1.24	0.44149	D	0.996947	P	0.39940	0.696	B	0.40285	0.325	T	0.26467	-1.0102	10	0.46703	T	0.11	-23.1953	14.8208	0.70070	0.0:0.145:0.855:0.0	.	752	Q9NRY4-2	.	I	752	ENSP00000385720:S752I	ENSP00000324820:S752I	S	+	2	0	ARHGAP35	52116027	0.882000	0.30256	1.000000	0.80357	0.992000	0.81027	1.973000	0.40550	2.684000	0.91462	0.655000	0.94253	AGT	-	NULL		0.433	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRLF1	protein_coding	OTTHUMT00000466652.1	G	NM_004491		52116027	1	no_errors	NM_004491	genbank	human	reviewed	54_36p	missense	SNP	1	T
DPP10	57628	genome.wustl.edu	37	2	116510874	116510874	+	Splice_Site	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:116510874G>A	ENST00000410059.1	+	11	1554		c.e11+1		DPP10_ENST00000409163.1_Splice_Site|DPP10_ENST00000310323.8_Splice_Site|DPP10_ENST00000393147.2_Splice_Site	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.?(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTGTAGTAAAGTGAGTATAAT	0.373																																																1	Unknown(1)	ovary(1)	2											98.0	92.0	94.0					2																	116510874		2203	4300	6503	116227344	SO:0001630	splice_region_variant	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1074+1G>A	2.37:g.116510874G>A			116227344	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Splice_Site	SNP	-	e11+1	ENST00000410059.1	37	c.1074+1	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566750	0.45694	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6852	0.88255	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPP10	116227344	1.000000	0.71417	0.782000	0.31804	0.205000	0.24178	9.236000	0.95360	2.660000	0.90430	0.650000	0.86243	.	-	-		0.373	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	protein_coding	OTTHUMT00000330580.4	G	NM_020868	Intron	116227344	1	no_errors	NM_020868	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
THSD7B	80731	genome.wustl.edu	37	2	137990529	137990529	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:137990529C>A	ENST00000409968.1	+	9	2154	c.1976C>A	c.(1975-1977)tCc>tAc	p.S659Y	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.S659Y|THSD7B_ENST00000413152.2_Missense_Mutation_p.S628Y			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	659	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.S659Y(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AATGACCATTCCTGTATGCAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	114.0	114.0					2																	137990529		1995	4164	6159	137706999	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1976C>A	2.37:g.137990529C>A	ENSP00000387145:p.Ser659Tyr		137706999		Missense_Mutation	SNP	-	p.S628Y	ENST00000409968.1	37	c.1883		2	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180431	0.57800	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.54279	0.58;0.58;0.58	5.65	5.65	0.86999	.	0.147403	0.64402	D	0.000006	T	0.69070	0.3070	M	0.64404	1.975	0.80722	D	1	D;D	0.64830	0.994;0.988	D;P	0.68943	0.961;0.862	T	0.70528	-0.4847	10	0.87932	D	0	.	15.2101	0.73214	0.0:0.9306:0.0:0.0694	.	659;628	Q9C0I4;C9JKN6	THS7B_HUMAN;.	Y	659;659;628	ENSP00000387145:S659Y;ENSP00000272643:S659Y;ENSP00000413841:S628Y	ENSP00000272643:S659Y	S	+	2	0	THSD7B	137706999	0.995000	0.38212	0.999000	0.59377	0.236000	0.25371	3.845000	0.55880	2.826000	0.97356	0.491000	0.48974	TCC	-	NULL		0.488	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9		137706999	1	no_errors	NM_001080427	genbank	human	provisional	54_36p	missense	SNP	1	A
AC012501.2	0	genome.wustl.edu	37	2	154277036	154277036	+	RNA	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:154277036G>C	ENST00000424322.1	-	0	1172																											TTTGAGACATGATGGAAAAAT	0.294																																																0			2																																								153985282			642635																															2.37:g.154277036G>C			153985282		RNA	SNP	-	NULL	ENST00000424322.1	37	NULL		2																																																																																			-	-		0.294	AC012501.2-003	KNOWN	basic	sense_overlapping	LOC642635	sense_overlapping	OTTHUMT00000332581.1	G			153985282	-1	pseudogene	XR_016188	genbank	human	model	54_36p	rna	SNP	0.002	C
AC012501.2	0	genome.wustl.edu	37	2	154277040	154277040	+	RNA	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:154277040G>A	ENST00000424322.1	-	0	1172																											AGACATGATGGAAAAATCTTG	0.294																																																0			2																																								153985286			642635																															2.37:g.154277040G>A			153985286		RNA	SNP	-	NULL	ENST00000424322.1	37	NULL		2																																																																																			-	-		0.294	AC012501.2-003	KNOWN	basic	sense_overlapping	LOC642635	sense_overlapping	OTTHUMT00000332581.1	G			153985286	-1	pseudogene	XR_016188	genbank	human	model	54_36p	rna	SNP	0	A
AC012501.2	0	genome.wustl.edu	37	2	154277530	154277530	+	RNA	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:154277530G>A	ENST00000424322.1	-	0	1172																											TCTTGTTAGTGGAATAGCAGT	0.428																																																0			2																																								153985776			642635																															2.37:g.154277530G>A			153985776		RNA	SNP	-	NULL	ENST00000424322.1	37	NULL		2																																																																																			-	-		0.428	AC012501.2-003	KNOWN	basic	sense_overlapping	LOC642635	sense_overlapping	OTTHUMT00000332581.1	G			153985776	-1	pseudogene	XR_016188	genbank	human	model	54_36p	rna	SNP	1	A
CCDC148	130940	genome.wustl.edu	37	2	159035456	159035456	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:159035456C>A	ENST00000283233.5	-	12	1736	c.1423G>T	c.(1423-1425)Gtg>Ttg	p.V475L	CCDC148_ENST00000409187.1_Missense_Mutation_p.V484L|CCDC148-AS1_ENST00000412781.2_RNA	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	475								p.V475L(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						TGAAGGGCCACTTCCTTTTTC	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	98.0	98.0					2																	159035456		2203	4300	6503	158743702	SO:0001583	missense	130940				CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.1423G>T	2.37:g.159035456C>A	ENSP00000283233:p.Val475Leu		158743702	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	-	p.V475L	ENST00000283233.5	37	c.1423	CCDS33304.1	2	.	.	.	.	.	.	.	.	.	.	C	8.459	0.854791	0.17106	.	.	ENSG00000153237	ENST00000283233;ENST00000409187	T;T	0.21543	2.0;2.01	5.93	3.76	0.43208	.	.	.	.	.	T	0.10035	0.0246	N	0.08118	0	0.44492	D	0.997438	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.13710	-1.0499	9	0.28530	T	0.3	0.0071	8.3907	0.32526	0.2817:0.6362:0.0:0.0821	.	484;475	B8ZZV3;Q8NFR7	.;CC148_HUMAN	L	475;484	ENSP00000283233:V475L;ENSP00000386674:V484L	ENSP00000283233:V475L	V	-	1	0	CCDC148	158743702	0.000000	0.05858	0.966000	0.40874	0.317000	0.28152	-0.204000	0.09425	1.455000	0.47813	0.655000	0.94253	GTG	-	NULL		0.378	CCDC148-001	KNOWN	basic|CCDS	protein_coding	CCDC148	protein_coding	OTTHUMT00000333270.1	C	NM_138803		158743702	-1	no_errors	NM_138803	genbank	human	provisional	54_36p	missense	SNP	0.93	A
PKP4	8502	genome.wustl.edu	37	2	159481794	159481794	+	Silent	SNP	G	G	A	rs200934987		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:159481794G>A	ENST00000389759.3	+	7	1120	c.1008G>A	c.(1006-1008)tcG>tcA	p.S336S	PKP4_ENST00000389757.3_Silent_p.S336S	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	336				S -> V (in Ref. 1; CAA57478). {ECO:0000305}.	cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.S336S(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						TGGGGTCGTCGTCCCCCAAAC	0.592										HNSCC(62;0.18)																																						1	Substitution - coding silent(1)	ovary(1)	2											70.0	63.0	66.0					2																	159481794		2203	4300	6503	159190040	SO:0001819	synonymous_variant	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1008G>A	2.37:g.159481794G>A			159190040	Q86W91	Silent	SNP	-	p.S336	ENST00000389759.3	37	c.1008	CCDS33305.1	2																																																																																			-	NULL		0.592	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	protein_coding	OTTHUMT00000333250.1	G			159190040	1	no_errors	NM_003628	genbank	human	reviewed	54_36p	silent	SNP	0.98	A
FAM171B	165215	genome.wustl.edu	37	2	187627354	187627354	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:187627354A>C	ENST00000304698.5	+	8	2488	c.2285A>C	c.(2284-2286)cAc>cCc	p.H762P		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	762						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.H762P(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCTTTAAGGCACATCCTAGAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	77.0	77.0					2																	187627354		2203	4300	6503	187335599	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2285A>C	2.37:g.187627354A>C	ENSP00000304108:p.His762Pro		187335599	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	-	p.H762P	ENST00000304698.5	37	c.2285	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	A	11.41	1.630778	0.28978	.	.	ENSG00000144369	ENST00000304698	T	0.26957	1.7	6.02	4.81	0.61882	.	0.143965	0.64402	D	0.000006	T	0.14527	0.0351	N	0.10874	0.06	0.47407	D	0.999414	B;B	0.15473	0.013;0.013	B;B	0.18871	0.023;0.023	T	0.08994	-1.0695	10	0.27082	T	0.32	-18.4059	13.0247	0.58808	0.8658:0.1342:0.0:0.0	.	762;763	Q6P995;A8K122	F171B_HUMAN;.	P	762	ENSP00000304108:H762P	ENSP00000304108:H762P	H	+	2	0	FAM171B	187335599	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	4.628000	0.61282	2.299000	0.77371	0.528000	0.53228	CAC	-	NULL		0.498	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	protein_coding	OTTHUMT00000334679.1	A	NM_177454		187335599	1	no_errors	NM_177454	genbank	human	validated	54_36p	missense	SNP	1	C
TRAPPC12	51112	genome.wustl.edu	37	2	3464057	3464057	+	Missense_Mutation	SNP	C	C	T	rs201978278		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:3464057C>T	ENST00000324266.5	+	8	1822	c.1627C>T	c.(1627-1629)Cgt>Tgt	p.R543C	TRAPPC12_ENST00000469147.1_3'UTR|TRAPPC12_ENST00000382110.2_Missense_Mutation_p.R543C	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	543					vesicle-mediated transport (GO:0016192)			p.R543C(1)									GTGGAGGTCACGTCTGGGCCG	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		16310	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											95.0	85.0	88.0					2																	3464057		2203	4300	6503	3443064	SO:0001583	missense	51112			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1627C>T	2.37:g.3464057C>T	ENSP00000324318:p.Arg543Cys		3443064	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	-	p.R543C	ENST00000324266.5	37	c.1627	CCDS1652.1	2	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	22.2|22.2	4.255633|4.255633	0.80135|0.80135	.|.	.|.	ENSG00000171853|ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266;ENST00000415624|ENST00000433382	T;T|.	0.67523|.	-0.27;-0.27|.	5.75|5.75	4.87|4.87	0.63330|0.63330	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80319|0.80319	0.4601|0.4601	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.84033|0.84033	0.0360|0.0360	10|5	0.87932|.	D|.	0|.	.|.	13.8667|13.8667	0.63592|0.63592	0.0:0.9267:0.0:0.0733|0.0:0.9267:0.0:0.0733	.|.	532;543|.	E7ENL7;Q8WVT3|.	.;TPC12_HUMAN|.	C|M	543;532;543;41|88	ENSP00000371544:R543C;ENSP00000324318:R543C|.	ENSP00000303612:R532C|.	R|T	+|+	1|2	0|0	TTC15|TTC15	3443064|3443064	1.000000|1.000000	0.71417|0.71417	0.877000|0.877000	0.34402|0.34402	0.728000|0.728000	0.41692|0.41692	7.260000|7.260000	0.78391|0.78391	1.434000|1.434000	0.47414|0.47414	0.467000|0.467000	0.42956|0.42956	CGT|ACG	-	NULL		0.547	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TTC15	protein_coding	OTTHUMT00000206693.2	C	NM_016030		3443064	1	no_errors	NM_016030	genbank	human	validated	54_36p	missense	SNP	1	T
XPO1	7514	genome.wustl.edu	37	2	61724139	61724139	+	Silent	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:61724139G>A	ENST00000401558.2	-	10	1490	c.763C>T	c.(763-765)Ctg>Ttg	p.L255L	XPO1_ENST00000404992.2_Silent_p.L255L|XPO1_ENST00000406957.1_Silent_p.L255L	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	255	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)	p.L255L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			GGAACATTCAGGAACTATTTA	0.343			Mis		CLL																																	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	1	Substitution - coding silent(1)	ovary(1)	2											79.0	81.0	80.0					2																	61724139		2203	4300	6503	61577643	SO:0001819	synonymous_variant	7514			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.763C>T	2.37:g.61724139G>A			61577643	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Silent	SNP	HMMPfam_IBN_N;HMMPfam_Xpo1;HMMPfam_CRM1_C;superfamily_ARM repeat	p.L255	ENST00000401558.2	37	c.763	CCDS33205.1	2																																																																																			-	HMMPfam_Xpo1		0.343	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	protein_coding	OTTHUMT00000325872.3	G	NM_003400		61577643	-1	no_errors	NM_003400	genbank	human	reviewed	54_36p	silent	SNP	1	A
SMYD1	150572	genome.wustl.edu	37	2	88387386	88387386	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:88387386C>T	ENST00000419482.2	+	3	405	c.320C>T	c.(319-321)gCg>gTg	p.A107V	SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000444564.2_Missense_Mutation_p.A107V|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	107	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.A107V(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CACAGGCTGGCGGCGCGCATC	0.602																																																1	Substitution - Missense(1)	ovary(1)	2											25.0	23.0	24.0					2																	88387386		2199	4296	6495	88168501	SO:0001583	missense	150572			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.320C>T	2.37:g.88387386C>T	ENSP00000393453:p.Ala107Val		88168501	A0AV30|A6NE13	Missense_Mutation	SNP	-	p.A107V	ENST00000419482.2	37	c.320	CCDS33240.1	2	.	.	.	.	.	.	.	.	.	.	C	8.183	0.794184	0.16327	.	.	ENSG00000115593	ENST00000419482;ENST00000444564	T;T	0.21361	2.01;2.01	4.82	4.82	0.62117	SET domain (2);	0.049513	0.85682	D	0.000000	T	0.08891	0.0220	N	0.17379	0.485	0.80722	D	1	P	0.52842	0.956	B	0.28991	0.097	T	0.22347	-1.0219	10	0.02654	T	1	-20.2177	17.2354	0.86997	0.0:1.0:0.0:0.0	.	107	Q8NB12	SMYD1_HUMAN	V	107	ENSP00000393453:A107V;ENSP00000407888:A107V	ENSP00000393453:A107V	A	+	2	0	SMYD1	88168501	0.996000	0.38824	0.943000	0.38184	0.616000	0.37450	3.412000	0.52679	2.363000	0.80096	0.561000	0.74099	GCG	-	NULL		0.602	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	protein_coding	OTTHUMT00000338229.2	C	XM_097915		88168501	1	no_errors	NM_198274	genbank	human	provisional	54_36p	missense	SNP	0.967	T
BMPR2	659	genome.wustl.edu	37	2	203383770	203383770	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr2:203383770C>A	ENST00000374580.4	+	6	1386	c.847C>A	c.(847-849)Ccc>Acc	p.P283T	BMPR2_ENST00000374574.2_Missense_Mutation_p.P283T	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.P283T(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GGAGTACTATCCCAATGTAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	103.0	107.0					2																	203383770		2203	4300	6503	203092015	SO:0001583	missense	659			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.847C>A	2.37:g.203383770C>A	ENSP00000363708:p.Pro283Thr		203092015	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	HMMPfam_Activin_recp;HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);superfamily_Snake toxin-like	p.P283T	ENST00000374580.4	37	c.847	CCDS33361.1	2	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847144	0.51164	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.94046	-3.34;-3.34	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100972	0.64402	D	0.000001	D	0.94850	0.8336	M	0.73372	2.23	0.58432	D	0.999999	P;P	0.49696	0.565;0.927	B;P	0.53035	0.213;0.716	D	0.95000	0.8142	10	0.72032	D	0.01	.	14.6084	0.68498	0.0:0.7335:0.2665:0.0	.	283;283	Q13161;Q13873	.;BMPR2_HUMAN	T	283	ENSP00000363708:P283T;ENSP00000363702:P283T	ENSP00000363702:P283T	P	+	1	0	BMPR2	203092015	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.154000	0.50693	2.666000	0.90696	0.650000	0.86243	CCC	-	HMMPfam_Pkinase		0.453	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	protein_coding	OTTHUMT00000257743.1	C	NM_001204		203092015	1	no_errors	NM_001204	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNFX1	57169	genome.wustl.edu	37	20	47866023	47866023	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr20:47866023T>C	ENST00000396105.1	-	14	3784	c.3538A>G	c.(3538-3540)Agg>Ggg	p.R1180G	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.R1180G	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1180							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1180G(2)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACATGGACCCTGACGCCAGCA	0.532																																																2	Substitution - Missense(2)	ovary(2)	20											158.0	143.0	148.0					20																	47866023		2203	4300	6503	47299430	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3538A>G	20.37:g.47866023T>C	ENSP00000379412:p.Arg1180Gly		47299430	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	-	p.R1180G	ENST00000396105.1	37	c.3538	CCDS13417.1	20	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490293	0.26686	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	D;D	0.92495	-3.05;-3.05	6.03	6.03	0.97812	.	0.103596	0.64402	D	0.000004	D	0.94338	0.8180	M	0.93197	3.39	0.30480	N	0.772486	B	0.28470	0.213	B	0.30716	0.119	D	0.92892	0.6332	10	0.66056	D	0.02	-23.3123	15.3822	0.74669	0.0:0.0:0.0:1.0	.	1180	Q9P2E3	ZNFX1_HUMAN	G	1180	ENSP00000360817:R1180G;ENSP00000379412:R1180G	ENSP00000360817:R1180G	R	-	1	2	ZNFX1	47299430	1.000000	0.71417	0.999000	0.59377	0.359000	0.29487	6.142000	0.71750	2.308000	0.77769	0.533000	0.62120	AGG	-	NULL		0.532	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	protein_coding	OTTHUMT00000079647.2	T	NM_021035		47299430	-1	no_errors	NM_021035	genbank	human	validated	54_36p	missense	SNP	1	C
ADNP	23394	genome.wustl.edu	37	20	49509183	49509183	+	Missense_Mutation	SNP	C	C	T	rs370301614		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr20:49509183C>T	ENST00000396029.3	-	5	2635	c.2068G>A	c.(2068-2070)Gtt>Att	p.V690I	ADNP_ENST00000349014.3_Missense_Mutation_p.V690I|ADNP_ENST00000371602.4_Missense_Mutation_p.V690I|ADNP_ENST00000396032.3_Missense_Mutation_p.V690I	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	690					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V690I(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GTCTTTCCAACGCCCCTGCAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	20						C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	132.0	116.0	121.0		2068,2068	6.1	1.0	20		121	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADNP	NM_015339.2,NM_181442.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	690/1103,690/1103	49509183	1,13005	2203	4300	6503	48942590	SO:0001583	missense	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2068G>A	20.37:g.49509183C>T	ENSP00000379346:p.Val690Ile		48942590	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	-	p.V690I	ENST00000396029.3	37	c.2068	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924691	0.73213	0.0	1.16E-4	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.76492	0.3995	L	0.53249	1.67	0.58432	D	0.999999	D	0.69078	0.997	D	0.68039	0.955	T	0.73981	-0.3811	9	0.49607	T	0.09	-19.6929	20.6397	0.99537	0.0:1.0:0.0:0.0	.	690	Q9H2P0	ADNP_HUMAN	I	690	.	ENSP00000342905:V690I	V	-	1	0	ADNP	48942590	1.000000	0.71417	0.952000	0.39060	0.991000	0.79684	7.476000	0.81055	2.880000	0.98712	0.650000	0.86243	GTT	-	NULL		0.483	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	protein_coding	OTTHUMT00000079705.2	C	NM_181442		48942590	-1	no_errors	NM_015339	genbank	human	reviewed	54_36p	missense	SNP	1	T
GNAS	2778	genome.wustl.edu	37	20	57480494	57480494	+	Nonsense_Mutation	SNP	C	C	G	rs372290095		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr20:57480494C>G	ENST00000371085.3	+	6	913	c.489C>G	c.(487-489)taC>taG	p.Y163*	GNAS_ENST00000354359.7_Nonsense_Mutation_p.Y164*|GNAS_ENST00000306090.10_Nonsense_Mutation_p.Y149*|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Nonsense_Mutation_p.Y806*|GNAS_ENST00000371095.3_Nonsense_Mutation_p.Y149*|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Nonsense_Mutation_p.Y148*|GNAS_ENST00000371102.4_Nonsense_Mutation_p.Y792*|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	163					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.Y806*(2)|p.Y163*(2)|p.Y806Y(1)|p.Y163Y(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GTGCCTGCTACGAACGCTCCA	0.468			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	6	Substitution - Nonsense(4)|Substitution - coding silent(2)	ovary(4)|prostate(2)	20	GRCh37	CM002274	GNAS	M							127.0	116.0	120.0					20																	57480494		2203	4300	6503	56913889	SO:0001587	stop_gained	2778			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.489C>G	20.37:g.57480494C>G	ENSP00000360126:p.Tyr163*		56913889	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Nonsense_Mutation	SNP	-	p.Y164*	ENST00000371085.3	37	c.492	CCDS13472.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	11.68|11.68	1.709782|1.709782	0.30322|0.30322	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000371100;ENST00000371102;ENST00000349036;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	.|.	.|.	.|.	5.93|5.93	-11.9|-11.9	0.00025|0.00025	.|.	.|0.299614	.|0.37053	.|N	.|0.002265	T|.	0.43100|.	0.1232|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.58370|.	-0.7648|.	3|.	.|0.10902	.|T	.|0.67	.|.	19.0914|19.0914	0.93228|0.93228	0.0:0.426:0.0:0.574|0.0:0.426:0.0:0.574	.|.	.|.	.|.	.|.	G|X	178|806;792;180;149;163;164;148;149	.|.	.|ENSP00000265620:Y148X	R|Y	+|+	1|3	2|2	GNAS|GNAS	56913889|56913889	0.000000|0.000000	0.05858|0.05858	0.228000|0.228000	0.23943|0.23943	0.653000|0.653000	0.38743|0.38743	-2.176000|-2.176000	0.01262|0.01262	-2.589000|-2.589000	0.00457|0.00457	-2.036000|-2.036000	0.00420|0.00420	CGA|TAC	-	NULL		0.468	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080431.2	C	NM_000516		56913889	1	no_errors	NM_001077488	genbank	human	reviewed	54_36p	nonsense	SNP	0.98	G
ST13P19	100131961	genome.wustl.edu	37	1	210440472	210440472	+	IGR	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr1:210440472G>A								SERTAD4 (20872 upstream) : HHAT (61123 downstream)																							TACTTTACCCGCCATGCTCTC	0.453																																																0			1																																								208507095	SO:0001628	intergenic_variant	100131961																															1.37:g.210440472G>A			208507095		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.453					LOC100131961			G			208507095	-1	pseudogene	XR_036984	genbank	human	model	54_36p	rna	SNP	0.96	A
POTED	317754	genome.wustl.edu	37	21	14983001	14983001	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr21:14983001A>G	ENST00000299443.5	+	1	504	c.452A>G	c.(451-453)aAa>aGa	p.K151R		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	151						plasma membrane (GO:0005886)		p.K151R(1)		central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						TGGTGGGGTAAAGTCCCCAGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	21											10.0	17.0	16.0					21																	14983001		665	2939	3604	13904872	SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.452A>G	21.37:g.14983001A>G	ENSP00000299443:p.Lys151Arg		13904872	C9JCF7	Missense_Mutation	SNP	superfamily_Ankyrin repeat;HMMPfam_Ank	p.K151R	ENST00000299443.5	37	c.452	CCDS13562.1	21	.	.	.	.	.	.	.	.	.	.	A	12.45	1.940228	0.34283	.	.	ENSG00000166351	ENST00000299443	T	0.52295	0.67	1.13	1.13	0.20643	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.39784	0.1091	L	0.47716	1.5	0.09310	N	1	P	0.34587	0.458	B	0.39152	0.292	T	0.36212	-0.9757	9	0.52906	T	0.07	.	4.4646	0.11682	1.0:0.0:0.0:0.0	.	151	Q86YR6	POTED_HUMAN	R	151	ENSP00000299443:K151R	ENSP00000299443:K151R	K	+	2	0	POTED	13904872	0.002000	0.14202	0.001000	0.08648	0.158000	0.22134	1.367000	0.34204	0.756000	0.33013	0.155000	0.16302	AAA	-	NULL		0.577	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTED	protein_coding	OTTHUMT00000157660.1	A	NM_174981		13904872	1	no_errors	NM_174981	genbank	human	validated	54_36p	missense	SNP	0.01	G
FANCD2	2177	genome.wustl.edu	37	3	10106040	10106040	+	Splice_Site	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:10106040G>T	ENST00000419585.1	+	22	2109	c.1948G>T	c.(1948-1950)Gaa>Taa	p.E650*	FANCD2_ENST00000383807.1_Splice_Site_p.E650*|FANCD2_ENST00000287647.3_Splice_Site_p.E650*|FANCD2_ENST00000383806.1_Splice_Site_p.E650*			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	650					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.E650*(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CTTCCTGAAGGAATGGGTTGG	0.453			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	1	Substitution - Nonsense(1)	ovary(1)	3											114.0	109.0	111.0					3																	10106040		2202	4280	6482	10081040	SO:0001630	splice_region_variant	2177	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1948-1G>T	3.37:g.10106040G>T			10081040	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Nonsense_Mutation	SNP	-	p.E650*	ENST00000419585.1	37	c.1948	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.498528	0.98838	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	.	.	.	5.58	5.58	0.84498	.	0.289991	0.42053	D	0.000779	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	10.8721	0.46889	0.0861:0.0:0.9139:0.0	.	.	.	.	X	650	.	ENSP00000287647:E650X	E	+	1	0	FANCD2	10081040	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	4.394000	0.59671	2.808000	0.96608	0.585000	0.79938	GAA	-	NULL		0.453	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	protein_coding	OTTHUMT00000339873.1	G		Nonsense_Mutation	10081040	1	no_errors	NM_033084	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
QRICH1	54870	genome.wustl.edu	37	3	49069660	49069660	+	Silent	SNP	T	T	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:49069660T>C	ENST00000395443.2	-	9	2566	c.2094A>G	c.(2092-2094)ccA>ccG	p.P698P	QRICH1_ENST00000479449.1_5'Flank|IMPDH2_ENST00000326739.4_5'Flank|RP13-131K19.6_ENST00000607245.1_RNA|QRICH1_ENST00000424300.1_Silent_p.P698P|QRICH1_ENST00000357496.2_Silent_p.P698P	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	698						nucleus (GO:0005634)		p.P698P(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GACATCTCAATGGATTCTCTG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	3											247.0	208.0	221.0					3																	49069660		2203	4300	6503	49044664	SO:0001819	synonymous_variant	54870				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.2094A>G	3.37:g.49069660T>C			49044664	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	-	p.P698	ENST00000395443.2	37	c.2094	CCDS2787.1	3																																																																																			-	NULL		0.458	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRICH1	protein_coding	OTTHUMT00000345669.1	T	NM_017730		49044664	-1	no_errors	NM_017730	genbank	human	validated	54_36p	silent	SNP	0.98	C
CAMKV	79012	genome.wustl.edu	37	3	49899251	49899251	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:49899251C>T	ENST00000477224.1	-	4	753	c.275G>A	c.(274-276)cGc>cAc	p.R92H	CAMKV_ENST00000463537.1_Missense_Mutation_p.R92H|CAMKV_ENST00000488336.1_Missense_Mutation_p.R92H|CAMKV_ENST00000466940.1_Missense_Mutation_p.R92H|RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000296471.7_Missense_Mutation_p.R92H|CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000467248.1_Missense_Mutation_p.R17H			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	92	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.R92H(2)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GTACTCCTTGCGGGTCACAAA	0.587																																																2	Substitution - Missense(2)	ovary(2)	3											60.0	58.0	59.0					3																	49899251		2203	4300	6503	49874255	SO:0001583	missense	79012			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.275G>A	3.37:g.49899251C>T	ENSP00000419195:p.Arg92His		49874255	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Missense_Mutation	SNP	Pkinase,HMMPfam_Pkinase	p.R92H	ENST00000477224.1	37	c.275	CCDS33762.1	3	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923739	0.73213	.	.	ENSG00000164076	ENST00000296471;ENST00000488336;ENST00000463537;ENST00000477224;ENST00000467248;ENST00000466940	T;T;T;T;T;T	0.66280	2.75;2.75;1.04;2.75;-0.2;2.75	4.94	4.94	0.65067	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43416	D	0.000577	T	0.67249	0.2873	N	0.17723	0.515	0.51767	D	0.999939	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.928;0.991;0.959;0.97;0.952	T	0.71540	-0.4562	10	0.59425	D	0.04	.	16.3199	0.82945	0.0:1.0:0.0:0.0	.	92;55;92;92;92	E7ETR1;B4DMF2;Q8NCB2-2;Q8NCB2-3;Q8NCB2	.;.;.;.;CAMKV_HUMAN	H	92;92;92;92;17;92	ENSP00000296471:R92H;ENSP00000418809:R92H;ENSP00000417614:R92H;ENSP00000419195:R92H;ENSP00000420053:R17H;ENSP00000420724:R92H	ENSP00000296471:R92H	R	-	2	0	CAMKV	49874255	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.650000	0.61440	2.459000	0.83118	0.462000	0.41574	CGC	-	HMMPfam_Pkinase		0.587	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKV	protein_coding	OTTHUMT00000350584.4	C	NM_024046		49874255	-1	no_errors	NM_024046	genbank	human	validated	54_36p	missense	SNP	1	T
DOCK3	1795	genome.wustl.edu	37	3	51418727	51418727	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:51418727G>A	ENST00000266037.9	+	53	5853	c.5830G>A	c.(5830-5832)Gtc>Atc	p.V1944I		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1944					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V1944I(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGAGTCTGCCGTCCTGGACTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	80.0	76.0					3																	51418727		2155	4258	6413	51393767	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5830G>A	3.37:g.51418727G>A	ENSP00000266037:p.Val1944Ile		51393767	O15017	Missense_Mutation	SNP	Ded_cyto,HMMPfam_Ded_cyto,SH3_2,HMMPfam_SH3_2	p.V1944I	ENST00000266037.9	37	c.5830	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	15.26	2.779546	0.49891	.	.	ENSG00000088538	ENST00000266037	T	0.05382	3.45	6.17	6.17	0.99709	.	0.294963	0.32852	N	0.005568	T	0.07503	0.0189	L	0.36672	1.1	0.39183	D	0.962814	B	0.33857	0.429	B	0.25140	0.058	T	0.32903	-0.9889	10	0.35671	T	0.21	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1944	Q8IZD9	DOCK3_HUMAN	I	1944	ENSP00000266037:V1944I	ENSP00000266037:V1944I	V	+	1	0	DOCK3	51393767	1.000000	0.71417	0.916000	0.36221	0.982000	0.71751	7.198000	0.77823	2.941000	0.99782	0.655000	0.94253	GTC	-	NULL		0.632	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	protein_coding	OTTHUMT00000346478.5	G	NM_004947		51393767	1	no_errors	NM_004947	genbank	human	validated	54_36p	missense	SNP	0.968	A
CPB1	1360	genome.wustl.edu	37	3	148558742	148558742	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr3:148558742C>T	ENST00000491148.1	+	6	788	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	CPB1_ENST00000282957.4_Missense_Mutation_p.R152C			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	152						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R152C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			ATTTGAGGGACGCGCTATTTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											145.0	127.0	133.0					3																	148558742		2203	4300	6503	150041432	SO:0001583	missense	1360			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.454C>T	3.37:g.148558742C>T	ENSP00000417222:p.Arg152Cys		150041432	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	-	p.R152C	ENST00000491148.1	37	c.454	CCDS33874.1	3	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729464	0.48833	.	.	ENSG00000153002	ENST00000491148;ENST00000282957	T;T	0.28895	1.59;1.59	5.29	3.44	0.39384	Peptidase M14, carboxypeptidase A (3);	0.171581	0.51477	D	0.000097	T	0.69396	0.3106	H	0.98314	4.2	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.80993	-0.1134	10	0.87932	D	0	.	13.9431	0.64069	0.2933:0.7067:0.0:0.0	.	152	P15086	CBPB1_HUMAN	C	152	ENSP00000417222:R152C;ENSP00000282957:R152C	ENSP00000282957:R152C	R	+	1	0	CPB1	150041432	0.996000	0.38824	0.626000	0.29213	0.501000	0.33797	3.484000	0.53201	0.561000	0.29186	0.655000	0.94253	CGC	-	NULL		0.428	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB1	protein_coding	OTTHUMT00000355928.1	C	NM_001871		150041432	1	no_errors	NM_001871	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
GC	2638	genome.wustl.edu	37	4	72629573	72629573	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr4:72629573A>G	ENST00000273951.8	-	5	897	c.554T>C	c.(553-555)aTg>aCg	p.M185T	GC_ENST00000504199.1_Missense_Mutation_p.M204T|GC_ENST00000513476.1_Missense_Mutation_p.M185T|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	185	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)	p.M185T(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	GGACCCTACCATAGAAAGATA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											106.0	112.0	110.0					4																	72629573		2203	4300	6503	72848437	SO:0001583	missense	2638			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.554T>C	4.37:g.72629573A>G	ENSP00000273951:p.Met185Thr		72848437	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	superfamily_Serum albumin-like;HMMPfam_Serum_albumin;HMMPfam_VitD-bind_III	p.M185T	ENST00000273951.8	37	c.554	CCDS3550.1	4	.	.	.	.	.	.	.	.	.	.	A	17.53	3.411857	0.62511	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.71934	-0.61;-0.61;-0.61	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.84133	0.5405	M	0.77616	2.38	0.51767	D	0.999935	D;D	0.71674	0.993;0.998	D;D	0.87578	0.996;0.998	D	0.86052	0.1526	10	0.66056	D	0.02	.	15.5538	0.76173	1.0:0.0:0.0:0.0	.	204;185	D6RAK8;D6RF35	.;.	T	185;204;185	ENSP00000273951:M185T;ENSP00000421725:M204T;ENSP00000426683:M185T	ENSP00000273951:M185T	M	-	2	0	GC	72848437	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	6.137000	0.71710	2.205000	0.71048	0.533000	0.62120	ATG	-	HMMPfam_Serum_albumin		0.363	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GC	protein_coding	OTTHUMT00000252167.2	A			72848437	-1	no_errors	NM_000583	genbank	human	reviewed	54_36p	missense	SNP	1	G
AFP	174	genome.wustl.edu	37	4	74310761	74310761	+	Silent	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr4:74310761C>T	ENST00000395792.2	+	7	865	c.765C>T	c.(763-765)atC>atT	p.I255I	AFP_ENST00000226359.2_Silent_p.I255I	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	255	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)	p.I255I(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTACTGAAATCCAGAAACTAG	0.378									Alpha-Fetoprotein, Hereditary Persistence of																																							1	Substitution - coding silent(1)	ovary(1)	4											88.0	87.0	87.0					4																	74310761		2203	4300	6503	74529625	SO:0001819	synonymous_variant	174	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.765C>T	4.37:g.74310761C>T			74529625	B2RBU3	Silent	SNP	superfamily_Serum albumin-like;HMMPfam_Serum_albumin	p.I255	ENST00000395792.2	37	c.765	CCDS3556.1	4																																																																																			-	HMMPfam_Serum_albumin		0.378	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	protein_coding	OTTHUMT00000252284.3	C			74529625	1	no_errors	NM_001134	genbank	human	reviewed	54_36p	silent	SNP	0.17	T
RRH	10692	genome.wustl.edu	37	4	110765294	110765294	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr4:110765294G>C	ENST00000317735.4	+	7	989	c.955G>C	c.(955-957)Gtg>Ctg	p.V319L		NM_006583.2	NP_006574.1	O14718	OPSX_HUMAN	retinal pigment epithelium-derived rhodopsin homolog	319					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.V319L(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	12		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		AACAATGCCTGTGACAAGTAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											167.0	159.0	162.0					4																	110765294		2203	4300	6503	110984743	SO:0001583	missense	10692			AF012270	CCDS3687.1	4q25	2012-08-08			ENSG00000180245	ENSG00000180245		"""GPCR / Class A : Opsin receptors"""	10450	protein-coding gene	gene with protein product	"""peropsin"""	605224				9275222	Standard	NM_006583		Approved	peropsin	uc003hzv.3	O14718	OTTHUMG00000132045	ENST00000317735.4:c.955G>C	4.37:g.110765294G>C	ENSP00000314992:p.Val319Leu		110984743	A1A4V2|Q7RTS4	Missense_Mutation	SNP	-	p.V319L	ENST00000317735.4	37	c.955	CCDS3687.1	4	.	.	.	.	.	.	.	.	.	.	G	5.256	0.232658	0.09969	.	.	ENSG00000180245	ENST00000317735	T	0.37915	1.17	5.9	1.26	0.21427	.	0.551296	0.18332	N	0.144465	T	0.13970	0.0338	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19257	-1.0311	10	0.26408	T	0.33	.	5.4253	0.16423	0.4141:0.1408:0.4451:0.0	.	319	O14718	OPSX_HUMAN	L	319	ENSP00000314992:V319L	ENSP00000314992:V319L	V	+	1	0	RRH	110984743	0.004000	0.15560	0.002000	0.10522	0.156000	0.22039	0.348000	0.20031	0.412000	0.25729	0.655000	0.94253	GTG	-	NULL		0.368	RRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRH	protein_coding	OTTHUMT00000255066.1	G	NM_006583		110984743	1	no_errors	NM_006583	genbank	human	reviewed	54_36p	missense	SNP	0.66	C
FBXL7	23194	genome.wustl.edu	37	5	15928350	15928350	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr5:15928350C>T	ENST00000504595.1	+	3	960	c.479C>T	c.(478-480)aCg>aTg	p.T160M	FBXL7_ENST00000510662.1_Missense_Mutation_p.T113M|FBXL7_ENST00000329673.7_Missense_Mutation_p.T148M	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	160					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.T160M(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						ATCCGCCTGACGGGCGAGACC	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											19.0	23.0	22.0					5																	15928350		2087	4213	6300	15981350	SO:0001583	missense	23194			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.479C>T	5.37:g.15928350C>T	ENSP00000423630:p.Thr160Met		15981350	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	HMMPfam_F-box;superfamily_RNI-like	p.T160M	ENST00000504595.1	37	c.479	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389583	0.42410	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.10382	2.88;2.88;2.88	5.36	4.5	0.54988	F-box domain, Skp2-like (1);	0.092711	0.85682	N	0.000000	T	0.09818	0.0241	L	0.36672	1.1	0.50632	D	0.999887	B	0.18968	0.032	B	0.11329	0.006	T	0.08806	-1.0704	10	0.44086	T	0.13	.	11.1644	0.48535	0.0:0.8515:0.0:0.1485	.	160	Q9UJT9	FBXL7_HUMAN	M	160;113;148	ENSP00000423630:T160M;ENSP00000425184:T113M;ENSP00000329632:T148M	ENSP00000329632:T148M	T	+	2	0	FBXL7	15981350	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	2.700000	0.47085	1.274000	0.44362	0.561000	0.74099	ACG	-	NULL		0.657	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	protein_coding	OTTHUMT00000366117.1	C	NM_012304		15981350	1	no_errors	NM_012304	genbank	human	reviewed	54_36p	missense	SNP	1	T
SFXN1	94081	genome.wustl.edu	37	5	174940555	174940555	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr5:174940555T>C	ENST00000321442.5	+	7	940	c.686T>C	c.(685-687)gTt>gCt	p.V229A		NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	229					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.V229A(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATCACGCAAGTTGTCGTGTCC	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											107.0	96.0	100.0					5																	174940555		2203	4300	6503	174873161	SO:0001583	missense	94081			AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.686T>C	5.37:g.174940555T>C	ENSP00000316905:p.Val229Ala		174873161	B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	-	p.V229A	ENST00000321442.5	37	c.686	CCDS4394.1	5	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359838	0.61403	.	.	ENSG00000164466	ENST00000321442	T	0.37058	1.22	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	H	0.94542	3.55	0.80722	D	1	P	0.51791	0.948	P	0.60068	0.868	T	0.77067	-0.2725	10	0.66056	D	0.02	-32.8627	14.0874	0.64968	0.0:0.0:0.0:1.0	.	229	Q9H9B4	SFXN1_HUMAN	A	229	ENSP00000316905:V229A	ENSP00000316905:V229A	V	+	2	0	SFXN1	174873161	1.000000	0.71417	0.079000	0.20413	0.020000	0.10135	7.787000	0.85759	1.971000	0.57363	0.379000	0.24179	GTT	-	NULL		0.532	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN1	protein_coding	OTTHUMT00000252980.2	T	NM_022754		174873161	1	no_errors	NM_022754	genbank	human	validated	54_36p	missense	SNP	1	C
PLCXD3	345557	genome.wustl.edu	37	5	41313739	41313739	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr5:41313739C>A	ENST00000377801.3	-	3	1020	c.946G>T	c.(946-948)Gaa>Taa	p.E316*	PLCXD3_ENST00000328457.3_Nonsense_Mutation_p.E316*			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	316					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.E316*(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GCTTCTCCTTCATCAAAGACA	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	5											122.0	109.0	113.0					5																	41313739		2203	4300	6503	41349496	SO:0001587	stop_gained	345557				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.946G>T	5.37:g.41313739C>A	ENSP00000367032:p.Glu316*		41349496	A6NL04	Nonsense_Mutation	SNP	superfamily_PLC-like phosphodiesterases	p.E316*	ENST00000377801.3	37	c.946	CCDS34150.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.047347	0.97236	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	5.65	5.65	0.86999	.	0.110420	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-16.8443	19.7362	0.96205	0.0:1.0:0.0:0.0	.	.	.	.	X	316	.	ENSP00000333751:E316X	E	-	1	0	PLCXD3	41349496	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.395000	0.79876	2.678000	0.91216	0.655000	0.94253	GAA	-	NULL		0.408	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	protein_coding	OTTHUMT00000367109.1	C	XM_293875		41349496	-1	no_errors	NM_001005473	genbank	human	validated	54_36p	nonsense	SNP	1	A
VCAN	1462	genome.wustl.edu	37	5	82834217	82834217	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr5:82834217T>A	ENST00000265077.3	+	8	5960	c.5395T>A	c.(5395-5397)Tta>Ata	p.L1799I	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.L812I|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1799	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.L1799I(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AACAAATACATTAGAAAATTT	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											51.0	55.0	54.0					5																	82834217		2203	4299	6502	82869973	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5395T>A	5.37:g.82834217T>A	ENSP00000265077:p.Leu1799Ile		82869973	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_Xlink;HMMPfam_Lectin_C;HMMPfam_EGF;HMMPfam_V-set;superfamily_Immunoglobulin;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.L1799I	ENST00000265077.3	37	c.5395	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	T	10.89	1.478481	0.26511	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.85088	-1.89;-1.94;3.21	5.82	3.35	0.38373	.	0.816597	0.10695	N	0.644709	T	0.79131	0.4394	L	0.52364	1.645	0.09310	N	0.999999	P;P	0.38078	0.617;0.483	B;B	0.33196	0.159;0.076	T	0.59721	-0.7401	10	0.16420	T	0.52	.	11.9	0.52678	0.0:0.0:0.3525:0.6475	.	812;1799	P13611-2;P13611	.;CSPG2_HUMAN	I	1799;812;812	ENSP00000265077:L1799I;ENSP00000340062:L812I;ENSP00000426251:L812I	ENSP00000265077:L1799I	L	+	1	2	VCAN	82869973	0.014000	0.17966	0.005000	0.12908	0.026000	0.11368	1.904000	0.39868	0.404000	0.25506	0.533000	0.62120	TTA	-	NULL		0.458	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	protein_coding	OTTHUMT00000254092.3	T	NM_004385		82869973	1	no_errors	NM_004385	genbank	human	validated	54_36p	missense	SNP		A
UIMC1	51720	genome.wustl.edu	37	5	176338311	176338311	+	Splice_Site	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr5:176338311C>T	ENST00000377227.4	-	11	1809		c.e11+1		UIMC1_ENST00000511320.1_Splice_Site|UIMC1_ENST00000506128.1_Splice_Site|UIMC1_ENST00000503273.1_Splice_Site|UIMC1_ENST00000377219.2_Splice_Site			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1						double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.?(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACCTACTTACTTGTCAATGT	0.393																																																1	Unknown(1)	ovary(1)	5											140.0	131.0	134.0					5																	176338311		2203	4300	6503	176270917	SO:0001630	splice_region_variant	51720			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.1676+1G>A	5.37:g.176338311C>T			176270917	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Splice_Site	SNP	-	e10+1	ENST00000377227.4	37	c.1676+1	CCDS4408.1	5	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243015	0.79912	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000506128;ENST00000377220;ENST00000323774	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5308	0.87814	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UIMC1	176270917	1.000000	0.71417	0.982000	0.44146	0.862000	0.49288	4.509000	0.60448	2.551000	0.86045	0.650000	0.86243	.	-	-		0.393	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UIMC1	protein_coding	OTTHUMT00000253422.1	C	NM_016290	Intron	176270917	-1	no_errors	NM_016290	genbank	human	provisional	54_36p	splice_site	SNP	1	T
FAM217A	222826	genome.wustl.edu	37	6	4070003	4070003	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr6:4070003G>A	ENST00000274673.3	-	7	857	c.454C>T	c.(454-456)Ccc>Tcc	p.P152S	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	152								p.P152S(1)									TCAGCATAGGGCCAGCAGAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											95.0	87.0	89.0					6																	4070003		2203	4300	6503	4015002	SO:0001583	missense	222826			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.454C>T	6.37:g.4070003G>A	ENSP00000274673:p.Pro152Ser		4015002	Q5JYK1	Missense_Mutation	SNP	-	p.P152S	ENST00000274673.3	37	c.454	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	G	9.148	1.015640	0.19355	.	.	ENSG00000145975	ENST00000274673;ENST00000470599	T	0.26660	1.72	5.64	3.88	0.44766	.	0.179687	0.37348	N	0.002134	T	0.08447	0.0210	N	0.20986	0.625	0.30120	N	0.805789	B	0.29301	0.241	B	0.35971	0.215	T	0.12091	-1.0561	10	0.87932	D	0	-9.4794	8.4504	0.32866	0.1721:0.0:0.8279:0.0	.	152	Q8IXS0	CF146_HUMAN	S	152;280	ENSP00000274673:P152S	ENSP00000274673:P152S	P	-	1	0	C6orf146	4015002	0.996000	0.38824	0.992000	0.48379	0.403000	0.30841	0.293000	0.19029	0.949000	0.37715	-0.143000	0.13931	CCC	-	NULL		0.403	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf146	protein_coding	OTTHUMT00000352577.2	G	NM_173563		4015002	-1	no_errors	NM_173563	genbank	human	predicted	54_36p	missense	SNP	1	A
TULP1	7287	genome.wustl.edu	37	6	35477519	35477519	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr6:35477519C>G	ENST00000229771.6	-	7	689	c.610G>C	c.(610-612)Gag>Cag	p.E204Q	TULP1_ENST00000322263.4_Missense_Mutation_p.E151Q	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	204					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E204Q(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						TTGTCGGCCTCCCCAGACCCT	0.597																																					GBM(55;1027 1091 11115 23439)											1	Substitution - Missense(1)	ovary(1)	6											117.0	116.0	116.0					6																	35477519		2203	4300	6503	35585497	SO:0001583	missense	7287			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.610G>C	6.37:g.35477519C>G	ENSP00000229771:p.Glu204Gln		35585497	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	-	p.E204Q	ENST00000229771.6	37	c.610	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047308	0.75846	.	.	ENSG00000112041	ENST00000229771;ENST00000322263;ENST00000545327;ENST00000428978	D;D;T	0.82984	-1.67;-1.6;-0.18	4.16	4.16	0.48862	.	0.389460	0.23760	N	0.044821	D	0.83783	0.5329	L	0.59436	1.845	0.41873	D	0.990286	D;D	0.69078	0.993;0.997	D;P	0.63033	0.91;0.815	D	0.83619	0.0138	10	0.42905	T	0.14	-29.3315	11.8129	0.52194	0.0:1.0:0.0:0.0	.	151;204	O00294-2;O00294	.;TULP1_HUMAN	Q	204;151;151;156	ENSP00000229771:E204Q;ENSP00000319414:E151Q;ENSP00000406765:E156Q	ENSP00000229771:E204Q	E	-	1	0	TULP1	35585497	0.723000	0.28027	0.803000	0.32268	0.042000	0.13812	2.732000	0.47352	2.151000	0.67156	0.462000	0.41574	GAG	-	NULL		0.597	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	protein_coding	OTTHUMT00000040307.2	C			35585497	-1	no_errors	NM_003322	genbank	human	reviewed	54_36p	missense	SNP	0.9	G
PNISR	25957	genome.wustl.edu	37	6	99857075	99857075	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr6:99857075delG	ENST00000369239.5	-	6	851	c.647delC	c.(646-648)cctfs	p.P216fs	PNISR_ENST00000466057.1_5'Flank|PNISR_ENST00000438806.1_Frame_Shift_Del_p.P216fs	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	216	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P216fs*2(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						CTGCTTCACAGGAAGTGCAAT	0.443																																																1	Deletion - Frameshift(1)	ovary(1)	6											87.0	83.0	84.0					6																	99857075		2203	4300	6503	99963796	SO:0001589	frameshift_variant	25957			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.647delC	6.37:g.99857075delG	ENSP00000358242:p.Pro216fs		99963796	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Frame_Shift_Del	DEL	-	p.P216fs	ENST00000369239.5	37	c.647	CCDS5043.1	6																																																																																			(deletion:cds_exon[99963770;99963941])	NULL		0.443	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRS18	protein_coding	OTTHUMT00000041598.1	G	NM_032870		99963796	-1	no_errors	NM_015491	genbank	human	validated	54_36p	frame_shift_del	DEL	1	-
BCLAF1	9774	genome.wustl.edu	37	6	136597310	136597310	+	Missense_Mutation	SNP	A	A	T	rs369686402		TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr6:136597310A>T	ENST00000531224.1	-	5	1605	c.1353T>A	c.(1351-1353)gaT>gaA	p.D451E	BCLAF1_ENST00000527536.1_Missense_Mutation_p.D451E|BCLAF1_ENST00000527759.1_Missense_Mutation_p.D449E|BCLAF1_ENST00000392348.2_Missense_Mutation_p.D449E|BCLAF1_ENST00000353331.4_Missense_Mutation_p.D449E|BCLAF1_ENST00000530767.1_Intron	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	451					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.D451E(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTCTAAATCCATCACTTTCTC	0.363																																					Colon(142;1534 1789 5427 7063 28491)											1	Substitution - Missense(1)	ovary(1)	6											142.0	144.0	143.0					6																	136597310		2203	4300	6503	136639003	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1353T>A	6.37:g.136597310A>T	ENSP00000435210:p.Asp451Glu		136639003	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	-	p.D451E	ENST00000531224.1	37	c.1353	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	A	0.968	-0.700945	0.03255	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57;2.57	5.21	2.63	0.31362	.	0.087906	0.49305	D	0.000154	T	0.01124	0.0037	N	0.02916	-0.46	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.45338	-0.9268	10	0.05525	T	0.97	-11.4404	5.5787	0.17238	0.6179:0.0:0.076:0.3061	.	449;449;451	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	E	451;449;451;449;449;451	ENSP00000435210:D451E;ENSP00000229446:D449E;ENSP00000435441:D451E;ENSP00000434826:D449E;ENSP00000376159:D449E;ENSP00000431734:D451E	ENSP00000229446:D449E	D	-	3	2	BCLAF1	136639003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.073000	0.41519	0.935000	0.37341	0.524000	0.50904	GAT	-	NULL		0.363	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	A	NM_014739		136639003	-1	no_errors	NM_014739	genbank	human	reviewed	54_36p	missense	SNP	1	T
SNX8	29886	genome.wustl.edu	37	7	2304007	2304007	+	Silent	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr7:2304007G>T	ENST00000222990.3	-	6	750	c.708C>A	c.(706-708)cgC>cgA	p.R236R		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	236					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.R236R(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CGGCCCTGTCGCGAAGCTTGT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	7											81.0	72.0	75.0					7																	2304007		2203	4300	6503	2270533	SO:0001819	synonymous_variant	29886			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.708C>A	7.37:g.2304007G>T			2270533	A4D207|Q96I67	Silent	SNP	HMMPfam_PX,superfamily_PX domain	p.R236	ENST00000222990.3	37	c.708	CCDS5331.1	7																																																																																			-	NULL		0.552	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	protein_coding	OTTHUMT00000322949.2	G			2270533	-1	no_errors	NM_013321	genbank	human	provisional	54_36p	silent	SNP	0.964	T
FIGNL1	63979	genome.wustl.edu	37	7	50514775	50514775	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr7:50514775C>A	ENST00000419119.1	-	2	1764	c.211G>T	c.(211-213)Gat>Tat	p.D71Y	FIGNL1_ENST00000433017.1_Missense_Mutation_p.D71Y|FIGNL1_ENST00000435566.1_Intron|FIGNL1_ENST00000395556.2_Missense_Mutation_p.D71Y|FIGNL1_ENST00000356889.4_Missense_Mutation_p.D71Y			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	71					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.D71Y(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TTGTCAGAATCAATAATTGCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	82.0	83.0					7																	50514775		2203	4300	6503	50482269	SO:0001583	missense	63979			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.211G>T	7.37:g.50514775C>A	ENSP00000410811:p.Asp71Tyr		50482269	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	-	p.D71Y	ENST00000419119.1	37	c.211	CCDS5510.1	7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045216	0.75846	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119;ENST00000436590;ENST00000422854;ENST00000440350	T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48843	-0.8999	10	0.87932	D	0	-23.2158	19.4655	0.94935	0.0:1.0:0.0:0.0	.	71	Q6PIW4	FIGL1_HUMAN	Y	71	ENSP00000349356:D71Y;ENSP00000378924:D71Y;ENSP00000399997:D71Y;ENSP00000410811:D71Y;ENSP00000394070:D71Y;ENSP00000403012:D71Y;ENSP00000388471:D71Y	ENSP00000349356:D71Y	D	-	1	0	FIGNL1	50482269	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.356000	0.79445	2.680000	0.91292	0.563000	0.77884	GAT	-	NULL		0.368	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FIGNL1	protein_coding	OTTHUMT00000342579.1	C	NM_001042762		50482269	-1	no_errors	NM_001042762	genbank	human	validated	54_36p	missense	SNP	1	A
TMEM248	55069	genome.wustl.edu	37	7	66410186	66410186	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr7:66410186G>T	ENST00000341567.4	+	3	638	c.383G>T	c.(382-384)gGg>gTg	p.G128V		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	128						integral component of membrane (GO:0016021)		p.G128V(1)									CCCTTCGGAGGGTATTCCCGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											98.0	96.0	96.0					7																	66410186		2203	4300	6503	66047621	SO:0001583	missense	55069				CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.383G>T	7.37:g.66410186G>T	ENSP00000340668:p.Gly128Val		66047621	Q53H07|Q96FR2	Missense_Mutation	SNP	-	p.G128V	ENST00000341567.4	37	c.383	CCDS5536.1	7	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629738	0.87660	.	.	ENSG00000106609	ENST00000341567;ENST00000424964	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.67353	0.2884	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	D	0.64776	0.929	T	0.69038	-0.5251	9	0.72032	D	0.01	-5.0415	19.0145	0.92888	0.0:0.0:1.0:0.0	.	128	Q9NWD8	CG042_HUMAN	V	128	.	ENSP00000340668:G128V	G	+	2	0	C7orf42	66047621	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	9.394000	0.97261	2.735000	0.93741	0.655000	0.94253	GGG	-	NULL		0.567	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf42	protein_coding	OTTHUMT00000251745.2	G	NM_017994		66047621	1	no_errors	NM_017994	genbank	human	validated	54_36p	missense	SNP	1	T
HEPACAM2	253012	genome.wustl.edu	37	7	92844715	92844715	+	Splice_Site	SNP	A	A	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr7:92844715A>T	ENST00000394468.2	-	3	791	c.714T>A	c.(712-714)taT>taA	p.Y238*	HEPACAM2_ENST00000341723.4_Splice_Site_p.Y226*|HEPACAM2_ENST00000440868.1_Splice_Site_p.Y226*|HEPACAM2_ENST00000453812.2_Splice_Site_p.Y261*	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	238	Ig-like C2-type 2.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.Y226*(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TAAACTTACAATATATGATGG	0.358																																																1	Substitution - Nonsense(1)	ovary(1)	7											70.0	69.0	69.0					7																	92844715		2203	4300	6503	92682651	SO:0001630	splice_region_variant	253012			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.715+1T>A	7.37:g.92844715A>T			92682651	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Nonsense_Mutation	SNP	-	p.Y238*	ENST00000394468.2	37	c.714	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	A	28.8	4.950620	0.92660	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	.	.	.	5.07	-3.61	0.04556	.	0.170513	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-12.8736	13.4712	0.61283	0.4715:0.0:0.5285:0.0	.	.	.	.	X	238;226;226;261	.	ENSP00000340532:Y226X	Y	-	3	2	HEPACAM2	92682651	0.966000	0.33281	0.973000	0.42090	0.957000	0.61999	0.096000	0.15147	-0.484000	0.06763	0.482000	0.46254	TAT	-	NULL		0.358	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	protein_coding	OTTHUMT00000254651.1	A	NM_198151	Nonsense_Mutation	92682651	-1	no_errors	NM_001039372	genbank	human	provisional	54_36p	nonsense	SNP	0.97	T
ANKS6	203286	genome.wustl.edu	37	9	101552872	101552872	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr9:101552872C>G	ENST00000353234.4	-	2	423	c.376G>C	c.(376-378)Gtg>Ctg	p.V126L	ANKS6_ENST00000471846.1_5'UTR|ANKS6_ENST00000375019.2_Intron|ANKS6_ENST00000540940.1_5'UTR|ANKS6_ENST00000375018.1_Missense_Mutation_p.V126L			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	126						cilium (GO:0005929)|cytoplasm (GO:0005737)		p.V126L(1)		endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				AGGTGTGCCACACTCACATGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											31.0	34.0	33.0					9																	101552872		2102	4217	6319	100592693	SO:0001583	missense	203286			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.376G>C	9.37:g.101552872C>G	ENSP00000297837:p.Val126Leu		100592693	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	-	p.V126L	ENST00000353234.4	37	c.376	CCDS43856.1	9	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349980	0.41599	.	.	ENSG00000165138	ENST00000375018;ENST00000353234	T;T	0.63580	-0.05;-0.05	5.67	5.67	0.87782	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	L	0.37850	1.14	0.80722	D	1	P	0.38110	0.618	B	0.33750	0.169	T	0.58261	-0.7667	10	0.56958	D	0.05	-28.2508	17.2762	0.87116	0.0:1.0:0.0:0.0	.	126	Q68DC2	ANKS6_HUMAN	L	126	ENSP00000364158:V126L;ENSP00000297837:V126L	ENSP00000297837:V126L	V	-	1	0	ANKS6	100592693	1.000000	0.71417	0.960000	0.40013	0.013000	0.08279	5.546000	0.67243	2.677000	0.91161	0.561000	0.74099	GTG	-	NULL		0.557	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKS6	protein_coding	OTTHUMT00000277053.1	C	NM_173551		100592693	-1	no_errors	NM_173551	genbank	human	provisional	54_36p	missense	SNP	1	G
COL27A1	85301	genome.wustl.edu	37	9	117070033	117070033	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr9:117070033G>T	ENST00000356083.3	+	59	5583	c.5192G>T	c.(5191-5193)tGt>tTt	p.C1731F		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1731	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.C1731F(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGACAGACGTGTCTCAAGCCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	9											210.0	155.0	174.0					9																	117070033		2203	4300	6503	116109854	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.5192G>T	9.37:g.117070033G>T	ENSP00000348385:p.Cys1731Phe		116109854	Q66K43|Q96JF7	Missense_Mutation	SNP	-	p.C1731F	ENST00000356083.3	37	c.5192	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	G	19.35	3.809832	0.70797	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.88046	-2.33	5.6	5.6	0.85130	Fibrillar collagen, C-terminal (3);	.	.	.	.	D	0.95443	0.8520	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.97110	1.0;0.947	D	0.96223	0.9162	9	0.66056	D	0.02	.	17.1167	0.86690	0.0:0.0:1.0:0.0	.	46;1731	Q9HAA3;Q8IZC6	.;CORA1_HUMAN	F	1731;1738	ENSP00000348385:C1731F	ENSP00000348385:C1731F	C	+	2	0	COL27A1	116109854	1.000000	0.71417	0.987000	0.45799	0.958000	0.62258	9.869000	0.99810	2.648000	0.89879	0.561000	0.74099	TGT	-	NULL		0.612	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	protein_coding	OTTHUMT00000053763.1	G	NM_032888		116109854	1	no_errors	NM_032888	genbank	human	provisional	54_36p	missense	SNP	1	T
IFNA5	3442	genome.wustl.edu	37	9	21304927	21304927	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr9:21304927G>C	ENST00000259555.4	-	1	385	c.329C>G	c.(328-330)aCt>aGt	p.T110S		NM_002169.2	NP_002160.1	P01569	IFNA5_HUMAN	interferon, alpha 5	110					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)	p.T110S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				Lung(24;2.34e-24)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GTAAAGTTCAGTGTAGAATTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	9											120.0	116.0	117.0					9																	21304927		2203	4300	6503	21294927	SO:0001583	missense	3442				CCDS6502.1	9p22	2010-08-24			ENSG00000147873	ENSG00000147873		"""Interferons"""	5426	protein-coding gene	gene with protein product		147565				1385305	Standard	NM_002169		Approved	IFN-alphaG	uc011lnh.2	P01569	OTTHUMG00000019664	ENST00000259555.4:c.329C>G	9.37:g.21304927G>C	ENSP00000259555:p.Thr110Ser		21294927	Q52LX3	Missense_Mutation	SNP	-	p.T110S	ENST00000259555.4	37	c.329	CCDS6502.1	9	.	.	.	.	.	.	.	.	.	.	G	5.422	0.263030	0.10294	.	.	ENSG00000147873	ENST00000259555	T	0.03496	3.91	4.16	-4.13	0.03904	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.767710	0.02814	N	0.124715	T	0.03959	0.0111	L	0.45228	1.405	0.09310	N	1	B	0.09022	0.002	B	0.23419	0.046	T	0.45160	-0.9280	10	0.32370	T	0.25	.	3.3838	0.07264	0.0877:0.3601:0.2956:0.2566	.	110	P01569	IFNA5_HUMAN	S	110	ENSP00000259555:T110S	ENSP00000259555:T110S	T	-	2	0	IFNA5	21294927	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.439000	0.06897	-0.339000	0.08401	0.537000	0.68136	ACT	-	NULL		0.468	IFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA5	protein_coding	OTTHUMT00000051893.1	G	NM_002169		21294927	-1	no_errors	NM_002169	genbank	human	provisional	54_36p	missense	SNP		C
SPATA31E1	286234	genome.wustl.edu	37	9	90503023	90503023	+	Silent	SNP	C	C	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr9:90503023C>T	ENST00000325643.5	+	4	3687	c.3621C>T	c.(3619-3621)caC>caT	p.H1207H		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1207					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.H1207H(1)									GCGAGGCCCACAGGAGGCCCA	0.647																																																1	Substitution - coding silent(1)	ovary(1)	9											12.0	11.0	12.0					9																	90503023		2191	4276	6467	89692843	SO:0001819	synonymous_variant	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3621C>T	9.37:g.90503023C>T			89692843	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	-	p.H1207	ENST00000325643.5	37	c.3621	CCDS6676.1	9																																																																																			-	NULL		0.647	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf79	protein_coding	OTTHUMT00000052954.2	C	NM_178828		89692843	1	no_errors	NM_178828	genbank	human	validated	54_36p	silent	SNP	0	T
AKNA	80709	genome.wustl.edu	37	9	117139410	117139410	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chr9:117139410G>C	ENST00000307564.4	-	3	838	c.677C>G	c.(676-678)cCc>cGc	p.P226R	AKNA_ENST00000374075.5_Missense_Mutation_p.P145R|AKNA_ENST00000312033.3_Missense_Mutation_p.P226R|AKNA_ENST00000374088.3_Missense_Mutation_p.P226R|AKNA_ENST00000223791.3_5'Flank	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	226					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P226R(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						AGTGGGCTGGGGGCCATCGGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											58.0	52.0	54.0					9																	117139410		2203	4300	6503	116179231	SO:0001583	missense	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.677C>G	9.37:g.117139410G>C	ENSP00000303769:p.Pro226Arg		116179231	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	-	p.P226R	ENST00000307564.4	37	c.677	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	G	5.569	0.289887	0.10567	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.57273	1.69;1.69;1.7;0.41	4.49	2.25	0.28309	.	0.000000	0.39834	N	0.001243	T	0.43211	0.1237	L	0.29908	0.895	0.09310	N	0.999995	P;P;P	0.41131	0.739;0.622;0.739	P;B;B	0.47705	0.555;0.18;0.334	T	0.25467	-1.0131	10	0.62326	D	0.03	-15.6933	4.4732	0.11722	0.1171:0.0:0.6074:0.2755	.	226;226;145	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	R	226;226;145;226;226	ENSP00000303769:P226R;ENSP00000363201:P226R;ENSP00000363188:P145R;ENSP00000309222:P226R	ENSP00000303769:P226R	P	-	2	0	AKNA	116179231	0.943000	0.32029	0.021000	0.16686	0.074000	0.17049	1.170000	0.31883	0.990000	0.38787	0.462000	0.41574	CCC	-	NULL		0.632	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	protein_coding	OTTHUMT00000053767.2	G	NM_030767		116179231	-1	no_errors	NM_030767	genbank	human	validated	54_36p	missense	SNP	0.04	C
ZMAT1	84460	genome.wustl.edu	37	X	101152946	101152946	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:101152946G>A	ENST00000372782.3	-	5	447	c.400C>T	c.(400-402)Ctt>Ttt	p.L134F	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.L134F	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	134						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L134F(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGAGCAATAAGTGGAGAGCTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	X											158.0	125.0	136.0					X																	101152946		2203	4300	6503	101039602	SO:0001583	missense	84460			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.400C>T	X.37:g.101152946G>A	ENSP00000361868:p.Leu134Phe		101039602	Q8NDS3|Q96JN6	Missense_Mutation	SNP	HMMPfam_zf-C2H2;HMMPfam_zf-U1;superfamily_C2H2 and C2HC zinc fingers	p.L134F	ENST00000372782.3	37	c.400	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	G	0.746	-0.774439	0.02951	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.22134	1.97;1.97	4.59	-1.44	0.08856	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	1.017460	0.07909	N	0.973892	T	0.11965	0.0291	L	0.27053	0.805	0.21499	N	0.999666	B	0.18166	0.026	B	0.15052	0.012	T	0.33085	-0.9882	10	0.51188	T	0.08	-0.0416	1.3095	0.02094	0.1334:0.3782:0.1667:0.3217	.	134	Q5H9K5	ZMAT1_HUMAN	F	134	ENSP00000361868:L134F;ENSP00000437529:L134F	ENSP00000361868:L134F	L	-	1	0	ZMAT1	101039602	0.015000	0.18098	0.014000	0.15608	0.001000	0.01503	-0.684000	0.05173	-0.760000	0.04677	-2.445000	0.00210	CTT	-	HMMPfam_zf-U1		0.393	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	protein_coding	OTTHUMT00000057598.1	G			101039602	-1	no_errors	NM_001011657	genbank	human	validated	54_36p	missense	SNP	0.99	A
ZNF182	7569	genome.wustl.edu	37	X	47836716	47836716	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:47836716G>A	ENST00000396965.1	-	7	1120	c.770C>T	c.(769-771)aCg>aTg	p.T257M	ZNF182_ENST00000376943.3_Missense_Mutation_p.T238M|ZNF182_ENST00000305127.6_Missense_Mutation_p.T257M	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	257					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T257M(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TTTCTCTCCCGTATGAGTTCT	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	72.0	72.0					X																	47836716		2203	4300	6503	47721660	SO:0001583	missense	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.770C>T	X.37:g.47836716G>A	ENSP00000380165:p.Thr257Met		47721660	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers;HMMPfam_KRAB	p.T257M	ENST00000396965.1	37	c.770	CCDS35236.1	X	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533754	0.45073	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.18810	2.19;2.19;2.19	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47783	0.1464	M	0.80422	2.495	0.33233	D	0.556232	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.99;0.991;0.975	T	0.64296	-0.6441	9	0.87932	D	0	.	13.3752	0.60734	0.0:0.0:1.0:0.0	.	237;238;257	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	M	238;257;257	ENSP00000366142:T238M;ENSP00000380165:T257M;ENSP00000306351:T257M	ENSP00000306351:T257M	T	-	2	0	ZNF182	47721660	0.997000	0.39634	0.977000	0.42913	0.910000	0.53928	2.347000	0.44036	2.110000	0.64415	0.594000	0.82650	ACG	-	NULL		0.403	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	protein_coding	OTTHUMT00000277055.1	G	NM_006962		47721660	-1	no_errors	NM_006962	genbank	human	validated	54_36p	missense	SNP	0.99	A
ZC4H2	55906	genome.wustl.edu	37	X	64141803	64141803	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:64141803G>A	ENST00000374839.3	-	2	225	c.119C>T	c.(118-120)tCa>tTa	p.S40L	ZC4H2_ENST00000447788.2_Missense_Mutation_p.S40L|ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000545618.1_Missense_Mutation_p.S35L|ZC4H2_ENST00000337990.2_Missense_Mutation_p.S17L	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	40					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)	p.S40*(2)|p.S40L(1)		endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CCTTTCCTCTGACTCAAGTGC	0.507																																																3	Substitution - Nonsense(2)|Substitution - Missense(1)	lung(2)|ovary(1)	X											158.0	107.0	124.0					X																	64141803		2203	4300	6503	64058528	SO:0001583	missense	55906			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.119C>T	X.37:g.64141803G>A	ENSP00000363972:p.Ser40Leu		64058528	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	-	p.S40L	ENST00000374839.3	37	c.119	CCDS14380.1	X	.	.	.	.	.	.	.	.	.	.	G	15.03	2.710967	0.48517	.	.	ENSG00000126970	ENST00000447788;ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.48	4.56	0.56223	.	0.060317	0.64402	D	0.000002	T	0.32164	0.0820	N	0.08118	0	0.54753	D	0.999984	B;B	0.27882	0.192;0.126	B;B	0.29077	0.098;0.042	T	0.16158	-1.0412	9	0.29301	T	0.29	.	12.5338	0.56131	0.0:0.1647:0.8353:0.0	.	40;40	B4DED0;Q9NQZ6	.;ZC4H2_HUMAN	L	40;35;40;17	.	ENSP00000338650:S17L	S	-	2	0	ZC4H2	64058528	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.166000	0.64965	2.436000	0.82500	0.600000	0.82982	TCA	-	NULL		0.507	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC4H2	protein_coding	OTTHUMT00000056958.1	G	NM_018684		64058528	-1	no_errors	NM_018684	genbank	human	provisional	54_36p	missense	SNP	1	A
DGAT2L6	347516	genome.wustl.edu	37	X	69421817	69421817	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:69421817G>T	ENST00000333026.3	+	5	650	c.550G>T	c.(550-552)Gtg>Ttg	p.V184L		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	184					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)	p.V184L(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						GGTTATTGTGGTGGGTGGAGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	88.0	95.0					X																	69421817		2203	4300	6503	69338542	SO:0001583	missense	347516			AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.550G>T	X.37:g.69421817G>T	ENSP00000328036:p.Val184Leu		69338542	Q6IEE2	Missense_Mutation	SNP	-	p.V184L	ENST00000333026.3	37	c.550	CCDS14397.1	X	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453145	0.63290	.	.	ENSG00000184210	ENST00000333026	T	0.16073	2.37	4.51	3.62	0.41486	.	0.302194	0.27567	N	0.018793	T	0.30324	0.0761	M	0.66506	2.035	0.33933	D	0.642297	P	0.39216	0.664	P	0.49922	0.626	T	0.46638	-0.9177	10	0.66056	D	0.02	-21.6203	11.1799	0.48623	0.0:0.1895:0.8105:0.0	.	184	Q6ZPD8	DG2L6_HUMAN	L	184	ENSP00000328036:V184L	ENSP00000328036:V184L	V	+	1	0	DGAT2L6	69338542	0.985000	0.35326	0.959000	0.39883	0.897000	0.52465	1.725000	0.38074	0.997000	0.38969	0.594000	0.82650	GTG	-	NULL		0.532	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2L6	protein_coding	OTTHUMT00000057067.1	G	NM_198512		69338542	1	no_errors	NM_198512	genbank	human	provisional	54_36p	missense	SNP	1	T
PABPC5	140886	genome.wustl.edu	37	X	90691013	90691013	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:90691013G>C	ENST00000312600.3	+	2	651	c.437G>C	c.(436-438)gGt>gCt	p.G146A	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	146	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G146A(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						GGCTCTAAGGGTTATGCCTAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											80.0	70.0	73.0					X																	90691013		2203	4300	6503	90577669	SO:0001583	missense	140886			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.437G>C	X.37:g.90691013G>C	ENSP00000308012:p.Gly146Ala		90577669	A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.G146A	ENST00000312600.3	37	c.437	CCDS14460.1	X	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695323	0.68386	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.27256	1.68	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75522	-0.3288	10	0.87932	D	0	.	13.8905	0.63736	0.0:0.0:1.0:0.0	.	146	Q96DU9	PABP5_HUMAN	A	146;114	ENSP00000308012:G146A	ENSP00000308012:G146A	G	+	2	0	PABPC5	90577669	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.429000	0.80309	2.450000	0.82876	0.600000	0.82982	GGT	-	HMMPfam_RRM_1		0.488	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC5	protein_coding	OTTHUMT00000057429.1	G	NM_080832		90577669	1	no_errors	NM_080832	genbank	human	validated	54_36p	missense	SNP	1	C
UTP14A	10813	genome.wustl.edu	37	X	129041340	129041340	+	Intron	SNP	C	C	G			TCGA-23-1123-01A-01W-0488-09	TCGA-23-1123-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	22cfe2c8-5e1f-4b64-854d-2a7a02bf10fe	378b119a-44b0-468e-9270-a6247a96a77a	g.chrX:129041340C>G	ENST00000394422.3	+	2	54				UTP14A_ENST00000425117.2_Intron|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.?(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						CCTCTTTTAACAGCCTTCTGG	0.378																																																1	Unknown(1)	ovary(1)	X											70.0	60.0	63.0					X																	129041340		2203	4300	6503	128869021	SO:0001627	intron_variant	10813			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.27-3C>G	X.37:g.129041340C>G			128869021	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Splice_Site	SNP	-	e2-1	ENST00000394422.3	37	c.25-1	CCDS14615.1	X																																																																																			-	-		0.378	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	protein_coding	OTTHUMT00000058221.1	C	NM_006649		128869021	1	no_start_codon	ENST00000394422	ensembl	human	known	54_36p	splice_site	SNP	0.99	G
