#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								5823	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A			5823		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210140			G			5823	-1	no_errors	ENST00000387405	ensembl	human	novel	54_36p	rna	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chrUnknown:0C>T								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113889																																								39903	SO:0001628	intergenic_variant	0																															Unknown.37:g.0C>T			39903		Silent	SNP	HMMPfam_Tektin	p.M138		37	c.414		NT_113889																																																																																			-	HMMPfam_Tektin	0	0					ENSG00000215615			C			39903	-1	no_stop_codon	ENST00000400681	ensembl	human	known	54_36p	silent	SNP	NULL	T
BAIAP3	8938	genome.wustl.edu	37	16	1388909	1388909	+	Silent	SNP	C	C	T	rs77633104	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr16:1388909C>T	ENST00000324385.5	+	3	401	c.243C>T	c.(241-243)ccC>ccT	p.P81P	BAIAP3_ENST00000568887.1_Silent_p.P46P|BAIAP3_ENST00000426824.3_Silent_p.P46P|BAIAP3_ENST00000421665.2_Silent_p.P46P|BAIAP3_ENST00000562208.1_Silent_p.P46P|BAIAP3_ENST00000397488.2_Silent_p.P46P|BAIAP3_ENST00000397489.1_Silent_p.P46P	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	81					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCAGGAAACCCGGGGATGGCG	0.647													C|||	207	0.0413339	0.0908	0.0259	5008	,	,		17156	0.0		0.0179	False		,,,				2504	0.0521															0			16						C	,,,,	417,3981	202.8+/-225.5	15,387,1797	81.0	87.0	85.0		138,138,138,138,243	-8.1	0.1	16	dbSNP_132	85	131,8469	67.0+/-129.4	0,131,4169	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BAIAP3	NM_001199096.1,NM_001199097.1,NM_001199098.1,NM_001199099.1,NM_003933.4	,,,,	15,518,5966	TT,TC,CC		1.5233,9.4816,4.216	,,,,	46/1117,46/1153,46/1130,46/1125,81/1188	1388909	548,12450	2199	4300	6499	1328910	SO:0001819	synonymous_variant	8938			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.243C>T	16.37:g.1388909C>T			1328910	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.P81	ENST00000324385.5	37	c.243	CCDS10434.1	16																																																																																			-	NULL		0.647	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	protein_coding	OTTHUMT00000109056.3	C			1328910	+1	no_errors	NM_003933	genbank	human	reviewed	54_36p	silent	SNP	0.013	T
MAD1L1	8379	genome.wustl.edu	37	7	2260551	2260551	+	Intron	SNP	G	G	A	rs114013751	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr7:2260551G>A	ENST00000406869.1	-	6	1029				MAD1L1_ENST00000399654.2_Intron|MAD1L1_ENST00000265854.7_Intron|MAD1L1_ENST00000402746.1_Missense_Mutation_p.R55W			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		ATGCAGGGCCGAGCCCACCTG	0.527													G|||	283	0.0565096	0.1762	0.0101	5008	,	,		19745	0.0		0.0	False		,,,				2504	0.044															0			7						G	,,	271,1481		14,243,619	28.0	26.0	27.0		,,	-4.0	0.0	7	dbSNP_132	27	7,3975		0,7,1984	no	intron,intron,intron	MAD1L1	NM_001013836.1,NM_001013837.1,NM_003550.2	,,	14,250,2603	AA,AG,GG		0.1758,15.468,4.8483	,,	,,	2260551	278,5456	876	1991	2867	2227077	SO:0001627	intron_variant	8379			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.472-1460C>T	7.37:g.2260551G>A			2227077	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	HMMPfam_MAD	p.R55W	ENST00000406869.1	37	c.163	CCDS43539.1	7	72	0.03296703296703297	66	0.13414634146341464	6	0.016574585635359115	0	0.0	0	0.0	G	13.10	2.137326	0.37728	0.15468	0.001758	ENSG00000002822	ENST00000402746	T	0.29655	1.56	2.01	-4.02	0.04034	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31530	-0.9940	7	0.87932	D	0	.	0.2949	0.00264	0.3484:0.1969:0.2584:0.1963	.	55	B3KR41	.	W	55	ENSP00000384155:R55W	ENSP00000384155:R55W	R	-	1	2	MAD1L1	2227077	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.307000	0.19296	-1.121000	0.02949	-1.092000	0.02172	CGG	-	HMMPfam_MAD		0.527	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAD1L1	protein_coding	OTTHUMT00000322871.1	G	NM_003550		2227077	-1	no_errors	ENST00000402746	ensembl	human	known	54_36p	missense	SNP	0.001	A
SIGLEC1	6614	genome.wustl.edu	37	20	3674875	3674875	+	Silent	SNP	G	G	A	rs79525664	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr20:3674875G>A	ENST00000344754.4	-	12	3248	c.3249C>T	c.(3247-3249)gaC>gaT	p.D1083D	SIGLEC1_ENST00000202578.4_Silent_p.D1083D	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1083	Ig-like C2-type 10.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GACCTTGAGCGTCGAAGTCAG	0.572													G|||	32	0.00638978	0.0212	0.0014	5008	,	,		14821	0.003		0.0	False		,,,				2504	0.0															0			20						G		55,4295		1,53,2121	55.0	45.0	49.0		3249	-1.1	0.7	20	dbSNP_132	49	4,8414		0,4,4205	no	coding-synonymous	SIGLEC1	NM_023068.3		1,57,6326	AA,AG,GG		0.0475,1.2644,0.4621		1083/1710	3674875	59,12709	2175	4209	6384	3622875	SO:0001819	synonymous_variant	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3249C>T	20.37:g.3674875G>A			3622875	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_C2-set_2,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set	p.D1083	ENST00000344754.4	37	c.3249	CCDS13060.1	20																																																																																			-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.572	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	protein_coding	OTTHUMT00000077761.2	G	NM_023068		3622875	-1	no_errors	NM_023068	genbank	human	reviewed	54_36p	silent	SNP	0.778	A
NBEAP3	100418905	genome.wustl.edu	37	22	16123346	16123346	+	IGR	SNP	C	C	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr22:16123346C>A								LA16c-4G1.3 (60110 upstream) : AP000525.9 (24632 downstream)																							AGCCCACTACCTCCAGAGCAT	0.622																																																0			22																																								14503346	SO:0001628	intergenic_variant	729057																															22.37:g.16123346C>A			14503346		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.622					LOC729057			C			14503346	+1	no_errors	XR_042044	genbank	human	model	54_36p	rna	SNP	1.000	A
FLCN	201163	genome.wustl.edu	37	17	17125975	17125975	+	Splice_Site	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr17:17125975C>T	ENST00000285071.4	-	7	1073	c.619G>A	c.(619-621)Gtg>Atg	p.V207M	RP11-45M22.4_ENST00000427497.3_Intron|FLCN_ENST00000389169.5_Splice_Site_p.V207M	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	207					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCCTCAAACACCTGAAATGCA	0.582									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																																							0			17											111.0	85.0	94.0					17																	17125975		2203	4300	6503	17066700	SO:0001630	splice_region_variant	201163	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.619-1G>A	17.37:g.17125975C>T			17066700	A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Missense_Mutation	SNP	NULL	p.V207M	ENST00000285071.4	37	c.619	CCDS32579.1	17	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970070	0.92855	.	.	ENSG00000154803	ENST00000285071;ENST00000389169	D;D	0.89270	-2.49;-2.49	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.94437	0.8210	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.92897	0.6336	10	0.33141	T	0.24	-33.1454	19.5045	0.95110	0.0:1.0:0.0:0.0	.	207;207	Q8NFG4-2;Q8NFG4	.;FLCN_HUMAN	M	207	ENSP00000285071:V207M;ENSP00000373821:V207M	ENSP00000285071:V207M	V	-	1	0	FLCN	17066700	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.017000	0.76399	2.623000	0.88846	0.462000	0.41574	GTG	-	NULL		0.582	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLCN	protein_coding	OTTHUMT00000131577.1	C	NM_144606	Missense_Mutation	17066700	-1	no_errors	NM_144997	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FEM1AP4	729524	genome.wustl.edu	37	13	19240868	19240868	+	IGR	SNP	T	T	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr13:19240868T>G								LINC00388 (55053 upstream) : LINC00387 (6098 downstream)																							CCACCTGCTCTACCTGCTGGA	0.617																																																0			13																																								18138868	SO:0001628	intergenic_variant	729524																															13.37:g.19240868T>G			18138868		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.617					LOC729524			T			18138868	+1	pseudogene	XR_015575	genbank	human	model	54_36p	rna	SNP	1.000	G
OR4N2	390429	genome.wustl.edu	37	14	20296116	20296116	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr14:20296116G>A	ENST00000315947.1	+	1	509	c.509G>A	c.(508-510)gGc>gAc	p.G170D	OR4N2_ENST00000568211.1_Missense_Mutation_p.G170D	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTTTTTGTGGCCCAAACCAG	0.517																																																0			14											127.0	134.0	132.0					14																	20296116		2203	4297	6500	19365956	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.509G>A	14.37:g.20296116G>A	ENSP00000319601:p.Gly170Asp		19365956	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G170D	ENST00000315947.1	37	c.509	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	19.08	3.758058	0.69648	.	.	ENSG00000176294	ENST00000315947	T	0.38887	1.11	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.126944	0.36167	N	0.002759	T	0.66848	0.2831	M	0.82630	2.6	0.30102	N	0.807326	D	0.89917	1.0	D	0.97110	1.0	T	0.68819	-0.5308	10	0.87932	D	0	-7.0683	15.0916	0.72198	0.0:0.0:1.0:0.0	.	170	Q8NGD1	OR4N2_HUMAN	D	170	ENSP00000319601:G170D	ENSP00000319601:G170D	G	+	2	0	OR4N2	19365956	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.917000	0.56424	2.483000	0.83821	0.585000	0.79938	GGC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.517	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	protein_coding	OTTHUMT00000409821.2	G			19365956	+1	no_errors	NM_001004723	genbank	human	provisional	54_36p	missense	SNP	0.273	A
LRRC74B	400891	genome.wustl.edu	37	22	21402372	21402372	+	Missense_Mutation	SNP	G	G	A	rs77133550	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr22:21402372G>A	ENST00000543388.1	+	3	488	c.482G>A	c.(481-483)cGt>cAt	p.R161H	AC002472.13_ENST00000342608.4_Intron|AC002472.13_ENST00000497328.1_3'UTR																lung(2)	2						TGCCTCCATCGTTGAAAGCTG	0.617													g|||	202	0.0403355	0.1112	0.0086	5008	,	,		15888	0.0		0.0159	False		,,,				2504	0.0337															0			22																																								19732372	SO:0001583	missense	0																														ENST00000543388.1:c.482G>A	22.37:g.21402372G>A	ENSP00000441009:p.Arg161His		19732372		Missense_Mutation	SNP	superfamily_SSF52047	p.R161H	ENST00000543388.1	37	c.482		22	66	0.03021978021978022	52	0.10569105691056911	4	0.011049723756906077	0	0.0	10	0.013192612137203167	G	0.040	-1.289230	0.01387	.	.	ENSG00000187905	ENST00000543388	T	0.25749	1.78	0.729	-1.46	0.08800	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21348	-1.0248	5	0.87932	D	0	.	.	.	.	.	.	.	.	H	161	ENSP00000441009:R161H	ENSP00000441009:R161H	R	+	2	0	AC002472.13	19732372	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.212000	0.02994	-2.382000	0.00593	-2.060000	0.00399	CGT	-	NULL		0.617	AC002472.13-202	KNOWN	basic	protein_coding	ENSG00000187905	protein_coding		G			19732372	+1	no_errors	ENST00000342608	ensembl	human	known	54_36p	missense	SNP	0.000	A
TOP3B	8940	genome.wustl.edu	37	22	22324757	22324757	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr22:22324757C>T	ENST00000398793.2	-	6	840	c.406G>A	c.(406-408)Gtc>Atc	p.V136I	TOP3B_ENST00000413067.2_Intron|TOP3B_ENST00000357179.5_Missense_Mutation_p.V136I	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	136	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTGTTCATGACGGGCAGAACA	0.607																																																0			22											67.0	57.0	60.0					22																	22324757		2203	4300	6503	20654757	SO:0001583	missense	8940			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.406G>A	22.37:g.22324757C>T	ENSP00000381773:p.Val136Ile		20654757	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	HMMSmart_SM00493,HMMPfam_Toprim,superfamily_Prokaryotic type I DNA topoisomerase,HMMSmart_SM00436,HMMPfam_Topoisom_bac,HMMSmart_SM00437,PatternScan_TOPOISOMERASE_I_PROK	p.V136I	ENST00000398793.2	37	c.406	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229377	0.39399	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000424393	T;T;T	0.22743	1.94;1.94;1.94	4.87	3.85	0.44370	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.129763	0.52532	N	0.000074	T	0.22627	0.0546	M	0.74467	2.265	0.80722	D	1	B	0.19200	0.034	B	0.16289	0.015	T	0.04767	-1.0928	10	0.16420	T	0.52	.	10.6385	0.45579	0.0:0.845:0.0:0.155	.	136	O95985	TOP3B_HUMAN	I	136	ENSP00000349705:V136I;ENSP00000381773:V136I;ENSP00000390977:V136I	ENSP00000349705:V136I	V	-	1	0	TOP3B	20654757	1.000000	0.71417	0.900000	0.35374	0.684000	0.39900	4.799000	0.62517	1.290000	0.44636	0.561000	0.74099	GTC	-	HMMSmart_SM00493,HMMPfam_Toprim,superfamily_Prokaryotic type I DNA topoisomerase		0.607	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	protein_coding	OTTHUMT00000320251.1	C	NM_003935		20654757	-1	no_errors	NM_003935	genbank	human	reviewed	54_36p	missense	SNP	0.975	T
GGTLC2	91227	genome.wustl.edu	37	22	22989594	22989594	+	Intron	SNP	G	G	T	rs148128345		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr22:22989594G>T	ENST00000480559.1	+	4	360				GGTLC2_ENST00000448514.1_Intron|POM121L1P_ENST00000402027.1_RNA	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2						glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		CTCCCTGGCCGTGCCCACCCT	0.632																																																0			22											83.0	88.0	87.0					22																	22989594		2203	4300	6503	21319594	SO:0001627	intron_variant	91227			X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.361-17G>T	22.37:g.22989594G>T			21319594	A1A516|A2VCM9|Q5NV76|Q6ISH0	Missense_Mutation	SNP	HMMPfam_G_glu_transpept,PatternScan_G_GLU_TRANSPEPTIDASE	p.R149L	ENST00000480559.1	37	c.446	CCDS13802.2	22																																																																																			-	NULL		0.632	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	GGTLC2	protein_coding	OTTHUMT00000321662.1	G	NM_199127		21319594	+1	no_errors	NM_199127	genbank	human	validated	54_36p	missense	SNP	0.001	T
NCAM2	4685	genome.wustl.edu	37	21	22664541	22664541	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr21:22664541A>T	ENST00000400546.1	+	5	848	c.599A>T	c.(598-600)gAt>gTt	p.D200V	NCAM2_ENST00000535285.1_Missense_Mutation_p.D225V|NCAM2_ENST00000284894.7_Missense_Mutation_p.D58V	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	200	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GACTTCCGTGATATCATTGTT	0.338																																																0			21											156.0	156.0	156.0					21																	22664541		1836	4095	5931	21586412	SO:0001583	missense	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.599A>T	21.37:g.22664541A>T	ENSP00000383392:p.Asp200Val		21586412	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.D200V	ENST00000400546.1	37	c.599	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130903	0.56828	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.76316	1.74;-1.01;1.74	5.48	5.48	0.80851	.	0.044202	0.85682	D	0.000000	T	0.81088	0.4750	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.66351	0.931;0.943;0.943	T	0.80970	-0.1144	10	0.41790	T	0.15	-30.0262	14.6778	0.68993	1.0:0.0:0.0:0.0	.	225;58;200	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	V	200;58;225	ENSP00000383392:D200V;ENSP00000284894:D58V;ENSP00000441887:D225V	ENSP00000284894:D58V	D	+	2	0	NCAM2	21586412	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.970000	0.49240	2.206000	0.71126	0.533000	0.62120	GAT	-	superfamily_SSF48726		0.338	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	protein_coding	OTTHUMT00000170915.1	A	NM_004540		21586412	+1	no_errors	NM_004540	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
DSC2	1824	genome.wustl.edu	37	18	28662381	28662381	+	Silent	SNP	T	T	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr18:28662381T>C	ENST00000280904.6	-	9	1529	c.1086A>G	c.(1084-1086)acA>acG	p.T362T	DSC2_ENST00000251081.6_Silent_p.T362T	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	362	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CTTCCACTGATGTCACATACT	0.318																																																0			18											69.0	66.0	67.0					18																	28662381		2200	4299	6499	26916379	SO:0001819	synonymous_variant	1824			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1086A>G	18.37:g.28662381T>C			26916379		Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_pro,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1	p.T362	ENST00000280904.6	37	c.1086	CCDS11892.1	18																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.318	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	protein_coding	OTTHUMT00000254943.1	T	NM_004949		26916379	-1	no_errors	NM_024422	genbank	human	reviewed	54_36p	silent	SNP	0.683	C
EMILIN1	11117	genome.wustl.edu	37	2	27306616	27306616	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr2:27306616G>A	ENST00000380320.4	+	4	2676	c.2177G>A	c.(2176-2178)cGa>cAa	p.R726Q	KHK_ENST00000260599.6_5'Flank	NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	726					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAGAGGGGCGATTGGGCCGT	0.647																																																0			2											70.0	76.0	74.0					2																	27306616		2203	4300	6503	27160120	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.2177G>A	2.37:g.27306616G>A	ENSP00000369677:p.Arg726Gln		27160120	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	HMMPfam_EMI,HMMPfam_Collagen,superfamily_TNF_like,HMMPfam_C1q	p.R726Q	ENST00000380320.4	37	c.2177	CCDS1733.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.34|19.34	3.808605|3.808605	0.70797|0.70797	.|.	.|.	ENSG00000138080|ENSG00000138080	ENST00000433140|ENST00000380320;ENST00000544143	.|T	.|0.75477	.|-0.94	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.74959|0.74959	0.3785|0.3785	L|L	0.29908|0.29908	0.895|0.895	0.20196|0.20196	N|N	0.999929|0.999929	.|D	.|0.89917	.|1.0	.|D	.|0.63957	.|0.92	T|T	0.65602|0.65602	-0.6128|-0.6128	5|10	.|0.39692	.|T	.|0.17	-11.0345|-11.0345	10.6237|10.6237	0.45495|0.45495	0.0:0.0:0.8086:0.1914|0.0:0.0:0.8086:0.1914	.|.	.|726	.|Q9Y6C2	.|EMIL1_HUMAN	N|Q	52|726;52	.|ENSP00000369677:R726Q	.|ENSP00000369677:R726Q	D|R	+|+	1|2	0|0	EMILIN1|EMILIN1	27160120|27160120	0.998000|0.998000	0.40836|0.40836	0.304000|0.304000	0.25085|0.25085	0.956000|0.956000	0.61745|0.61745	7.006000|7.006000	0.76329|0.76329	2.539000|2.539000	0.85634|0.85634	0.561000|0.561000	0.74099|0.74099	GAT|CGA	-	NULL		0.647	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN1	protein_coding	OTTHUMT00000214185.1	G	NM_007046		27160120	+1	no_errors	NM_007046	genbank	human	validated	54_36p	missense	SNP	0.826	A
EPHX2	2053	genome.wustl.edu	37	8	27401703	27401703	+	Splice_Site	SNP	A	A	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr8:27401703A>G	ENST00000521400.1	+	18	1961	c.1531A>G	c.(1531-1533)Att>Gtt	p.I511V	EPHX2_ENST00000517536.1_Splice_Site_p.I328V|EPHX2_ENST00000380476.3_Splice_Site_p.I458V|EPHX2_ENST00000518379.1_Splice_Site_p.I479V|EPHX2_ENST00000521780.1_Splice_Site_p.I445V	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	511	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		TTCCTTTCAGATTCCCCACCT	0.572																																																0			8											141.0	133.0	136.0					8																	27401703		2203	4300	6503	27457620	SO:0001630	splice_region_variant	2053			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.1531-1A>G	8.37:g.27401703A>G			27457620	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	HMMPfam_Hydrolase,superfamily_SSF56784,superfamily_SSF53474,HMMPfam_Abhydrolase_1	p.I511V	ENST00000521400.1	37	c.1531	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	A	13.21	2.170290	0.38315	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	4.05	4.05	0.47172	Alpha/beta hydrolase fold-1 (1);	0.102754	0.64402	D	0.000004	T	0.49864	0.1582	N	0.11000	0.08	0.53688	D	0.999974	B;B	0.30889	0.299;0.233	P;B	0.45610	0.487;0.274	T	0.45775	-0.9238	9	.	.	.	-27.6493	9.6845	0.40089	1.0:0.0:0.0:0.0	.	479;511	E5RFU2;P34913	.;HYES_HUMAN	V	511;328;445;458;458;479	ENSP00000430269:I511V;ENSP00000428875:I328V;ENSP00000430302:I445V;ENSP00000369843:I458V;ENSP00000427956:I479V	.	I	+	1	0	EPHX2	27457620	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	4.067000	0.57527	2.061000	0.61500	0.402000	0.26972	ATT	-	superfamily_SSF53474,HMMPfam_Abhydrolase_1		0.572	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	protein_coding	OTTHUMT00000219954.4	A		Missense_Mutation	27457620	+1	no_errors	NM_001979	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ELP3	55140	genome.wustl.edu	37	8	28017873	28017873	+	Missense_Mutation	SNP	G	G	A	rs190129217		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr8:28017873G>A	ENST00000256398.8	+	13	1762	c.1385G>A	c.(1384-1386)cGt>cAt	p.R462H	ELP3_ENST00000542181.1_Missense_Mutation_p.R333H|ELP3_ENST00000537665.1_Missense_Mutation_p.R343H|ELP3_ENST00000521015.1_Missense_Mutation_p.R448H|ELP3_ENST00000380353.4_Missense_Mutation_p.R370H|ELP3_ENST00000524103.1_Missense_Mutation_p.R390H	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	462	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		GAAACTTTCCGTTTCGAATTG	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17499	0.0		0.0	False		,,,				2504	0.0															0			8						G	HIS/ARG	0,4406		0,0,2203	170.0	145.0	153.0		1385	5.2	1.0	8		153	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ELP3	NM_018091.5	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	462/548	28017873	1,13005	2203	4300	6503	28073792	SO:0001583	missense	55140				CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.1385G>A	8.37:g.28017873G>A	ENSP00000256398:p.Arg462His		28073792	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	superfamily_Radical SAM enzymes,HMMSmart_SM00729,HMMPfam_Radical_SAM,superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_Acetyltransf_1	p.R462H	ENST00000256398.8	37	c.1385	CCDS6065.1	8	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	29.0	4.964935	0.92855	0.0	1.16E-4	ENSG00000134014	ENST00000521015;ENST00000256398;ENST00000542181;ENST00000524103;ENST00000537665;ENST00000380353;ENST00000523357;ENST00000517975	.	.	.	5.17	5.17	0.71159	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.89805	0.6821	H	0.98027	4.13	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70016	0.932;0.967	D	0.93157	0.6554	9	0.62326	D	0.03	-14.2666	16.5174	0.84304	0.0:0.0:1.0:0.0	.	343;462	B4DE19;Q9H9T3	.;ELP3_HUMAN	H	448;462;333;390;343;370;61;55	.	ENSP00000256398:R462H	R	+	2	0	ELP3	28073792	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.785000	0.99042	2.543000	0.85770	0.655000	0.94253	CGT	-	superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_Acetyltransf_1		0.478	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP3	protein_coding	OTTHUMT00000219963.2	G	NM_018091		28073792	+1	no_errors	NM_018091	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF24	7572	genome.wustl.edu	37	18	32919936	32919936	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr18:32919936G>C	ENST00000261332.6	-	3	604	c.425C>G	c.(424-426)tCt>tGt	p.S142C	ZNF24_ENST00000399061.3_Missense_Mutation_p.S142C|ZNF24_ENST00000589881.1_Missense_Mutation_p.S142C	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	142					myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						TCGACGGAGAGAAACCTGGAA	0.418																																					Colon(42;769 913 8916 19469 46270)											0			18											83.0	79.0	80.0					18																	32919936		2203	4300	6503	31173934	SO:0001583	missense	7572			AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.425C>G	18.37:g.32919936G>C	ENSP00000261332:p.Ser142Cys		31173934	O14754|Q53YE4|Q6ICR5|Q8IZN4	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.S142C	ENST00000261332.6	37	c.425	CCDS11912.1	18	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635885	0.67130	.	.	ENSG00000172466	ENST00000261332;ENST00000399061	T;T	0.05382	3.45;3.45	5.5	5.5	0.81552	Transcription regulator SCAN (1);	0.000000	0.56097	D	0.000034	T	0.09069	0.0224	N	0.08118	0	0.38509	D	0.948429	P;D	0.63046	0.921;0.992	P;P	0.60117	0.753;0.869	T	0.48854	-0.8998	10	0.34782	T	0.22	.	15.2701	0.73693	0.0:0.0:1.0:0.0	.	142;142	P17028-2;P17028	.;ZNF24_HUMAN	C	142	ENSP00000261332:S142C;ENSP00000382015:S142C	ENSP00000261332:S142C	S	-	2	0	ZNF24	31173934	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.100000	0.50275	2.771000	0.95319	0.655000	0.94253	TCT	-	HMMSmart_SCAN		0.418	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF24	protein_coding	OTTHUMT00000255769.1	G	NM_006965		31173934	-1	no_errors	NM_006965	genbank	human	validated	54_36p	missense	SNP	1.000	C
ITPR3	3710	genome.wustl.edu	37	6	33636358	33636358	+	Silent	SNP	C	C	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr6:33636358C>G	ENST00000374316.5	+	18	3013	c.1953C>G	c.(1951-1953)ctC>ctG	p.L651L	ITPR3_ENST00000605930.1_Silent_p.L651L			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	651					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCCAAGAGCTCATCTGCAAGT	0.617																																																0			6											171.0	137.0	148.0					6																	33636358		2203	4300	6503	33744336	SO:0001819	synonymous_variant	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1953C>G	6.37:g.33636358C>G			33744336	Q14649|Q5TAQ2	Silent	SNP	HMMPfam_Ins145_P3_rec,superfamily_MIR,HMMSmart_MIR,HMMPfam_MIR,superfamily_SSF100909,HMMPfam_RYDR_ITPR,HMMPfam_RIH_assoc,HMMPfam_Ion_trans	p.L651	ENST00000374316.5	37	c.1953	CCDS4783.1	6																																																																																			-	HMMPfam_RYDR_ITPR		0.617	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	C	NM_002224		33744336	+1	no_errors	NM_002224	genbank	human	validated	54_36p	silent	SNP	1.000	G
KRT19	3880	genome.wustl.edu	37	17	39680089	39680089	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr17:39680089T>C	ENST00000361566.3	-	6	1169	c.1109A>G	c.(1108-1110)aAg>aGg	p.K370R	KRT15_ENST00000393976.2_5'Flank|KRT15_ENST00000254043.3_5'Flank|KRT15_ENST00000393974.3_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	370	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				CAGCCGCGACTTGATGTCCAT	0.577																																																0			17											58.0	53.0	54.0					17																	39680089		2203	4300	6503	36933615	SO:0001583	missense	3880				CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.1109A>G	17.37:g.39680089T>C	ENSP00000355124:p.Lys370Arg		36933615	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.K370R	ENST00000361566.3	37	c.1109	CCDS11399.1	17	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416496	0.83449	.	.	ENSG00000171345	ENST00000361566	D	0.94376	-3.41	4.99	4.99	0.66335	Filament (1);	0.000000	0.49305	D	0.000150	D	0.97065	0.9041	M	0.91768	3.24	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	D	0.96844	0.9620	10	0.30854	T	0.27	.	14.7481	0.69505	0.0:0.0:0.0:1.0	.	533;370	B4DE59;P08727	.;K1C19_HUMAN	R	370	ENSP00000355124:K370R	ENSP00000355124:K370R	K	-	2	0	KRT19	36933615	1.000000	0.71417	0.953000	0.39169	0.990000	0.78478	7.947000	0.87758	1.882000	0.54519	0.454000	0.30748	AAG	-	HMMPfam_Filament		0.577	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT19	protein_coding	OTTHUMT00000257285.1	T	NM_002276		36933615	-1	no_errors	NM_002276	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SLC25A15	10166	genome.wustl.edu	37	13	41381594	41381594	+	Missense_Mutation	SNP	A	A	G	rs576852849		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr13:41381594A>G	ENST00000338625.4	+	5	853	c.617A>G	c.(616-618)gAa>gGa	p.E206G	SLC25A15_ENST00000478827.1_3'UTR	NM_014252.3	NP_055067.1	Q9Y619	ORNT1_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15	206					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|L-ornithine transmembrane transport (GO:1903352)|mitochondrial ornithine transport (GO:0000066)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	L-ornithine transmembrane transporter activity (GO:0000064)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|stomach(1)|urinary_tract(1)	14		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.48e-08)|Epithelial(112;7.51e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000191)|GBM - Glioblastoma multiforme(144;0.00231)|BRCA - Breast invasive adenocarcinoma(63;0.0704)	L-Ornithine(DB00129)	TCAAAAGATGAATTAGGTAAA	0.468																																																0			13											133.0	126.0	128.0					13																	41381594		2203	4300	6503	40279594	SO:0001583	missense	10166			AF112968	CCDS9373.1	13q14	2013-05-22			ENSG00000102743	ENSG00000102743		"""Solute carriers"""	10985	protein-coding gene	gene with protein product	"""ornithine transporter 1"""	603861		ORNT1, HHH		10369256	Standard	NM_014252		Approved	ORC1, D13S327	uc001uxn.3	Q9Y619	OTTHUMG00000016776	ENST00000338625.4:c.617A>G	13.37:g.41381594A>G	ENSP00000342267:p.Glu206Gly		40279594	Q5VZD8|Q9HC45	Missense_Mutation	SNP	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.E206G	ENST00000338625.4	37	c.617	CCDS9373.1	13	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560815	0.65538	.	.	ENSG00000102743	ENST00000338625;ENST00000443985	T	0.78707	-1.2	5.46	5.46	0.80206	Mitochondrial carrier domain (2);	0.095292	0.64402	D	0.000001	T	0.75759	0.3893	L	0.58302	1.8	0.54753	D	0.999989	B;B	0.21225	0.053;0.02	B;B	0.25759	0.063;0.033	T	0.72852	-0.4167	10	0.46703	T	0.11	.	15.0131	0.71565	1.0:0.0:0.0:0.0	.	146;206	B4DL63;Q9Y619	.;ORNT1_HUMAN	G	206;146	ENSP00000342267:E206G	ENSP00000342267:E206G	E	+	2	0	SLC25A15	40279594	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.896000	0.69822	2.199000	0.70637	0.455000	0.32223	GAA	-	superfamily_Mitochondrial carrier		0.468	SLC25A15-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A15	protein_coding	OTTHUMT00000276149.2	A	NM_014252		40279594	+1	no_errors	NM_014252	genbank	human	validated	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	10	42672508	42672508	+	IGR	SNP	T	T	C	rs200686947		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr10:42672508T>C								None (None upstream) : AL031601.1 (57842 downstream)																							TATTTTGCCCTCCGCCGCCGC	0.592																																																0			10																																								41992514	SO:0001628	intergenic_variant	0																															10.37:g.42672508T>C			41992514		Missense_Mutation	SNP	HMMSmart_SM00406,HMMSmart_SM00409,HMMPfam_V-set,superfamily_Immunoglobulin	p.L16P		37	c.47		10																																																																																			-	NULL	0	0.592					LOC642424			T			41992514	+1	no_errors	XM_001717196	genbank	human	model	54_36p	missense	SNP	0.002	C
CUBNP1	728064	genome.wustl.edu	37	10	43199659	43199659	+	lincRNA	SNP	C	C	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr10:43199659C>G	ENST00000439913.1	+	0	1723																											TTCCCCCACACTGAGCTGaaa	0.373																																																0			10																																								42519665			728064																															10.37:g.43199659C>G			42519665		RNA	SNP	-	NULL	ENST00000439913.1	37	NULL		10																																																																																			-	-		0.373	AL022344.5-001	KNOWN	basic	lincRNA	LOC728064	lincRNA	OTTHUMT00000047688.1	C			42519665	-1	no_errors	XR_015196	genbank	human	model	54_36p	rna	SNP	0.650	G
HDAC10	83933	genome.wustl.edu	37	22	50684515	50684515	+	Missense_Mutation	SNP	C	C	T	rs138919111	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr22:50684515C>T	ENST00000216271.5	-	18	2009	c.1657G>A	c.(1657-1659)Ggt>Agt	p.G553S	HDAC10_ENST00000498366.1_5'UTR|TUBGCP6_ENST00000248846.5_5'Flank|MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000349505.4_Missense_Mutation_p.G533S|HDAC10_ENST00000448072.1_Missense_Mutation_p.G503S|TUBGCP6_ENST00000439308.2_5'Flank	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	553					chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGGAAACCACCGGTCATCTGT	0.647													C|||	11	0.00219649	0.0083	0.0	5008	,	,		18272	0.0		0.0	False		,,,				2504	0.0															0			22						C	SER/GLY,SER/GLY	26,4376	32.6+/-62.9	0,26,2175	43.0	45.0	44.0		1597,1657	4.8	0.5	22	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	HDAC10	NM_001159286.1,NM_032019.5	56,56	0,27,6474	TT,TC,CC		0.0116,0.5906,0.2077	benign,benign	533/650,553/670	50684515	27,12975	2201	4300	6501	49026642	SO:0001583	missense	83933			AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.1657G>A	22.37:g.50684515C>T	ENSP00000216271:p.Gly553Ser		49026642	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Missense_Mutation	SNP	superfamily_Arginase/deacetylase,HMMPfam_Hist_deacetyl	p.G553S	ENST00000216271.5	37	c.1657	CCDS14088.1	22	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	13.75	2.331549	0.41297	0.005906	1.16E-4	ENSG00000100429	ENST00000216271;ENST00000448072;ENST00000349505	T;T;T	0.28666	1.6;1.6;1.6	4.8	4.8	0.61643	Histone deacetylase domain (1);	0.371913	0.22522	N	0.058959	T	0.19725	0.0474	L	0.54323	1.7	0.80722	D	1	P;B;P;P	0.48503	0.911;0.003;0.911;0.855	B;B;B;B	0.36989	0.238;0.002;0.238;0.12	T	0.03157	-1.1066	10	0.31617	T	0.26	-17.6656	13.5279	0.61605	0.0:1.0:0.0:0.0	.	533;503;553;553	Q969S8-2;C9J8B8;Q969S8-4;Q969S8	.;.;.;HDA10_HUMAN	S	553;503;533	ENSP00000216271:G553S;ENSP00000397542:G503S;ENSP00000343540:G533S	ENSP00000216271:G553S	G	-	1	0	HDAC10	49026642	0.147000	0.22687	0.546000	0.28166	0.220000	0.24768	1.808000	0.38912	2.641000	0.89580	0.561000	0.74099	GGT	-	superfamily_Arginase/deacetylase		0.647	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC10	protein_coding	OTTHUMT00000104141.4	C	NM_032019		49026642	-1	no_errors	NM_032019	genbank	human	validated	54_36p	missense	SNP	0.084	T
ZNF404	342908	genome.wustl.edu	37	19	44377031	44377031	+	Silent	SNP	T	T	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr19:44377031T>C	ENST00000587539.1	-	3	1334	c.1335A>G	c.(1333-1335)ggA>ggG	p.G445G	ZNF404_ENST00000324394.6_Silent_p.G443G	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TAAAGGTTTTTCCACATTCCT	0.368																																																0			19																																								49068871	SO:0001819	synonymous_variant	342908			XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.1335A>G	19.37:g.44377031T>C			49068871	A4FU30|K7ELF2	Silent	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G445	ENST00000587539.1	37	c.1335	CCDS59394.1	19																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.368	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF404	protein_coding	OTTHUMT00000460019.1	T	NM_001033719		49068871	-1	no_errors	NM_001033719	genbank	human	validated	54_36p	silent	SNP	1.000	C
FGD1	2245	genome.wustl.edu	37	X	54472831	54472831	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chrX:54472831C>T	ENST00000375135.3	-	18	3330	c.2597G>A	c.(2596-2598)cGc>cAc	p.R866H		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	866	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGGCAGGCTGCGCTGGGCTTT	0.632																																																0			X											25.0	21.0	23.0					X																	54472831		2202	4300	6502	54489556	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2597G>A	X.37:g.54472831C>T	ENSP00000364277:p.Arg866His		54489556	Q5H999|Q8N4D9	Missense_Mutation	SNP	PatternScan_DH_1,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_FYVE_PHD_ZnF,HMMSmart_FYVE,HMMPfam_FYVE	p.R866H	ENST00000375135.3	37	c.2597	CCDS14359.1	X	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225287	0.58668	.	.	ENSG00000102302	ENST00000375135	T	0.12361	2.69	5.79	5.79	0.91817	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.53938	D	0.000046	T	0.15998	0.0385	L	0.50333	1.59	0.47584	D	0.999462	P	0.40083	0.702	B	0.37780	0.258	T	0.03287	-1.1052	10	0.24483	T	0.36	-15.4332	17.6058	0.88037	0.0:1.0:0.0:0.0	.	866	P98174	FGD1_HUMAN	H	866	ENSP00000364277:R866H	ENSP00000364277:R866H	R	-	2	0	FGD1	54489556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.124000	0.57924	2.429000	0.82318	0.513000	0.50165	CGC	-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.632	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD1	protein_coding	OTTHUMT00000056801.1	C	NM_004463		54489556	-1	no_errors	NM_004463	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TIMM9	26520	genome.wustl.edu	37	14	58875825	58875825	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr14:58875825C>G	ENST00000395159.2	-	6	722	c.197G>C	c.(196-198)aGa>aCa	p.R66T	TIMM9_ENST00000555061.1_Missense_Mutation_p.R66T|TIMM9_ENST00000216463.4_5'UTR|TIMM9_ENST00000555404.1_Missense_Mutation_p.R66T|TIMM9_ENST00000555593.1_Missense_Mutation_p.R66T|RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000556007.2_Intron	NM_012460.2	NP_036592.1	Q9Y5J7	TIM9_HUMAN	translocase of inner mitochondrial membrane 9 homolog (yeast)	66					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|protein import into mitochondrial inner membrane (GO:0045039)|protein targeting to mitochondrion (GO:0006626)|sensory perception of sound (GO:0007605)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial intermembrane space protein transporter complex (GO:0042719)|mitochondrion (GO:0005739)	chaperone binding (GO:0051087)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			kidney(2)|skin(1)	3						TTCCTGAAATCTCATGGATAT	0.403																																																0			14											99.0	90.0	93.0					14																	58875825		2203	4300	6503	57945578	SO:0001583	missense	26520			AF150100	CCDS9735.1	14q22.3-q24	2008-07-04	2001-11-28		ENSG00000100575	ENSG00000100575			11819	protein-coding gene	gene with protein product		607384	"""translocase of inner mitochondrial membrane 9 (yeast) homolog"""			10552927, 14726512	Standard	NM_012460		Approved	TIM9A	uc001xds.3	Q9Y5J7	OTTHUMG00000140322	ENST00000395159.2:c.197G>C	14.37:g.58875825C>G	ENSP00000378588:p.Arg66Thr		57945578	B2R584	Missense_Mutation	SNP	HMMPfam_zf-Tim10_DDP	p.R66T	ENST00000395159.2	37	c.197	CCDS9735.1	14	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744593	0.89663	.	.	ENSG00000100575	ENST00000395159;ENST00000555593;ENST00000555061;ENST00000555404	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.55	5.55	0.83447	.	0.045286	0.85682	D	0.000000	T	0.81361	0.4806	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82748	-0.0304	9	0.87932	D	0	-17.8487	19.2868	0.94082	0.0:1.0:0.0:0.0	.	66	Q9Y5J7	TIM9_HUMAN	T	66	ENSP00000378588:R66T;ENSP00000451006:R66T;ENSP00000450638:R66T;ENSP00000451198:R66T	ENSP00000216463:R66T	R	-	2	0	TIMM9	57945578	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.512000	0.81728	2.885000	0.99019	0.655000	0.94253	AGA	-	HMMPfam_zf-Tim10_DDP		0.403	TIMM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM9	protein_coding	OTTHUMT00000276936.2	C			57945578	-1	no_errors	NM_012460	genbank	human	provisional	54_36p	missense	SNP	1.000	G
PTPRH	5794	genome.wustl.edu	37	19	55696927	55696927	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr19:55696927A>G	ENST00000376350.3	-	18	3027	c.3005T>C	c.(3004-3006)aTg>aCg	p.M1002T	PTPRH_ENST00000263434.5_Missense_Mutation_p.M824T	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1002	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTGCCGAAGCATCCTCCAGAA	0.627																																																0			19											58.0	50.0	53.0					19																	55696927		2203	4300	6503	60388739	SO:0001583	missense	5794				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.3005T>C	19.37:g.55696927A>G	ENSP00000365528:p.Met1002Thr		60388739	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	HMMPfam_fn3,superfamily_Fibronectin type III,HMMSmart_SM00060,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.M1002T	ENST00000376350.3	37	c.3005	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	A	10.29	1.310720	0.23821	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	D;D	0.82984	-1.67;-1.67	5.21	3.09	0.35607	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.838721	0.10022	N	0.725851	T	0.67002	0.2847	N	0.16903	0.455	0.09310	N	1	B;B	0.27013	0.077;0.166	B;B	0.19148	0.011;0.024	T	0.51124	-0.8745	10	0.21014	T	0.42	.	6.6468	0.22939	0.7861:0.0:0.0768:0.1371	.	824;1002	C9JCH2;Q9HD43	.;PTPRH_HUMAN	T	1002;824	ENSP00000365528:M1002T;ENSP00000263434:M824T	ENSP00000263434:M824T	M	-	2	0	PTPRH	60388739	0.000000	0.05858	0.004000	0.12327	0.326000	0.28443	1.126000	0.31344	0.387000	0.25024	-0.341000	0.08007	ATG	-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404		0.627	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	protein_coding	OTTHUMT00000452649.1	A			60388739	-1	no_errors	NM_002842	genbank	human	reviewed	54_36p	missense	SNP	0.014	G
DNAJC5	80331	genome.wustl.edu	37	20	62562232	62562232	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr20:62562232C>T	ENST00000360864.4	+	4	503	c.350C>T	c.(349-351)aCg>aTg	p.T117M	DNAJC5_ENST00000369911.2_Missense_Mutation_p.T117M	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	117					cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)				cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGCCTCCTCACGtgctgctac	0.622																																																0			20											84.0	75.0	78.0					20																	62562232		2203	4299	6502	62032676	SO:0001583	missense	80331				CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.350C>T	20.37:g.62562232C>T	ENSP00000354111:p.Thr117Met		62032676	A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	Missense_Mutation	SNP	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ,PatternScan_DNAJ_1	p.T117M	ENST00000360864.4	37	c.350	CCDS13546.1	20	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041520	0.93685	.	.	ENSG00000101152	ENST00000369911;ENST00000360864	T;T	0.72942	-0.63;-0.7	5.91	5.91	0.95273	.	0.114243	0.64402	D	0.000020	D	0.87822	0.6274	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.72338	0.944;0.977	D	0.89018	0.3433	10	0.72032	D	0.01	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	117;117	Q9H3Z4-2;Q9H3Z4	.;DNJC5_HUMAN	M	117	ENSP00000358927:T117M;ENSP00000354111:T117M	ENSP00000354111:T117M	T	+	2	0	DNAJC5	62032676	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.297000	0.65704	2.808000	0.96608	0.655000	0.94253	ACG	-	superfamily_Chaperone J-domain		0.622	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC5	protein_coding	OTTHUMT00000080244.1	C	NM_025219		62032676	+1	no_errors	NM_025219	genbank	human	provisional	54_36p	missense	SNP	0.996	T
ZBTB3	79842	genome.wustl.edu	37	11	62519928	62519928	+	Silent	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr11:62519928C>T	ENST00000394807.3	-	2	1484	c.1359G>A	c.(1357-1359)ctG>ctA	p.L453L		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						ACTCAGAAGACAGGTAAAGTG	0.537																																																0			11											67.0	63.0	65.0					11																	62519928		2202	4299	6501	62276504	SO:0001819	synonymous_variant	79842			AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1359G>A	11.37:g.62519928C>T			62276504		Silent	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.L453	ENST00000394807.3	37	c.1359	CCDS8034.1	11																																																																																			-	NULL		0.537	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB3	protein_coding	OTTHUMT00000395342.1	C	NM_024784		62276504	-1	no_errors	NM_024784	genbank	human	validated	54_36p	silent	SNP	0.001	T
WDR74	54663	genome.wustl.edu	37	11	62607022	62607022	+	Silent	SNP	G	G	C	rs114810174	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr11:62607022G>C	ENST00000525239.1	-	2	558	c.21C>G	c.(19-21)cgC>cgG	p.R7R	RNU2-2P_ENST00000410396.1_RNA|WDR74_ENST00000529106.1_Silent_p.R7R|WDR74_ENST00000525752.1_5'UTR|WDR74_ENST00000540620.1_5'UTR|WDR74_ENST00000278856.4_Silent_p.R7R|WDR74_ENST00000311713.7_Silent_p.R7R			Q6RFH5	WDR74_HUMAN	WD repeat domain 74	7					blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						CATGGTTCCAGCGTGCAGCAG	0.667													G|||	61	0.0121805	0.0439	0.0043	5008	,	,		15014	0.0		0.0	False		,,,				2504	0.0															0			11						G		134,4160		0,134,2013	34.0	40.0	38.0		21	-1.1	0.6	11	dbSNP_132	38	1,8523		0,1,4261	yes	coding-synonymous	WDR74	NM_018093.2		0,135,6274	CC,CG,GG		0.0117,3.1206,1.0532		7/386	62607022	135,12683	2147	4262	6409	62363598	SO:0001819	synonymous_variant	54663				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.21C>G	11.37:g.62607022G>C			62363598	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Silent	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40	p.R7	ENST00000525239.1	37	c.21	CCDS44630.1	11																																																																																			-	NULL		0.667	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR74	protein_coding	OTTHUMT00000395678.1	G	NM_018093		62363598	-1	no_errors	NM_018093	genbank	human	validated	54_36p	silent	SNP	0.957	C
MRGPRD	116512	genome.wustl.edu	37	11	68747636	68747636	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr11:68747636C>T	ENST00000309106.3	-	1	819	c.820G>A	c.(820-822)Gtc>Atc	p.V274I		NM_198923.2	NP_944605.2	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	274						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)	22			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AAGTAGATGACGGGGTTGGCG	0.647																																																0			11											42.0	42.0	42.0					11																	68747636		2200	4294	6494	68504212	SO:0001583	missense	116512			AB083627	CCDS31625.1	11q13.3	2012-08-21			ENSG00000172938	ENSG00000172938		"""GPCR / Class A : Orphans"""	29626	protein-coding gene	gene with protein product		607231				11551509, 12909716	Standard	NM_198923		Approved	mrgD	uc010rqf.2	Q8TDS7	OTTHUMG00000167896	ENST00000309106.3:c.820G>A	11.37:g.68747636C>T	ENSP00000310631:p.Val274Ile		68504212	Q8NGK7	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.V274I	ENST00000309106.3	37	c.820	CCDS31625.1	11	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.490700	0.00011	.	.	ENSG00000172938	ENST00000309106	T	0.32753	1.44	4.53	-9.05	0.00730	GPCR, rhodopsin-like superfamily (1);	0.904688	0.09038	N	0.857708	T	0.07593	0.0191	N	0.04746	-0.17	0.09310	N	0.999999	B	0.21520	0.057	B	0.12837	0.008	T	0.18429	-1.0337	10	0.02654	T	1	-9.3492	1.0516	0.01581	0.204:0.1724:0.2995:0.3241	.	274	Q8TDS7	MRGRD_HUMAN	I	274	ENSP00000310631:V274I	ENSP00000310631:V274I	V	-	1	0	MRGPRD	68504212	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-8.439000	0.00020	-4.304000	0.00058	-3.118000	0.00062	GTC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.647	MRGPRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRD	protein_coding	OTTHUMT00000396874.1	C	NM_198923		68504212	-1	no_errors	NM_198923	genbank	human	validated	54_36p	missense	SNP	0.318	T
ZFHX3	463	genome.wustl.edu	37	16	72832395	72832395	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr16:72832395G>A	ENST00000268489.5	-	9	4858	c.4186C>T	c.(4186-4188)Cgc>Tgc	p.R1396C	ZFHX3_ENST00000397992.5_Missense_Mutation_p.R482C	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1396					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TACACATGGCGATCTGACACC	0.502																																																0			16											162.0	142.0	149.0					16																	72832395		2198	4300	6498	71389896	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.4186C>T	16.37:g.72832395G>A	ENSP00000268489:p.Arg1396Cys		71389896	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2,HMMSmart_SM00451,HMMSmart_SM00389,superfamily_Homeodomain-like,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.R1396C	ENST00000268489.5	37	c.4186	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836117	0.50951	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.76839	-1.05;-1.05	5.94	5.94	0.96194	.	0.000000	0.51477	D	0.000097	D	0.89019	0.6596	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.89105	0.3492	10	0.87932	D	0	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	1396	Q15911	ZFHX3_HUMAN	C	1396;482	ENSP00000268489:R1396C;ENSP00000438926:R482C	ENSP00000268489:R1396C	R	-	1	0	ZFHX3	71389896	1.000000	0.71417	0.999000	0.59377	0.861000	0.49209	9.869000	0.99810	2.826000	0.97356	0.561000	0.74099	CGC	-	superfamily_C2H2 and C2HC zinc fingers		0.502	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	protein_coding	OTTHUMT00000269008.1	G	NM_006885		71389896	-1	no_errors	NM_006885	genbank	human	validated	54_36p	missense	SNP	1.000	A
TMEM63C	57156	genome.wustl.edu	37	14	77705773	77705773	+	Silent	SNP	T	T	C	rs116434167	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr14:77705773T>C	ENST00000298351.4	+	11	888	c.744T>C	c.(742-744)agT>agC	p.S248S		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	248					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		ATCCAGGCAGTGTCGTGACAA	0.642													T|||	88	0.0175719	0.0628	0.0058	5008	,	,		17800	0.001		0.0	False		,,,				2504	0.0															0			14						T		201,3913		1,199,1857	50.0	55.0	53.0		744	-1.1	0.1	14	dbSNP_132	53	2,8394		0,2,4196	no	coding-synonymous	TMEM63C	NM_020431.2		1,201,6053	CC,CT,TT		0.0238,4.8858,1.6227		248/807	77705773	203,12307	2057	4198	6255	76775526	SO:0001819	synonymous_variant	57156				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.744T>C	14.37:g.77705773T>C			76775526	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Silent	SNP	HMMPfam_DUF221	p.S248	ENST00000298351.4	37	c.744	CCDS45141.1	14																																																																																			-	NULL		0.642	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	protein_coding	OTTHUMT00000414193.1	T			76775526	+1	no_errors	NM_020431	genbank	human	validated	54_36p	silent	SNP	0.999	C
SEC31A	22872	genome.wustl.edu	37	4	83765560	83765560	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr4:83765560G>T	ENST00000395310.2	-	21	2787	c.2605C>A	c.(2605-2607)Cca>Aca	p.P869T	SEC31A_ENST00000355196.2_Missense_Mutation_p.P869T|SEC31A_ENST00000432794.1_Missense_Mutation_p.P869T|SEC31A_ENST00000448323.1_Missense_Mutation_p.P869T|SEC31A_ENST00000264405.5_Missense_Mutation_p.P633T|SEC31A_ENST00000508502.1_Missense_Mutation_p.P869T|SEC31A_ENST00000513858.1_Missense_Mutation_p.P830T|SEC31A_ENST00000326950.5_Missense_Mutation_p.P830T|SEC31A_ENST00000311785.7_Missense_Mutation_p.P869T|SEC31A_ENST00000508479.1_Missense_Mutation_p.P869T|SEC31A_ENST00000509142.1_Missense_Mutation_p.P869T|SEC31A_ENST00000505984.1_Missense_Mutation_p.P830T|SEC31A_ENST00000348405.4_Missense_Mutation_p.P830T|SEC31A_ENST00000443462.2_Missense_Mutation_p.P864T|SEC31A_ENST00000505472.1_Missense_Mutation_p.P900T|SEC31A_ENST00000500777.2_Missense_Mutation_p.P830T	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	869	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GGATAAGGTGGTACCTGGGTG	0.443																																																0			4											169.0	164.0	166.0					4																	83765560		2203	4300	6503	83984584	SO:0001583	missense	22872			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2605C>A	4.37:g.83765560G>T	ENSP00000378721:p.Pro869Thr		83984584	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.P869T	ENST00000395310.2	37	c.2605	CCDS3596.1	4	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	6.816|6.816|6.816	0.519571|0.519571|0.519571	0.13005|0.13005|0.13005	.|.|.	.|.|.	ENSG00000138674|ENSG00000138674|ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479|ENST00000511338|ENST00000503937	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.|.	0.44482|.|.	1.14;0.95;2.26;2.23;1.08;2.14;2.26;1.14;1.08;0.92;0.95;2.24;2.26;2.93;2.11;2.21|.|.	5.52|5.52|5.52	4.65|4.65|4.65	0.58169|0.58169|0.58169	.|.|.	0.489959|.|.	0.22690|.|.	N|.|.	0.056826|.|.	T|T|.	0.53706|0.53706|.	0.1813|0.1813|.	L|L|L	0.29908|0.29908|0.29908	0.895|0.895|0.895	0.53688|0.53688|0.53688	D|D|D	0.999977|0.999977|0.999977	P;P;P;P;B;B;P;B;B;D|.|.	0.54397|.|.	0.709;0.518;0.455;0.59;0.328;0.103;0.702;0.44;0.015;0.966|.|.	B;B;B;B;B;B;P;B;B;P|.|.	0.57324|.|.	0.343;0.255;0.085;0.176;0.178;0.058;0.544;0.118;0.015;0.818|.|.	T|T|.	0.49204|0.49204|.	-0.8964|-0.8964|.	10|5|.	0.54805|.|.	T|.|.	0.06|.|.	-9.8264|-9.8264|-9.8264	14.3409|14.3409|14.3409	0.66624|0.66624|0.66624	0.0:0.1482:0.8518:0.0|0.0:0.1482:0.8518:0.0|0.0:0.1482:0.8518:0.0	.|.|.	864;830;869;830;830;869;869;869;633;869|.|.	B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7;O94979-8|.|.	.;.;.;.;.;.;.;SC31A_HUMAN;.;.|.|.	T|N|X	830;830;869;864;869;869;869;830;869;900;830;869;869;633;830;869|79|18	ENSP00000337602:P830T;ENSP00000426886:P830T;ENSP00000378721:P869T;ENSP00000408027:P864T;ENSP00000426569:P869T;ENSP00000407944:P869T;ENSP00000400926:P869T;ENSP00000325087:P830T;ENSP00000309070:P869T;ENSP00000421633:P900T;ENSP00000421464:P830T;ENSP00000424635:P869T;ENSP00000347329:P869T;ENSP00000264405:P633T;ENSP00000424451:P830T;ENSP00000425999:P869T|.|.	ENSP00000264405:P633T|.|.	P|T|Y	-|-|-	1|2|3	0|0|2	SEC31A|SEC31A|SEC31A	83984584|83984584|83984584	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.949000|0.949000|0.949000	0.60115|0.60115|0.60115	1.922000|1.922000|1.922000	0.40045|0.40045|0.40045	1.267000|1.267000|1.267000	0.44247|0.44247|0.44247	0.484000|0.484000|0.484000	0.47621|0.47621|0.47621	CCA|ACC|TAC	-	NULL		0.443	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	protein_coding	OTTHUMT00000252640.1	G	NM_016211		83984584	-1	no_errors	NM_001077207	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NBN	4683	genome.wustl.edu	37	8	90982674	90982674	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr8:90982674C>T	ENST00000265433.3	-	7	968	c.814G>A	c.(814-816)Gat>Aat	p.D272N	NBN_ENST00000409330.1_Missense_Mutation_p.D190N	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	272	Interaction with MTOR, MAPKAP1 and RICTOR.|Mediates interaction with SP100. {ECO:0000250}.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			ATTCCTGTATCAACAACACAC	0.388								Homologous recombination																																								0			8											106.0	104.0	104.0					8																	90982674		2203	4300	6503	91051850	SO:0001583	missense	4683			AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.814G>A	8.37:g.90982674C>T	ENSP00000265433:p.Asp272Asn		91051850	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	superfamily_SMAD/FHA domain,HMMSmart_SM00240,HMMPfam_FHA,HMMPfam_BRCT,HMMPfam_Nbs1_C	p.D272N	ENST00000265433.3	37	c.814	CCDS6249.1	8	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677955	0.68042	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387	T;T	0.62105	0.09;0.05	5.6	5.6	0.85130	.	0.087373	0.85682	D	0.000000	T	0.76328	0.3972	M	0.75447	2.3	0.58432	D	0.999998	D;D	0.52996	0.957;0.957	P;P	0.57244	0.764;0.816	T	0.79072	-0.1953	10	0.87932	D	0	-18.8863	17.3941	0.87440	0.0:1.0:0.0:0.0	.	272;272	A6H8Y5;O60934	.;NBN_HUMAN	N	272;190;272	ENSP00000265433:D272N;ENSP00000386924:D190N	ENSP00000265433:D272N	D	-	1	0	NBN	91051850	1.000000	0.71417	0.997000	0.53966	0.129000	0.20672	4.824000	0.62701	2.627000	0.88993	0.655000	0.94253	GAT	-	NULL		0.388	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBN	protein_coding	OTTHUMT00000331583.3	C	NM_001024688		91051850	-1	no_errors	NM_002485	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ANO4	121601	genome.wustl.edu	37	12	101295547	101295547	+	5'UTR	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr12:101295547G>A	ENST00000392977.3	+	0	194				ANO4_ENST00000538618.1_Missense_Mutation_p.G161D|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CTCCCACCAGGCAGAAGGTCA	0.537										HNSCC(74;0.22)																																						0			12											103.0	101.0	102.0					12																	101295547		2203	4300	6503	99819678	SO:0001623	5_prime_UTR_variant	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.-17G>A	12.37:g.101295547G>A			99819678	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	HMMPfam_DUF590	p.G56D	ENST00000392977.3	37	c.167		12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226655	0.79576	.	.	ENSG00000151572	ENST00000538618	T	0.73897	-0.79	5.64	3.67	0.42095	.	.	.	.	.	T	0.75664	0.3880	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74578	-0.3619	6	0.48119	T	0.1	.	7.8741	0.29584	0.0:0.1165:0.5277:0.3558	.	.	.	.	D	161	ENSP00000443751:G161D	ENSP00000443751:G161D	G	+	2	0	ANO4	99819678	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.355000	0.44107	2.657000	0.90304	0.655000	0.94253	GGC	-	NULL		0.537	ANO4-002	KNOWN	basic	protein_coding	ANO4	protein_coding	OTTHUMT00000409295.1	G	NM_178826		99819678	+1	no_start_codon	ENST00000392979	ensembl	human	known	54_36p	missense	SNP	1.000	A
TBC1D8B	54885	genome.wustl.edu	37	X	106070472	106070472	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chrX:106070472C>T	ENST00000357242.5	+	7	1282	c.1108C>T	c.(1108-1110)Cgc>Tgc	p.R370C	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.R370C|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.R370C|TBC1D8B_ENST00000481617.2_Missense_Mutation_p.R370C	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	370							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AACAGCTTTTCGCTTCCATGA	0.388																																																0			X											105.0	105.0	105.0					X																	106070472		2203	4300	6503	105957128	SO:0001583	missense	54885			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.1108C>T	X.37:g.106070472C>T	ENSP00000349781:p.Arg370Cys		105957128	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	HMMPfam_GRAM,HMMSmart_SM00568,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164,superfamily_EF-hand,PatternScan_EF_HAND_1	p.R370C	ENST00000357242.5	37	c.1108	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	c	22.7	4.329037	0.81690	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	T;T;T;T	0.23348	3.12;2.52;1.91;3.1	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.95;0.996	T	0.53500	-0.8430	10	0.49607	T	0.09	-7.8169	16.5658	0.84599	0.0:1.0:0.0:0.0	.	370;370;370	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	C	370	ENSP00000349781:R370C;ENSP00000310675:R370C;ENSP00000421375:R370C;ENSP00000276175:R370C	ENSP00000276175:R370C	R	+	1	0	TBC1D8B	105957128	1.000000	0.71417	0.998000	0.56505	0.781000	0.44180	6.915000	0.75770	2.219000	0.72066	0.502000	0.49764	CGC	-	NULL		0.388	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	protein_coding	OTTHUMT00000057807.2	C	NM_017752		105957128	+1	no_errors	NM_017752	genbank	human	validated	54_36p	missense	SNP	1.000	T
RPL3P7	642741	genome.wustl.edu	37	6	108326253	108326253	+	IGR	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr6:108326253G>A								SNORA73 (19270 upstream) : RP1-111B22.3 (25199 downstream)																							TTCTTCTGGCGCAGAGGAAGC	0.577																																																0			6																																								108432946	SO:0001628	intergenic_variant	642741																															6.37:g.108326253G>A			108432946		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.577					LOC642741			G			108432946	-1	pseudogene	XR_016455	genbank	human	model	54_36p	rna	SNP	0.964	A
MVK	4598	genome.wustl.edu	37	12	110019277	110019277	+	Missense_Mutation	SNP	C	C	T	rs104895310		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr12:110019277C>T	ENST00000228510.3	+	5	525	c.449C>T	c.(448-450)tCg>tTg	p.S150L	MVK_ENST00000535044.1_Intron|MVK_ENST00000392727.3_Intron|MVK_ENST00000541384.1_Intron|MVK_ENST00000539696.1_Intron|MVK_ENST00000539575.1_Intron	NM_000431.2|NM_001114185.1	NP_000422.1|NP_001107657.1	Q03426	KIME_HUMAN	mevalonate kinase	150			S -> L (in HIDS). {ECO:0000269|PubMed:11313769}.		cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|negative regulation of inflammatory response (GO:0050728)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|mevalonate kinase activity (GO:0004496)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8						GCCGCCTACTCGGTGTGTCTG	0.637																																																0			12	GRCh37	CM010934	MVK	M							71.0	69.0	70.0					12																	110019277		2203	4300	6503	108503660	SO:0001583	missense	4598			M88468	CCDS9132.1, CCDS73522.1	12q24	2014-09-17	2008-01-30		ENSG00000110921	ENSG00000110921	2.7.1.36		7530	protein-coding gene	gene with protein product	"""LH receptor mRNA-binding protein"", ""mevalonic aciduria"""	251170	"""mevalonate kinase (mevalonic aciduria)"""			1377680	Standard	XM_005253883		Approved	LRBP, MK	uc001toy.4	Q03426	OTTHUMG00000169256	ENST00000228510.3:c.449C>T	12.37:g.110019277C>T	ENSP00000228510:p.Ser150Leu		108503660		Missense_Mutation	SNP	superfamily_Ribosomal protein S5 domain 2-like,HMMPfam_GHMP_kinases_N,PatternScan_GHMP_KINASES_ATP,superfamily_GHMP Kinase C-terminal domain,HMMPfam_GHMP_kinases_C	p.S150L	ENST00000228510.3	37	c.449	CCDS9132.1	12	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175779	0.78564	.	.	ENSG00000110921	ENST00000539335;ENST00000546277;ENST00000228510	D;D;D	0.85702	-2.02;-2.02;-2.02	5.15	5.15	0.70609	Ribosomal protein S5 domain 2-type fold (1);GHMP kinase (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.394630	0.28946	N	0.013634	D	0.89336	0.6686	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.63877	0.919	D	0.90122	0.4200	10	0.72032	D	0.01	-19.1924	14.1183	0.65169	0.0:1.0:0.0:0.0	.	150	Q03426	KIME_HUMAN	L	150	ENSP00000440379:S150L;ENSP00000438153:S150L;ENSP00000228510:S150L	ENSP00000228510:S150L	S	+	2	0	MVK	108503660	0.978000	0.34361	0.984000	0.44739	0.672000	0.39443	2.453000	0.44970	2.395000	0.81488	0.655000	0.94253	TCG	-	superfamily_Ribosomal protein S5 domain 2-like,HMMPfam_GHMP_kinases_N		0.637	MVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVK	protein_coding	OTTHUMT00000403143.1	C	NM_000431		108503660	+1	no_errors	NM_000431	genbank	human	reviewed	54_36p	missense	SNP	0.983	T
ACTL7A	10881	genome.wustl.edu	37	9	111624725	111624725	+	Silent	SNP	C	C	T	rs570985989		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr9:111624725C>T	ENST00000333999.3	+	1	123	c.123C>T	c.(121-123)gcC>gcT	p.A41A		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	41	Required for interaction with TES.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CGAAGCGGGCCGTGTGGGTCC	0.622																																					Esophageal Squamous(177;1480 3591 17554)											0			9											44.0	47.0	46.0					9																	111624725		2203	4300	6503	110664546	SO:0001819	synonymous_variant	10881			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.123C>T	9.37:g.111624725C>T			110664546	B2RC83|Q5JSV0	Silent	SNP	HMMPfam_Actin,superfamily_Actin-like ATPase domain,HMMSmart_SM00268	p.A41	ENST00000333999.3	37	c.123	CCDS6772.1	9																																																																																			-	NULL		0.622	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	protein_coding	OTTHUMT00000053570.1	C	NM_006687		110664546	+1	no_errors	NM_006687	genbank	human	reviewed	54_36p	silent	SNP	0.953	T
HECTD4	283450	genome.wustl.edu	37	12	112621071	112621071	+	Splice_Site	SNP	C	C	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr12:112621071C>A	ENST00000430131.2	-	61	10659		c.e61-1		HECTD4_ENST00000550722.1_Splice_Site|HECTD4_ENST00000377560.5_Splice_Site			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4						glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGGATCTTATCTGTGTGAACA	0.408																																																0			12											106.0	106.0	106.0					12																	112621071		1852	4100	5952	111105454	SO:0001630	splice_region_variant	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9514-1G>T	12.37:g.112621071C>A			111105454	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Splice_Site	SNP	-	e55-1	ENST00000430131.2	37	c.9514-1		12	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021060	0.93462	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C12orf51	111105454	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.153000	0.77428	2.687000	0.91594	0.655000	0.94253	.	-	-		0.408	HECTD4-202	KNOWN	basic	protein_coding	C12orf51	protein_coding		C	NM_173813	Intron	111105454	-1	no_errors	NM_001109662	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
PTPN3	5774	genome.wustl.edu	37	9	112199195	112199195	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr9:112199195C>T	ENST00000374541.2	-	9	747	c.643G>A	c.(643-645)Gac>Aac	p.D215N	PTPN3_ENST00000446349.1_Missense_Mutation_p.D84N|PTPN3_ENST00000262539.3_Missense_Mutation_p.D106N|PTPN3_ENST00000412145.1_Missense_Mutation_p.D84N	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	215	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CCATAGAAGTCGAGGGTCCGC	0.383																																																0			9											118.0	108.0	111.0					9																	112199195		2203	4300	6503	111239016	SO:0001583	missense	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.643G>A	9.37:g.112199195C>T	ENSP00000363667:p.Asp215Asn		111239016	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	HMMSmart_B41,superfamily_SSF54236,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729,HMMPfam_FERM_C,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase,PatternScan_TYR_PHOSPHATASE_1	p.D215N	ENST00000374541.2	37	c.643	CCDS6776.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.860110	0.97036	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000262539	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.82	5.82	0.92795	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.145706	0.64402	D	0.000010	D	0.90259	0.6954	M	0.68952	2.095	0.80722	D	1	D;P;D	0.67145	0.996;0.913;0.977	P;P;P	0.57204	0.815;0.595;0.756	D	0.90691	0.4613	10	0.72032	D	0.01	.	18.8705	0.92311	0.0:1.0:0.0:0.0	.	106;215;215	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	N	215;84;84;215;106	ENSP00000416654:D84N;ENSP00000395384:D84N;ENSP00000363667:D215N;ENSP00000262539:D106N	ENSP00000262539:D106N	D	-	1	0	PTPN3	111239016	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	6.275000	0.72594	2.752000	0.94435	0.655000	0.94253	GAC	-	HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729		0.383	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	protein_coding	OTTHUMT00000053598.4	C			111239016	-1	no_errors	NM_002829	genbank	human	reviewed	54_36p	missense	SNP	0.995	T
TDRD1	56165	genome.wustl.edu	37	10	115980407	115980407	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr10:115980407G>C	ENST00000369280.1	+	19	3035	c.2575G>C	c.(2575-2577)Gcc>Ccc	p.A859P	TDRD1_ENST00000369282.1_Missense_Mutation_p.A859P|TDRD1_ENST00000422662.1_Missense_Mutation_p.A463P|TDRD1_ENST00000369281.2_Missense_Mutation_p.A745P|TDRD1_ENST00000251864.2_Missense_Mutation_p.A859P			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	859					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		AAAATTGCAAGCCAGAGTGGT	0.393																																																0			10											123.0	115.0	117.0					10																	115980407		2203	4300	6503	115970397	SO:0001583	missense	56165			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2575G>C	10.37:g.115980407G>C	ENSP00000358286:p.Ala859Pro		115970397	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	HMMPfam_zf-MYND,PatternScan_ZF_MYND_1,HMMPfam_TUDOR,superfamily_SSF63748,HMMSmart_TUDOR	p.A859P	ENST00000369280.1	37	c.2575		10	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689631	0.88735	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.29917	2.56;2.52;1.55;2.13;2.58	5.83	5.83	0.93111	.	0.237004	0.42294	D	0.000729	T	0.58206	0.2106	M	0.76574	2.34	0.48087	D	0.999585	D;P;P;D;D	0.69078	0.997;0.955;0.892;0.973;0.975	D;P;P;P;P	0.76071	0.987;0.572;0.562;0.754;0.826	T	0.59295	-0.7481	10	0.72032	D	0.01	-12.1578	18.3179	0.90227	0.0:0.0:1.0:0.0	.	463;859;745;859;745	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	P	859;859;745;463;859	ENSP00000358288:A859P;ENSP00000251864:A859P;ENSP00000358287:A745P;ENSP00000402794:A463P;ENSP00000358286:A859P	ENSP00000251864:A859P	A	+	1	0	TDRD1	115970397	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.558000	0.73942	2.763000	0.94921	0.563000	0.77884	GCC	-	NULL		0.393	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	protein_coding	OTTHUMT00000050457.2	G			115970397	+1	no_errors	NM_198795	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FGFR2	2263	genome.wustl.edu	37	10	123279674	123279674	+	Missense_Mutation	SNP	G	G	C	rs77543610|rs281865420|rs387907372		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr10:123279674G>C	ENST00000358487.5	-	7	1030	c.758C>G	c.(757-759)cCt>cGt	p.P253R	FGFR2_ENST00000369059.1_Missense_Mutation_p.P138R|FGFR2_ENST00000457416.2_Missense_Mutation_p.P253R|FGFR2_ENST00000357555.5_Missense_Mutation_p.P164R|FGFR2_ENST00000369056.1_Missense_Mutation_p.P253R|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000351936.6_Missense_Mutation_p.P253R|FGFR2_ENST00000360144.3_Missense_Mutation_p.P164R|FGFR2_ENST00000369060.4_Missense_Mutation_p.P253R|FGFR2_ENST00000478859.1_Missense_Mutation_p.P25R|FGFR2_ENST00000356226.4_Missense_Mutation_p.P138R|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000346997.2_Missense_Mutation_p.P253R	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	253			P -> R (in APRS; common mutation). {ECO:0000269|PubMed:11781872, ECO:0000269|PubMed:7668257, ECO:0000269|PubMed:7719344, ECO:0000269|PubMed:9452027, ECO:0000269|PubMed:9677057}.|SP -> FS (in PS).		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.P253R(7)|p.P253L(3)|p.P164R(1)|p.P164L(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	GGGCCGGTGAGGCGATCGCTC	0.567		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																														Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	12	Substitution - Missense(12)	endometrium(8)|lung(4)	10	GRCh37	CM950459	FGFR2	M	rs77543610						58.0	47.0	50.0					10																	123279674		2203	4300	6503	123269664	SO:0001583	missense	2263	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.758C>G	10.37:g.123279674G>C	ENSP00000351276:p.Pro253Arg		123269664	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig,HMMPfam_I-set,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.P253R	ENST00000358487.5	37	c.758	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662958	0.67700	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	T;T;T;D;T;T;D;T;T;T;T;T	0.81908	-1.44;-1.47;-1.43;-1.55;-1.45;-1.47;-1.5;-1.47;-1.46;-1.47;-1.47;-1.41	5.79	5.79	0.91817	.	0.047110	0.85682	D	0.000000	D	0.86636	0.5980	M	0.70275	2.135	0.80722	A	1	P;B;D;B;B;B;B;D;B;B	0.62365	0.563;0.086;0.966;0.001;0.011;0.211;0.003;0.991;0.035;0.323	B;B;P;B;B;P;B;P;B;B	0.47705	0.153;0.045;0.555;0.005;0.059;0.506;0.036;0.488;0.029;0.278	D	0.88096	0.2816	9	0.87932	D	0	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	272;138;253;272;253;164;138;272;164;253	D3DRD4;B5A963;B5A960;D3DRD5;P21802-18;P21802-21;P21802-20;D3DRE0;P21802-22;P21802-17	.;.;.;.;.;.;.;.;.;.	R	164;253;253;138;253;138;253;253;253;164;253;253;164	ENSP00000350166:P164R;ENSP00000351276:P253R;ENSP00000348559:P138R;ENSP00000358056:P253R;ENSP00000358055:P138R;ENSP00000263451:P253R;ENSP00000410294:P253R;ENSP00000309878:P253R;ENSP00000353262:P164R;ENSP00000358052:P253R;ENSP00000358054:P253R;ENSP00000337665:P164R	ENSP00000337665:P164R	P	-	2	0	FGFR2	123269664	1.000000	0.71417	0.871000	0.34182	0.805000	0.45488	9.860000	0.99555	2.735000	0.93741	0.563000	0.77884	CCT	-	NULL		0.567	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	protein_coding	OTTHUMT00000050715.1	G	NM_022976, NM_000141		123269664	-1	no_errors	NM_022970	genbank	human	reviewed	54_36p	missense	SNP	0.988	C
OR8B3	390271	genome.wustl.edu	37	11	124266664	124266664	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr11:124266664T>A	ENST00000354597.3	-	1	600	c.584A>T	c.(583-585)aAc>aTc	p.N195I		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AACCACCTCGTTGACATAGGT	0.428																																																0			11											89.0	92.0	91.0					11																	124266664		2201	4299	6500	123771874	SO:0001583	missense	390271			AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.584A>T	11.37:g.124266664T>A	ENSP00000346611:p.Asn195Ile		123771874	Q6IFQ8|Q8NGH1	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N195I	ENST00000354597.3	37	c.584	CCDS31709.1	11	.	.	.	.	.	.	.	.	.	.	N	9.136	1.012511	0.19277	.	.	ENSG00000196661	ENST00000354597	T	0.00231	8.49	3.62	1.26	0.21427	GPCR, rhodopsin-like superfamily (1);	0.090718	0.47852	D	0.000209	T	0.00210	0.0006	L	0.41710	1.295	0.23425	N	0.997704	D	0.55172	0.97	P	0.51742	0.678	T	0.50423	-0.8830	10	0.62326	D	0.03	.	2.9325	0.05804	0.2931:0.2972:0.0:0.4097	.	195	Q8NGG8	OR8B3_HUMAN	I	195	ENSP00000346611:N195I	ENSP00000346611:N195I	N	-	2	0	OR8B3	123771874	0.027000	0.19231	0.108000	0.21378	0.170000	0.22686	1.164000	0.31810	0.250000	0.21479	0.454000	0.30748	AAC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.428	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B3	protein_coding	OTTHUMT00000387291.1	T	NM_001005467		123771874	-1	no_errors	NM_001005467	genbank	human	provisional	54_36p	missense	SNP	0.139	A
INTU	27152	genome.wustl.edu	37	4	128625389	128625389	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr4:128625389G>A	ENST00000335251.6	+	10	1613	c.1510G>A	c.(1510-1512)Gat>Aat	p.D504N	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	504					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						CCAGTCCGAGGATTACTATGA	0.308																																																0			4											113.0	116.0	115.0					4																	128625389		2203	4300	6503	128844839	SO:0001583	missense	27152			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1510G>A	4.37:g.128625389G>A	ENSP00000334003:p.Asp504Asn		128844839	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	HMMSmart_SM00228,superfamily_PDZ domain-like	p.D504N	ENST00000335251.6	37	c.1510	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.142783	0.94560	.	.	ENSG00000164066	ENST00000335251	T	0.35789	1.29	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.65319	-0.6197	10	0.72032	D	0.01	-20.6031	18.4011	0.90516	0.0:0.0:1.0:0.0	.	504	Q9ULD6	PDZD6_HUMAN	N	504	ENSP00000334003:D504N	ENSP00000334003:D504N	D	+	1	0	INTU	128844839	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.131000	0.94446	2.672000	0.90937	0.555000	0.69702	GAT	-	NULL		0.308	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	protein_coding	OTTHUMT00000364147.2	G	XM_371707		128844839	+1	no_errors	NM_015693	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PODXL	5420	genome.wustl.edu	37	7	131196071	131196071	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr7:131196071G>C	ENST00000378555.3	-	2	469	c.222C>G	c.(220-222)atC>atG	p.I74M	PODXL_ENST00000322985.9_Missense_Mutation_p.I74M|PODXL_ENST00000537928.1_Missense_Mutation_p.I74M|PODXL_ENST00000465001.1_5'UTR|PODXL_ENST00000541194.1_Missense_Mutation_p.I76M			O00592	PODXL_HUMAN	podocalyxin-like	74	Thr-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CCGAGGCCAAGATTTCGTTGG	0.562																																																0			7											188.0	181.0	183.0					7																	131196071		2203	4300	6503	130846611	SO:0001583	missense	5420				CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.222C>G	7.37:g.131196071G>C	ENSP00000367817:p.Ile74Met		130846611	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	HMMPfam_CD34_antigen	p.I74M	ENST00000378555.3	37	c.222	CCDS34755.1	7	.	.	.	.	.	.	.	.	.	.	G	6.587	0.476646	0.12521	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000544955;ENST00000378555;ENST00000322985	T;T;T;T	0.12569	2.8;2.67;2.81;2.79	2.93	-5.86	0.02304	.	24.233300	0.00678	N	0.000661	T	0.06325	0.0163	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.25847	-1.0120	10	0.45353	T	0.12	3.1544	3.3928	0.07295	0.1405:0.4103:0.3345:0.1148	.	74;74	O00592-2;O00592	.;PODXL_HUMAN	M	76;74;64;74;74	ENSP00000440518:I76M;ENSP00000442655:I74M;ENSP00000367817:I74M;ENSP00000319782:I74M	ENSP00000319782:I74M	I	-	3	3	PODXL	130846611	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.452000	0.06787	-2.025000	0.00935	0.511000	0.50034	ATC	-	NULL		0.562	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	protein_coding	OTTHUMT00000337627.2	G	NM_001018111		130846611	-1	no_errors	NM_001018111	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
OR2A4	79541	genome.wustl.edu	37	6	132021773	132021773	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr6:132021773T>A	ENST00000315453.2	-	1	862	c.769A>T	c.(769-771)Atg>Ttg	p.M257L	ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000414305.1_Intron	NM_030908.1	NP_112170.1	O95047	OR2A4_HUMAN	olfactory receptor, family 2, subfamily A, member 4	257					positive regulation of cytokinesis (GO:0032467)|regulation of actin cytoskeleton organization (GO:0032956)	cleavage furrow (GO:0032154)|Flemming body (GO:0090543)|integral component of membrane (GO:0016021)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|ovary(1)|skin(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.018)|OV - Ovarian serous cystadenocarcinoma(155;0.041)		CCAACATACATGATAATGGCT	0.473																																																0			6											52.0	75.0	68.0					6																	132021773		1799	4252	6051	132063466	SO:0001583	missense	79541			AC005587	CCDS5149.1	6q23	2012-08-09	2003-05-22		ENSG00000180658	ENSG00000180658		"""GPCR / Class A : Olfactory receptors"""	14729	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 10"""	OR2A10			Standard	NM_030908		Approved		uc011ecd.2	O95047	OTTHUMG00000016316	ENST00000315453.2:c.769A>T	6.37:g.132021773T>A	ENSP00000319546:p.Met257Leu		132063466	Q0VAR3|Q6IF18|Q9NQN0	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.M257L	ENST00000315453.2	37	c.769	CCDS5149.1	6	.	.	.	.	.	.	.	.	.	.	-	2.989	-0.208582	0.06140	.	.	ENSG00000180658	ENST00000315453	T	0.00115	8.71	1.65	0.0121	0.14090	GPCR, rhodopsin-like superfamily (1);	0.387008	0.19223	U	0.119603	T	0.00039	0.0001	L	0.41632	1.29	0.20638	N	0.999872	B	0.26935	0.164	B	0.21917	0.037	T	0.31916	-0.9926	10	0.59425	D	0.04	.	4.7835	0.13213	0.5003:0.0:0.0:0.4997	.	257	O95047	OR2A4_HUMAN	L	257	ENSP00000319546:M257L	ENSP00000319546:M257L	M	-	1	0	OR2A4	132063466	0.009000	0.17119	0.998000	0.56505	0.000000	0.00434	0.215000	0.17562	-0.085000	0.12573	0.000000	0.15137	ATG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.473	OR2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A4	protein_coding	OTTHUMT00000109221.1	T	NM_030908		132063466	-1	no_errors	NM_030908	genbank	human	provisional	54_36p	missense	SNP	0.995	A
UBN2	254048	genome.wustl.edu	37	7	138969002	138969002	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr7:138969002G>A	ENST00000473989.3	+	15	3351	c.3351G>A	c.(3349-3351)atG>atA	p.M1117I	UBN2_ENST00000288561.8_Missense_Mutation_p.M1034I	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1117	Ser-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CCAGTGGAATGAACATCAGCA	0.498																																																0			7											79.0	82.0	81.0					7																	138969002		2021	4192	6213	138619542	SO:0001583	missense	254048			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.3351G>A	7.37:g.138969002G>A	ENSP00000418648:p.Met1117Ile		138619542	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	PatternScan_TUBULIN	p.M1034I	ENST00000473989.3	37	c.3102	CCDS43655.2	7	.	.	.	.	.	.	.	.	.	.	G	1.183	-0.637677	0.03557	.	.	ENSG00000157741	ENST00000473989;ENST00000288561	T;T	0.28895	1.59;1.6	5.51	-11.0	0.00169	.	1.032470	0.07602	N	0.923919	T	0.09730	0.0239	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13548	-1.0505	10	0.18710	T	0.47	1.6182	4.8769	0.13660	0.3872:0.3764:0.1607:0.0757	.	1117	Q6ZU65	UBN2_HUMAN	I	1117;1034	ENSP00000418648:M1117I;ENSP00000288561:M1034I	ENSP00000288561:M1034I	M	+	3	0	UBN2	138619542	0.154000	0.22792	0.016000	0.15963	0.874000	0.50279	-0.686000	0.05161	-2.134000	0.00812	-1.141000	0.01876	ATG	-	NULL		0.498	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	protein_coding	OTTHUMT00000349272.3	G	NM_173569		138619542	+1	no_errors	NM_173569	genbank	human	validated	54_36p	missense	SNP	0.097	A
PCDHA8	56140	genome.wustl.edu	37	5	140221195	140221195	+	Missense_Mutation	SNP	G	G	C	rs199713478	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr5:140221195G>C	ENST00000531613.1	+	1	289	c.289G>C	c.(289-291)Ggg>Cgg	p.G97R	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.G97R|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G97R(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGTGCGGGCGGAGCGC	0.577													.|||	572	0.114217	0.1036	0.1499	5008	,	,		18938	0.0933		0.1103	False		,,,				2504	0.1288															2	Substitution - Missense(2)	NS(2)	5																																								140201379	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.289G>C	5.37:g.140221195G>C	ENSP00000434655:p.Gly97Arg		140201379	B9EGT7|O75281	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.G97R	ENST00000531613.1	37	c.289	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373716	0.61624	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.30981	1.51;1.51	3.91	3.91	0.45181	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.213176	0.22539	U	0.058753	T	0.36413	0.0966	M	0.70595	2.14	0.24709	N	0.993216	P;D	0.56287	0.915;0.975	P;P	0.47744	0.49;0.556	T	0.29397	-1.0013	10	0.49607	T	0.09	.	7.8746	0.29586	0.1899:0.0:0.8101:0.0	.	97;97	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	R	97	ENSP00000434655:G97R;ENSP00000367363:G97R	ENSP00000367363:G97R	G	+	1	0	PCDHA8	140201379	0.396000	0.25262	1.000000	0.80357	0.974000	0.67602	2.166000	0.42406	1.900000	0.55004	0.552000	0.68991	GGG	-	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112		0.577	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	protein_coding	OTTHUMT00000372830.2	G	NM_018911		140201379	+1	no_errors	NM_018911	genbank	human	reviewed	54_36p	missense	SNP	0.705	C
TPK1	27010	genome.wustl.edu	37	7	144344268	144344268	+	Intron	SNP	A	A	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr7:144344268A>T	ENST00000360057.3	-	5	361				TPK1_ENST00000378099.3_Intron|TPK1_ENST00000538212.2_Intron|TPK1_ENST00000549981.1_Intron|TPK1_ENST00000547966.1_Intron	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1						small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	GGCAGGTATTAGGGATAATAT	0.448																																					Ovarian(45;88 1034 2073 5829 28455)											0			7																																								143975201	SO:0001627	intron_variant	0			AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.258+1631T>A	7.37:g.144344268A>T			143975201	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	RNA	SNP	-	NULL	ENST00000360057.3	37	NULL	CCDS5888.1	7																																																																																			-	-		0.448	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132804	protein_coding	OTTHUMT00000327777.1	A	NM_022445		143975201	-1	pseudogene	XR_038193	genbank	human	model	54_36p	rna	SNP	0.616	T
MMAA	166785	genome.wustl.edu	37	4	146546739	146546739	+	Intron	SNP	G	G	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr4:146546739G>T	ENST00000281317.5	+	1	1145					NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type						cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATGGTGATGGTCTGGCACAG	0.433																																																0			4																																								146766189	SO:0001627	intron_variant	729497			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.-66+6180G>T	4.37:g.146546739G>T			146766189	B3KX40|Q495G7	RNA	SNP	-	NULL	ENST00000281317.5	37	NULL	CCDS3766.1	4																																																																																			-	-		0.433	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729497	protein_coding	OTTHUMT00000364668.2	G			146766189	-1	pseudogene	XR_015940	genbank	human	model	54_36p	rna	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152500388	152500388	+	Silent	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr2:152500388G>A	ENST00000172853.10	-	57	8047	c.7900C>T	c.(7900-7902)Ctg>Ttg	p.L2634L	NEB_ENST00000397345.3_Silent_p.L2634L|NEB_ENST00000427231.2_Silent_p.L2634L|NEB_ENST00000603639.1_Silent_p.L2634L|NEB_ENST00000604864.1_Silent_p.L2634L|NEB_ENST00000409198.1_Silent_p.L2634L			P20929	NEBU_HUMAN	nebulin	2634					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGTCGGGCAGGCATGTCCAC	0.547																																																0			2											226.0	217.0	220.0					2																	152500388		2051	4206	6257	152208634	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7900C>T	2.37:g.152500388G>A			152208634	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	HMMSmart_SM00227,HMMPfam_Nebulin,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.L2634	ENST00000172853.10	37	c.7900		2																																																																																			-	HMMSmart_SM00227		0.547	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		G	NM_004543		152208634	-1	no_errors	NM_004543	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
FCRL4	83417	genome.wustl.edu	37	1	157559011	157559011	+	Missense_Mutation	SNP	C	C	T	rs200366937		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:157559011C>T	ENST00000271532.1	-	3	425	c.290G>A	c.(289-291)cGc>cAc	p.R97H	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	97	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AAAGAGCAAGCGCACAGGGTT	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		18190	0.0		0.001	False		,,,				2504	0.0															0			1											65.0	71.0	69.0					1																	157559011		2203	4300	6503	155825635	SO:0001583	missense	83417			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.290G>A	1.37:g.157559011C>T	ENSP00000271532:p.Arg97His		155825635	Q96PJ3|Q96RE0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.R97H	ENST00000271532.1	37	c.290	CCDS1166.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.009	-1.828377	0.00584	.	.	ENSG00000163518	ENST00000271532	T	0.13538	2.58	4.2	-8.41	0.00961	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	5.085590	0.00616	N	0.000432	T	0.00936	0.0031	N	0.11255	0.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29610	-1.0006	10	0.02654	T	1	.	3.4917	0.07639	0.1931:0.447:0.1785:0.1815	.	97	Q96PJ5	FCRL4_HUMAN	H	97	ENSP00000271532:R97H	ENSP00000271532:R97H	R	-	2	0	FCRL4	155825635	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-3.799000	0.00363	-3.237000	0.00208	-1.031000	0.02408	CGC	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.502	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	protein_coding	OTTHUMT00000086180.1	C	NM_031282		155825635	-1	no_errors	NM_031282	genbank	human	provisional	54_36p	missense	SNP	0.000	T
ADAM19	8728	genome.wustl.edu	37	5	156915448	156915448	+	Missense_Mutation	SNP	C	C	T	rs138014472		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr5:156915448C>T	ENST00000517905.1	-	21	2419	c.2375G>A	c.(2374-2376)cGg>cAg	p.R792Q	ADAM19_ENST00000394020.1_Missense_Mutation_p.R794Q|ADAM19_ENST00000257527.4_Missense_Mutation_p.R792Q|ADAM19_ENST00000430702.2_Missense_Mutation_p.R525Q			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	792					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGAGGGGGCCGGGGAGGAGG	0.607																																																0			5						C	GLN/ARG	0,4402		0,0,2201	33.0	36.0	35.0		2375	3.8	1.0	5	dbSNP_134	35	2,8588		0,2,4293	no	missense	ADAM19	NM_033274.3	43	0,2,6494	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	792/919	156915448	2,12990	2201	4295	6496	156848026	SO:0001583	missense	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2375G>A	5.37:g.156915448C>T	ENSP00000428654:p.Arg792Gln		156848026	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,HMMPfam_EGF_2,PatternScan_EGF_2"	p.R792Q	ENST00000517905.1	37	c.2375		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.80|10.80	1.451453|1.451453	0.26074|0.26074	0.0|0.0	2.33E-4|2.33E-4	ENSG00000135074|ENSG00000135074	ENST00000517374|ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	.|T;T;T;T	.|0.01685	.|4.69;4.81;4.84;4.81	5.58|5.58	3.79|3.79	0.43588|0.43588	.|.	.|0.327401	.|0.26708	.|N	.|0.022916	T|T	0.01189|0.01189	0.0039|0.0039	L|L	0.35487|0.35487	1.065|1.065	0.30636|0.30636	N|N	0.756988|0.756988	.|B;B;B	.|0.33494	.|0.414;0.147;0.106	.|B;B;B	.|0.20384	.|0.029;0.009;0.024	T|T	0.34030|0.34030	-0.9845|-0.9845	5|10	.|0.10377	.|T	.|0.69	.|.	4.474|4.474	0.11726|0.11726	0.1722:0.6183:0.0:0.2094|0.1722:0.6183:0.0:0.2094	.|.	.|792;792;525	.|Q9H013-2;Q9H013;E9PD32	.|.;ADA19_HUMAN;.	S|Q	363|525;792;794;792	.|ENSP00000414088:R525Q;ENSP00000257527:R792Q;ENSP00000377588:R794Q;ENSP00000428654:R792Q	.|ENSP00000257527:R792Q	G|R	-|-	1|2	0|0	ADAM19|ADAM19	156848026|156848026	0.113000|0.113000	0.22115|0.22115	0.970000|0.970000	0.41538|0.41538	0.034000|0.034000	0.12701|0.12701	0.374000|0.374000	0.20501|0.20501	0.709000|0.709000	0.31976|0.31976	-0.332000|-0.332000	0.08345|0.08345	GGC|CGG	-	NULL		0.607	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	protein_coding	OTTHUMT00000373918.1	C	NM_033274		156848026	-1	no_errors	NM_033274	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
ATP10B	23120	genome.wustl.edu	37	5	160047770	160047770	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr5:160047770G>A	ENST00000327245.5	-	15	2846	c.2000C>T	c.(1999-2001)tCt>tTt	p.S667F	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	667					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTGCACACAGATGCATCATC	0.587																																																0			5											67.0	70.0	69.0					5																	160047770		2170	4272	6442	159980348	SO:0001583	missense	23120			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2000C>T	5.37:g.160047770G>A	ENSP00000313600:p.Ser667Phe		159980348	Q9H725	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Hydrolase_3	p.S667F	ENST00000327245.5	37	c.2000	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	3.685	-0.064763	0.07273	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.86497	-2.13;-2.13	5.36	5.36	0.76844	HAD-like domain (1);	0.317848	0.30979	N	0.008498	D	0.86892	0.6042	L	0.58101	1.795	0.21652	N	0.9996	P;P	0.52463	0.817;0.953	B;P	0.44597	0.372;0.454	T	0.81510	-0.0900	9	.	.	.	.	18.1147	0.89549	0.0:0.0:1.0:0.0	.	275;667	Q2YDW8;O94823	.;AT10B_HUMAN	F	667;275	ENSP00000313600:S667F;ENSP00000431081:S275F	.	S	-	2	0	ATP10B	159980348	1.000000	0.71417	0.536000	0.28039	0.021000	0.10359	5.996000	0.70639	2.523000	0.85059	0.655000	0.94253	TCT	-	superfamily_HAD-like		0.587	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	protein_coding	OTTHUMT00000374127.1	G	NM_025153		159980348	-1	no_errors	NM_025153	genbank	human	validated	54_36p	missense	SNP	0.005	A
DUSP27	92235	genome.wustl.edu	37	1	167097496	167097496	+	Missense_Mutation	SNP	G	G	A	rs373097210		TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:167097496G>A	ENST00000361200.2	+	6	3294	c.3128G>A	c.(3127-3129)cGc>cAc	p.R1043H	DUSP27_ENST00000443333.1_Missense_Mutation_p.R1043H|DUSP27_ENST00000271385.5_Missense_Mutation_p.R1043H|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1043					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TACTTCTTCCGCCGGACCCCA	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		17980	0.001		0.0	False		,,,				2504	0.0															0			1						G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	30.0	35.0	34.0		3128	3.0	1.0	1		34	0,8600		0,0,4300	no	missense	DUSP27	NM_001080426.1	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	1043/1159	167097496	2,13004	2203	4300	6503	165364120	SO:0001583	missense	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3128G>A	1.37:g.167097496G>A	ENSP00000354483:p.Arg1043His		165364120	A0AUM4|Q9C074	Missense_Mutation	SNP	PatternScan_TYR_PHOSPHATASE_1,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc	p.R1043H	ENST00000361200.2	37	c.3128	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404622	0.42613	4.54E-4	0.0	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03607	3.87;3.87;3.87	5.25	3.01	0.34805	.	0.728597	0.12539	N	0.460071	T	0.02047	0.0064	L	0.57536	1.79	0.25501	N	0.987551	B	0.18610	0.029	B	0.10450	0.005	T	0.36553	-0.9743	10	0.87932	D	0	-4.8272	11.2261	0.48884	0.1697:0.0:0.8303:0.0	.	1043	Q5VZP5	DUS27_HUMAN	H	1043	ENSP00000354483:R1043H;ENSP00000271385:R1043H;ENSP00000404874:R1043H	ENSP00000271385:R1043H	R	+	2	0	DUSP27	165364120	0.997000	0.39634	0.989000	0.46669	0.516000	0.34256	2.891000	0.48617	1.189000	0.43028	0.643000	0.83706	CGC	-	NULL		0.587	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	protein_coding	OTTHUMT00000083244.1	G	NM_001080426		165364120	+1	no_errors	NM_001080426	genbank	human	provisional	54_36p	missense	SNP	0.976	A
WDR49	151790	genome.wustl.edu	37	3	167246840	167246840	+	Splice_Site	SNP	C	C	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr3:167246840C>A	ENST00000308378.3	-	10	1655	c.1350G>T	c.(1348-1350)gaG>gaT	p.E450D	WDR49_ENST00000476376.1_Splice_Site_p.E275D|WDR49_ENST00000453925.2_Splice_Site_p.E514D|WDR49_ENST00000479765.1_Intron	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	450								p.E450D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TTCAATTTACCTCTATATTCC	0.358																																																1	Substitution - Missense(1)	lung(1)	3											64.0	61.0	62.0					3																	167246840		2203	4299	6502	168729534	SO:0001630	splice_region_variant	151790			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1350+1G>T	3.37:g.167246840C>A			168729534	Q8N297	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.E450D	ENST00000308378.3	37	c.1350	CCDS3201.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.827757|2.827757	0.50845|0.50845	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925|ENST00000472600;ENST00000493061	T;T;T|.	0.35048|.	1.59;1.33;2.29|.	5.52|5.52	2.43|2.43	0.29744|0.29744	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.391663|.	0.29676|.	N|.	0.011493|.	T|T	0.44117|0.44117	0.1278|0.1278	L|L	0.57536|0.57536	1.79|1.79	0.19575|0.19575	N|N	0.999968|0.999968	P;P|.	0.48694|.	0.914;0.651|.	B;B|.	0.41236|.	0.351;0.165|.	T|T	0.28459|0.28459	-1.0043|-1.0043	9|5	.|.	.|.	.|.	.|.	8.8415|8.8415	0.35144|0.35144	0.0:0.7211:0.0:0.2789|0.0:0.7211:0.0:0.2789	.|.	514;450|.	E7EQK3;Q8IV35|.	.;WDR49_HUMAN|.	D|M	450;275;514|526;88	ENSP00000311343:E450D;ENSP00000420508:E275D;ENSP00000410863:E514D|.	.|.	E|R	-|-	3|2	2|0	WDR49|WDR49	168729534|168729534	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.970000|0.970000	0.65996|0.65996	1.759000|1.759000	0.38420|0.38420	0.172000|0.172000	0.19760|0.19760	0.563000|0.563000	0.77884|0.77884	GAG|AGG	-	superfamily_WD40 repeat-like		0.358	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	protein_coding	OTTHUMT00000350592.3	C	NM_178824	Missense_Mutation	168729534	-1	no_errors	NM_178824	genbank	human	provisional	54_36p	missense	SNP	1.000	A
HNRNPA3	220988	genome.wustl.edu	37	2	178082446	178082446	+	Silent	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr2:178082446C>T	ENST00000392524.2	+	8	1071	c.834C>T	c.(832-834)ggC>ggT	p.G278G	HNRNPA3_ENST00000411529.2_Silent_p.G256G|HNRNPA3_ENST00000435711.1_Silent_p.G278G			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	278	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GCAACTATGGCGGTGGTCCTG	0.448																																																0			2											249.0	251.0	250.0					2																	178082446		2203	4300	6503	177790692	SO:0001819	synonymous_variant	220988			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.834C>T	2.37:g.178082446C>T			177790692	D3DPF4|Q53RW7|Q6URK5	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.G278	ENST00000392524.2	37	c.834	CCDS2273.1	2																																																																																			-	NULL		0.448	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	protein_coding	OTTHUMT00000255729.3	C	NM_194247		177790692	+1	no_errors	NM_194247	genbank	human	validated	54_36p	silent	SNP	0.979	T
DCTD	1635	genome.wustl.edu	37	4	183836655	183836655	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr4:183836655C>T	ENST00000438320.2	-	2	357	c.67G>A	c.(67-69)Gcc>Acc	p.A23T	DCTD_ENST00000510370.1_Missense_Mutation_p.A23T|DCTD_ENST00000357067.3_Missense_Mutation_p.A34T|DCTD_ENST00000513383.1_5'UTR	NM_001921.2	NP_001912.2	P32321	DCTD_HUMAN	dCMP deaminase	23					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	dCMP deaminase activity (GO:0004132)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|urinary_tract(1)	18		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)	Cytarabine(DB00987)	GATAAGAAGGCCACAGCCATA	0.413																																																0			4											121.0	133.0	129.0					4																	183836655		2203	4300	6503	184073649	SO:0001583	missense	1635			L12136	CCDS3831.1, CCDS34108.1	4q35.1	2008-08-01			ENSG00000129187	ENSG00000129187	3.5.4.12		2710	protein-coding gene	gene with protein product		607638					Standard	XM_005262778		Approved		uc003ivg.3	P32321	OTTHUMG00000160685	ENST00000438320.2:c.67G>A	4.37:g.183836655C>T	ENSP00000398194:p.Ala23Thr		184073649	B2R836|D3DP49|D3DP50|Q5M7Z8|Q9BVD8	Missense_Mutation	SNP	HMMPfam_dCMP_cyt_deam_1,superfamily_Cytidine_deaminase-like,PatternScan_CYT_DCMP_DEAMINASES	p.A34T	ENST00000438320.2	37	c.100	CCDS3831.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.541156	0.96474	.	.	ENSG00000129187	ENST00000357067;ENST00000438320;ENST00000510370;ENST00000503182;ENST00000510307;ENST00000512766;ENST00000514754;ENST00000503820;ENST00000503988;ENST00000508994	T;T;T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	4.58	4.58	0.56647	Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.000000	0.85682	D	0.000000	D	0.84754	0.5542	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	D	0.88066	0.2797	10	0.87932	D	0	-19.9159	17.9365	0.89013	0.0:1.0:0.0:0.0	.	34;23	P32321-2;P32321	.;DCTD_HUMAN	T	34;23;23;23;23;23;23;23;23;23	ENSP00000349576:A34T;ENSP00000398194:A23T;ENSP00000424017:A23T;ENSP00000422662:A23T;ENSP00000424050:A23T;ENSP00000423182:A23T;ENSP00000423894:A23T;ENSP00000421792:A23T;ENSP00000422729:A23T	ENSP00000349576:A34T	A	-	1	0	DCTD	184073649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.303000	0.78871	2.530000	0.85305	0.655000	0.94253	GCC	-	HMMPfam_dCMP_cyt_deam_1,superfamily_Cytidine_deaminase-like		0.413	DCTD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTD	protein_coding	OTTHUMT00000361743.2	C			184073649	-1	no_errors	NM_001012732	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197396643	197396643	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:197396643G>A	ENST00000367400.3	+	7	2323	c.2188G>A	c.(2188-2190)Gat>Aat	p.D730N	CRB1_ENST00000544212.1_Missense_Mutation_p.D211N|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Missense_Mutation_p.D618N|CRB1_ENST00000535699.1_Missense_Mutation_p.D661N|CRB1_ENST00000367397.1_Missense_Mutation_p.D111N|CRB1_ENST00000543483.1_3'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	730	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTTTACTCTTGATGAGAGCTA	0.418																																																0			1											87.0	77.0	80.0					1																	197396643		2203	4300	6503	195663266	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2188G>A	1.37:g.197396643G>A	ENSP00000356370:p.Asp730Asn		195663266	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_C_TYPE_LECTIN_1	p.D730N	ENST00000367400.3	37	c.2188	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	5.870	0.344617	0.11126	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.75	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.60366	0.2263	N	0.16368	0.405	0.20638	N	0.999875	B;B;B;B	0.17268	0.005;0.021;0.005;0.007	B;B;B;B	0.15484	0.009;0.013;0.006;0.004	T	0.35871	-0.9771	9	0.08837	T	0.75	.	11.6491	0.51277	0.1444:0.0:0.8556:0.0	.	661;618;379;730	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	N	661;730;618;211;111;379	ENSP00000438786:D661N;ENSP00000356370:D730N;ENSP00000356369:D618N;ENSP00000444556:D211N;ENSP00000356367:D111N	ENSP00000356367:D111N	D	+	1	0	CRB1	195663266	0.043000	0.20138	0.004000	0.12327	0.007000	0.05969	2.149000	0.42244	0.757000	0.33036	0.650000	0.86243	GAT	-	superfamily_Concanavalin A-like lectins/glucanases		0.418	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253		195663266	+1	no_errors	NM_201253	genbank	human	reviewed	54_36p	missense	SNP	0.411	A
CRB1	23418	genome.wustl.edu	37	1	197396764	197396764	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:197396764G>C	ENST00000367400.3	+	7	2444	c.2309G>C	c.(2308-2310)gGc>gCc	p.G770A	CRB1_ENST00000544212.1_Missense_Mutation_p.G251A|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Missense_Mutation_p.G658A|CRB1_ENST00000535699.1_Missense_Mutation_p.G701A|CRB1_ENST00000367397.1_Missense_Mutation_p.G151A|CRB1_ENST00000543483.1_3'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	770	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTAGAGCGCGGCAGACTAGCA	0.408																																																0			1											51.0	49.0	49.0					1																	197396764		2203	4300	6503	195663387	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2309G>C	1.37:g.197396764G>C	ENSP00000356370:p.Gly770Ala		195663387	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	PatternScan_ASX_HYDROXYL,HMMSmart_SM00282,HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,PatternScan_C_TYPE_LECTIN_1,superfamily_EGF/Laminin	p.G770A	ENST00000367400.3	37	c.2309	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176848	0.57692	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12	5.56	5.56	0.83823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.94955	0.8368	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	D	0.95018	0.8158	9	0.54805	T	0.06	.	19.5255	0.95203	0.0:0.0:1.0:0.0	.	701;658;419;770	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	A	701;770;658;251;151;419	ENSP00000438786:G701A;ENSP00000356370:G770A;ENSP00000356369:G658A;ENSP00000444556:G251A;ENSP00000356367:G151A	ENSP00000356367:G151A	G	+	2	0	CRB1	195663387	1.000000	0.71417	0.176000	0.23000	0.017000	0.09413	9.212000	0.95126	2.595000	0.87683	0.650000	0.86243	GGC	-	HMMSmart_SM00282,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2		0.408	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253		195663387	+1	no_errors	NM_201253	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
USH2A	7399	genome.wustl.edu	37	1	215848894	215848894	+	Missense_Mutation	SNP	C	C	T	rs188008529	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:215848894C>T	ENST00000307340.3	-	63	12745	c.12359G>A	c.(12358-12360)cGc>cAc	p.R4120H	USH2A_ENST00000366943.2_Missense_Mutation_p.R4120H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4120	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATCCAGGCGGCGGAAGAGAAA	0.532										HNSCC(13;0.011)			C|||	3	0.000599042	0.0	0.0014	5008	,	,		16504	0.001		0.001	False		,,,				2504	0.0															0			1											64.0	62.0	62.0					1																	215848894		2203	4300	6503	213915517	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12359G>A	1.37:g.215848894C>T	ENSP00000305941:p.Arg4120His		213915517	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.R4120H	ENST00000307340.3	37	c.12359	CCDS31025.1	1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	24.6	4.553248	0.86127	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54279	0.58;0.58	5.25	5.25	0.73442	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.38164	N	0.001785	T	0.67998	0.2953	M	0.65975	2.015	0.49915	D	0.999838	D	0.89917	1.0	D	0.69142	0.962	T	0.70306	-0.4908	10	0.62326	D	0.03	.	12.2311	0.54488	0.0:0.9223:0.0:0.0777	.	4120	O75445	USH2A_HUMAN	H	4120	ENSP00000305941:R4120H;ENSP00000355910:R4120H	ENSP00000305941:R4120H	R	-	2	0	USH2A	213915517	0.998000	0.40836	0.426000	0.26672	0.974000	0.67602	4.575000	0.60908	2.454000	0.82982	0.650000	0.86243	CGC	-	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.532	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123		213915517	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	missense	SNP	0.962	T
MARCH4	57574	genome.wustl.edu	37	2	217234468	217234468	+	Splice_Site	SNP	C	C	G			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr2:217234468C>G	ENST00000273067.4	-	1	2282	c.516G>C	c.(514-516)caG>caC	p.Q172H		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	172						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GGGGACTCACCTGTTCTGGCC	0.537																																																0			2											82.0	83.0	82.0					2																	217234468		2203	4300	6503	216942713	SO:0001630	splice_region_variant	57574			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.516+1G>C	2.37:g.217234468C>G			216942713	Q4KMN7|Q86WR8	Missense_Mutation	SNP	HMMSmart_RINGv,HMMPfam_zf-C3HC4	p.Q172H	ENST00000273067.4	37	c.516	CCDS33376.1	2	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144237	0.37825	.	.	ENSG00000144583	ENST00000273067	T	0.29917	1.55	5.5	5.5	0.81552	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.143577	0.48767	D	0.000174	T	0.31857	0.0810	L	0.52126	1.63	0.49687	D	0.99981	B	0.17038	0.02	B	0.17433	0.018	T	0.04961	-1.0915	9	.	.	.	0.0268	18.7696	0.91885	0.0:1.0:0.0:0.0	.	172	Q9P2E8	MARH4_HUMAN	H	172	ENSP00000273067:Q172H	.	Q	-	3	2	MARCH4	216942713	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.500000	0.53318	2.757000	0.94681	0.591000	0.81541	CAG	-	HMMSmart_RINGv,HMMPfam_zf-C3HC4		0.537	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH4	protein_coding	OTTHUMT00000337272.2	C	NM_020814	Missense_Mutation	216942713	-1	no_errors	NM_020814	genbank	human	validated	54_36p	missense	SNP	1.000	G
GNPAT	8443	genome.wustl.edu	37	1	231401855	231401855	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:231401855G>T	ENST00000366647.4	+	7	1037	c.868G>T	c.(868-870)Gaa>Taa	p.E290*	GNPAT_ENST00000366646.3_Nonsense_Mutation_p.E229*	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	290					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GATCTTGGAAGAAACTCTTTA	0.363																																																0			1											116.0	116.0	116.0					1																	231401855		2203	4300	6503	229468478	SO:0001587	stop_gained	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.868G>T	1.37:g.231401855G>T	ENSP00000355607:p.Glu290*		229468478	B4DNM9|Q5TBH7|Q9BWC2	Nonsense_Mutation	SNP	HMMPfam_Acyltransferase,superfamily_SSF69593,HMMSmart_PlsC	p.E290*	ENST00000366647.4	37	c.868	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.860793	0.97893	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6181	0.95643	0.0:0.0:1.0:0.0	.	.	.	.	X	290;229;280	.	.	E	+	1	0	GNPAT	229468478	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.639000	0.89480	0.460000	0.39030	GAA	-	superfamily_SSF69593		0.363	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	protein_coding	OTTHUMT00000092871.1	G			229468478	+1	no_errors	NM_014236	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
LRRFIP1	9208	genome.wustl.edu	37	2	238688126	238688126	+	Missense_Mutation	SNP	G	G	A	rs200515993	byFrequency	TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr2:238688126G>A	ENST00000308482.9	+	24	1943	c.1874G>A	c.(1873-1875)cGt>cAt	p.R625H		NM_001137550.1	NP_001131022.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	471					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TTAGTGAAGCGTCTGGAAAAA	0.488													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18110	0.0		0.0	False		,,,				2504	0.0															0			2											76.0	70.0	72.0					2																	238688126		1568	3582	5150	238352865	SO:0001583	missense	9208			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000308482.9:c.1874G>A	2.37:g.238688126G>A	ENSP00000310109:p.Arg625His		238352865	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	HMMPfam_DUF2051	p.R625H	ENST00000308482.9	37	c.1874	CCDS46551.1	2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	33	5.228303	0.95173	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	D	0.83163	-1.69	4.85	4.85	0.62838	.	.	.	.	.	D	0.91663	0.7365	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.92967	0.6394	9	0.87932	D	0	.	17.3552	0.87334	0.0:0.0:1.0:0.0	.	379;625	B4DPC0;E9PGZ2	.;.	H	625;615	ENSP00000310109:R625H	ENSP00000310109:R625H	R	+	2	0	LRRFIP1	238352865	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	9.375000	0.97178	2.409000	0.81822	0.563000	0.77884	CGT	-	NULL		0.488	LRRFIP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRFIP1	protein_coding	OTTHUMT00000257169.3	G	NM_004735		238352865	+1	no_errors	ENST00000308482	ensembl	human	known	54_36p	missense	SNP	1.000	A
CEP170	9859	genome.wustl.edu	37	1	243328396	243328396	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:243328396G>A	ENST00000366542.1	-	13	2917	c.2866C>T	c.(2866-2868)Cga>Tga	p.R956*	RP11-261C10.4_ENST00000437499.1_RNA|RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000366543.1_Nonsense_Mutation_p.R858*|CEP170_ENST00000366544.1_Nonsense_Mutation_p.R858*|CEP170_ENST00000490813.1_5'Flank	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	956	Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AAACTCTTTCGCTTTTGGGTT	0.373																																																0			1											13.0	12.0	12.0					1																	243328396		1740	3931	5671	241395019	SO:0001587	stop_gained	9859			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.2866C>T	1.37:g.243328396G>A	ENSP00000355500:p.Arg956*		241395019	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Nonsense_Mutation	SNP	superfamily_SMAD/FHA domain,HMMSmart_SM00240,HMMPfam_FHA	p.R956*	ENST00000366542.1	37	c.2866	CCDS44339.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.924332	0.97940	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543	.	.	.	4.89	4.89	0.63831	.	0.064020	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4089	12.1925	0.54278	0.0:0.0:0.8294:0.1706	.	.	.	.	X	956;858;858	.	ENSP00000355500:R956X	R	-	1	2	CEP170	241395019	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.022000	0.64078	2.248000	0.74166	0.555000	0.69702	CGA	-	NULL		0.373	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	protein_coding	OTTHUMT00000096178.2	G	NM_014812		241395019	-1	no_errors	NM_014812	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
OR2L3	391192	genome.wustl.edu	37	1	248224819	248224819	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1809-01A-01W-0633-09	TCGA-23-1809-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	dd837ff4-200c-4a34-8041-32e8bea0735d	0a8ad60d-da44-4fce-8678-59772304d75f	g.chr1:248224819C>A	ENST00000359959.3	+	1	836	c.836C>A	c.(835-837)aCc>aAc	p.T279N	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTCTACACCACCCTCACTCCA	0.493																																																0			1											101.0	92.0	95.0					1																	248224819		2203	4300	6503	246291442	SO:0001583	missense	391192			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.836C>A	1.37:g.248224819C>A	ENSP00000353044:p.Thr279Asn		246291442	B9EH44	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T279N	ENST00000359959.3	37	c.836	CCDS31104.1	1	.	.	.	.	.	.	.	.	.	.	T	5.296	0.239985	0.10023	.	.	ENSG00000198128	ENST00000359959	T	0.00115	8.71	2.01	0.771	0.18504	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31821	U	0.007016	T	0.00109	0.0003	N	0.16567	0.415	0.09310	N	1	B	0.24258	0.1	B	0.36092	0.217	T	0.30179	-0.9987	10	0.87932	D	0	.	6.3461	0.21351	0.0:0.2447:0.0:0.7553	.	279	Q8NG85	OR2L3_HUMAN	N	279	ENSP00000353044:T279N	ENSP00000353044:T279N	T	+	2	0	OR2L3	246291442	0.000000	0.05858	0.070000	0.20053	0.405000	0.30901	0.295000	0.19065	-0.357000	0.08175	-0.535000	0.04281	ACC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.493	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	protein_coding	OTTHUMT00000096852.1	C	NM_001004687		246291442	+1	no_errors	NM_001004687	genbank	human	provisional	54_36p	missense	SNP	0.000	A
