#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CNN2	1265	genome.wustl.edu	37	19	1036537	1036537	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:1036537G>C	ENST00000263097.4	+	6	993	c.630G>C	c.(628-630)atG>atC	p.M210I	CNN2_ENST00000565096.2_Missense_Mutation_p.M199I|CNN2_ENST00000348419.3_Missense_Mutation_p.M171I|CNN2_ENST00000562958.2_Missense_Mutation_p.M231I|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000606983.1_3'UTR	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	210					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTCCAGATGGGCACGAACA	0.662																																																0			19											53.0	57.0	55.0					19																	1036537		2203	4299	6502	987537	SO:0001583	missense	1265			D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.630G>C	19.37:g.1036537G>C	ENSP00000263097:p.Met210Ile		987537	A5D8U8|A6NFI4|D6W5X9|Q92578	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,PatternScan_CALPONIN_1,HMMPfam_Calponin	p.M210I	ENST00000263097.4	37	c.630	CCDS12053.1	19	.	.	.	.	.	.	.	.	.	.	g	23.8	4.464373	0.84425	.	.	ENSG00000064666	ENST00000263097;ENST00000348419;ENST00000442531	T;T	0.58940	0.3;0.3	4.18	4.18	0.49190	.	0.047302	0.85682	U	0.000000	T	0.78534	0.4298	M	0.90650	3.135	0.46279	D	0.998965	B;P;D;D;P;P	0.69078	0.368;0.868;0.992;0.997;0.747;0.868	B;P;P;D;B;P	0.69479	0.238;0.694;0.858;0.964;0.298;0.694	D	0.83520	0.0085	10	0.66056	D	0.02	.	14.027	0.64592	0.0:0.0:1.0:0.0	.	231;199;185;171;210;210	B4DUT8;B4DDF4;B4DHU5;A6NFI4;Q99439;Q6FHE4	.;.;.;.;CNN2_HUMAN;.	I	210;171;189	ENSP00000263097:M210I;ENSP00000340129:M171I	ENSP00000263097:M210I	M	+	3	0	CNN2	987537	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.370000	0.79589	2.173000	0.68751	0.556000	0.70494	ATG	-	PatternScan_CALPONIN_1,HMMPfam_Calponin		0.662	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN2	protein_coding	OTTHUMT00000420293.3	G	NM_004368		987537	+1	no_errors	NM_004368	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	1	4035881	4035881	+	IGR	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:4035881G>A								RP13-614K11.1 (20559 upstream) : RP5-1166F10.1 (436229 downstream)																							aggtgaccagggaaggcctcc	0.572																																																0			1																																								3935741	SO:0001628	intergenic_variant	729655																															1.37:g.4035881G>A			3935741		Missense_Mutation	SNP	NULL	p.P277S		37	c.829		1																																																																																			-	NULL	0	0.572					LOC729655			G			3935741	-1	no_start_codon:pseudogene:no_stop_codon	XM_001715930	genbank	human	model	54_36p	missense	SNP	0.000	A
L3MBTL4	91133	genome.wustl.edu	37	18	6080922	6080922	+	Missense_Mutation	SNP	T	T	A	rs372184772		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr18:6080922T>A	ENST00000284898.6	-	16	1602	c.1402A>T	c.(1402-1404)Atc>Ttc	p.I468F	RP11-793A3.2_ENST00000577935.1_RNA|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.I468F|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.I468F|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.I468F|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.I281F	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	468					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TTTCCTTTGATTTTCAAACAC	0.343																																					Esophageal Squamous(41;748 902 17366 28959 43175)											0			18											92.0	88.0	90.0					18																	6080922		2201	4299	6500	6070922	SO:0001583	missense	91133			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1402A>T	18.37:g.6080922T>A	ENSP00000284898:p.Ile468Phe		6070922	A8MTL8|Q8IXS3	Missense_Mutation	SNP	superfamily_SSF63748,HMMSmart_MBT,HMMPfam_MBT,superfamily_SSF103637,HMMPfam_zf-C2HC,superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_1	p.I468F	ENST00000284898.6	37	c.1402	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	T	21.1	4.091457	0.76756	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.14766	2.48;2.49;2.48;2.5;2.65	5.65	5.65	0.86999	.	0.365789	0.25250	N	0.032022	T	0.15565	0.0375	N	0.24115	0.695	0.40702	D	0.982497	P;P	0.46784	0.83;0.884	P;P	0.49708	0.496;0.62	T	0.02758	-1.1114	10	0.51188	T	0.08	.	12.281	0.54762	0.0:0.0:0.0:1.0	.	468;468	Q8NA19;F8W9S8	LMBL4_HUMAN;.	F	468;468;468;281;468	ENSP00000382976:I468F;ENSP00000318543:I468F;ENSP00000284898:I468F;ENSP00000444774:I281F;ENSP00000382975:I468F	ENSP00000284898:I468F	I	-	1	0	L3MBTL4	6070922	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.186000	0.42593	2.149000	0.67028	0.533000	0.62120	ATC	-	NULL		0.343	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	protein_coding	OTTHUMT00000254448.2	T	NM_173464		6070922	-1	no_errors	NM_173464	genbank	human	validated	54_36p	missense	SNP	1.000	A
JAKMIP1	152789	genome.wustl.edu	37	4	6066613	6066613	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:6066613C>G	ENST00000282924.5	-	9	1910	c.1425G>C	c.(1423-1425)ttG>ttC	p.L475F	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.L475F|JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.L290F|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.L310F|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.L475F	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	475	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TTACATCGTCCAAGTCTTCTT	0.552																																																0			4											160.0	134.0	143.0					4																	6066613		2203	4300	6503	6117514	SO:0001583	missense	152789			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1425G>C	4.37:g.6066613C>G	ENSP00000282924:p.Leu475Phe		6117514	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.L475F	ENST00000282924.5	37	c.1425	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528219	0.64860	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.35789	1.74;1.29;1.73;1.73;1.31	4.45	3.59	0.41128	.	0.262387	0.27591	N	0.018695	T	0.46737	0.1408	M	0.68317	2.08	0.41991	D	0.990845	P;D;P;D;D	0.63046	0.944;0.992;0.944;0.98;0.992	P;P;P;P;P	0.57101	0.548;0.813;0.646;0.624;0.813	T	0.40059	-0.9583	10	0.39692	T	0.17	.	7.4751	0.27371	0.0:0.7949:0.0:0.2051	.	310;475;290;475;475	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	F	475;290;475;367;475;475;310	ENSP00000386711:L475F;ENSP00000387042:L290F;ENSP00000282924:L475F;ENSP00000386925:L475F;ENSP00000386745:L310F	ENSP00000282924:L475F	L	-	3	2	JAKMIP1	6117514	1.000000	0.71417	0.986000	0.45419	0.974000	0.67602	1.140000	0.31516	0.976000	0.38417	0.561000	0.74099	TTG	-	NULL		0.552	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	protein_coding	OTTHUMT00000246816.2	C	NM_144720		6117514	-1	no_errors	NM_001099433	genbank	human	validated	54_36p	missense	SNP	1.000	G
LOC284023	284023	genome.wustl.edu	37	17	7819092	7819092	+	RNA	SNP	G	G	A	rs76072033	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:7819092G>A	ENST00000324348.7	-	0	179					NR_024349.1																						CCTAGGCCCCGCCCCCTTCTC	0.721													G|||	190	0.0379393	0.0023	0.0231	5008	,	,		9979	0.1429		0.005	False		,,,				2504	0.0225															0			17																																								7759817			0																															17.37:g.7819092G>A			7759817		Missense_Mutation	SNP	NULL	p.A48V	ENST00000324348.7	37	c.143		17																																																																																			-	NULL		0.721	AC025335.1-001	KNOWN	mRNA_end_NF|basic	antisense	uc002gjl.1	antisense	OTTHUMT00000256357.2	G			7759817	-1	no_errors	ENST00000324348	ensembl	human	known	54_36p	missense	SNP	0.344	A
MFSD6L	162387	genome.wustl.edu	37	17	8701764	8701764	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:8701764C>G	ENST00000329805.4	-	1	903	c.675G>C	c.(673-675)ttG>ttC	p.L225F		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	225						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						TGGTCCCTGACAAATTGGCTG	0.592																																																0			17											54.0	64.0	60.0					17																	8701764		2203	4300	6503	8642489	SO:0001583	missense	162387			AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.675G>C	17.37:g.8701764C>G	ENSP00000330051:p.Leu225Phe		8642489	Q6YL34|Q8NA76	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter	p.L225F	ENST00000329805.4	37	c.675	CCDS11146.1	17	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971598	0.34754	.	.	ENSG00000185156	ENST00000329805	D	0.90788	-2.73	4.86	2.86	0.33363	.	2.302200	0.02275	N	0.068841	D	0.90307	0.6968	L	0.57536	1.79	0.21553	N	0.999648	P	0.50369	0.934	P	0.44597	0.454	T	0.76623	-0.2891	10	0.52906	T	0.07	0.0657	8.0874	0.30780	0.0:0.613:0.3035:0.0835	.	225	Q8IWD5	MFS6L_HUMAN	F	225	ENSP00000330051:L225F	ENSP00000330051:L225F	L	-	3	2	MFSD6L	8642489	0.035000	0.19736	0.140000	0.22221	0.005000	0.04900	0.183000	0.16919	0.630000	0.30394	-0.136000	0.14681	TTG	-	NULL		0.592	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6L	protein_coding	OTTHUMT00000442554.1	C	NM_152599		8642489	-1	no_errors	NM_152599	genbank	human	provisional	54_36p	missense	SNP	0.105	G
PAK1IP1	55003	genome.wustl.edu	37	6	10704742	10704742	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:10704742G>A	ENST00000379568.3	+	6	790	c.499G>A	c.(499-501)Gct>Act	p.A167T		NM_017906.2	NP_060376.2	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	167					cell proliferation (GO:0008283)|negative regulation of signal transduction (GO:0009968)|palate development (GO:0060021)	nucleus (GO:0005634)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				ACTTACAGATGCTCACATAGT	0.308																																																0			6											47.0	46.0	46.0					6																	10704742		2202	4300	6502	10812728	SO:0001583	missense	55003			AF283303	CCDS34339.1	6p24.1	2013-05-21			ENSG00000111845	ENSG00000111845		"""WD repeat domain containing"""	20882	protein-coding gene	gene with protein product		607811				11371639	Standard	XM_005249204		Approved	FLJ20624, hPIP1, PIP1, bA421M1.5, MAK11, WDR84	uc003mzg.3	Q9NWT1	OTTHUMG00000014245	ENST00000379568.3:c.499G>A	6.37:g.10704742G>A	ENSP00000368887:p.Ala167Thr		10812728	Q5T4J2|Q96QJ8|Q96T87	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.A167T	ENST00000379568.3	37	c.499	CCDS34339.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079894	0.76528	.	.	ENSG00000111845	ENST00000379568	T	0.35605	1.3	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.047431	0.85682	D	0.000000	T	0.56187	0.1968	M	0.86953	2.85	0.80722	D	1	D	0.67145	0.996	P	0.61201	0.885	T	0.60954	-0.7160	10	0.49607	T	0.09	1.6069	17.2147	0.86940	0.0:0.0:1.0:0.0	.	167	Q9NWT1	PK1IP_HUMAN	T	167	ENSP00000368887:A167T	ENSP00000368887:A167T	A	+	1	0	PAK1IP1	10812728	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	6.490000	0.73645	2.651000	0.90000	0.650000	0.86243	GCT	-	superfamily_WD40_like		0.308	PAK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1IP1	protein_coding	OTTHUMT00000039835.1	G	NM_017906		10812728	+1	no_errors	NM_017906	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF44	51710	genome.wustl.edu	37	19	12384612	12384612	+	Missense_Mutation	SNP	C	C	T	rs372299239		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:12384612C>T	ENST00000356109.5	-	5	720	c.602G>A	c.(601-603)cGc>cAc	p.R201H	ZNF44_ENST00000355684.5_Missense_Mutation_p.R153H	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		AAAGGAGTGGCGATAACTTAA	0.428																																																0			19						C	HIS/ARG,HIS/ARG	0,4404		0,0,2202	107.0	107.0	107.0		602,458	-1.3	0.0	19		107	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	ZNF44	NM_001164276.1,NM_016264.3	29,29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	201/664,153/616	12384612	1,12997	2202	4297	6499	12245612	SO:0001583	missense	51710			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.602G>A	19.37:g.12384612C>T	ENSP00000348419:p.Arg201His		12245612	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R153H	ENST00000356109.5	37	c.458	CCDS54223.1	19	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.413747	0.01145	0.0	1.16E-4	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.29397	1.57;1.57;3.23	0.645	-1.29	0.09288	Zinc finger, C2H2 (1);	.	.	.	.	T	0.14313	0.0346	N	0.25031	0.7	.	.	.	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38757	-0.9646	8	0.11182	T	0.66	.	3.5764	0.07936	0.2576:0.4847:0.2577:0.0	.	201;153	P15621;F8W7T7	ZNF44_HUMAN;.	H	201;201;153;153	ENSP00000377008:R201H;ENSP00000348419:R201H;ENSP00000347910:R153H	ENSP00000347910:R153H	R	-	2	0	ZNF44	12245612	0.001000	0.12720	0.006000	0.13384	0.050000	0.14768	0.102000	0.15272	-1.050000	0.03230	0.205000	0.17691	CGC	-	superfamily_C2H2 and C2HC zinc fingers		0.428	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	protein_coding	OTTHUMT00000344132.1	C	NM_016264		12245612	-1	no_errors	NM_016264	genbank	human	provisional	54_36p	missense	SNP	0.005	T
FAM188A	80013	genome.wustl.edu	37	10	15838108	15838108	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:15838108C>T	ENST00000277632.3	-	11	1166	c.946G>A	c.(946-948)Gac>Aac	p.D316N	FAM188A_ENST00000378036.1_Missense_Mutation_p.D21N|FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	316					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						CCTTCTGGGTCGTAGGTTTGA	0.363																																					Pancreas(159;946 1953 2111 4475 22008)											0			10											136.0	145.0	142.0					10																	15838108		2203	4300	6503	15878114	SO:0001583	missense	80013			AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.946G>A	10.37:g.15838108C>T	ENSP00000277632:p.Asp316Asn		15878114	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_EF-hand	p.D316N	ENST00000277632.3	37	c.946	CCDS7110.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.676218	0.96764	.	.	ENSG00000148481	ENST00000277632;ENST00000378036;ENST00000378033;ENST00000418767	T;T	0.59224	0.47;0.28	6.08	6.08	0.98989	EF-hand-like domain (1);	0.042232	0.85682	D	0.000000	T	0.64338	0.2589	M	0.84219	2.685	0.80722	D	1	B	0.27971	0.196	B	0.23852	0.049	T	0.64433	-0.6409	10	0.62326	D	0.03	-13.4342	18.8526	0.92238	0.0:1.0:0.0:0.0	.	316	Q9H8M7	F188A_HUMAN	N	316;21;21;156	ENSP00000277632:D316N;ENSP00000388661:D156N	ENSP00000277632:D316N	D	-	1	0	FAM188A	15878114	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.965000	0.76067	2.894000	0.99253	0.591000	0.81541	GAC	-	superfamily_EF-hand		0.363	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf97	protein_coding	OTTHUMT00000046990.2	C	NM_024948		15878114	-1	no_errors	NM_024948	genbank	human	validated	54_36p	missense	SNP	1.000	T
ABCC1	4363	genome.wustl.edu	37	16	16196533	16196533	+	Silent	SNP	T	T	C	rs556651702	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr16:16196533T>C	ENST00000399410.3	+	20	2869	c.2694T>C	c.(2692-2694)aaT>aaC	p.N898N	ABCC1_ENST00000351154.5_Silent_p.N839N|ABCC1_ENST00000576557.1_3'UTR|ABCC1_ENST00000346370.5_Silent_p.N842N|ABCC1_ENST00000349029.5_Silent_p.N783N|ABCC1_ENST00000399408.2_Silent_p.N908N|ABCC1_ENST00000345148.5_Silent_p.N898N	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	898					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	AAATGGAGAATGGCATGCTGG	0.597													T|||	3	0.000599042	0.0	0.0	5008	,	,		20501	0.003		0.0	False		,,,				2504	0.0															0			16											38.0	45.0	43.0					16																	16196533		2082	4210	6292	16104034	SO:0001819	synonymous_variant	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2694T>C	16.37:g.16196533T>C			16104034	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Silent	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_PROTEIN_KINASE_ATP,PatternScan_ABC_TRANSPORTER_1	p.N898	ENST00000399410.3	37	c.2694	CCDS42122.1	16																																																																																			-	NULL		0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	protein_coding	OTTHUMT00000109701.1	T	NM_004996		16104034	+1	no_errors	NM_004996	genbank	human	reviewed	54_36p	silent	SNP	0.996	C
FAM49A	81553	genome.wustl.edu	37	2	16743398	16743398	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:16743398G>A	ENST00000381323.3	-	6	530	c.310C>T	c.(310-312)Cag>Tag	p.Q104*	FAM49A_ENST00000355549.2_Nonsense_Mutation_p.Q104*|FAM49A_ENST00000406434.1_Nonsense_Mutation_p.Q104*	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	104						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			AATAAACTCTGAAGAGCTTTT	0.443																																																0			2											68.0	76.0	73.0					2																	16743398		2203	4300	6503	16606879	SO:0001587	stop_gained	81553			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.310C>T	2.37:g.16743398G>A	ENSP00000370724:p.Gln104*		16606879	B3KNZ1|Q53QW2	Nonsense_Mutation	SNP	HMMPfam_DUF1394	p.Q104*	ENST00000381323.3	37	c.310	CCDS1688.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.355985	0.98231	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	.	.	.	5.57	5.57	0.84162	.	0.051638	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-20.6768	18.9342	0.92579	0.0:0.0:1.0:0.0	.	.	.	.	X	104	.	ENSP00000347744:Q104X	Q	-	1	0	FAM49A	16606879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.725000	0.84808	2.798000	0.96311	0.650000	0.86243	CAG	-	HMMPfam_DUF1394		0.443	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	protein_coding	OTTHUMT00000207203.2	G	NM_030797		16606879	-1	no_errors	NM_030797	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
SMC6	79677	genome.wustl.edu	37	2	17913092	17913092	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:17913092C>T	ENST00000448223.2	-	6	666	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	SMC6_ENST00000381272.4_Missense_Mutation_p.A159T|SMC6_ENST00000402989.1_Missense_Mutation_p.A133T|SMC6_ENST00000351948.4_Missense_Mutation_p.A133T	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	133					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TACACACTGGCTTTAAAGGCA	0.363																																																0			2											160.0	140.0	146.0					2																	17913092		2203	4300	6503	17776573	SO:0001583	missense	79677			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.397G>A	2.37:g.17913092C>T	ENSP00000404092:p.Ala133Thr		17776573	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	HMMPfam_SMC_N,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A133T	ENST00000448223.2	37	c.397	CCDS1690.1	2	.	.	.	.	.	.	.	.	.	.	C	16.21	3.057671	0.55325	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.06687	3.27;3.27;3.27;3.27;3.27	5.75	3.89	0.44902	RecF/RecN/SMC (1);	0.165026	0.53938	D	0.000044	T	0.04724	0.0128	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.25719	0.132;0.012;0.042	B;B;B	0.25759	0.062;0.026;0.063	T	0.37033	-0.9723	10	0.54805	T	0.06	.	14.4514	0.67386	0.0:0.4523:0.5477:0.0	.	159;159;133	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	T	133;133;159;133;159	ENSP00000404092:A133T;ENSP00000323439:A133T;ENSP00000370672:A159T;ENSP00000384539:A133T;ENSP00000408644:A159T	ENSP00000323439:A133T	A	-	1	0	SMC6	17776573	0.998000	0.40836	0.692000	0.30179	0.939000	0.58152	2.522000	0.45572	1.387000	0.46486	0.655000	0.94253	GCC	-	HMMPfam_SMC_N,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.363	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	protein_coding	OTTHUMT00000207359.1	C	NM_024624		17776573	-1	no_errors	NM_024624	genbank	human	validated	54_36p	missense	SNP	0.132	T
NCAN	1463	genome.wustl.edu	37	19	19356178	19356178	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:19356178C>A	ENST00000252575.6	+	13	3648	c.3549C>A	c.(3547-3549)gaC>gaA	p.D1183E	NCAN_ENST00000538881.1_Missense_Mutation_p.D634E	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1183	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GTGGCGAGGACTGTGTGGTGA	0.572																																																0			19											141.0	119.0	126.0					19																	19356178		2203	4300	6503	19217178	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3549C>A	19.37:g.19356178C>A	ENSP00000252575:p.Asp1183Glu		19217178	Q9UPK6	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,superfamily_C-type_lectin_fold,HMMSmart_LINK,HMMPfam_Xlink,PatternScan_LINK_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_CLECT,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.D1183E	ENST00000252575.6	37	c.3549	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166798	0.78339	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.19669	2.13;2.13	4.62	-2.06	0.07298	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.37669	N	0.001981	T	0.42040	0.1185	M	0.83692	2.655	0.35669	D	0.813142	D	0.89917	1.0	D	0.87578	0.998	T	0.52381	-0.8583	10	0.62326	D	0.03	.	9.471	0.38842	0.0:0.5523:0.0:0.4477	.	1183	O14594	NCAN_HUMAN	E	1197;1183;634	ENSP00000252575:D1183E;ENSP00000442202:D634E	ENSP00000252575:D1183E	D	+	3	2	NCAN	19217178	0.990000	0.36364	0.996000	0.52242	0.946000	0.59487	0.358000	0.20216	-0.136000	0.11475	0.453000	0.30009	GAC	-	superfamily_C-type_lectin_fold,HMMSmart_CLECT,HMMPfam_Lectin_C		0.572	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	protein_coding	OTTHUMT00000460111.2	C	NM_004386		19217178	+1	no_errors	NM_004386	genbank	human	validated	54_36p	missense	SNP	1.000	A
IQCK	124152	genome.wustl.edu	37	16	19741751	19741751	+	Splice_Site	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr16:19741751G>T	ENST00000320394.6	+	3	880		c.e3-1		IQCK_ENST00000433597.2_Intron|IQCK_ENST00000541926.1_Splice_Site|IQCK_ENST00000564186.1_Splice_Site	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K											kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						CTTCCCTTTAGAGTATGAAGC	0.398																																																0			16											106.0	107.0	106.0					16																	19741751		2197	4300	6497	19649252	SO:0001630	splice_region_variant	124152			AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.182-1G>T	16.37:g.19741751G>T			19649252	B2RDU0|O43327|Q8NFF4	Splice_Site	SNP	-	e2-1	ENST00000320394.6	37	c.182-1	CCDS10580.1	16	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940074	0.73557	.	.	ENSG00000174628	ENST00000320394;ENST00000308214;ENST00000541926	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3566	0.87337	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IQCK	19649252	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.497000	0.66924	2.775000	0.95449	0.563000	0.77884	.	-	-		0.398	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCK	protein_coding	OTTHUMT00000254273.2	G	NM_153208	Intron	19649252	+1	no_errors	NM_153208	genbank	human	provisional	54_36p	splice_site	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	16	20168148	20168148	+	IGR	SNP	T	T	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr16:20168148T>A								GPR139 (82909 upstream) : RP11-204E4.3 (52098 downstream)																							TCTTTGTACATCAATAGATGA	0.473																																																0			16																																								20075649	SO:0001628	intergenic_variant	0																															16.37:g.20168148T>A			20075649		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.473					LOC100131046			T			20075649	+1	pseudogene	XR_037711	genbank	human	model	54_36p	rna	SNP	0.963	A
PRAME	23532	genome.wustl.edu	37	22	22890969	22890969	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr22:22890969C>T	ENST00000398741.1	-	6	1356	c.1050G>A	c.(1048-1050)caG>caA	p.Q350Q	PRAME_ENST00000539862.1_Silent_p.Q334Q|PRAME_ENST00000405655.3_Silent_p.Q350Q|PRAME_ENST00000424204.2_Silent_p.Q334Q|PRAME_ENST00000543184.1_Silent_p.Q350Q|PRAME_ENST00000402697.1_Silent_p.Q350Q|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000398743.2_Silent_p.Q350Q	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	350					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GGACACTTAGCTGACTGACGC	0.577																																					Melanoma(73;1707 1838 15168 27201)											0			22											142.0	136.0	138.0					22																	22890969		2203	4300	6503	21220969	SO:0001819	synonymous_variant	23532			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1050G>A	22.37:g.22890969C>T			21220969	B2R6Y7|O43481|Q8IXN8	Silent	SNP	superfamily_RNI-like	p.Q350	ENST00000398741.1	37	c.1050	CCDS13801.1	22																																																																																			-	superfamily_RNI-like		0.577	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	protein_coding	OTTHUMT00000321644.1	C	NM_206953		21220969	-1	no_errors	NM_006115	genbank	human	reviewed	54_36p	silent	SNP	0.007	T
MIPEP	4285	genome.wustl.edu	37	13	24443441	24443441	+	Silent	SNP	A	A	G	rs36114598		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr13:24443441A>G	ENST00000382172.3	-	7	1031	c.933T>C	c.(931-933)gcT>gcC	p.A311A		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	311					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CTGGATTTTTAGCTATCGTTC	0.368																																																0			13											112.0	117.0	115.0					13																	24443441		2203	4300	6503	23341441	SO:0001819	synonymous_variant	4285				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.933T>C	13.37:g.24443441A>G			23341441	Q5JV15|Q5T9Q9|Q96G65	Silent	SNP	superfamily_SSF55486,HMMPfam_Peptidase_M3,PatternScan_ZINC_PROTEASE	p.A311	ENST00000382172.3	37	c.933	CCDS9303.1	13																																																																																			-	superfamily_SSF55486,HMMPfam_Peptidase_M3		0.368	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	protein_coding	OTTHUMT00000044169.1	A			23341441	-1	no_errors	NM_005932	genbank	human	reviewed	54_36p	silent	SNP	0.488	G
ADCY4	196883	genome.wustl.edu	37	14	24788554	24788554	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr14:24788554G>C	ENST00000310677.4	-	23	2935	c.2822C>G	c.(2821-2823)tCt>tGt	p.S941C	ADCY4_ENST00000554068.2_Missense_Mutation_p.S941C|ADCY4_ENST00000418030.2_Missense_Mutation_p.S941C	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	941					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ATCCTGTCCAGAGGTGGCATT	0.527																																																0			14											210.0	161.0	177.0					14																	24788554		2203	4300	6503	23858394	SO:0001583	missense	196883			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2822C>G	14.37:g.24788554G>C	ENSP00000312126:p.Ser941Cys		23858394	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1,HMMPfam_DUF1053	p.S941C	ENST00000310677.4	37	c.2822	CCDS9627.1	14	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765071	0.69878	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.30448	1.53;1.53;1.53	5.77	5.77	0.91146	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.143876	0.32640	N	0.005827	T	0.27765	0.0683	N	0.17872	0.535	0.80722	D	1	B	0.31435	0.323	B	0.36959	0.237	T	0.08848	-1.0702	10	0.59425	D	0.04	.	17.4827	0.87677	0.0:0.0:1.0:0.0	.	941	Q8NFM4	ADCY4_HUMAN	C	941	ENSP00000312126:S941C;ENSP00000452250:S941C;ENSP00000393177:S941C	ENSP00000312126:S941C	S	-	2	0	ADCY4	23858394	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	6.705000	0.74644	2.704000	0.92352	0.655000	0.94253	TCT	-	HMMSmart_SM00044,HMMPfam_Guanylate_cyc,superfamily_Adenylyl and guanylyl cyclase catalytic domain		0.527	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY4	protein_coding	OTTHUMT00000073200.4	G			23858394	-1	no_errors	NM_139247	genbank	human	reviewed	54_36p	missense	SNP	0.982	C
GPR113	165082	genome.wustl.edu	37	2	26532442	26532442	+	IGR	SNP	T	T	C	rs199902400	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:26532442T>C	ENST00000311519.1	-	0	3240				GPR113_ENST00000541401.1_Missense_Mutation_p.N653S|GPR113_ENST00000421160.2_Missense_Mutation_p.N981S|GPR113_ENST00000333478.6_Missense_Mutation_p.N851S|GPR113_ENST00000459892.1_5'UTR	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGCCTTCATTTGTGGCCTA	0.507													T|||	2	0.000399361	0.0	0.0	5008	,	,		20543	0.002		0.0	False		,,,				2504	0.0															0			2											58.0	61.0	60.0					2																	26532442		2066	4213	6279	26385946	SO:0001628	intergenic_variant	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225		2.37:g.26532442T>C			26385946	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.N851S	ENST00000311519.1	37	c.2552	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	T	2.397	-0.338502	0.05243	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160	T;T;T	0.28255	1.64;1.62;1.65	6.07	-0.179	0.13299	.	.	.	.	.	T	0.17195	0.0413	L	0.36672	1.1	0.58432	D	0.999999	B;B;B	0.13594	0.002;0.008;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.30119	-0.9989	9	0.02654	T	1	.	8.6626	0.34101	0.0:0.4072:0.0:0.5928	.	981;851;653	E9PEV1;Q8IZF5-2;F5H1E4	.;.;.	S	653;851;981	ENSP00000445729:N653S;ENSP00000327396:N851S;ENSP00000388537:N981S	ENSP00000327396:N851S	N	-	2	0	GPR113	26385946	0.949000	0.32298	0.641000	0.29422	0.019000	0.09904	0.053000	0.14184	-0.033000	0.13736	-1.087000	0.02190	AAT	-	NULL		0.507	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	protein_coding	OTTHUMT00000316892.1	T	NM_153835		26385946	-1	no_errors	NM_153835	genbank	human	validated	54_36p	missense	SNP	0.699	C
DRC1	92749	genome.wustl.edu	37	2	26654775	26654775	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:26654775G>A	ENST00000288710.2	+	7	863	c.789G>A	c.(787-789)atG>atA	p.M263I	DRC1_ENST00000483675.1_3'UTR	NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	263					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											ACAACCGCATGAAGAAAGTAG	0.502																																																0			2											152.0	147.0	149.0					2																	26654775		2203	4300	6503	26508279	SO:0001583	missense	92749			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.789G>A	2.37:g.26654775G>A	ENSP00000288710:p.Met263Ile		26508279	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	NULL	p.M263I	ENST00000288710.2	37	c.789	CCDS1723.1	2	.	.	.	.	.	.	.	.	.	.	G	6.185	0.402338	0.11696	.	.	ENSG00000157856	ENST00000288710;ENST00000442810	T	0.13901	2.55	5.65	-0.729	0.11158	.	0.534882	0.21628	N	0.071525	T	0.11067	0.0270	L	0.36672	1.1	0.27798	N	0.942587	B	0.09022	0.002	B	0.13407	0.009	T	0.21552	-1.0242	10	0.32370	T	0.25	-4.4212	14.3715	0.66843	0.0:0.1043:0.7743:0.1213	.	263	Q96MC2	CC164_HUMAN	I	263;92	ENSP00000288710:M263I	ENSP00000288710:M263I	M	+	3	0	CCDC164	26508279	0.999000	0.42202	0.986000	0.45419	0.184000	0.23303	0.262000	0.18460	-0.098000	0.12285	-0.262000	0.10625	ATG	-	NULL		0.502	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf39	protein_coding	OTTHUMT00000246862.1	G	NM_145038		26508279	+1	no_errors	NM_145038	genbank	human	validated	54_36p	missense	SNP	0.999	A
OTOF	9381	genome.wustl.edu	37	2	26712161	26712161	+	Silent	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:26712161C>A	ENST00000272371.2	-	11	1089	c.963G>T	c.(961-963)gtG>gtT	p.V321V	OTOF_ENST00000403946.3_Silent_p.V321V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	321	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGAGTGAATCACCTTTCAGG	0.612																																					GBM(102;732 1451 20652 24062 31372)											0			2											53.0	44.0	47.0					2																	26712161		2203	4300	6503	26565665	SO:0001819	synonymous_variant	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.963G>T	2.37:g.26712161C>A			26565665	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2,HMMPfam_FerI,HMMPfam_FerB	p.V321	ENST00000272371.2	37	c.963	CCDS1725.1	2																																																																																			-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2		0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	C			26565665	-1	no_errors	NM_194248	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
PLAA	9373	genome.wustl.edu	37	9	26919332	26919332	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr9:26919332G>A	ENST00000397292.3	-	9	1810	c.1393C>T	c.(1393-1395)Ccc>Tcc	p.P465S	PLAA_ENST00000520641.1_5'UTR|PLAA_ENST00000520884.1_Missense_Mutation_p.P465S	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	465	PFU. {ECO:0000255|PROSITE- ProRule:PRU00727}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GAAAAGCTGGGATTCCCAAGT	0.313																																					Melanoma(175;2670 2735 14091 35526)											0			9											90.0	89.0	89.0					9																	26919332		2203	4300	6503	26909332	SO:0001583	missense	9373			AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.1393C>T	9.37:g.26919332G>A	ENSP00000380460:p.Pro465Ser		26909332	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1,superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,HMMPfam_PFU,HMMPfam_PUL,superfamily_ARM-type_fold	p.P465S	ENST00000397292.3	37	c.1393	CCDS35000.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.855|4.855	0.158861|0.158861	0.09236|0.09236	.|.	.|.	ENSG00000137055|ENSG00000137055	ENST00000397292;ENST00000520884|ENST00000517642;ENST00000487173	T;T|.	0.54675|.	0.56;0.67|.	5.33|5.33	1.64|1.64	0.23874|0.23874	PLAA family ubiquitin binding, PFU (1);|.	0.272631|.	0.42964|.	D|.	0.000627|.	T|T	0.17195|0.17195	0.0413|0.0413	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.22068|0.22068	-1.0227|-1.0227	10|5	0.05436|.	T|.	0.98|.	-0.1483|-0.1483	2.1663|2.1663	0.03838|0.03838	0.2314:0.0714:0.2901:0.4071|0.2314:0.0714:0.2901:0.4071	.|.	465;465|.	E5RIM3;Q9Y263|.	.;PLAP_HUMAN|.	S|F	465|137;14	ENSP00000380460:P465S;ENSP00000429372:P465S|.	ENSP00000380460:P465S|.	P|S	-|-	1|2	0|0	PLAA|PLAA	26909332|26909332	0.009000|0.009000	0.17119|0.17119	0.326000|0.326000	0.25389|0.25389	0.922000|0.922000	0.55478|0.55478	-0.017000|-0.017000	0.12590|0.12590	0.019000|0.019000	0.15079|0.15079	-0.293000|-0.293000	0.09583|0.09583	CCC|TCC	-	NULL		0.313	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAA	protein_coding	OTTHUMT00000051958.2	G	NM_001031689		26909332	-1	no_errors	NM_001031689	genbank	human	validated	54_36p	missense	SNP	0.005	A
EMILIN1	11117	genome.wustl.edu	37	2	27306489	27306489	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:27306489C>G	ENST00000380320.4	+	4	2549	c.2050C>G	c.(2050-2052)Cgt>Ggt	p.R684G		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	684					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACCAAGGACCGTATCATTTC	0.567																																																0			2											77.0	77.0	77.0					2																	27306489		2203	4300	6503	27159993	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.2050C>G	2.37:g.27306489C>G	ENSP00000369677:p.Arg684Gly		27159993	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	HMMPfam_EMI,HMMPfam_Collagen,superfamily_TNF_like,HMMPfam_C1q	p.R684G	ENST00000380320.4	37	c.2050	CCDS1733.1	2	.	.	.	.	.	.	.	.	.	.	C	6.506	0.461578	0.12342	.	.	ENSG00000138080	ENST00000380320;ENST00000544143	T	0.63913	-0.07	4.89	1.65	0.23941	.	0.614528	0.16808	N	0.198687	T	0.41073	0.1143	N	0.14661	0.345	0.27611	N	0.948664	B	0.28713	0.22	B	0.23150	0.044	T	0.20438	-1.0275	10	0.27785	T	0.31	-6.1902	12.3426	0.55103	0.706:0.294:0.0:0.0	.	684	Q9Y6C2	EMIL1_HUMAN	G	684;10	ENSP00000369677:R684G	ENSP00000369677:R684G	R	+	1	0	EMILIN1	27159993	0.971000	0.33674	1.000000	0.80357	0.647000	0.38526	0.618000	0.24373	0.513000	0.28278	0.555000	0.69702	CGT	-	NULL		0.567	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN1	protein_coding	OTTHUMT00000214185.1	C	NM_007046		27159993	+1	no_errors	NM_007046	genbank	human	validated	54_36p	missense	SNP	0.927	G
HMGB1	3146	genome.wustl.edu	37	13	31116105	31116105	+	Intron	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr13:31116105C>T	ENST00000405805.1	-	1	927							P09429	HMGB1_HUMAN	high mobility group box 1						apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		TCTTCCTCAGCCAGCTTCCGC	0.463																																																0			13																																								30014105	SO:0001627	intron_variant	646755			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.13+74702G>A	13.37:g.31116105C>T			30014105	A5D8W9|Q14321|Q5T7C3|Q6IBE1	RNA	SNP	-	NULL	ENST00000405805.1	37	NULL	CCDS9335.1	13																																																																																			-	-		0.463	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC646755	protein_coding	OTTHUMT00000303998.2	C	NM_002128		30014105	-1	pseudogene	XR_037386	genbank	human	model	54_36p	rna	SNP	1.000	T
TRIM15	89870	genome.wustl.edu	37	6	30131602	30131602	+	Silent	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:30131602G>T	ENST00000376694.4	+	1	610	c.141G>T	c.(139-141)ggG>ggT	p.G47G	TRIM10_ENST00000449742.2_5'Flank|TRIM10_ENST00000376704.3_5'Flank|TRIM15_ENST00000376688.1_Silent_p.G47G	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	47					innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						CCCAGATGGGGGCCCAATCCT	0.677																																																0			6											45.0	43.0	43.0					6																	30131602		1509	2709	4218	30239581	SO:0001819	synonymous_variant	89870			AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.141G>T	6.37:g.30131602G>T			30239581	A2BEC9|O95604|Q8IUX9|Q9C018	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.G47	ENST00000376694.4	37	c.141	CCDS4677.1	6																																																																																			-	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4		0.677	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM15	protein_coding	OTTHUMT00000076026.2	G	NM_033229		30239581	+1	no_errors	NM_033229	genbank	human	reviewed	54_36p	silent	SNP	0.845	T
CCT6B	10693	genome.wustl.edu	37	17	33266306	33266306	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:33266306C>G	ENST00000314144.5	-	10	1224	c.1109G>C	c.(1108-1110)tGc>tCc	p.C370S	CCT6B_ENST00000436961.3_Missense_Mutation_p.C325S|CCT6B_ENST00000421975.3_Missense_Mutation_p.C333S	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	370					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				GGTAACAGAGCAAGGGTTAAC	0.353																																																0			17											188.0	162.0	171.0					17																	33266306		2203	4300	6503	30290419	SO:0001583	missense	10693			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.1109G>C	17.37:g.33266306C>G	ENSP00000327191:p.Cys370Ser		30290419	B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,PatternScan_TCP1_1,PatternScan_TCP1_2,PatternScan_TCP1_3,superfamily_GroEL-intermediate domain like,superfamily_GroEL apical domain-like	p.C370S	ENST00000314144.5	37	c.1109	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	C	1.382	-0.583112	0.03827	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.76839	-1.05;-1.05;-1.05	4.47	-0.243	0.13035	.	0.292083	0.44285	D	0.000463	T	0.52693	0.1750	N	0.04508	-0.205	0.23282	N	0.997987	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.47724	-0.9095	10	0.72032	D	0.01	0.9925	8.7343	0.34519	0.3632:0.5597:0.0:0.0771	.	325;333;370	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	S	333;370;325	ENSP00000398044:C333S;ENSP00000327191:C370S;ENSP00000400917:C325S	ENSP00000327191:C370S	C	-	2	0	CCT6B	30290419	1.000000	0.71417	0.997000	0.53966	0.046000	0.14306	0.868000	0.27982	-0.295000	0.08960	-2.696000	0.00138	TGC	-	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,superfamily_GroEL-intermediate domain like		0.353	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	protein_coding	OTTHUMT00000448014.1	C	NM_006584		30290419	-1	no_errors	NM_006584	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
SLC35G3	146861	genome.wustl.edu	37	17	33520722	33520722	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:33520722G>A	ENST00000297307.5	-	1	690	c.605C>T	c.(604-606)gCg>gTg	p.A202V	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	202						integral component of membrane (GO:0016021)											CAGGGACAGCGCCAGGCCTCC	0.607																																																0			17											95.0	102.0	99.0					17																	33520722		2203	4300	6503	30544835	SO:0001583	missense	146861			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.605C>T	17.37:g.33520722G>A	ENSP00000297307:p.Ala202Val		30544835	B9EGE9	Missense_Mutation	SNP	HMMPfam_DUF6,superfamily_Multidrug resistance efflux transporter EmrE	p.A202V	ENST00000297307.5	37	c.605	CCDS11293.1	17	.	.	.	.	.	.	.	.	.	.	G	11.30	1.597589	0.28445	.	.	ENSG00000164729	ENST00000297307	T	0.27890	1.64	.	.	.	.	0.146381	0.30723	N	0.009015	T	0.17746	0.0426	L	0.51422	1.61	0.25692	N	0.985678	P	0.40144	0.704	B	0.31869	0.137	T	0.23048	-1.0199	9	0.15066	T	0.55	-0.7688	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	202	Q8N808	S35G3_HUMAN	V	202	ENSP00000297307:A202V	ENSP00000297307:A202V	A	-	2	0	SLC35G3	30544835	0.545000	0.26449	0.138000	0.22173	0.139000	0.21198	1.948000	0.40303	0.064000	0.16427	0.064000	0.15345	GCG	-	NULL		0.607	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMAC1	protein_coding	OTTHUMT00000256445.2	G	NM_152462		30544835	-1	no_errors	NM_152462	genbank	human	provisional	54_36p	missense	SNP	0.956	A
KRTAP13-1	140258	genome.wustl.edu	37	21	31768628	31768628	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr21:31768628C>T	ENST00000355459.2	+	1	237	c.224C>T	c.(223-225)cCc>cTc	p.P75L		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	75	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGTCCAGCCCCTGCCAGACC	0.612																																																0			21											62.0	63.0	62.0					21																	31768628		2203	4300	6503	30690499	SO:0001583	missense	140258			AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.224C>T	21.37:g.31768628C>T	ENSP00000347635:p.Pro75Leu		30690499	Q14D20|Q3LI79	Missense_Mutation	SNP	HMMPfam_PMG	p.P75L	ENST00000355459.2	37	c.224	CCDS13590.2	21	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762629	0.49574	.	.	ENSG00000198390	ENST00000355459	T	0.03441	3.93	4.51	3.61	0.41365	.	0.188804	0.25299	N	0.031661	T	0.16896	0.0406	M	0.85777	2.775	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.02269	-1.1185	10	0.62326	D	0.03	.	7.8327	0.29353	0.1855:0.6353:0.1792:0.0	.	75	Q8IUC0	KR131_HUMAN	L	75	ENSP00000347635:P75L	ENSP00000347635:P75L	P	+	2	0	KRTAP13-1	30690499	0.001000	0.12720	0.085000	0.20634	0.037000	0.13140	0.903000	0.28475	1.459000	0.47892	0.557000	0.71058	CCC	-	HMMPfam_PMG		0.612	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-1	protein_coding	OTTHUMT00000128252.3	C			30690499	+1	no_errors	NM_181599	genbank	human	validated	54_36p	missense	SNP	0.018	T
PURG	29942	genome.wustl.edu	37	8	30889416	30889416	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:30889416G>T	ENST00000475541.1	-	1	1815	c.883C>A	c.(883-885)Cct>Act	p.P295T	PURG_ENST00000339382.2_Intron|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	295						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		TTACGGTAAGGTGGTCTCACC	0.398																																																0			8											55.0	55.0	55.0					8																	30889416		2203	4300	6503	31008958	SO:0001583	missense	29942			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.883C>A	8.37:g.30889416G>T	ENSP00000418721:p.Pro295Thr		31008958	Q8TE64	Missense_Mutation	SNP	HMMPfam_PurA,HMMSmart_SM00712	p.P295T	ENST00000475541.1	37	c.883	CCDS6081.1	8	.	.	.	.	.	.	.	.	.	.	G	8.094	0.775234	0.16051	.	.	ENSG00000172733	ENST00000475541	T	0.27890	1.64	5.4	5.4	0.78164	.	.	.	.	.	T	0.38825	0.1055	N	0.25647	0.755	0.47994	D	0.999565	D	0.69078	0.997	D	0.64144	0.922	T	0.05500	-1.0881	9	0.09590	T	0.72	.	18.7746	0.91907	0.0:0.0:1.0:0.0	.	295	Q9UJV8	PURG_HUMAN	T	295	ENSP00000418721:P295T	ENSP00000418721:P295T	P	-	1	0	PURG	31008958	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.677000	0.61634	2.526000	0.85167	0.655000	0.94253	CCT	-	HMMPfam_PurA,HMMSmart_SM00712		0.398	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PURG	protein_coding	OTTHUMT00000348565.1	G	NM_013357		31008958	-1	no_errors	NM_013357	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DCDC1	341019	genome.wustl.edu	37	11	31349758	31349758	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr11:31349758C>G	ENST00000452803.1	-	3	271	c.70G>C	c.(70-72)Gca>Cca	p.A24P	DCDC1_ENST00000597505.1_Missense_Mutation_p.A24P	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	24					intracellular signal transduction (GO:0035556)			p.A24T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACTTCCATTGCTTCAGTCAAG	0.358																																																1	Substitution - Missense(1)	large_intestine(1)	11											110.0	102.0	104.0					11																	31349758		2202	4299	6501	31306334	SO:0001583	missense	341019			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.70G>C	11.37:g.31349758C>G	ENSP00000389792:p.Ala24Pro		31306334	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	superfamily_SSF89837	p.A24P	ENST00000452803.1	37	c.70	CCDS7872.1	11	.	.	.	.	.	.	.	.	.	.	c	11.86	1.764790	0.31228	.	.	ENSG00000188682	ENST00000452803	T	0.47869	0.83	4.84	-7.48	0.01360	.	2.126880	0.02108	N	0.054570	T	0.28067	0.0692	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13575	-1.0504	10	0.62326	D	0.03	.	2.3607	0.04307	0.1004:0.3393:0.1981:0.3622	.	24	P59894	DCDC1_HUMAN	P	24	ENSP00000389792:A24P	ENSP00000343496:A24P	A	-	1	0	DCDC1	31306334	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.536000	0.06135	-1.760000	0.01312	-1.069000	0.02264	GCA	-	NULL		0.358	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	protein_coding	OTTHUMT00000316531.1	C	NM_181807		31306334	-1	no_errors	NM_181807	genbank	human	validated	54_36p	missense	SNP	0.000	G
NELFE	7936	genome.wustl.edu	37	6	31922844	31922844	+	Silent	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:31922844C>G	ENST00000375429.3	-	6	622	c.396G>C	c.(394-396)ctG>ctC	p.L132L	NELFE_ENST00000375425.5_Silent_p.L139L|NELFE_ENST00000444811.2_Silent_p.L132L|MIR1236_ENST00000408340.1_RNA	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	132					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ACCTCTCATACAGAGATTTCC	0.468																																																0			6											89.0	93.0	92.0					6																	31922844		1511	2709	4220	32030823	SO:0001819	synonymous_variant	7936			M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.396G>C	6.37:g.31922844C>G			32030823	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.L132	ENST00000375429.3	37	c.396	CCDS4730.1	6																																																																																			-	NULL		0.468	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RDBP	protein_coding	OTTHUMT00000076047.4	C			32030823	-1	no_errors	NM_002904	genbank	human	reviewed	54_36p	silent	SNP	0.990	G
DXO	1797	genome.wustl.edu	37	6	31940013	31940013	+	5'UTR	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:31940013C>G	ENST00000375349.3	-	0	54				DXO_ENST00000478221.1_5'UTR|DXO_ENST00000337523.5_5'UTR|STK19_ENST00000375333.2_Intron|DXO_ENST00000375356.3_5'Flank|STK19_ENST00000375331.2_Intron			O77932	DXO_HUMAN	decapping exoribonuclease						metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										TCGCCACCGCCCCTCCCAGCA	0.687																																																0			6											32.0	33.0	33.0					6																	31940013		2180	4263	6443	32047992	SO:0001623	5_prime_UTR_variant	8859			AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.-358G>C	6.37:g.31940013C>G			32047992	A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Silent	SNP	NULL	p.A80	ENST00000375349.3	37	c.240	CCDS4732.1	6																																																																																			-	NULL		0.687	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	STK19	protein_coding	OTTHUMT00000076592.3	C			32047992	+1	no_errors	ENST00000395649	ensembl	human	known	54_36p	silent	SNP	0.006	G
HSD17B8	7923	genome.wustl.edu	37	6	33173447	33173447	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:33173447G>T	ENST00000374662.3	+	5	538	c.511G>T	c.(511-513)Gca>Tca	p.A171S	HSD17B8_ENST00000469186.1_3'UTR|MIR219-1_ENST00000362166.1_RNA|RING1_ENST00000374656.4_5'Flank	NM_014234.4	NP_055049.1	Q92506	DHB8_HUMAN	hydroxysteroid (17-beta) dehydrogenase 8	171					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|fatty acid biosynthetic process (GO:0006633)	mitochondrial envelope (GO:0005740)|mitochondrial matrix (GO:0005759)|plasma membrane (GO:0005886)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	9						AAACTATGCAGCATCCAAGGC	0.582																																																0			6											47.0	48.0	47.0					6																	33173447		1507	2707	4214	33281425	SO:0001583	missense	7923			D82061	CCDS4769.1	6p21.3	2011-09-14	2002-02-19	2002-02-22	ENSG00000204228	ENSG00000204228	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	3554	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 30C, member 1"""	601417	"""FabG (beta-ketoacyl-[acyl-carrier-protein] reductase, E coli) like (E. coli)"""	FABGL		8812499, 19027726	Standard	NM_014234		Approved	HKE6, D6S2245E, RING2, KE6, H2-KE6, SDR30C1	uc003odi.2	Q92506	OTTHUMG00000031117	ENST00000374662.3:c.511G>T	6.37:g.33173447G>T	ENSP00000363794:p.Ala171Ser		33281425	A6NLX7|Q5STP7|Q9UIQ1	Missense_Mutation	SNP	superfamily_NAD(P)-bd,HMMPfam_adh_short,PatternScan_ADH_SHORT	p.A171S	ENST00000374662.3	37	c.511	CCDS4769.1	6	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026902	0.54683	.	.	ENSG00000204228	ENST00000374662	D	0.91945	-2.94	4.52	3.61	0.41365	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.186295	0.45361	N	0.000367	D	0.84343	0.5451	L	0.50333	1.59	0.51233	D	0.999917	B	0.12013	0.005	B	0.25140	0.058	T	0.82987	-0.0184	10	0.62326	D	0.03	.	11.1874	0.48664	0.0:0.0:0.8078:0.1922	.	171	Q92506	DHB8_HUMAN	S	171	ENSP00000363794:A171S	ENSP00000363794:A171S	A	+	1	0	HSD17B8	33281425	1.000000	0.71417	0.695000	0.30226	0.947000	0.59692	4.166000	0.58203	1.059000	0.40554	0.637000	0.83480	GCA	-	superfamily_NAD(P)-bd,HMMPfam_adh_short,PatternScan_ADH_SHORT		0.582	HSD17B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B8	protein_coding	OTTHUMT00000076196.1	G	NM_014234		33281425	+1	no_errors	NM_014234	genbank	human	reviewed	54_36p	missense	SNP	0.997	T
VPS52	6293	genome.wustl.edu	37	6	33236315	33236315	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:33236315G>A	ENST00000445902.2	-	7	878	c.660C>T	c.(658-660)tgC>tgT	p.C220C	VPS52_ENST00000436044.2_Silent_p.C95C|VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	220					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TGACATCTGCGCAGGCTGCTG	0.597																																																0			6											89.0	78.0	82.0					6																	33236315		1509	2708	4217	33344293	SO:0001819	synonymous_variant	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.660C>T	6.37:g.33236315G>A			33344293	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	HMMPfam_Vps52	p.C220	ENST00000445902.2	37	c.660	CCDS4770.2	6																																																																																			-	HMMPfam_Vps52		0.597	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	protein_coding	OTTHUMT00000076598.2	G	NM_022553		33344293	-1	no_errors	NM_022553	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
ERGIC3	51614	genome.wustl.edu	37	20	34135217	34135217	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr20:34135217G>A	ENST00000348547.2	+	5	499	c.422G>A	c.(421-423)cGc>cAc	p.R141H	ERGIC3_ENST00000447986.1_Missense_Mutation_p.R141H|ERGIC3_ENST00000279052.6_Missense_Mutation_p.R141H|ERGIC3_ENST00000357394.4_Missense_Mutation_p.R141H	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	141					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GACCCTGATCGCTGTGAGAGC	0.602																																																0			20											114.0	82.0	93.0					20																	34135217		2203	4300	6503	33598631	SO:0001583	missense	51614			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.422G>A	20.37:g.34135217G>A	ENSP00000341358:p.Arg141His		33598631	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Missense_Mutation	SNP	HMMPfam_DUF1692	p.R141H	ENST00000348547.2	37	c.422	CCDS13257.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.265628|5.265628	0.95399|0.95399	.|.	.|.	ENSG00000125991|ENSG00000125991	ENST00000416206|ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052	.|T;T;T;T	.|0.44083	.|0.94;0.93;0.94;0.93	4.7|4.7	4.7|4.7	0.59300|0.59300	.|.	.|0.054638	.|0.85682	.|D	.|0.000000	T|T	0.38081|0.38081	0.1027|0.1027	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|B;D;D;D;D	.|0.64830	.|0.366;0.981;0.989;0.982;0.994	.|B;P;P;P;P	.|0.54889	.|0.071;0.584;0.584;0.635;0.763	T|T	0.09684|0.09684	-1.0663|-1.0663	5|10	.|0.17369	.|T	.|0.5	-17.9825|-17.9825	16.0006|16.0006	0.80290|0.80290	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|141;141;141;141;141	.|B4DV36;E9PFA8;Q9Y282;Q9Y282-3;Q9Y282-2	.|.;.;ERGI3_HUMAN;.;.	T|H	140|141	.|ENSP00000341358:R141H;ENSP00000349970:R141H;ENSP00000392341:R141H;ENSP00000279052:R141H	.|ENSP00000279052:R141H	A|R	+|+	1|2	0|0	ERGIC3|ERGIC3	33598631|33598631	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	9.171000|9.171000	0.94802|0.94802	2.442000|2.442000	0.82660|0.82660	0.555000|0.555000	0.69702|0.69702	GCT|CGC	-	NULL		0.602	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC3	protein_coding	OTTHUMT00000078880.2	G	NM_015966		33598631	+1	no_errors	NM_198398	genbank	human	validated	54_36p	missense	SNP	1.000	A
NPSR1	387129	genome.wustl.edu	37	7	34867176	34867176	+	Silent	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr7:34867176G>C	ENST00000360581.1	+	5	770	c.642G>C	c.(640-642)gtG>gtC	p.V214V	NPSR1_ENST00000381539.3_Silent_p.V214V|NPSR1_ENST00000531252.1_Silent_p.V203V|NPSR1_ENST00000359791.1_Silent_p.V214V|NPSR1_ENST00000381542.1_Silent_p.V148V	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	214						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	TGACCATCGTGGCCTTCCTGG	0.582																																																0			7											138.0	123.0	128.0					7																	34867176		2203	4300	6503	34833701	SO:0001819	synonymous_variant	387129			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.642G>C	7.37:g.34867176G>C			34833701	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V214	ENST00000360581.1	37	c.642	CCDS5444.1	7																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.582	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1	protein_coding	OTTHUMT00000216837.1	G	NM_207173		34833701	+1	no_errors	NM_207173	genbank	human	reviewed	54_36p	silent	SNP	0.949	C
ZMYM6	9204	genome.wustl.edu	37	1	35480362	35480362	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:35480362C>A	ENST00000357182.4	-	6	958	c.731G>T	c.(730-732)aGt>aTt	p.S244I	ZMYM6_ENST00000373340.2_Missense_Mutation_p.S244I|ZMYM6_ENST00000487874.1_Missense_Mutation_p.S244I|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	244					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ACCAGAGCTACTATAGCAATA	0.418																																																0			1											129.0	118.0	121.0					1																	35480362		2203	4300	6503	35252949	SO:0001583	missense	9204			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.731G>T	1.37:g.35480362C>A	ENSP00000349708:p.Ser244Ile		35252949	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	HMMPfam_zf-FCS,HMMSmart_SM00746	p.S244I	ENST00000357182.4	37	c.731	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.720658	0.68959	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.26223	1.75;2.89	4.9	3.96	0.45880	.	0.200350	0.51477	D	0.000100	T	0.46718	0.1407	L	0.60455	1.87	0.34539	D	0.71005	D;D;D	0.76494	0.991;0.995;0.999	P;D;D	0.76575	0.601;0.945;0.988	T	0.62091	-0.6927	10	0.52906	T	0.07	-4.6899	15.4036	0.74861	0.0:0.8602:0.1398:0.0	.	147;244;244	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	I	244	ENSP00000362437:S244I;ENSP00000349708:S244I	ENSP00000349708:S244I	S	-	2	0	ZMYM6	35252949	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.648000	0.54410	1.378000	0.46305	0.563000	0.77884	AGT	-	HMMPfam_zf-FCS		0.418	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	protein_coding	OTTHUMT00000011999.1	C	NM_007167		35252949	-1	no_errors	NM_007167	genbank	human	validated	54_36p	missense	SNP	1.000	A
CYTH4	27128	genome.wustl.edu	37	22	37707075	37707075	+	Missense_Mutation	SNP	C	C	G	rs370247166		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr22:37707075C>G	ENST00000248901.6	+	10	1042	c.855C>G	c.(853-855)gaC>gaG	p.D285E		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	285	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						TCCTGACCGACAACTGCCTCT	0.627																																																0			22											174.0	139.0	151.0					22																	37707075		2203	4300	6503	36037021	SO:0001583	missense	27128			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.855C>G	22.37:g.37707075C>G	ENSP00000248901:p.Asp285Glu		36037021	Q5R3F9|Q9UGT6	Missense_Mutation	SNP	superfamily_Sec7,HMMPfam_Sec7,HMMSmart_Sec7,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.D285E	ENST00000248901.6	37	c.855	CCDS13946.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.268360|2.268360	0.40095|0.40095	.|.	.|.	ENSG00000100055|ENSG00000100055	ENST00000248901|ENST00000446506	T|.	0.19105|.	2.17|.	4.52|4.52	1.99|1.99	0.26369|0.26369	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51719|0.51719	0.1691|0.1691	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	B|.	0.29612|.	0.251|.	B|.	0.34385|.	0.181|.	T|T	0.42682|0.42682	-0.9437|-0.9437	10|5	0.36615|.	T|.	0.2|.	.|.	6.6752|6.6752	0.23090|0.23090	0.0:0.6698:0.0:0.3302|0.0:0.6698:0.0:0.3302	.|.	285|.	Q9UIA0|.	CYH4_HUMAN|.	E|E	285|38	ENSP00000248901:D285E|.	ENSP00000248901:D285E|.	D|Q	+|+	3|1	2|0	CYTH4|CYTH4	36037021|36037021	0.994000|0.994000	0.37717|0.37717	0.956000|0.956000	0.39512|0.39512	0.839000|0.839000	0.47603|0.47603	0.411000|0.411000	0.21115|0.21115	1.008000|1.008000	0.39264|0.39264	-0.140000|-0.140000	0.14226|0.14226	GAC|CAA	-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.627	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH4	protein_coding	OTTHUMT00000318917.1	C			36037021	+1	no_errors	NM_013385	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NUP155	9631	genome.wustl.edu	37	5	37307524	37307524	+	Nonsense_Mutation	SNP	A	A	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:37307524A>C	ENST00000231498.3	-	25	2981	c.2778T>G	c.(2776-2778)taT>taG	p.Y926*	NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000513532.1_Nonsense_Mutation_p.Y862*|NUP155_ENST00000381843.2_Nonsense_Mutation_p.Y867*	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	926					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCACACCCTCATAAAATCTCA	0.388																																																0			5											81.0	76.0	78.0					5																	37307524		2203	4300	6503	37343281	SO:0001587	stop_gained	9631			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2778T>G	5.37:g.37307524A>C	ENSP00000231498:p.Tyr926*		37343281	Q9UBE9|Q9UFL5	Nonsense_Mutation	SNP	HMMPfam_Nucleoporin	p.Y926*	ENST00000231498.3	37	c.2778	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	A	40	8.107609	0.98657	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	.	.	.	5.46	3.08	0.35506	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.1145	9.4962	0.38989	0.8578:0.0:0.1422:0.0	.	.	.	.	X	926;867;888;862	.	ENSP00000231498:Y926X	Y	-	3	2	NUP155	37343281	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.067000	0.57527	0.392000	0.25172	0.533000	0.62120	TAT	-	HMMPfam_Nucleoporin		0.388	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	protein_coding	OTTHUMT00000207593.2	A	NM_153485, NM_004298		37343281	-1	no_errors	NM_153485	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	C
UTP11L	51118	genome.wustl.edu	37	1	38484245	38484245	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:38484245C>A	ENST00000373014.4	+	4	399	c.338C>A	c.(337-339)gCt>gAt	p.A113D	UTP11L_ENST00000537711.1_Missense_Mutation_p.A113D|UTP11L_ENST00000488453.1_3'UTR	NM_016037.3	NP_057121.2	Q9Y3A2	UTP11_HUMAN	UTP11-like, U3 small nucleolar ribonucleoprotein (yeast)	113					nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleolus (GO:0005730)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTTGCAGAAGCTAAGGTAATT	0.338																																																0			1											79.0	86.0	84.0					1																	38484245		2203	4300	6503	38256832	SO:0001583	missense	51118			AF151852	CCDS429.1	1p34.3	2014-03-06	2014-03-06		ENSG00000183520	ENSG00000183520			24329	protein-coding gene	gene with protein product		609440				11860508, 10810093	Standard	NM_016037		Approved	CGI-94	uc001ccn.4	Q9Y3A2	OTTHUMG00000004435	ENST00000373014.4:c.338C>A	1.37:g.38484245C>A	ENSP00000362105:p.Ala113Asp		38256832	A8K785|B4DJC6|D3DPT7|Q5VT93|Q9BS98|Q9NS31	Missense_Mutation	SNP	HMMPfam_Utp11	p.A113D	ENST00000373014.4	37	c.338	CCDS429.1	1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190194	0.58017	.	.	ENSG00000183520	ENST00000373014;ENST00000537711	.	.	.	6.07	4.23	0.50019	.	0.260739	0.44285	D	0.000471	T	0.60157	0.2247	M	0.72624	2.21	0.47245	D	0.999362	P	0.50369	0.934	P	0.49637	0.617	T	0.58137	-0.7689	9	0.12430	T	0.62	-1.3745	10.6941	0.45888	0.0:0.7944:0.0:0.2056	.	113	Q9Y3A2	UTP11_HUMAN	D	113	.	ENSP00000362105:A113D	A	+	2	0	UTP11L	38256832	0.887000	0.30362	1.000000	0.80357	0.987000	0.75469	1.431000	0.34925	0.916000	0.36871	-0.136000	0.14681	GCT	-	HMMPfam_Utp11		0.338	UTP11L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP11L	protein_coding	OTTHUMT00000012962.1	C	NM_016037		38256832	+1	no_errors	NM_016037	genbank	human	validated	54_36p	missense	SNP	1.000	A
XIRP1	165904	genome.wustl.edu	37	3	39225423	39225423	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:39225423G>A	ENST00000340369.3	-	2	5742	c.5514C>T	c.(5512-5514)tcC>tcT	p.S1838S	XIRP1_ENST00000421646.1_Silent_p.S521S|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1838	Interaction with FLNC.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAGCTGGCTGGGAGTAGCTGC	0.647																																																0			3											36.0	39.0	38.0					3																	39225423		2203	4300	6503	39200427	SO:0001819	synonymous_variant	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.5514C>T	3.37:g.39225423G>A			39200427	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	HMMPfam_Xin	p.S1838	ENST00000340369.3	37	c.5514	CCDS2683.1	3																																																																																			-	NULL		0.647	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	protein_coding	OTTHUMT00000254065.1	G	XM_093522		39200427	-1	no_errors	NM_194293	genbank	human	provisional	54_36p	silent	SNP	0.644	A
CHD6	84181	genome.wustl.edu	37	20	40081475	40081475	+	Silent	SNP	G	G	A	rs182170504		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr20:40081475G>A	ENST00000373233.3	-	21	3405	c.3228C>T	c.(3226-3228)gaC>gaT	p.D1076D	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1076					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGGGCCTTTCGTCTGAGTCGC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19741	0.001		0.0	False		,,,				2504	0.0															0			20											148.0	120.0	130.0					20																	40081475		2203	4300	6503	39514889	SO:0001819	synonymous_variant	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.3228C>T	20.37:g.40081475G>A			39514889	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	superfamily_Chromo domain-like,HMMSmart_SM00298,HMMPfam_Chromo,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_BRK,HMMSmart_SM00592	p.D1076	ENST00000373233.3	37	c.3228	CCDS13317.1	20																																																																																			-	NULL		0.547	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	protein_coding	OTTHUMT00000079270.1	G			39514889	-1	no_errors	NM_032221	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
ASB16	92591	genome.wustl.edu	37	17	42255062	42255062	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:42255062T>C	ENST00000293414.1	+	4	1232	c.1148T>C	c.(1147-1149)gTg>gCg	p.V383A	ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000592897.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	383					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GAGACCTGGGTGGAGGCGGTG	0.582																																																0			17											155.0	117.0	130.0					17																	42255062		2203	4300	6503	39610588	SO:0001583	missense	92591			AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.1148T>C	17.37:g.42255062T>C	ENSP00000293414:p.Val383Ala		39610588	B2RBC0|Q8WXK0	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_SOCS_box	p.V383A	ENST00000293414.1	37	c.1148	CCDS11478.1	17	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511526	0.44660	.	.	ENSG00000161664	ENST00000293414	T	0.63096	-0.02	5.2	1.68	0.24146	.	0.513654	0.20757	N	0.086238	T	0.41949	0.1181	N	0.20986	0.625	0.25690	N	0.985704	B	0.06786	0.001	B	0.06405	0.002	T	0.20075	-1.0286	10	0.28530	T	0.3	-23.1015	7.3972	0.26944	0.0:0.2776:0.0:0.7224	.	383	Q96NS5	ASB16_HUMAN	A	383	ENSP00000293414:V383A	ENSP00000293414:V383A	V	+	2	0	ASB16	39610588	0.490000	0.26012	0.827000	0.32855	0.987000	0.75469	1.225000	0.32551	0.446000	0.26666	0.402000	0.26972	GTG	-	superfamily_Ankyrin repeat		0.582	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB16	protein_coding	OTTHUMT00000457703.1	T			39610588	+1	no_errors	NM_080863	genbank	human	reviewed	54_36p	missense	SNP	0.669	C
CCDC103	388389	genome.wustl.edu	37	17	42979935	42979935	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:42979935G>T	ENST00000417826.2	+	4	574	c.479G>T	c.(478-480)cGg>cTg	p.R160L	FAM187A_ENST00000412523.2_Intron|CCDC103_ENST00000410006.2_Missense_Mutation_p.R160L|EFTUD2_ENST00000426333.2_5'Flank|FAM187A_ENST00000331733.4_5'UTR|AC015936.3_ENST00000441312.1_RNA	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	160					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				CCGGCTGACCGGGCAGCGGTG	0.652																																																0			17											54.0	61.0	59.0					17																	42979935		2203	4300	6503	40335461	SO:0001583	missense	388389			AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.479G>T	17.37:g.42979935G>T	ENSP00000391692:p.Arg160Leu		40335461	A8K145|B8ZZU0	Missense_Mutation	SNP	NULL	p.R160L	ENST00000417826.2	37	c.479	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	G	5.116	0.207082	0.09704	.	.	ENSG00000167131	ENST00000357776;ENST00000417826;ENST00000410006	T;T;T	0.54866	0.55;0.55;0.55	5.64	3.63	0.41609	.	1.223890	0.06283	U	0.697782	T	0.49287	0.1548	L	0.29908	0.895	0.09310	N	1	P	0.45283	0.855	P	0.48304	0.573	T	0.35276	-0.9795	10	0.26408	T	0.33	0.3331	9.4555	0.38751	0.2162:0.0:0.7838:0.0	.	160	Q8IW40	CC103_HUMAN	L	160	ENSP00000350420:R160L;ENSP00000391692:R160L;ENSP00000387252:R160L	ENSP00000350420:R160L	R	+	2	0	CCDC103	40335461	0.164000	0.22935	0.003000	0.11579	0.062000	0.15995	2.412000	0.44609	1.628000	0.50416	0.650000	0.86243	CGG	-	NULL		0.652	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	protein_coding	OTTHUMT00000334578.1	G	NM_213607		40335461	+1	no_errors	NM_213607	genbank	human	provisional	54_36p	missense	SNP	0.005	T
KAT6A	7994	genome.wustl.edu	37	8	41792211	41792211	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:41792211C>G	ENST00000396930.3	-	18	4070	c.3527G>C	c.(3526-3528)aGt>aCt	p.S1176T	KAT6A_ENST00000265713.2_Missense_Mutation_p.S1176T|KAT6A_ENST00000406337.1_Missense_Mutation_p.S1176T	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1176					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GATTTCCCGACTCAACTTAAA	0.463																																																0			8											157.0	155.0	156.0					8																	41792211		2203	4300	6503	41911368	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3527G>C	8.37:g.41792211C>G	ENSP00000380136:p.Ser1176Thr		41911368	Q76L81	Missense_Mutation	SNP	HMMSmart_H15,superfamily_SSF46785,HMMSmart_PHD,HMMPfam_PHD,HMMSmart_RING,PatternScan_ZF_PHD_1,superfamily_FYVE_PHD_ZnF,superfamily_Acyl_CoA_acyltransferase,HMMPfam_MOZ_SAS	p.S1176T	ENST00000396930.3	37	c.3527	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	4.458	0.084760	0.08583	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.59224	0.28;0.28;0.28	5.95	0.78	0.18556	.	0.122383	0.56097	D	0.000033	T	0.37320	0.0999	N	0.22421	0.69	0.21256	N	0.999748	B	0.02656	0.0	B	0.01281	0.0	T	0.21109	-1.0255	10	0.52906	T	0.07	-12.8141	6.4556	0.21928	0.0:0.1974:0.1205:0.6822	.	1176	Q92794	KAT6A_HUMAN	T	1176	ENSP00000265713:S1176T;ENSP00000385888:S1176T;ENSP00000380136:S1176T	ENSP00000265713:S1176T	S	-	2	0	KAT6A	41911368	1.000000	0.71417	0.950000	0.38849	0.134000	0.20937	0.827000	0.27421	-0.089000	0.12484	-0.302000	0.09304	AGT	-	NULL		0.463	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST3	protein_coding	OTTHUMT00000318163.1	C	NM_006766		41911368	-1	no_errors	NM_001099412	genbank	human	validated	54_36p	missense	SNP	0.858	G
HNF4A	3172	genome.wustl.edu	37	20	43034855	43034855	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr20:43034855C>A	ENST00000316099.4	+	2	362	c.273C>A	c.(271-273)aaC>aaA	p.N91K	HNF4A_ENST00000316673.4_Missense_Mutation_p.N69K|HNF4A_ENST00000443598.2_Missense_Mutation_p.N91K|HNF4A_ENST00000457232.1_Missense_Mutation_p.N69K|HNF4A_ENST00000609795.1_Missense_Mutation_p.N69K|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000415691.2_Missense_Mutation_p.N91K	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	91					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TGCGGAAGAACCACATGTACT	0.607																																					Colon(79;2 1269 8820 14841 52347)											0			20											52.0	49.0	50.0					20																	43034855		2203	4300	6503	42468269	SO:0001583	missense	3172			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.273C>A	20.37:g.43034855C>A	ENSP00000312987:p.Asn91Lys		42468269	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.N91K	ENST00000316099.4	37	c.273	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	c	20.1	3.937078	0.73557	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	5.17	3.24	0.37175	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.185694	0.56097	D	0.000023	D	0.94105	0.8110	N	0.16478	0.41	0.80722	D	1	P;P;P;P;P;P;P	0.44429	0.835;0.576;0.576;0.802;0.553;0.498;0.521	P;P;P;P;B;B;B	0.53518	0.728;0.457;0.457;0.607;0.392;0.272;0.328	D	0.93957	0.7237	10	0.87932	D	0	.	10.9289	0.47207	0.0:0.8492:0.0:0.1508	.	84;91;91;91;69;69;69	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	K	69;69;91;91;121;91	ENSP00000315180:N69K;ENSP00000396216:N69K;ENSP00000312987:N91K;ENSP00000410911:N91K;ENSP00000412111:N91K	ENSP00000312987:N91K	N	+	3	2	HNF4A	42468269	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.193000	0.50997	1.186000	0.42985	0.645000	0.84053	AAC	-	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain)		0.607	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	protein_coding	OTTHUMT00000079363.3	C			42468269	+1	no_errors	NM_000457	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
UBR2	23304	genome.wustl.edu	37	6	42541550	42541550	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:42541550G>A	ENST00000372899.1	+	2	415	c.157G>A	c.(157-159)Ggt>Agt	p.G53S	UBR2_ENST00000372901.1_Missense_Mutation_p.G53S|UBR2_ENST00000372903.2_Missense_Mutation_p.G53S	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	53					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CTACTGCAGGGGTCCCAACCC	0.443																																																0			6											103.0	101.0	101.0					6																	42541550		2203	4300	6503	42649528	SO:0001583	missense	23304			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.157G>A	6.37:g.42541550G>A	ENSP00000361990:p.Gly53Ser		42649528	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	PatternScan_LIPOCALIN,HMMPfam_zf-UBR,HMMSmart_SM00396,superfamily_ClpS-like,HMMPfam_ClpS,PatternScan_RCC1_2	p.G53S	ENST00000372899.1	37	c.157	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501248	0.44455	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71461	-0.57;0.44;0.44	5.88	5.02	0.67125	.	0.107039	0.64402	N	0.000007	T	0.50343	0.1610	M	0.62723	1.935	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.13407	0.001;0.009	T	0.54289	-0.8316	10	0.11182	T	0.66	-14.6674	15.0694	0.72024	0.0678:0.0:0.9322:0.0	.	53;53	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	S	53	ENSP00000361994:G53S;ENSP00000361990:G53S;ENSP00000361992:G53S	ENSP00000361990:G53S	G	+	1	0	UBR2	42649528	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.845000	0.62853	1.494000	0.48533	0.655000	0.94253	GGT	-	NULL		0.443	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	protein_coding	OTTHUMT00000040558.2	G	NM_015255		42649528	+1	no_errors	NM_015255	genbank	human	provisional	54_36p	missense	SNP	1.000	A
SAMD4B	55095	genome.wustl.edu	37	19	39873883	39873883	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:39873883C>G	ENST00000314471.6	+	15	3043	c.2008C>G	c.(2008-2010)Ccc>Gcc	p.P670A	SAMD4B_ENST00000598913.1_Missense_Mutation_p.P670A|SAMD4B_ENST00000596368.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	670					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GGAGATCAATCCCACTCTGGA	0.587																																																0			19											169.0	131.0	144.0					19																	39873883		2203	4300	6503	44565723	SO:0001583	missense	55095				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.2008C>G	19.37:g.39873883C>G	ENSP00000317224:p.Pro670Ala		44565723	A5Z0M6|Q6P194	Missense_Mutation	SNP	HMMSmart_SM00454,HMMPfam_SAM_1,superfamily_SAM/Pointed domain	p.P670A	ENST00000314471.6	37	c.2008	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827626	0.50845	.	.	ENSG00000179134	ENST00000314471	.	.	.	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000001	T	0.66925	0.2839	L	0.40543	1.245	0.53005	D	0.99996	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.69221	-0.5202	9	0.56958	D	0.05	.	14.0681	0.64844	0.0:1.0:0.0:0.0	.	670;670	Q5PRF9;A5Z0M6	SMAG2_HUMAN;.	A	670	.	ENSP00000317224:P670A	P	+	1	0	SAMD4B	44565723	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.366000	0.52343	2.186000	0.69663	0.289000	0.19496	CCC	-	NULL		0.587	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	protein_coding	OTTHUMT00000464467.1	C	NM_018028		44565723	+1	no_errors	NM_018028	genbank	human	provisional	54_36p	missense	SNP	1.000	G
SLC38A2	54407	genome.wustl.edu	37	12	46758464	46758464	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:46758464C>T	ENST00000256689.5	-	9	1112	c.668G>A	c.(667-669)gGc>gAc	p.G223D	SLC38A2_ENST00000547252.1_5'UTR|SLC38A2_ENST00000551374.1_Missense_Mutation_p.G61D	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	223					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		CAAGGAAAGGCCACTGGTATA	0.348																																					Ovarian(9;448 492 8335 28722 40361)											0			12											85.0	98.0	93.0					12																	46758464		2202	4299	6501	45044731	SO:0001583	missense	54407			AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.668G>A	12.37:g.46758464C>T	ENSP00000256689:p.Gly223Asp		45044731	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.G223D	ENST00000256689.5	37	c.668	CCDS8749.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.346323	0.95807	.	.	ENSG00000134294	ENST00000256689;ENST00000551374	T;T	0.02421	4.3;4.3	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.21881	0.0527	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	T	0.02047	-1.1223	10	0.59425	D	0.04	-10.4963	19.2372	0.93866	0.0:1.0:0.0:0.0	.	61;123;223	F8VQW8;Q96QD8-2;Q96QD8	.;.;S38A2_HUMAN	D	223;61	ENSP00000256689:G223D;ENSP00000450406:G61D	ENSP00000256689:G223D	G	-	2	0	SLC38A2	45044731	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.818000	0.86416	2.546000	0.85860	0.460000	0.39030	GGC	-	HMMPfam_Aa_trans		0.348	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A2	protein_coding	OTTHUMT00000404226.1	C			45044731	-1	no_errors	NM_018976	genbank	human	validated	54_36p	missense	SNP	1.000	T
MYLK3	91807	genome.wustl.edu	37	16	46781804	46781804	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr16:46781804T>G	ENST00000394809.4	-	1	417	c.302A>C	c.(301-303)cAg>cCg	p.Q101P	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	101					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CGCATCCTGCTGCATGGCCCT	0.701																																																0			16											34.0	31.0	32.0					16																	46781804		2203	4299	6502	45339305	SO:0001583	missense	91807			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.302A>C	16.37:g.46781804T>G	ENSP00000378288:p.Gln101Pro		45339305	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.Q101P	ENST00000394809.4	37	c.302	CCDS10723.2	16	.	.	.	.	.	.	.	.	.	.	T	16.67	3.188852	0.57909	.	.	ENSG00000140795	ENST00000394809	T	0.69561	-0.41	4.87	-1.37	0.09056	.	0.536042	0.13959	N	0.350943	T	0.59756	0.2217	L	0.34521	1.04	0.52099	D	0.999947	D	0.61080	0.989	P	0.50314	0.637	T	0.60052	-0.7338	10	0.54805	T	0.06	.	10.5238	0.44936	0.0:0.3946:0.0:0.6054	.	101	Q32MK0	MYLK3_HUMAN	P	101	ENSP00000378288:Q101P	ENSP00000378288:Q101P	Q	-	2	0	MYLK3	45339305	0.036000	0.19791	0.633000	0.29310	0.876000	0.50452	-0.191000	0.09601	-0.168000	0.10853	0.402000	0.26972	CAG	-	NULL		0.701	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	protein_coding	OTTHUMT00000255743.2	T	NM_182493		45339305	-1	no_errors	NM_182493	genbank	human	validated	54_36p	missense	SNP	0.249	G
PRMT2	3275	genome.wustl.edu	37	21	48078803	48078803	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr21:48078803C>T	ENST00000397637.1	+	7	1755	c.801C>T	c.(799-801)aaC>aaT	p.N267N	PRMT2_ENST00000291705.6_Intron|PRMT2_ENST00000451211.2_Silent_p.N267N|PRMT2_ENST00000458387.2_Intron|PRMT2_ENST00000355680.3_Silent_p.N267N|PRMT2_ENST00000397638.2_Silent_p.N267N|PRMT2_ENST00000440086.1_Intron			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	267	Interaction with ESR1.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCTGGGACAACGCGTACGAGT	0.582																																																0			21											145.0	106.0	119.0					21																	48078803		2203	4300	6503	46903231	SO:0001819	synonymous_variant	3275			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.801C>T	21.37:g.48078803C>T			46903231	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.T151M	ENST00000397637.1	37	c.452	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	9.854	1.194565	0.22037	.	.	ENSG00000160310	ENST00000379844	.	.	.	5.14	-1.04	0.10068	.	.	.	.	.	T	0.55321	0.1913	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49826	-0.8898	4	.	.	.	-19.8553	9.4632	0.38798	0.0:0.4118:0.0:0.5881	.	.	.	.	M	153	.	.	T	+	2	0	PRMT2	46903231	0.116000	0.22171	0.991000	0.47740	0.915000	0.54546	-1.502000	0.02279	-0.179000	0.10654	-0.251000	0.11542	ACG	-	NULL		0.582	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	protein_coding	OTTHUMT00000207401.1	C	NM_001535		46903231	+1	no_errors	ENST00000379844	ensembl	human	known	54_36p	missense	SNP	0.997	T
WDR6	11180	genome.wustl.edu	37	3	49050270	49050270	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:49050270C>T	ENST00000608424.1	+	2	1342	c.1303C>T	c.(1303-1305)Cct>Tct	p.P435S	WDR6_ENST00000395474.3_Missense_Mutation_p.P465S|WDR6_ENST00000448293.1_Missense_Mutation_p.P384S|WDR6_ENST00000415265.2_Intron|WDR6_ENST00000489684.1_3'UTR			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	435					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.P435S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GACCCTGTTTCCTGGGAAGGT	0.592																																																1	Substitution - Missense(1)	lung(1)	3											66.0	50.0	56.0					3																	49050270		2203	4300	6503	49025274	SO:0001583	missense	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1303C>T	3.37:g.49050270C>T	ENSP00000477389:p.Pro435Ser		49025274	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.P435S	ENST00000608424.1	37	c.1303		3	.	.	.	.	.	.	.	.	.	.	C	2.707	-0.269708	0.05716	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;T	0.56941	0.43;2.24	5.4	1.12	0.20585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	1.381220	0.04049	N	0.304373	T	0.23451	0.0567	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.31696	-0.9934	10	0.09843	T	0.71	3.0621	3.9469	0.09352	0.2443:0.469:0.2053:0.0814	.	306;435;384	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	S	465;384	ENSP00000378857:P465S;ENSP00000413432:P384S	ENSP00000378857:P465S	P	+	1	0	WDR6	49025274	0.001000	0.12720	0.460000	0.27093	0.945000	0.59286	0.329000	0.19698	1.218000	0.43458	0.561000	0.74099	CCT	-	superfamily_WD40_like		0.592	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	protein_coding	OTTHUMT00000471652.1	C			49025274	+1	no_errors	NM_018031	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
DIP2B	57609	genome.wustl.edu	37	12	51092123	51092123	+	Silent	SNP	A	A	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:51092123A>T	ENST00000301180.5	+	18	2095	c.2061A>T	c.(2059-2061)ccA>ccT	p.P687P		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	687						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CTGGAGTTCCAGGAGCCCCTT	0.423																																																0			12											81.0	82.0	82.0					12																	51092123		2203	4300	6503	49378390	SO:0001819	synonymous_variant	57609			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2061A>T	12.37:g.51092123A>T			49378390	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	HMMPfam_DMAP_binding,superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding	p.P687	ENST00000301180.5	37	c.2061	CCDS31799.1	12																																																																																			-	superfamily_Acetyl-CoA synthetase-like		0.423	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	protein_coding	OTTHUMT00000404243.1	A	NM_173602		49378390	+1	no_errors	NM_173602	genbank	human	validated	54_36p	silent	SNP	0.976	T
NFATC2	4773	genome.wustl.edu	37	20	50158928	50158928	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr20:50158928C>G	ENST00000396009.3	-	1	330	c.111G>C	c.(109-111)gaG>gaC	p.E37D	NFATC2_ENST00000414705.1_Intron|NFATC2_ENST00000609507.1_Intron|NFATC2_ENST00000371564.3_Missense_Mutation_p.E37D|NFATC2_ENST00000609943.1_Intron|NFATC2_ENST00000610033.1_5'UTR	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	37					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GATTCAAATACTCATAGTCGA	0.677																																																0			20											24.0	28.0	26.0					20																	50158928		2201	4300	6501	49592335	SO:0001583	missense	4773			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.111G>C	20.37:g.50158928C>G	ENSP00000379330:p.Glu37Asp		49592335	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	superfamily_p53-like transcription factors,HMMPfam_RHD,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG	p.E37D	ENST00000396009.3	37	c.111	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	C	4.393	0.072630	0.08436	.	.	ENSG00000101096	ENST00000371564;ENST00000396009	T;T	0.14391	2.51;2.52	4.18	-0.801	0.10893	.	0.484355	0.18463	N	0.140466	T	0.04907	0.0132	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45381	-0.9265	10	0.02654	T	1	-5.6613	14.8849	0.70560	0.0:0.5844:0.4156:0.0	.	37;37	Q13469;B5B2N8	NFAC2_HUMAN;.	D	37	ENSP00000360619:E37D;ENSP00000379330:E37D	ENSP00000360619:E37D	E	-	3	2	NFATC2	49592335	0.978000	0.34361	0.998000	0.56505	0.844000	0.47949	0.009000	0.13219	0.002000	0.14630	-0.519000	0.04390	GAG	-	NULL		0.677	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	protein_coding	OTTHUMT00000079730.2	C	NM_012340		49592335	-1	no_errors	NM_173091	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
OGDHL	55753	genome.wustl.edu	37	10	50952143	50952143	+	Silent	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:50952143G>C	ENST00000374103.4	-	14	1843	c.1758C>G	c.(1756-1758)ccC>ccG	p.P586P	OGDHL_ENST00000432695.1_Silent_p.P377P|OGDHL_ENST00000419399.1_Silent_p.P529P	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	586					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.P586P(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TCATGCTCTTGGGCTCCCCAT	0.607																																																1	Substitution - coding silent(1)	large_intestine(1)	10											106.0	86.0	93.0					10																	50952143		2203	4300	6503	50622149	SO:0001819	synonymous_variant	55753			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1758C>G	10.37:g.50952143G>C			50622149	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	superfamily_SSF52518,HMMPfam_E1_dh,HMMPfam_Transket_pyr	p.P586	ENST00000374103.4	37	c.1758	CCDS7234.1	10																																																																																			-	superfamily_SSF52518		0.607	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	protein_coding	OTTHUMT00000048007.1	G	NM_018245		50622149	-1	no_errors	NM_018245	genbank	human	validated	54_36p	silent	SNP	1.000	C
FAM124A	220108	genome.wustl.edu	37	13	51826045	51826045	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr13:51826045A>G	ENST00000322475.8	+	3	677	c.542A>G	c.(541-543)gAc>gGc	p.D181G	FAM124A_ENST00000280057.6_Missense_Mutation_p.D217G	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	181			D -> H (in dbSNP:rs17075482).							breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		TGTCGCTACGACAACTATGCT	0.577																																																0			13											46.0	45.0	46.0					13																	51826045		2203	4300	6503	50724046	SO:0001583	missense	220108			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.542A>G	13.37:g.51826045A>G	ENSP00000324625:p.Asp181Gly		50724046	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Missense_Mutation	SNP	NULL	p.D217G	ENST00000322475.8	37	c.650	CCDS55900.1	13	.	.	.	.	.	.	.	.	.	.	A	11.13	1.549167	0.27652	.	.	ENSG00000150510	ENST00000322475;ENST00000280057	T;T	0.51817	0.69;0.69	5.79	4.61	0.57282	.	0.403648	0.27866	N	0.017528	T	0.42899	0.1223	M	0.67397	2.05	0.31458	N	0.669862	P;P;B	0.38078	0.617;0.617;0.082	B;B;B	0.30855	0.121;0.121;0.058	T	0.56836	-0.7913	10	0.72032	D	0.01	-39.3577	11.0341	0.47791	0.9275:0.0:0.0725:0.0	.	181;217;181	Q86V42;Q86V42-2;Q86V42-3	F124A_HUMAN;.;.	G	181;217	ENSP00000324625:D181G;ENSP00000280057:D217G	ENSP00000280057:D217G	D	+	2	0	FAM124A	50724046	1.000000	0.71417	0.836000	0.33094	0.010000	0.07245	7.174000	0.77620	1.022000	0.39626	-0.256000	0.11100	GAC	-	NULL		0.577	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	protein_coding	OTTHUMT00000045019.3	A	NM_145019		50724046	+1	no_errors	NM_145019	genbank	human	predicted	54_36p	missense	SNP	0.966	G
RBM15B	29890	genome.wustl.edu	37	3	51430334	51430334	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:51430334C>G	ENST00000323686.4	+	1	1604	c.1504C>G	c.(1504-1506)Cag>Gag	p.Q502E		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	502					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CCAGCAGTACCAGCCCTCGCC	0.622																																																0			3											49.0	53.0	52.0					3																	51430334		2203	4300	6503	51405374	SO:0001583	missense	29890			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1504C>G	3.37:g.51430334C>G	ENSP00000313890:p.Gln502Glu		51405374	A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SPOC-like,HMMPfam_SPOC	p.Q502E	ENST00000323686.4	37	c.1504	CCDS33764.1	3	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304129	0.40795	.	.	ENSG00000179837	ENST00000323686;ENST00000541145	T	0.15487	2.42	5.55	4.66	0.58398	Nucleotide-binding, alpha-beta plait (1);	.	.	.	.	T	0.16642	0.0400	L	0.54323	1.7	0.50632	D	0.999884	B	0.29037	0.231	B	0.29785	0.107	T	0.04400	-1.0954	9	0.23302	T	0.38	-14.5722	9.7452	0.40442	0.0:0.7849:0.1419:0.0732	.	502	Q8NDT2	RB15B_HUMAN	E	502;175	ENSP00000313890:Q502E	ENSP00000313890:Q502E	Q	+	1	0	RBM15B	51405374	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.727000	0.68523	1.299000	0.44798	0.655000	0.94253	CAG	-	superfamily_SSF54928		0.622	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM15B	protein_coding	OTTHUMT00000346489.1	C	NM_013286		51405374	+1	no_errors	NM_013286	genbank	human	validated	54_36p	missense	SNP	1.000	G
LIG1	3978	genome.wustl.edu	37	19	48638978	48638978	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:48638978C>T	ENST00000263274.7	-	16	1901	c.1482G>A	c.(1480-1482)acG>acA	p.T494T	LIG1_ENST00000427526.2_Silent_p.T463T|LIG1_ENST00000536218.1_Silent_p.T426T	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	494					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CCTCCAGCCACGTCTTTCTGG	0.597								Nucleotide excision repair (NER)																																								0			19											213.0	172.0	186.0					19																	48638978		2203	4300	6503	53330790	SO:0001819	synonymous_variant	3978				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1482G>A	19.37:g.48638978C>T			53330790	B2RAI8|Q2TB12|Q32P23	Silent	SNP	HMMPfam_DNA_ligase_A_N,superfamily_DNA ligase/mRNA capping enzyme catalytic domain,HMMPfam_DNA_ligase_A_M,PatternScan_DNA_LIGASE_A1,PatternScan_DNA_LIGASE_A2,HMMPfam_DNA_ligase_A_C	p.T494	ENST00000263274.7	37	c.1482	CCDS12711.1	19																																																																																			-	NULL		0.597	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	protein_coding	OTTHUMT00000465575.1	C	NM_000234		53330790	-1	no_errors	NM_000234	genbank	human	reviewed	54_36p	silent	SNP	0.317	T
ERBB3	2065	genome.wustl.edu	37	12	56488250	56488250	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:56488250C>T	ENST00000267101.3	+	15	2209	c.1769C>T	c.(1768-1770)cCc>cTc	p.P590L	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.P531L|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	590					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AGCAGCTGCCCCCATGGAGTC	0.542																																																0			12											102.0	103.0	103.0					12																	56488250		2203	4300	6503	54774517	SO:0001583	missense	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1769C>T	12.37:g.56488250C>T	ENSP00000267101:p.Pro590Leu		54774517	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_Recep_L_domain,HMMSmart_SM00261,HMMPfam_Furin-like,superfamily_Growth factor receptor domain,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220	p.P590L	ENST00000267101.3	37	c.1769	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.239834	0.95240	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.69040	-0.37;-0.37	5.77	5.77	0.91146	Growth factor, receptor (1);	0.000000	0.64402	D	0.000004	D	0.85375	0.5682	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	D	0.87410	0.2375	10	0.87932	D	0	.	18.7534	0.91823	0.0:1.0:0.0:0.0	.	531;590	P21860-4;P21860	.;ERBB3_HUMAN	L	590;531	ENSP00000267101:P590L;ENSP00000408340:P531L	ENSP00000267101:P590L	P	+	2	0	ERBB3	54774517	1.000000	0.71417	0.992000	0.48379	0.947000	0.59692	7.392000	0.79840	2.737000	0.93849	0.561000	0.74099	CCC	-	superfamily_Growth factor receptor domain,HMMSmart_SM00261		0.542	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	C			54774517	+1	no_errors	NM_001982	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CCDC88A	55704	genome.wustl.edu	37	2	55561567	55561567	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:55561567T>C	ENST00000436346.1	-	15	3231	c.2390A>G	c.(2389-2391)cAg>cGg	p.Q797R	CCDC88A_ENST00000336838.6_Missense_Mutation_p.Q797R|AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000263630.8_Missense_Mutation_p.Q797R|AC012358.8_ENST00000600219.1_RNA|CCDC88A_ENST00000413716.2_Missense_Mutation_p.Q797R|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599475.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	797					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TAGGTTTTTCTGCAATGTTTG	0.318																																																0			2											91.0	89.0	90.0					2																	55561567		2202	4298	6500	55415071	SO:0001583	missense	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2390A>G	2.37:g.55561567T>C	ENSP00000410608:p.Gln797Arg		55415071	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q797R	ENST00000436346.1	37	c.2390		2	.	.	.	.	.	.	.	.	.	.	T	12.82	2.052525	0.36181	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.14766	2.48;2.72;2.69;2.5	5.03	5.03	0.67393	.	0.000000	0.45867	U	0.000338	T	0.29817	0.0745	L	0.49571	1.57	0.80722	D	1	B;D;B;D;D	0.69078	0.172;0.992;0.1;0.997;0.996	B;D;B;D;D	0.75484	0.084;0.979;0.084;0.975;0.986	T	0.01879	-1.1255	10	0.23302	T	0.38	-15.7972	15.1059	0.72322	0.0:0.0:0.0:1.0	.	797;797;797;797;797	B7ZM78;Q3V6T2-2;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.;.;GRDN_HUMAN;.;.	R	797	ENSP00000338728:Q797R;ENSP00000263630:Q797R;ENSP00000410608:Q797R;ENSP00000404431:Q797R	ENSP00000263630:Q797R	Q	-	2	0	CCDC88A	55415071	1.000000	0.71417	0.989000	0.46669	0.948000	0.59901	7.994000	0.88315	2.034000	0.60081	0.369000	0.22263	CAG	-	superfamily_Prefoldin		0.318	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	protein_coding		T	NM_017571		55415071	-1	no_errors	NM_018084	genbank	human	validated	54_36p	missense	SNP	0.990	C
DENND6A	201627	genome.wustl.edu	37	3	57631413	57631413	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:57631413C>T	ENST00000311128.5	-	11	1082	c.1012G>A	c.(1012-1014)Gaa>Aaa	p.E338K	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	338					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GTAGTATATTCTTTGAATTCA	0.318																																																0			3											98.0	100.0	99.0					3																	57631413		2203	4299	6502	57606453	SO:0001583	missense	201627			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1012G>A	3.37:g.57631413C>T	ENSP00000311401:p.Glu338Lys		57606453	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	HMMPfam_DUF1630	p.E338K	ENST00000311128.5	37	c.1012	CCDS33773.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.543790|5.543790	0.96474|0.96474	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000311128|ENST00000477344	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79021|0.79021	0.4376|0.4376	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D|.	0.63880|.	0.993|.	D|.	0.72982|.	0.979|.	T|T	0.76961|0.76961	-0.2765|-0.2765	9|5	0.48119|.	T|.	0.1|.	-19.1995|-19.1995	20.2348|20.2348	0.98355|0.98355	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	338|.	Q8IWF6|.	F116A_HUMAN|.	K|K	338|106	.|.	ENSP00000311401:E338K|.	E|R	-|-	1|2	0|0	FAM116A|FAM116A	57606453|57606453	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.857000|6.857000	0.75455|0.75455	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	GAA|AGA	-	HMMPfam_DUF1630		0.318	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM116A	protein_coding	OTTHUMT00000351594.1	C	NM_152678		57606453	-1	no_errors	NM_152678	genbank	human	validated	54_36p	missense	SNP	1.000	T
MARCH10	162333	genome.wustl.edu	37	17	60821763	60821763	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:60821763G>T	ENST00000311269.5	-	5	783	c.509C>A	c.(508-510)gCa>gAa	p.A170E	MARCH10_ENST00000456609.2_Missense_Mutation_p.A170E|MARCH10_ENST00000583600.1_Missense_Mutation_p.A208E|MARCH10_ENST00000544856.2_Missense_Mutation_p.A169E	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	170					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						CGGCACCTTTGCAGGCCACTG	0.552																																																0			17											107.0	104.0	105.0					17																	60821763		2203	4300	6503	58175495	SO:0001583	missense	162333			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.509C>A	17.37:g.60821763G>T	ENSP00000311496:p.Ala170Glu		58175495	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00744,HMMPfam_zf-C3HC4	p.A170E	ENST00000311269.5	37	c.509	CCDS11635.1	17	.	.	.	.	.	.	.	.	.	.	G	9.532	1.111145	0.20714	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.34472	1.36;1.36;1.36	5.11	-10.2	0.00374	.	3.899720	0.00575	N	0.000312	T	0.21962	0.0529	L	0.47716	1.5	0.09310	N	1	B;B;P	0.42827	0.0;0.0;0.791	B;B;B	0.35240	0.001;0.003;0.198	T	0.37526	-0.9702	10	0.37606	T	0.19	3.197	3.8266	0.08856	0.2873:0.3781:0.2506:0.084	.	169;169;170	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	E	170;170;169	ENSP00000416177:A170E;ENSP00000311496:A170E;ENSP00000443746:A169E	ENSP00000311496:A170E	A	-	2	0	MARCH10	58175495	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.900000	0.01599	-1.983000	0.00987	-1.082000	0.02213	GCA	-	NULL		0.552	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	protein_coding	OTTHUMT00000445252.1	G	NM_152598		58175495	-1	no_errors	NM_001100875	genbank	human	validated	54_36p	missense	SNP	0.000	T
ZNF665	79788	genome.wustl.edu	37	19	53668104	53668104	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:53668104A>G	ENST00000600412.1	-	2	1559	c.1444T>C	c.(1444-1446)Tgc>Cgc	p.C482R	ZNF665_ENST00000396424.3_Missense_Mutation_p.C547R|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	482					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		ACCTTGCCGCAATCATTACAT	0.383																																																0			19											147.0	157.0	154.0					19																	53668104		2201	4300	6501	58359916	SO:0001583	missense	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1444T>C	19.37:g.53668104A>G	ENSP00000469154:p.Cys482Arg		58359916	A8K5T8	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.C547R	ENST00000600412.1	37	c.1639		19	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125132	0.37533	.	.	ENSG00000197497	ENST00000396424	D	0.85955	-2.05	2.28	2.28	0.28536	.	.	.	.	.	D	0.93890	0.8045	H	0.96604	3.85	0.40266	D	0.978231	D	0.89917	1.0	D	0.97110	1.0	D	0.93743	0.7052	9	0.87932	D	0	.	9.2402	0.37491	1.0:0.0:0.0:0.0	.	547	Q9H7R5-2	.	R	547	ENSP00000379702:C547R	ENSP00000379702:C547R	C	-	1	0	ZNF665	58359916	0.961000	0.32948	0.002000	0.10522	0.009000	0.06853	5.741000	0.68638	1.042000	0.40150	0.338000	0.21704	TGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.383	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	protein_coding	OTTHUMT00000464179.1	A	NM_024733		58359916	-1	no_errors	NM_024733	genbank	human	provisional	54_36p	missense	SNP	0.926	G
NLRP7	199713	genome.wustl.edu	37	19	55435157	55435157	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr19:55435157C>G	ENST00000590030.1	-	9	2934	c.2894G>C	c.(2893-2895)tGc>tCc	p.C965S	NLRP7_ENST00000446217.1_Missense_Mutation_p.C1050S|NLRP7_ENST00000592784.1_Missense_Mutation_p.C1022S|NLRP7_ENST00000588756.1_Missense_Mutation_p.C1022S|NLRP7_ENST00000448121.2_Missense_Mutation_p.C994S|NLRP7_ENST00000340844.2_Missense_Mutation_p.C965S|NLRP7_ENST00000328092.5_Missense_Mutation_p.C994S			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	965							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGAAGCATTGCAATCAATAGT	0.478																																																0			19											136.0	133.0	134.0					19																	55435157		2203	4300	6503	60126969	SO:0001583	missense	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2894G>C	19.37:g.55435157C>G	ENSP00000465520:p.Cys965Ser		60126969	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,superfamily_SSF52540,HMMPfam_NACHT,superfamily_SSF52047	p.C994S	ENST00000590030.1	37	c.2981	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	C	2.315	-0.357061	0.05138	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217	T;T;T	0.72725	-0.59;-0.68;-0.64	2.11	-0.113	0.13568	.	.	.	.	.	T	0.41789	0.1174	N	0.11789	0.175	0.09310	N	1	D;B;P	0.53885	0.963;0.045;0.879	B;B;B	0.41036	0.346;0.007;0.306	T	0.41233	-0.9520	9	0.06625	T	0.88	.	4.5595	0.12152	0.0:0.661:0.0:0.339	.	1050;965;994	E7EPM2;Q8WX94;Q8WX94-2	.;NALP7_HUMAN;.	S	1022;994;965;1050	ENSP00000409137:C994S;ENSP00000339491:C965S;ENSP00000414273:C1050S	ENSP00000329568:C1022S	C	-	2	0	NLRP7	60126969	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.660000	0.25009	0.056000	0.16144	-0.156000	0.13503	TGC	-	NULL		0.478	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	protein_coding	OTTHUMT00000451396.1	C	NM_139176		60126969	-1	no_errors	NM_139176	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
ANK3	288	genome.wustl.edu	37	10	61932746	61932746	+	Missense_Mutation	SNP	G	G	A	rs201704543		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:61932746G>A	ENST00000280772.2	-	20	2485	c.2294C>T	c.(2293-2295)aCg>aTg	p.T765M	ANK3_ENST00000373827.2_Missense_Mutation_p.T759M|ANK3_ENST00000503366.1_Missense_Mutation_p.T748M	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	765					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATGTAATGGCGTATACCCATT	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		15865	0.001		0.0	False		,,,				2504	0.0															0			10											148.0	134.0	139.0					10																	61932746		2203	4300	6503	61602752	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2294C>T	10.37:g.61932746G>A	ENSP00000280772:p.Thr765Met		61602752	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK,HMMPfam_ZU5,HMMSmart_ZU5,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.T765M	ENST00000280772.2	37	c.2294	CCDS7258.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.86	3.712666	0.68730	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304;ENST00000536348	D;D;D	0.85556	-2.0;-2.0;-2.0	6.06	6.06	0.98353	Ankyrin repeat-containing domain (3);	0.000000	0.43416	D	0.000573	D	0.95462	0.8526	H	0.95850	3.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.989;0.997;1.0;0.996;0.999	D	0.95920	0.8930	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	748;426;309;759;765	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	M	765;759;748;727;426;421;309	ENSP00000280772:T765M;ENSP00000362933:T759M;ENSP00000425236:T748M	ENSP00000280772:T765M	T	-	2	0	ANK3	61602752	1.000000	0.71417	0.680000	0.29994	0.260000	0.26232	9.799000	0.99117	2.882000	0.98803	0.655000	0.94253	ACG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987		61602752	-1	no_errors	NM_020987	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
BPTF	2186	genome.wustl.edu	37	17	65942142	65942142	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr17:65942142C>A	ENST00000321892.4	+	23	7757	c.7696C>A	c.(7696-7698)Caa>Aaa	p.Q2566K	BPTF_ENST00000424123.3_Intron|BPTF_ENST00000306378.6_Missense_Mutation_p.Q2440K|BPTF_ENST00000335221.5_Intron			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2566					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCAGCTGCAACAACAAGTCCA	0.488																																																0			17											121.0	105.0	110.0					17																	65942142		2203	4300	6503	63372604	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.7696C>A	17.37:g.65942142C>A	ENSP00000315454:p.Gln2566Lys		63372604	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	HMMPfam_FYDLN_acid,HMMPfam_DDT,HMMSmart_DDT,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,PatternScan_EGF_2,HMMSmart_BROMO,superfamily_Bromodomain,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.Q2440K	ENST00000321892.4	37	c.7318		17	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763302	0.69763	.	.	ENSG00000171634	ENST00000306378;ENST00000321892	T;T	0.20881	2.04;2.04	6.1	6.1	0.99115	.	.	.	.	.	T	0.29355	0.0731	L	0.56769	1.78	0.80722	D	1	P	0.37370	0.592	B	0.40329	0.326	T	0.01056	-1.1466	9	0.22109	T	0.4	-0.2113	20.7146	0.99709	0.0:1.0:0.0:0.0	.	2440	Q12830-2	.	K	2440;2566	ENSP00000307208:Q2440K;ENSP00000315454:Q2566K	ENSP00000307208:Q2440K	Q	+	1	0	BPTF	63372604	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.408000	0.80041	2.902000	0.99343	0.650000	0.86243	CAA	-	NULL		0.488	BPTF-201	KNOWN	basic	protein_coding	BPTF	protein_coding		C	NM_182641, NM_004459		63372604	+1	no_errors	NM_182641	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CDH11	1009	genome.wustl.edu	37	16	65025697	65025697	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr16:65025697T>C	ENST00000268603.4	-	6	1400	c.785A>G	c.(784-786)aAt>aGt	p.N262S	CDH11_ENST00000394156.3_Missense_Mutation_p.N262S|CDH11_ENST00000566827.1_Missense_Mutation_p.N136S	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	262	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TGGGTTGTCATTGACATCGGT	0.522			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0			16											307.0	212.0	244.0					16																	65025697		2203	4300	6503	63583198	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.785A>G	16.37:g.65025697T>C	ENSP00000268603:p.Asn262Ser		63583198	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.N262S	ENST00000268603.4	37	c.785	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	T	29.8	5.039765	0.93630	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.70631	-0.5;-0.5	5.42	5.42	0.78866	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.044464	0.85682	D	0.000000	D	0.89315	0.6680	H	0.98256	4.185	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.66351	0.795;0.943	D	0.93126	0.6529	10	0.87932	D	0	.	14.6317	0.68660	0.0:0.0:0.0:1.0	.	262;262	P55287-2;P55287	.;CAD11_HUMAN	S	262;262;245	ENSP00000268603:N262S;ENSP00000377711:N262S	ENSP00000268603:N262S	N	-	2	0	CDH11	63583198	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.010000	0.88615	2.052000	0.61016	0.455000	0.32223	AAT	-	HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Cadherin-like		0.522	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	protein_coding	OTTHUMT00000268755.1	T	NM_033664		63583198	-1	no_errors	NM_001797	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MIR192	406967	genome.wustl.edu	37	11	64658615	64658615	+	lincRNA	SNP	A	A	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr11:64658615A>C	ENST00000601517.1	-	0	0				MIR194-2_ENST00000384864.1_lincRNA|MIR192_ENST00000384915.1_RNA																							GGTGGCTGGCATTGAGGCGAA	0.612																																																0			11											20.0	21.0	21.0					11																	64658615		1547	3545	5092	64415191			0																															11.37:g.64658615A>C			64415191		RNA	SNP	-	NULL	ENST00000601517.1	37	NULL		11																																																																																			-	-		0.612	RP11-665N17.4-001	KNOWN	basic	lincRNA	MIRN192	lincRNA	OTTHUMT00000464673.1	A			64415191	-1	no_errors	ENST00000384915	ensembl	human	known	54_36p	rna	SNP	1.000	C
ADAMTS9	56999	genome.wustl.edu	37	3	64601090	64601090	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:64601090C>T	ENST00000498707.1	-	21	3438	c.3096G>A	c.(3094-3096)ctG>ctA	p.L1032L	ADAMTS9_ENST00000295903.4_Silent_p.L1004L	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1032	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TGCTGTCATCCAGTACATCAT	0.433																																																0			3											174.0	145.0	155.0					3																	64601090		2203	4300	6503	64576130	SO:0001819	synonymous_variant	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3096G>A	3.37:g.64601090C>T			64576130	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_GON"	p.L1032	ENST00000498707.1	37	c.3096	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	C	2.156	-0.393262	0.04899	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.88	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2795	0.49186	0.1279:0.8066:0.0:0.0655	.	.	.	.	X	88	.	.	W	-	2	0	ADAMTS9	64576130	1.000000	0.71417	0.993000	0.49108	0.161000	0.22273	0.975000	0.29449	0.837000	0.34925	0.555000	0.69702	TGG	-	superfamily_TSP-1 type 1 repeat,HMMPfam_TSP_1,HMMSmart_SM00209		0.433	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	protein_coding	OTTHUMT00000351891.1	C			64576130	-1	no_errors	NM_182920	genbank	human	reviewed	54_36p	silent	SNP	0.995	T
Unknown	0	genome.wustl.edu	37	7	66038412	66038412	+	IGR	SNP	T	T	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr7:66038412T>A								GS1-124K5.11 (30876 upstream) : KCTD7 (55455 downstream)																							TGAAGATTTCTTCACTGTGGT	0.473																																																0			7																																								65675847	SO:0001628	intergenic_variant	493754																															7.37:g.66038412T>A			65675847		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.473					LOC493754			T			65675847	-1	pseudogene	NR_002933	genbank	human	provisional	54_36p	rna	SNP	1.000	A
MRGPRF	116535	genome.wustl.edu	37	11	68773231	68773231	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr11:68773231C>T	ENST00000309099.6	-	3	929	c.547G>A	c.(547-549)Gtg>Atg	p.V183M	RP11-554A11.5_ENST00000562506.1_RNA|MRGPRF_ENST00000441623.1_Missense_Mutation_p.V183M	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	183						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			cccAGGAACACGCAGAAGTAG	0.697																																																0			11											11.0	13.0	12.0					11																	68773231		2025	3999	6024	68529807	SO:0001583	missense	219928			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.547G>A	11.37:g.68773231C>T	ENSP00000309782:p.Val183Met		68529807	B3KV43|Q8NBK8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V183M	ENST00000309099.6	37	c.547	CCDS8188.1	11	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274721	0.23307	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.71817	-0.6;-0.6	5.14	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.171139	0.27881	N	0.017477	T	0.47801	0.1465	N	0.20685	0.6	0.21627	N	0.999617	P	0.38551	0.636	B	0.32149	0.141	T	0.30707	-0.9969	10	0.30078	T	0.28	-17.7922	7.452	0.27244	0.0:0.7957:0.0:0.2043	.	183	Q96AM1	MRGRF_HUMAN	M	183;183;155	ENSP00000403660:V183M;ENSP00000309782:V183M	ENSP00000309782:V183M	V	-	1	0	MRGPRF	68529807	0.000000	0.05858	0.986000	0.45419	0.548000	0.35241	-0.628000	0.05515	0.545000	0.28902	-0.254000	0.11334	GTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.697	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	protein_coding	OTTHUMT00000396875.1	C	NM_145015		68529807	-1	no_errors	NM_001098515	genbank	human	validated	54_36p	missense	SNP	0.033	T
Unknown	0	genome.wustl.edu	37	8	70042599	70042599	+	IGR	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:70042599G>T								RNU7-102P (19790 upstream) : RP11-21C17.1 (45214 downstream)																							GAAGAGTCTTGTTCCAACAGA	0.418																																																0			8																																								70205153	SO:0001628	intergenic_variant	0																															8.37:g.70042599G>T			70205153		RNA	SNP	-	NULL		37	NULL		8																																																																																			-	-	0	0.418					LOC100129096			G			70205153	+1	pseudogene	XR_037300	genbank	human	model	54_36p	rna	SNP	0.016	T
MAP1B	4131	genome.wustl.edu	37	5	71490934	71490934	+	Silent	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:71490934A>G	ENST00000296755.7	+	5	2050	c.1752A>G	c.(1750-1752)gaA>gaG	p.E584E		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	584					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAAGCAAAGAAAAGGTAATGG	0.438																																					Melanoma(17;367 822 11631 31730 47712)											0			5											47.0	49.0	48.0					5																	71490934		2203	4300	6503	71526690	SO:0001819	synonymous_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.1752A>G	5.37:g.71490934A>G			71526690	A2BDK5	Silent	SNP	HMMPfam_MAP1B_neuraxin,PatternScan_MAP1B_NEURAXIN	p.E584	ENST00000296755.7	37	c.1752	CCDS4012.1	5																																																																																			-	NULL		0.438	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	A	NM_005909		71526690	+1	no_errors	NM_005909	genbank	human	validated	54_36p	silent	SNP	0.997	G
DYSF	8291	genome.wustl.edu	37	2	71827973	71827973	+	Splice_Site	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:71827973G>T	ENST00000258104.3	+	34	4120		c.e34+1		DYSF_ENST00000409366.1_Splice_Site|DYSF_ENST00000394120.2_Splice_Site|DYSF_ENST00000410041.1_Splice_Site|DYSF_ENST00000409651.1_Splice_Site|DYSF_ENST00000413539.2_Splice_Site|DYSF_ENST00000409744.1_Splice_Site|DYSF_ENST00000409762.1_Splice_Site|DYSF_ENST00000429174.2_Splice_Site|DYSF_ENST00000410020.3_Splice_Site|DYSF_ENST00000479049.2_Splice_Site|DYSF_ENST00000409582.3_Splice_Site	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin						plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GAGAGAGAAGGTGAGGCTGGT	0.642																																																0			2	GRCh37	CS053456	DYSF	S							43.0	47.0	45.0					2																	71827973		2203	4299	6502	71681481	SO:0001630	splice_region_variant	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3843+1G>T	2.37:g.71827973G>T			71681481	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Splice_Site	SNP	-	e34+1	ENST00000258104.3	37	c.3843+1	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337193	0.81911	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0248	0.86442	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYSF	71681481	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.418000	0.97395	2.628000	0.89032	0.591000	0.81541	.	-	-		0.642	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	protein_coding	OTTHUMT00000251970.3	G	NM_003494	Intron	71681481	+1	no_errors	NM_003494	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
GC	2638	genome.wustl.edu	37	4	72622547	72622547	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:72622547T>A	ENST00000273951.8	-	8	1259	c.916A>T	c.(916-918)Atg>Ttg	p.M306L	GC_ENST00000504199.1_Missense_Mutation_p.M325L|GC_ENST00000513476.1_Missense_Mutation_p.M306L|RNA5SP163_ENST00000410304.1_RNA|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	306	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	AAAACGTCCATGGCTGTTTTT	0.428																																																0			4											85.0	84.0	85.0					4																	72622547		2203	4300	6503	72841411	SO:0001583	missense	2638			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.916A>T	4.37:g.72622547T>A	ENSP00000273951:p.Met306Leu		72841411	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	HMMSmart_SM00103,HMMPfam_Serum_albumin,superfamily_Serum albumin-like,PatternScan_ALBUMIN,HMMPfam_VitD-bind_III	p.M306L	ENST00000273951.8	37	c.916	CCDS3550.1	4	.	.	.	.	.	.	.	.	.	.	T	8.761	0.923640	0.18056	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.72394	-0.65;-0.65;-0.65	5.76	3.11	0.35812	.	0.252479	0.47093	N	0.000250	T	0.63212	0.2492	L	0.61036	1.89	0.35856	D	0.827133	B;B	0.09022	0.002;0.002	B;B	0.14023	0.01;0.01	T	0.61893	-0.6969	10	0.19147	T	0.46	.	10.031	0.42101	0.3544:0.0:0.0:0.6456	.	325;306	D6RAK8;D6RF35	.;.	L	306;325;306	ENSP00000273951:M306L;ENSP00000421725:M325L;ENSP00000426683:M306L	ENSP00000273951:M306L	M	-	1	0	GC	72841411	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	0.587000	0.23909	1.076000	0.40961	0.533000	0.62120	ATG	-	HMMSmart_SM00103,superfamily_Serum albumin-like,HMMPfam_Serum_albumin		0.428	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GC	protein_coding	OTTHUMT00000252167.2	T			72841411	-1	no_errors	NM_000583	genbank	human	reviewed	54_36p	missense	SNP	0.915	A
ELN	2006	genome.wustl.edu	37	7	73477987	73477987	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr7:73477987T>G	ENST00000252034.7	+	29	2354	c.1955T>G	c.(1954-1956)gTc>gGc	p.V652G	ELN_ENST00000414324.1_Missense_Mutation_p.V628G|ELN_ENST00000320492.7_Missense_Mutation_p.V571G|ELN_ENST00000458204.1_Missense_Mutation_p.V642G|ELN_ENST00000357036.5_Missense_Mutation_p.V657G|ELN_ENST00000445912.1_Missense_Mutation_p.V652G|ELN_ENST00000380584.4_Missense_Mutation_p.V604G|ELN_ENST00000429192.1_Missense_Mutation_p.V638G|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000358929.4_Missense_Mutation_p.V720G|ELN_ENST00000380553.4_Missense_Mutation_p.V516G|ELN_ENST00000380575.4_Missense_Mutation_p.V623G|ELN_ENST00000380562.4_Missense_Mutation_p.V658G|ELN_ENST00000380576.5_Missense_Mutation_p.V633G|ELN_ENST00000320399.6_Missense_Mutation_p.V685G	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGACTCGGAGTCGGAGGGCTT	0.582			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																Dom	yes		7	7q11.23	2006	elastin	yes	L	0			7											158.0	130.0	140.0					7																	73477987		2203	4300	6503	73115923	SO:0001583	missense	2006				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1955T>G	7.37:g.73477987T>G	ENSP00000252034:p.Val652Gly		73115923	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	PatternScan_ENDONUCLEASE_III_2,PatternScan_HEXAPEP_TRANSFERASES	p.V652G	ENST00000252034.7	37	c.1955	CCDS5562.2	7	.	.	.	.	.	.	.	.	.	.	T	3.223	-0.159023	0.06544	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.36520	1.29;1.26;1.38;1.28;1.26;1.27;1.29;1.25;1.26;1.27;1.28;1.28;1.27;1.31	3.04	-3.24	0.05094	.	.	.	.	.	T	0.19167	0.0460	.	.	.	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B;B	0.32829	0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386;0.386	B;B;B;B;B;B;B;B;B;B;B;B;B	0.25140	0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058;0.058	T	0.12811	-1.0533	8	0.24483	T	0.36	.	10.722	0.46046	0.0:0.7575:0.0:0.2425	.	652;571;628;642;658;623;638;657;633;516;563;604;652	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	G	652;652;720;571;628;658;623;604;642;657;638;591;516;633;685	ENSP00000389857:V652G;ENSP00000252034:V652G;ENSP00000351807:V720G;ENSP00000315607:V571G;ENSP00000392575:V628G;ENSP00000369936:V658G;ENSP00000369949:V623G;ENSP00000369958:V604G;ENSP00000403162:V642G;ENSP00000349540:V657G;ENSP00000391129:V638G;ENSP00000369926:V516G;ENSP00000369950:V633G;ENSP00000313565:V685G	ENSP00000252034:V652G	V	+	2	0	ELN	73115923	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	-0.836000	0.04382	-0.774000	0.04590	-0.466000	0.05196	GTC	-	NULL		0.582	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	protein_coding	OTTHUMT00000316913.1	T	NM_000501		73115923	+1	no_errors	NM_000501	genbank	human	reviewed	54_36p	missense	SNP	0.003	G
ZDHHC15	158866	genome.wustl.edu	37	X	74636973	74636973	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chrX:74636973G>C	ENST00000373367.3	-	10	1146	c.916C>G	c.(916-918)Cca>Gca	p.P306A	ZDHHC15_ENST00000541184.1_Missense_Mutation_p.P297A|ZDHHC15_ENST00000373361.3_3'UTR	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	306					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						GCTAGCAGTGGGTTCTGTGAC	0.448																																																0			X											258.0	209.0	225.0					X																	74636973		2203	4300	6503	74553698	SO:0001583	missense	158866			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.916C>G	X.37:g.74636973G>C	ENSP00000362465:p.Pro306Ala		74553698	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	HMMPfam_zf-DHHC	p.P306A	ENST00000373367.3	37	c.916	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	G	7.746	0.702364	0.15172	.	.	ENSG00000102383	ENST00000373367;ENST00000541184	T;T	0.40756	1.02;1.24	5.43	5.43	0.79202	.	0.154836	0.64402	D	0.000015	T	0.36303	0.0962	L	0.57536	1.79	0.80722	D	1	B;B	0.31837	0.342;0.057	B;B	0.25884	0.064;0.015	T	0.26087	-1.0113	10	0.07030	T	0.85	0.7684	16.7653	0.85522	0.0:0.0:1.0:0.0	.	297;306	B3KVG7;Q96MV8	.;ZDH15_HUMAN	A	306;297	ENSP00000362465:P306A;ENSP00000445420:P297A	ENSP00000362465:P306A	P	-	1	0	ZDHHC15	74553698	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.226000	0.89785	2.268000	0.75426	0.513000	0.50165	CCA	-	NULL		0.448	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	protein_coding	OTTHUMT00000057283.1	G	NM_144969		74553698	-1	no_errors	NM_144969	genbank	human	provisional	54_36p	missense	SNP	1.000	C
VCL	7414	genome.wustl.edu	37	10	75849851	75849851	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:75849851G>A	ENST00000211998.4	+	10	1341	c.1247G>A	c.(1246-1248)cGg>cAg	p.R416Q	VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.R416Q|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	416	3 X 112 AA tandem repeats.|N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GCTGAAGCTCGGAAAATAGCA	0.448																																																0			10											186.0	176.0	179.0					10																	75849851		2203	4300	6503	75519857	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1247G>A	10.37:g.75849851G>A	ENSP00000211998:p.Arg416Gln		75519857	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	superfamily_alpha-catenin/vinculin,HMMPfam_Vinculin,PatternScan_VINCULIN_1,PatternScan_VINCULIN_2	p.R416Q	ENST00000211998.4	37	c.1247	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239577	0.58995	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.76060	-0.99;-0.99;1.15	5.54	5.54	0.83059	.	0.068337	0.64402	D	0.000009	T	0.69342	0.3100	L	0.60845	1.875	0.80722	D	1	P;B;P	0.41159	0.618;0.198;0.74	B;B;B	0.37047	0.052;0.022;0.24	T	0.72316	-0.4330	10	0.49607	T	0.09	.	12.8268	0.57725	0.0743:0.0:0.9257:0.0	.	343;416;416	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	Q	416;416;323;343;88	ENSP00000361841:R416Q;ENSP00000211998:R416Q;ENSP00000415489:R88Q	ENSP00000211998:R416Q	R	+	2	0	VCL	75519857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.549000	0.53681	2.626000	0.88956	0.585000	0.79938	CGG	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.448	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	protein_coding		G	NM_003373, NM_014000		75519857	+1	no_errors	NM_014000	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
VASH1	22846	genome.wustl.edu	37	14	77237584	77237584	+	Silent	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr14:77237584G>C	ENST00000167106.4	+	3	1083	c.450G>C	c.(448-450)ctG>ctC	p.L150L	VASH1_ENST00000556038.1_3'UTR|VASH1_ENST00000554237.1_Silent_p.L150L	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	150					angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		GCAGACCTCTGACAGGGTAAG	0.532																																																0			14											98.0	88.0	91.0					14																	77237584		2203	4300	6503	76307337	SO:0001819	synonymous_variant	22846			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.450G>C	14.37:g.77237584G>C			76307337	Q96H02|Q9UBF4|Q9Y629	Silent	SNP	NULL	p.L150	ENST00000167106.4	37	c.450	CCDS9851.1	14																																																																																			-	NULL		0.532	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	protein_coding	OTTHUMT00000413706.1	G	NM_014909		76307337	+1	no_errors	NM_014909	genbank	human	validated	54_36p	silent	SNP	1.000	C
TBX22	50945	genome.wustl.edu	37	X	79286132	79286132	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chrX:79286132C>A	ENST00000373294.5	+	8	1113	c.1085C>A	c.(1084-1086)gCa>gAa	p.A362E	TBX22_ENST00000373296.3_Missense_Mutation_p.A362E|TBX22_ENST00000373291.1_Missense_Mutation_p.A242E|TBX22_ENST00000442340.1_Missense_Mutation_p.A242E	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	362					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGTCCAGAGGCATACCTGCCC	0.473																																																0			X											162.0	143.0	150.0					X																	79286132		2203	4300	6503	79172788	SO:0001583	missense	50945			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.1085C>A	X.37:g.79286132C>A	ENSP00000362390:p.Ala362Glu		79172788	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	superfamily_P53_like_DNA_bnd,HMMSmart_TBOX,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.A362E	ENST00000373294.5	37	c.1085	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	c	9.465	1.094146	0.20471	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	4.57	2.55	0.30701	.	.	.	.	.	T	0.56321	0.1977	N	0.22421	0.69	0.09310	N	1	B	0.28128	0.201	B	0.21917	0.037	T	0.38001	-0.9681	9	0.20519	T	0.43	.	1.5241	0.02522	0.1878:0.352:0.3201:0.1401	.	362	Q9Y458	TBX22_HUMAN	E	362;242;362;242	ENSP00000362393:A362E;ENSP00000396394:A242E;ENSP00000362390:A362E;ENSP00000362388:A242E	ENSP00000362388:A242E	A	+	2	0	TBX22	79172788	0.000000	0.05858	0.023000	0.16930	0.689000	0.40095	0.620000	0.24403	0.654000	0.30846	0.462000	0.41574	GCA	-	NULL		0.473	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	protein_coding	OTTHUMT00000057334.1	C	NM_016954		79172788	+1	no_errors	NM_001109878	genbank	human	reviewed	54_36p	missense	SNP	0.109	A
TPBG	7162	genome.wustl.edu	37	6	83075928	83075928	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:83075928A>C	ENST00000369750.3	+	2	1867	c.1250A>C	c.(1249-1251)aAc>aCc	p.N417T	TPBG_ENST00000535040.1_Missense_Mutation_p.N417T|TPBG_ENST00000543496.1_Missense_Mutation_p.N417T			Q13641	TPBG_HUMAN	trophoblast glycoprotein	417					cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CTCAGTTCTAACTCGGATGTC	0.438																																																0			6											51.0	53.0	52.0					6																	83075928		2203	4300	6503	83132647	SO:0001583	missense	7162			AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.1250A>C	6.37:g.83075928A>C	ENSP00000358765:p.Asn417Thr		83132647	A8K555	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMSmart_SM00013,superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT	p.N417T	ENST00000369750.3	37	c.1250	CCDS4995.1	6	.	.	.	.	.	.	.	.	.	.	A	13.05	2.119946	0.37436	.	.	ENSG00000146242	ENST00000535040;ENST00000369750;ENST00000543496	T;T;T	0.60171	0.21;0.21;0.21	5.39	4.23	0.50019	.	0.315170	0.37095	N	0.002259	T	0.47248	0.1435	L	0.28274	0.84	0.51233	D	0.999918	D	0.69078	0.997	P	0.61874	0.895	T	0.51293	-0.8724	10	0.45353	T	0.12	-11.6818	11.1246	0.48310	0.9276:0.0:0.0724:0.0	.	417	Q13641	TPBG_HUMAN	T	417	ENSP00000441219:N417T;ENSP00000358765:N417T;ENSP00000440049:N417T	ENSP00000358765:N417T	N	+	2	0	TPBG	83132647	1.000000	0.71417	0.848000	0.33437	0.565000	0.35776	5.807000	0.69157	0.894000	0.36317	0.528000	0.53228	AAC	-	NULL		0.438	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPBG	protein_coding	OTTHUMT00000041340.1	A			83132647	+1	no_errors	NM_006670	genbank	human	provisional	54_36p	missense	SNP	1.000	C
SLITRK1	114798	genome.wustl.edu	37	13	84455225	84455225	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr13:84455225T>C	ENST00000377084.2	-	1	1303	c.418A>G	c.(418-420)Aat>Gat	p.N140D		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	140					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CGTAATAAATTAAAATCAGCC	0.458																																																0			13											59.0	64.0	62.0					13																	84455225		2203	4300	6503	83353226	SO:0001583	missense	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.418A>G	13.37:g.84455225T>C	ENSP00000366288:p.Asn140Asp		83353226	Q5U5I6|Q96SF9	Missense_Mutation	SNP	superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMSmart_LRRNT	p.N140D	ENST00000377084.2	37	c.418	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	T	16.90	3.250144	0.59212	.	.	ENSG00000178235	ENST00000377084	T	0.74526	-0.85	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.89767	0.6810	H	0.96430	3.82	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	D	0.92466	0.5981	10	0.87932	D	0	-8.8436	12.6952	0.56999	0.0:0.0:0.0:1.0	.	140	Q96PX8	SLIK1_HUMAN	D	140	ENSP00000366288:N140D	ENSP00000366288:N140D	N	-	1	0	SLITRK1	83353226	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	1.874000	0.54306	0.459000	0.35465	AAT	-	superfamily_SSF52058		0.458	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	protein_coding	OTTHUMT00000045396.1	T	NM_052910		83353226	-1	no_errors	NM_052910	genbank	human	validated	54_36p	missense	SNP	1.000	C
NRG3	10718	genome.wustl.edu	37	10	84738869	84738869	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:84738869T>G	ENST00000404547.1	+	8	1576	c.1576T>G	c.(1576-1578)Tgc>Ggc	p.C526G	NRG3_ENST00000372142.2_Missense_Mutation_p.C305G|NRG3_ENST00000556918.1_Missense_Mutation_p.C356G|NRG3_ENST00000537893.1_Missense_Mutation_p.C176G|NRG3_ENST00000372141.2_Missense_Mutation_p.C526G|NRG3_ENST00000545131.1_Missense_Mutation_p.C176G|NRG3_ENST00000404576.2_Missense_Mutation_p.C330G			P56975	NRG3_HUMAN	neuregulin 3	526					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TACGATACCTTGCCAAGGGTA	0.458																																																0			10											86.0	72.0	77.0					10																	84738869		2203	4300	6503	84728849	SO:0001583	missense	10718			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1576T>G	10.37:g.84738869T>G	ENSP00000384796:p.Cys526Gly		84728849	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_Neuregulin	p.C526G	ENST00000404547.1	37	c.1576	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	T	16.54	3.153032	0.57259	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.53640	1.13;0.61;0.65;0.64;0.64;0.64;0.64	5.83	3.47	0.39725	.	0.167671	0.52532	D	0.000075	T	0.57242	0.2040	L	0.50333	1.59	0.44762	D	0.997762	B;D;B;D	0.76494	0.095;0.991;0.004;0.999	B;P;B;D	0.72338	0.034;0.86;0.004;0.977	T	0.55302	-0.8162	10	0.66056	D	0.02	-58.3163	6.9968	0.24786	0.0:0.0782:0.1504:0.7714	.	525;526;305;526	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	G	526;526;525;305;330;356;176;176	ENSP00000361214:C526G;ENSP00000384796:C526G;ENSP00000361215:C305G;ENSP00000385804:C330G;ENSP00000451376:C356G;ENSP00000441201:C176G;ENSP00000440377:C176G	ENSP00000361214:C526G	C	+	1	0	NRG3	84728849	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.148000	0.31614	0.458000	0.26988	0.460000	0.39030	TGC	-	NULL		0.458	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	protein_coding	OTTHUMT00000412262.1	T	XM_166086		84728849	+1	no_errors	NM_001010848	genbank	human	validated	54_36p	missense	SNP	1.000	G
KCNK10	54207	genome.wustl.edu	37	14	88654418	88654418	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr14:88654418T>G	ENST00000340700.5	-	6	1340	c.889A>C	c.(889-891)Aag>Cag	p.K297Q	KCNK10_ENST00000319231.5_Missense_Mutation_p.K302Q|KCNK10_ENST00000312350.5_Missense_Mutation_p.K302Q	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	297					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						ACTAGGGGCTTATACCACTCC	0.443																																																0			14											159.0	154.0	156.0					14																	88654418		2203	4300	6503	87724171	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.889A>C	14.37:g.88654418T>G	ENSP00000343104:p.Lys297Gln		87724171	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2	p.K302Q	ENST00000340700.5	37	c.904	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263719	0.80358	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.36699	1.24;1.24;1.24	5.52	5.52	0.82312	Ion transport 2 (1);	0.043589	0.85682	D	0.000000	T	0.50718	0.1632	L	0.42686	1.345	0.80722	D	1	D;D;B	0.76494	0.996;0.999;0.232	D;D;B	0.70487	0.969;0.969;0.224	T	0.41680	-0.9495	10	0.34782	T	0.22	.	15.1125	0.72368	0.0:0.0:0.0:1.0	.	297;302;302	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	Q	297;302;302	ENSP00000343104:K297Q;ENSP00000310568:K302Q;ENSP00000312811:K302Q	ENSP00000310568:K302Q	K	-	1	0	KCNK10	87724171	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.972000	0.88022	2.225000	0.72522	0.459000	0.35465	AAG	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2		0.443	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	T	NM_021161		87724171	-1	no_errors	NM_138317	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MCTP2	55784	genome.wustl.edu	37	15	94899394	94899394	+	Missense_Mutation	SNP	C	C	T	rs564883944		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr15:94899394C>T	ENST00000357742.4	+	8	1034	c.1034C>T	c.(1033-1035)tCt>tTt	p.S345F	MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000451018.3_Missense_Mutation_p.S345F|MCTP2_ENST00000557742.1_5'UTR|MCTP2_ENST00000543482.1_Missense_Mutation_p.S345F	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	345	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CTACGGCTCTCTGAGTCCTTG	0.393																																																0			15											135.0	138.0	137.0					15																	94899394		2197	4298	6495	92700398	SO:0001583	missense	55784			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1034C>T	15.37:g.94899394C>T	ENSP00000350377:p.Ser345Phe		92700398	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.S345F	ENST00000357742.4	37	c.1034	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754464	0.69648	.	.	ENSG00000140563	ENST00000543482;ENST00000451018;ENST00000357742	T;T;T	0.72282	-0.64;-0.37;-0.21	5.77	5.77	0.91146	.	0.269820	0.33834	N	0.004516	T	0.77471	0.4135	L	0.43923	1.385	0.80722	D	1	D;B;B;D	0.71674	0.998;0.137;0.039;0.997	D;B;B;P	0.63597	0.916;0.059;0.025;0.825	T	0.76637	-0.2886	10	0.46703	T	0.11	.	15.2516	0.73552	0.141:0.859:0.0:0.0	.	345;345;345;345	F5H415;Q6DN12-2;Q6DN12;B7Z6H2	.;.;MCTP2_HUMAN;.	F	345	ENSP00000438521:S345F;ENSP00000395109:S345F;ENSP00000350377:S345F	ENSP00000350377:S345F	S	+	2	0	MCTP2	92700398	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.813000	0.55636	2.720000	0.93068	0.557000	0.71058	TCT	-	NULL		0.393	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	protein_coding	OTTHUMT00000415060.3	C	NM_018349		92700398	+1	no_errors	NM_018349	genbank	human	provisional	54_36p	missense	SNP	0.974	T
PNISR	25957	genome.wustl.edu	37	6	99857051	99857051	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:99857051A>T	ENST00000369239.5	-	6	875	c.671T>A	c.(670-672)aTt>aAt	p.I224N	PNISR_ENST00000466057.1_5'Flank|PNISR_ENST00000438806.1_Missense_Mutation_p.I224N	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	224						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						ATAGCTACCAATTTGTGGAGG	0.413																																																0			6											73.0	69.0	70.0					6																	99857051		2203	4300	6503	99963772	SO:0001583	missense	25957			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.671T>A	6.37:g.99857051A>T	ENSP00000358242:p.Ile224Asn		99963772	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	NULL	p.I224N	ENST00000369239.5	37	c.671	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509141	0.64410	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.42900	0.96;0.96	5.83	5.83	0.93111	.	0.099118	0.64402	D	0.000001	T	0.55369	0.1916	M	0.74467	2.265	0.80722	D	1	D	0.69078	0.997	P	0.62184	0.899	T	0.62163	-0.6912	10	0.87932	D	0	.	16.1999	0.82063	1.0:0.0:0.0:0.0	.	224	Q8TF01	PNISR_HUMAN	N	224	ENSP00000358242:I224N;ENSP00000387997:I224N	ENSP00000358242:I224N	I	-	2	0	PNISR	99963772	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.141000	0.77330	2.224000	0.72417	0.477000	0.44152	ATT	-	NULL		0.413	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRS18	protein_coding	OTTHUMT00000041598.1	A	NM_032870		99963772	-1	no_errors	NM_015491	genbank	human	validated	54_36p	missense	SNP	1.000	T
HPSE2	60495	genome.wustl.edu	37	10	100374701	100374701	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:100374701C>A	ENST00000370552.3	-	9	1339	c.1280G>T	c.(1279-1281)gGa>gTa	p.G427V	HPSE2_ENST00000404542.1_Missense_Mutation_p.G315V|HPSE2_ENST00000370549.1_Missense_Mutation_p.G369V|HPSE2_ENST00000370546.1_Missense_Mutation_p.G427V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	427					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GTGATTGTATCCATGGTCAAA	0.413																																																0			10											199.0	170.0	180.0					10																	100374701		2203	4300	6503	100364691	SO:0001583	missense	60495			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1280G>T	10.37:g.100374701C>A	ENSP00000359583:p.Gly427Val		100364691	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_79n	p.G427V	ENST00000370552.3	37	c.1280	CCDS7477.1	10	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747476	0.89663	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.87	5.87	0.94306	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.115026	0.64402	D	0.000018	T	0.60932	0.2307	M	0.83223	2.63	0.80722	D	1	D;D;D;P	0.89917	1.0;0.96;0.992;0.926	D;P;P;P	0.91635	0.999;0.56;0.77;0.454	T	0.56805	-0.7918	10	0.36615	T	0.2	-4.8014	19.3531	0.94398	0.0:1.0:0.0:0.0	.	315;427;369;427	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	V	427;369;427;315	ENSP00000359583:G427V;ENSP00000359580:G369V;ENSP00000359577:G427V;ENSP00000384384:G315V	ENSP00000359577:G427V	G	-	2	0	HPSE2	100364691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.883000	0.75595	2.941000	0.99782	0.655000	0.94253	GGA	-	NULL		0.413	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	protein_coding	OTTHUMT00000049789.1	C	NM_021828		100364691	-1	no_errors	NM_021828	genbank	human	validated	54_36p	missense	SNP	1.000	A
DYNC1H1	1778	genome.wustl.edu	37	14	102449375	102449375	+	Silent	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr14:102449375A>G	ENST00000360184.4	+	6	1145	c.981A>G	c.(979-981)gaA>gaG	p.E327E		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	327	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGGCTTTGGAAACTGTGAATG	0.363																																																0			14											64.0	73.0	70.0					14																	102449375		2200	4297	6497	101519128	SO:0001819	synonymous_variant	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.981A>G	14.37:g.102449375A>G			101519128	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.E327	ENST00000360184.4	37	c.981	CCDS9966.1	14																																																																																			-	HMMPfam_DHC_N1		0.363	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	A	NM_001376		101519128	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
STAB2	55576	genome.wustl.edu	37	12	104056740	104056740	+	Silent	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:104056740C>G	ENST00000388887.2	+	18	2190	c.1986C>G	c.(1984-1986)ccC>ccG	p.P662P		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CGATTCTGCCCCATCGATGTG	0.458																																																0			12											135.0	131.0	133.0					12																	104056740		2203	4300	6503	102580870	SO:0001819	synonymous_variant	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1986C>G	12.37:g.104056740C>G			102580870		Silent	SNP	HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_alliinase,superfamily_SSF57196,HMMPfam_EGF,superfamily_BIgH3_FAS1,HMMPfam_Fasciclin,HMMSmart_FAS1,HMMPfam_Laminin_EGF,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMPfam_EGF_2,HMMSmart_LINK,HMMPfam_Xlink,superfamily_C-type_lectin_fold,PatternScan_LINK_1	p.P662	ENST00000388887.2	37	c.1986	CCDS31888.1	12																																																																																			-	NULL		0.458	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	C			102580870	+1	no_errors	NM_017564	genbank	human	reviewed	54_36p	silent	SNP	0.991	G
ZCCHC18	644353	genome.wustl.edu	37	X	103359504	103359504	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chrX:103359504G>T	ENST00000537356.3	+	2	2116	c.702G>T	c.(700-702)agG>agT	p.R234S	SLC25A53_ENST00000357421.4_Intron|ZCCHC18_ENST00000422784.1_Intron			P0CG32	ZCC18_HUMAN	zinc finger, CCHC domain containing 18	234							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										GGCCGAAAAGGTCTGAGCCAA	0.493																																																0			X											32.0	25.0	27.0					X																	103359504		692	1591	2283	103246160	SO:0001583	missense	644353			AF086548	CCDS65304.1	Xq22.2	2013-01-31	2009-02-03		ENSG00000166707	ENSG00000166707		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	32459	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7B"""		"""zinc finger, CCHC domain containing 12 pseudogene 1"""				Standard	NM_001143978		Approved	SIZN2, PNMA7B	uc011msh.2	P0CG32	OTTHUMG00000022123	ENST00000537356.3:c.702G>T	X.37:g.103359504G>T	ENSP00000473824:p.Arg234Ser		103246160		Missense_Mutation	SNP	NULL	p.R234S	ENST00000537356.3	37	c.702		X																																																																																			-	NULL		0.493	ZCCHC18-006	PUTATIVE	basic|appris_principal	protein_coding	ZCCHC18	protein_coding	OTTHUMT00000471686.1	G	NM_001143978		103246160	+1	no_errors	ENST00000299903	ensembl	human	known	54_36p	missense	SNP	0.852	T
WBP1L	54838	genome.wustl.edu	37	10	104572399	104572399	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:104572399C>G	ENST00000369889.4	+	4	482	c.340C>G	c.(340-342)Cga>Gga	p.R114G	WBP1L_ENST00000448841.1_Missense_Mutation_p.R135G	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	114	Pro-rich.					integral component of membrane (GO:0016021)											AGTGGTGAACCGACCTCCAAC	0.542																																																0			10											131.0	131.0	131.0					10																	104572399		2203	4300	6503	104562389	SO:0001583	missense	54838			AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.340C>G	10.37:g.104572399C>G	ENSP00000358905:p.Arg114Gly		104562389	B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Missense_Mutation	SNP	NULL	p.R135G	ENST00000369889.4	37	c.403	CCDS7540.1	10	.	.	.	.	.	.	.	.	.	.	c	18.00	3.524481	0.64747	.	.	ENSG00000166272	ENST00000448841;ENST00000369889	T;T	0.20738	2.05;2.05	6.05	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	L	0.42245	1.32	0.58432	D	0.999992	D;D	0.63046	0.992;0.965	P;P	0.60236	0.871;0.87	T	0.12528	-1.0544	10	0.87932	D	0	-7.2858	15.6545	0.77124	0.2494:0.7506:0.0:0.0	.	135;114	Q9NX94-2;Q9NX94	.;OPA1L_HUMAN	G	135;114	ENSP00000414721:R135G;ENSP00000358905:R114G	ENSP00000358905:R114G	R	+	1	2	C10orf26	104562389	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.419000	0.52728	1.548000	0.49413	0.651000	0.88453	CGA	-	NULL		0.542	WBP1L-001	KNOWN	basic|CCDS	protein_coding	C10orf26	protein_coding	OTTHUMT00000050100.1	C	NM_017787		104562389	+1	no_errors	NM_001083913	genbank	human	validated	54_36p	missense	SNP	1.000	G
SLK	9748	genome.wustl.edu	37	10	105759043	105759043	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:105759043C>T	ENST00000369755.3	+	6	1299	c.754C>T	c.(754-756)Cca>Tca	p.P252S	SLK_ENST00000335753.4_Missense_Mutation_p.P252S	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	252	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AAAATCTGAGCCACCTACATT	0.358																																					NSCLC(111;540 1651 1927 4474 17706)											0			10											61.0	61.0	61.0					10																	105759043		2203	4299	6502	105749033	SO:0001583	missense	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.754C>T	10.37:g.105759043C>T	ENSP00000358770:p.Pro252Ser		105749033	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.P252S	ENST00000369755.3	37	c.754	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029194	0.93518	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.25085	1.82;1.82	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	L	0.43598	1.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.31752	-0.9932	10	0.66056	D	0.02	.	20.1935	0.98237	0.0:1.0:0.0:0.0	.	252;252	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	S	252	ENSP00000336824:P252S;ENSP00000358770:P252S	ENSP00000336824:P252S	P	+	1	0	SLK	105749033	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	7.776000	0.85560	2.779000	0.95612	0.591000	0.81541	CCA	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.358	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	protein_coding	OTTHUMT00000050188.1	C	NM_014720		105749033	+1	no_errors	NM_014720	genbank	human	provisional	54_36p	missense	SNP	1.000	T
SORCS1	114815	genome.wustl.edu	37	10	108427489	108427489	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:108427489G>C	ENST00000263054.6	-	17	2268	c.2261C>G	c.(2260-2262)tCa>tGa	p.S754*	SORCS1_ENST00000369698.1_Nonsense_Mutation_p.S289*|SORCS1_ENST00000344440.6_Nonsense_Mutation_p.S754*	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	754					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCAATCCTTTGACAGAGAGGA	0.493																																																0			10											78.0	69.0	72.0					10																	108427489		2203	4300	6503	108417479	SO:0001587	stop_gained	114815			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2261C>G	10.37:g.108427489G>C	ENSP00000263054:p.Ser754*		108417479	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Nonsense_Mutation	SNP	superfamily_SSF110296,HMMSmart_VPS10,HMMSmart_PKD,superfamily_PKD,HMMPfam_PKD	p.S754*	ENST00000263054.6	37	c.2261	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	G	40	7.922743	0.98563	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	.	.	.	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.2753	19.7394	0.96219	0.0:0.0:1.0:0.0	.	.	.	.	X	289;754;754	.	.	S	-	2	0	SORCS1	108417479	1.000000	0.71417	0.972000	0.41901	0.986000	0.74619	7.543000	0.82106	2.745000	0.94114	0.462000	0.41574	TCA	-	HMMSmart_VPS10		0.493	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	protein_coding	OTTHUMT00000050232.4	G	NM_052918		108417479	-1	no_errors	NM_001013031	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	C
ARPC3	10094	genome.wustl.edu	37	12	110878184	110878184	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:110878184G>C	ENST00000228825.7	-	3	262	c.116C>G	c.(115-117)aCa>aGa	p.T39R	RP11-478C19.2_ENST00000550231.1_RNA|ARPC3_ENST00000471641.1_5'Flank	NM_001278556.1|NM_005719.2	NP_001265485.1|NP_005710.1	O15145	ARPC3_HUMAN	actin related protein 2/3 complex, subunit 3, 21kDa	39					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			lung(1)|ovary(1)	2						CACAATATCTGTATCTTTTGC	0.338																																																0			12											70.0	67.0	68.0					12																	110878184		2203	4300	6503	109362567	SO:0001583	missense	10094			AF006086	CCDS9146.1	12q24	2011-07-06	2002-08-29		ENSG00000111229	ENSG00000111229		"""Actin related protein 2/3 complex subunits"""	706	protein-coding gene	gene with protein product		604225	"""actin related protein 2/3 complex, subunit 3 (21 kD)"""			9230079, 9359840	Standard	NM_001278556		Approved	p21-Arc, ARC21	uc001tqq.3	O15145	OTTHUMG00000134333	ENST00000228825.7:c.116C>G	12.37:g.110878184G>C	ENSP00000228825:p.Thr39Arg		109362567	O00554	Missense_Mutation	SNP	HMMPfam_P21-Arc,superfamily_Arp2/3 complex 21 kDa subunit ARPC3	p.T39R	ENST00000228825.7	37	c.116	CCDS9146.1	12	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802591	0.31869	.	.	ENSG00000111229	ENST00000228825;ENST00000392683;ENST00000426440;ENST00000547365	.	.	.	5.99	5.99	0.97316	.	0.044643	0.85682	D	0.000000	T	0.60064	0.2240	L	0.57536	1.79	0.80722	D	1	B	0.27559	0.181	B	0.25614	0.062	T	0.60352	-0.7280	9	0.87932	D	0	.	14.6024	0.68450	0.069:0.0:0.931:0.0	.	39	O15145	ARPC3_HUMAN	R	39;39;39;31	.	ENSP00000228825:T39R	T	-	2	0	ARPC3	109362567	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.175000	0.71949	2.840000	0.97914	0.655000	0.94253	ACA	-	HMMPfam_P21-Arc,superfamily_Arp2/3 complex 21 kDa subunit ARPC3		0.338	ARPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC3	protein_coding	OTTHUMT00000259487.2	G			109362567	-1	no_errors	NM_005719	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GSTM4	2948	genome.wustl.edu	37	1	110201708	110201708	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:110201708G>A	ENST00000369836.4	+	7	852	c.543G>A	c.(541-543)ctG>ctA	p.L181L	GSTM4_ENST00000326729.5_Silent_p.L181L|GSTM4_ENST00000495742.1_3'UTR|GSTM4_ENST00000336075.5_Silent_p.L120L|GSTM4_ENST00000369833.1_Silent_p.L140L	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4	181	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	TTCCAAATCTGAAGGACTTCA	0.502																																																0			1											362.0	338.0	346.0					1																	110201708		2203	4297	6500	110003231	SO:0001819	synonymous_variant	2948			M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	ENST00000369836.4:c.543G>A	1.37:g.110201708G>A			110003231	A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	Silent	SNP	superfamily_Thioredoxin-like,HMMPfam_GST_N,superfamily_Glutathione S-transferase (GST) C-terminal domain,HMMPfam_GST_C	p.L181	ENST00000369836.4	37	c.543	CCDS807.1	1																																																																																			-	superfamily_Glutathione S-transferase (GST) C-terminal domain,HMMPfam_GST_C		0.502	GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM4	protein_coding	OTTHUMT00000032187.1	G	NM_000850		110003231	+1	no_errors	NM_000850	genbank	human	reviewed	54_36p	silent	SNP	0.998	A
BCO2	83875	genome.wustl.edu	37	11	112087005	112087005	+	Silent	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr11:112087005T>C	ENST00000357685.5	+	11	1713	c.1578T>C	c.(1576-1578)aaT>aaC	p.N526N	BCO2_ENST00000393032.2_Silent_p.N492N|BCO2_ENST00000526088.1_Silent_p.N486N|BCO2_ENST00000531169.1_Silent_p.N492N|BCO2_ENST00000438022.1_Silent_p.N492N|BCO2_ENST00000532593.1_Silent_p.N421N|BCO2_ENST00000361053.4_Silent_p.N453N			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	526					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						CAGGAACCAATGAAGAAGATG	0.418																																					GBM(177;1916 2099 21049 29541 39946)											0			11											167.0	161.0	163.0					11																	112087005		2201	4297	6498	111592215	SO:0001819	synonymous_variant	83875			AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.1578T>C	11.37:g.112087005T>C			111592215	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Silent	SNP	HMMPfam_RPE65	p.N526	ENST00000357685.5	37	c.1578	CCDS8358.2	11	.	.	.	.	.	.	.	.	.	.	T	6.387	0.439425	0.12104	.	.	ENSG00000197580	ENST00000525175	.	.	.	5.58	0.508	0.16972	.	.	.	.	.	.	.	.	.	.	.	0.44685	D	0.997677	.	.	.	.	.	.	.	.	.	.	.	.	.	0.024	2.6906	0.05120	0.5036:0.0743:0.13:0.2921	.	.	.	.	R	61	.	.	X	+	1	0	BCO2	111592215	0.001000	0.12720	0.035000	0.18076	0.929000	0.56500	-0.213000	0.09305	0.047000	0.15862	-0.341000	0.08007	TGA	-	HMMPfam_RPE65		0.418	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCO2	protein_coding	OTTHUMT00000256570.3	T	NM_001037290		111592215	+1	no_errors	NM_031938	genbank	human	validated	54_36p	silent	SNP	0.099	C
MED13L	23389	genome.wustl.edu	37	12	116420941	116420941	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:116420941A>G	ENST00000281928.3	-	21	5142	c.4936T>C	c.(4936-4938)Tca>Cca	p.S1646P		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1646						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CCATCCTGTGAGGGCTGAGAA	0.522																																																0			12											90.0	86.0	87.0					12																	116420941		2203	4300	6503	114905324	SO:0001583	missense	23389			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4936T>C	12.37:g.116420941A>G	ENSP00000281928:p.Ser1646Pro		114905324	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	HMMPfam_TRAP_240kDa	p.S1646P	ENST00000281928.3	37	c.4936	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	A	9.680	1.149112	0.21288	.	.	ENSG00000123066	ENST00000281928	T	0.74002	-0.8	5.93	2.01	0.26516	.	1.436790	0.03877	N	0.276593	T	0.48077	0.1480	N	0.03608	-0.345	0.19300	N	0.999975	B	0.02656	0.0	B	0.01281	0.0	T	0.43327	-0.9398	10	0.24483	T	0.36	.	0.6241	0.00783	0.3645:0.2607:0.1298:0.245	.	1646	Q71F56	MD13L_HUMAN	P	1646	ENSP00000281928:S1646P	ENSP00000281928:S1646P	S	-	1	0	MED13L	114905324	0.925000	0.31364	0.782000	0.31804	0.996000	0.88848	0.909000	0.28558	1.056000	0.40484	0.533000	0.62120	TCA	-	HMMPfam_TRAP_240kDa		0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	protein_coding	OTTHUMT00000403879.3	A			114905324	-1	no_errors	NM_015335	genbank	human	validated	54_36p	missense	SNP	0.075	G
NRAS	4893	genome.wustl.edu	37	1	115256451	115256451	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:115256451C>T	ENST00000369535.4	-	3	513	c.260G>A	c.(259-261)aGc>aAc	p.S87N		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	87					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAATGACTTGCTATTATTGAT	0.413		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																													Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	0			1											161.0	142.0	148.0					1																	115256451		2203	4300	6503	115057974	SO:0001583	missense	4893	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.260G>A	1.37:g.115256451C>T	ENSP00000358548:p.Ser87Asn		115057974	Q14971|Q15104|Q15282	Missense_Mutation	SNP	HMMSmart_SM00173,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174	p.S87N	ENST00000369535.4	37	c.260	CCDS877.1	1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502184	0.44455	.	.	ENSG00000213281	ENST00000369535	T	0.76839	-1.05	5.08	4.17	0.49024	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000002	T	0.61476	0.2350	L	0.48218	1.51	0.52099	D	0.999945	B	0.20550	0.046	B	0.29440	0.102	T	0.62774	-0.6783	10	0.40728	T	0.16	.	13.3861	0.60797	0.0:0.9246:0.0:0.0754	.	87	P01111	RASN_HUMAN	N	87	ENSP00000358548:S87N	ENSP00000358548:S87N	S	-	2	0	NRAS	115057974	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.247000	0.51422	1.359000	0.45940	0.655000	0.94253	AGC	-	HMMSmart_SM00173,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174		0.413	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAS	protein_coding	OTTHUMT00000033395.2	C	NM_002524		115057974	-1	no_errors	NM_002524	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
VWA2	340706	genome.wustl.edu	37	10	116042300	116042300	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:116042300C>A	ENST00000392982.3	+	9	1109	c.859C>A	c.(859-861)Cct>Act	p.P287T	VWA2_ENST00000603594.1_Missense_Mutation_p.P287T			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	287					calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CCTAACCCACCCTGCCACCTG	0.498																																																0			10											124.0	119.0	121.0					10																	116042300		2203	4300	6503	116032290	SO:0001583	missense	340706			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.859C>A	10.37:g.116042300C>A	ENSP00000376708:p.Pro287Thr		116032290	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF	p.P287T	ENST00000392982.3	37	c.859		10	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350510	0.41599	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	T	0.66815	-0.23	5.66	4.74	0.60224	.	0.130474	0.53938	D	0.000049	T	0.78175	0.4242	M	0.74881	2.28	0.32018	N	0.601161	D;D	0.76494	0.999;0.999	D;D	0.69479	0.922;0.964	T	0.78853	-0.2040	10	0.16896	T	0.51	.	13.6688	0.62412	0.0:0.8448:0.1552:0.0	.	287;287	Q5GFL6;Q5GFL6-2	VWA2_HUMAN;.	T	287	ENSP00000376708:P287T	ENSP00000298715:P287T	P	+	1	0	VWA2	116032290	0.996000	0.38824	0.441000	0.26858	0.056000	0.15407	3.435000	0.52849	1.348000	0.45733	0.557000	0.71058	CCT	-	NULL		0.498	VWA2-001	KNOWN	basic|appris_principal	protein_coding	VWA2	protein_coding	OTTHUMT00000050456.3	C	NM_198496		116032290	+1	no_errors	NM_198496	genbank	human	provisional	54_36p	missense	SNP	0.690	A
ROS1	6098	genome.wustl.edu	37	6	117710739	117710739	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:117710739G>A	ENST00000368508.3	-	12	1731	c.1533C>T	c.(1531-1533)gtC>gtT	p.V511V	ROS1_ENST00000368507.3_Silent_p.V520V|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	511					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TGCCATCTGTGACAAGAAAGT	0.418			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0			6											94.0	95.0	94.0					6																	117710739		2203	4300	6503	117817432	SO:0001819	synonymous_variant	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1533C>T	6.37:g.117710739G>A			117817432	Q15368|Q5TDB5	Silent	SNP	HMMSmart_FN3,HMMPfam_fn3,superfamily_FN_III-like,superfamily_SSF63825,HMMSmart_LY,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.V511	ENST00000368508.3	37	c.1533	CCDS5116.1	6																																																																																			-	superfamily_SSF63825		0.418	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	G			117817432	-1	no_errors	NM_002944	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
MCAM	4162	genome.wustl.edu	37	11	119182329	119182329	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr11:119182329C>A	ENST00000264036.4	-	11	1332	c.1318G>T	c.(1318-1320)Gtg>Ttg	p.V440L	MCAM_ENST00000392814.1_Missense_Mutation_p.V389L	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	440	Ig-like C2-type 3.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TTCACCCACACCTTCCTCTCC	0.617																																																0			11											120.0	106.0	111.0					11																	119182329		2199	4295	6494	118687539	SO:0001583	missense	4162			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1318G>T	11.37:g.119182329C>A	ENSP00000264036:p.Val440Leu		118687539	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMPfam_C2-set_2,HMMSmart_SM00408,HMMPfam_ig	p.V440L	ENST00000264036.4	37	c.1318	CCDS31690.1	11	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995774	0.35226	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.65549	0.44;-0.16	5.78	-4.37	0.03633	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31104	0.0786	N	0.13327	0.33	0.20403	N	0.999903	B	0.02656	0.0	B	0.06405	0.002	T	0.34576	-0.9823	9	0.02654	T	1	-3.114	4.2218	0.10561	0.1064:0.4672:0.2656:0.1608	.	440	P43121	MUC18_HUMAN	L	440;389	ENSP00000264036:V440L;ENSP00000376561:V389L	ENSP00000264036:V440L	V	-	1	0	MCAM	118687539	0.196000	0.23350	0.576000	0.28549	0.888000	0.51559	-0.600000	0.05693	-0.606000	0.05746	-0.152000	0.13540	GTG	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.617	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	protein_coding	OTTHUMT00000388332.2	C			118687539	-1	no_errors	NM_006500	genbank	human	validated	54_36p	missense	SNP	0.063	A
WDR11	55717	genome.wustl.edu	37	10	122664840	122664840	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:122664840A>G	ENST00000263461.6	+	26	3449	c.3203A>G	c.(3202-3204)cAg>cGg	p.Q1068R	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.Q1068R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GAGGGCGTTCAGTTGCTCTGC	0.498																																																1	Substitution - Missense(1)	large_intestine(1)	10											90.0	84.0	86.0					10																	122664840		2203	4300	6503	122654830	SO:0001583	missense	55717			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.3203A>G	10.37:g.122664840A>G	ENSP00000263461:p.Gln1068Arg		122654830	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q1068R	ENST00000263461.6	37	c.3203	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	A	18.00	3.524679	0.64747	.	.	ENSG00000120008	ENST00000263461	D	0.92397	-3.03	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.95736	0.8613	M	0.76574	2.34	0.80722	D	1	D;D;D;P	0.89917	0.987;0.987;1.0;0.956	D;D;D;B	0.74348	0.953;0.953;0.983;0.444	D	0.96035	0.9020	10	0.72032	D	0.01	-19.149	16.3756	0.83387	1.0:0.0:0.0:0.0	.	1068;1068;359;597	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	R	1068	ENSP00000263461:Q1068R	ENSP00000263461:Q1068R	Q	+	2	0	WDR11	122654830	1.000000	0.71417	0.970000	0.41538	0.052000	0.14988	8.873000	0.92357	2.270000	0.75569	0.460000	0.39030	CAG	-	NULL		0.498	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	BRWD2	protein_coding	OTTHUMT00000050707.2	A			122654830	+1	no_errors	NM_018117	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DHX37	57647	genome.wustl.edu	37	12	125457129	125457129	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:125457129T>C	ENST00000308736.2	-	7	1095	c.997A>G	c.(997-999)Atc>Gtc	p.I333V	DHX37_ENST00000544745.1_Missense_Mutation_p.I120V	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	333	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TCATACCGGATCTGGTAGGAG	0.572																																																0			12											207.0	182.0	191.0					12																	125457129		2203	4300	6503	124023082	SO:0001583	missense	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.997A>G	12.37:g.125457129T>C	ENSP00000311135:p.Ile333Val		124023082	Q9BUI7|Q9P211	Missense_Mutation	SNP	PatternScan_DEAH_ATP_HELICASE,HMMSmart_DEXDc,superfamily_SSF52540,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.I333V	ENST00000308736.2	37	c.997	CCDS9261.1	12	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392778	0.83011	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.12361	2.69;2.69	4.58	4.58	0.56647	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.20170	0.0485	L	0.31526	0.94	0.80722	D	1	P	0.37708	0.606	P	0.50860	0.652	T	0.03259	-1.1055	10	0.62326	D	0.03	-18.1983	13.637	0.62227	0.0:0.0:0.0:1.0	.	333	Q8IY37	DHX37_HUMAN	V	333;120	ENSP00000311135:I333V;ENSP00000439009:I120V	ENSP00000311135:I333V	I	-	1	0	DHX37	124023082	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.559000	0.82265	1.698000	0.51180	0.459000	0.35465	ATC	-	HMMSmart_DEXDc,superfamily_SSF52540		0.572	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	protein_coding		T	NM_032656		124023082	-1	no_errors	NM_032656	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
AACS	65985	genome.wustl.edu	37	12	125621263	125621263	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr12:125621263C>T	ENST00000316519.6	+	17	1940	c.1734C>T	c.(1732-1734)taC>taT	p.Y578Y	AACS_ENST00000545511.1_Intron|AACS_ENST00000316543.10_Silent_p.Y176Y|AACS_ENST00000398953.2_3'UTR|AACS_ENST00000261686.6_Intron|AACS_ENST00000543665.1_Intron	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	578					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		ATAACAAGTACAGGGAGGAGA	0.592																																																0			12											113.0	93.0	100.0					12																	125621263		2203	4300	6503	124187216	SO:0001819	synonymous_variant	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1734C>T	12.37:g.125621263C>T			124187216	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Silent	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.Y578	ENST00000316519.6	37	c.1734	CCDS9263.1	12																																																																																			-	superfamily_Acetyl-CoA synthetase-like		0.592	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	protein_coding	OTTHUMT00000400202.1	C	NM_023928		124187216	+1	no_errors	NM_023928	genbank	human	validated	54_36p	silent	SNP	0.993	T
MYLK	4638	genome.wustl.edu	37	3	123441087	123441087	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:123441087G>A	ENST00000475616.1	-	10	1691	c.1692C>T	c.(1690-1692)ggC>ggT	p.G564G	MYLK_ENST00000360772.3_Silent_p.G564G|MYLK_ENST00000346322.5_Silent_p.G495G|MYLK_ENST00000359169.1_Silent_p.G564G|MYLK_ENST00000360304.3_Silent_p.G564G			Q15746	MYLK_HUMAN	myosin light chain kinase	564	Ig-like C2-type 4.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCTCAGCCACGCCGGCCTCGC	0.672																																																0			3											16.0	14.0	15.0					3																	123441087		2196	4280	6476	124923777	SO:0001819	synonymous_variant	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1692C>T	3.37:g.123441087G>A			124923777	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.G564	ENST00000475616.1	37	c.1692	CCDS46896.1	3																																																																																			-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.672	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	G	NM_053025		124923777	-1	no_errors	NM_053025	genbank	human	reviewed	54_36p	silent	SNP	0.036	A
MEGF10	84466	genome.wustl.edu	37	5	126770395	126770395	+	Silent	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:126770395T>C	ENST00000274473.6	+	16	2124	c.1857T>C	c.(1855-1857)ttT>ttC	p.F619F	MEGF10_ENST00000503335.2_Silent_p.F619F	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	619	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CCCCTGGTTTTTATGGGCATC	0.532																																																0			5											62.0	58.0	60.0					5																	126770395		2203	4300	6503	126798294	SO:0001819	synonymous_variant	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1857T>C	5.37:g.126770395T>C			126798294	Q68DE5|Q8WUL3	Silent	SNP	HMMPfam_EMI,superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00180,HMMPfam_Laminin_EGF,HMMPfam_EGF_2,superfamily_Plant inhibitors of proteinases and amylases	p.F619	ENST00000274473.6	37	c.1857	CCDS4142.1	5																																																																																			-	superfamily_EGF/Laminin,HMMPfam_Laminin_EGF,HMMSmart_SM00180		0.532	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	T	NM_032446		126798294	+1	no_errors	NM_032446	genbank	human	validated	54_36p	silent	SNP	1.000	C
ACTRT1	139741	genome.wustl.edu	37	X	127185519	127185519	+	Missense_Mutation	SNP	C	C	T	rs148603135	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chrX:127185519C>T	ENST00000371124.3	-	1	863	c.667G>A	c.(667-669)Gcc>Acc	p.A223T		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	223						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GGCTCCAAGGCGATGTAGCAC	0.522													C|||	3	0.000794702	0.0008	0.0029	3775	,	,		14846	0.0		0.0	False		,,,				2504	0.0															0			X						C	THR/ALA	4,3831		0,2,2,1630,569	138.0	129.0	132.0		667	0.4	0.0	X	dbSNP_134	132	1,6727		0,1,0,2427,1872	yes	missense	ACTRT1	NM_138289.3	58	0,3,2,4057,2441	TT,TC,T,CC,C		0.0149,0.1043,0.0473	benign	223/377	127185519	5,10558	2203	4300	6503	127013200	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.667G>A	X.37:g.127185519C>T	ENSP00000360165:p.Ala223Thr		127013200	Q6X7C1|Q96L10	Missense_Mutation	SNP	HMMPfam_Actin,superfamily_SSF53067,HMMSmart_ACTIN	p.A223T	ENST00000371124.3	37	c.667	CCDS14611.1	X	1	6.027727546714888E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.849	1.193166	0.22037	0.001043	1.49E-4	ENSG00000123165	ENST00000371124	D	0.94650	-3.48	3.48	0.355	0.16069	.	0.095573	0.43416	D	0.000565	D	0.90215	0.6941	M	0.77486	2.375	0.31131	N	0.707751	P	0.48016	0.904	B	0.36567	0.228	D	0.86187	0.1610	10	0.87932	D	0	.	2.2612	0.04068	0.2365:0.4823:0.162:0.1192	.	223	Q8TDG2	ACTT1_HUMAN	T	223	ENSP00000360165:A223T	ENSP00000360165:A223T	A	-	1	0	ACTRT1	127013200	0.733000	0.28132	0.001000	0.08648	0.241000	0.25554	1.356000	0.34079	-0.051000	0.13334	0.544000	0.68410	GCC	-	HMMPfam_Actin,HMMSmart_ACTIN,superfamily_SSF53067		0.522	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	protein_coding	OTTHUMT00000058192.1	C	NM_138289		127013200	-1	no_errors	NM_138289	genbank	human	provisional	54_36p	missense	SNP	0.942	T
SLC41A3	54946	genome.wustl.edu	37	3	125725955	125725955	+	Splice_Site	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:125725955A>G	ENST00000315891.6	-	11	1605		c.e11+1		SLC41A3_ENST00000383598.2_Silent_p.G430G|SLC41A3_ENST00000508835.1_Silent_p.G339G|SLC41A3_ENST00000346785.5_Splice_Site|SLC41A3_ENST00000360370.4_Silent_p.G456G	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		GGAGGCCAGTACCGAGCAGGT	0.582																																																0			3											83.0	77.0	79.0					3																	125725955		2203	4300	6503	127208645	SO:0001630	splice_region_variant	54946				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1366+1T>C	3.37:g.125725955A>G			127208645	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Splice_Site	SNP	-	e10+2	ENST00000315891.6	37	c.1366+2	CCDS33843.1	3	.	.	.	.	.	.	.	.	.	.	A	9.567	1.120029	0.20877	.	.	ENSG00000114544	ENST00000346785;ENST00000315891	.	.	.	5.52	-0.145	0.13436	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2965	0.10904	0.2252:0.4881:0.2066:0.0801	.	.	.	.	.	-1	.	.	.	-	.	.	SLC41A3	127208645	0.962000	0.33011	0.855000	0.33649	0.500000	0.33767	-0.033000	0.12246	-0.038000	0.13624	-0.254000	0.11334	.	-	-		0.582	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	protein_coding	OTTHUMT00000370886.1	A	NM_017836	Intron	127208645	-1	no_errors	NM_001008485	genbank	human	validated	54_36p	splice_site	SNP	0.932	G
LARP1B	55132	genome.wustl.edu	37	4	129076568	129076568	+	Intron	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:129076568G>A	ENST00000326639.6	+	12	1735				LARP1B_ENST00000441387.1_Intron|LARP1B_ENST00000354456.3_Intron|LARP1B_ENST00000264584.5_Intron	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						CAGGGAACCCGGCCCGAGCTC	0.662																																																0			4																																								129296018	SO:0001627	intron_variant	729231				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1525-6781G>A	4.37:g.129076568G>A			129296018	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	RNA	SNP	-	NULL	ENST00000326639.6	37	NULL	CCDS3738.1	4																																																																																			-	-		0.662	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC729231	protein_coding	OTTHUMT00000257173.2	G	NM_018078		129296018	+1	pseudogene	XR_015888	genbank	human	model	54_36p	rna	SNP	0.209	A
ODF2	4957	genome.wustl.edu	37	9	131243889	131243889	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr9:131243889G>T	ENST00000434106.3	+	9	1237	c.874G>T	c.(874-876)Gca>Tca	p.A292S	ODF2_ENST00000535026.1_3'UTR|ODF2_ENST00000448249.3_Missense_Mutation_p.A211S|ODF2_ENST00000372814.3_Missense_Mutation_p.A336S|ODF2_ENST00000393527.3_Missense_Mutation_p.A268S|ODF2_ENST00000546203.1_Missense_Mutation_p.A273S|ODF2_ENST00000444119.2_Missense_Mutation_p.A268S|ODF2_ENST00000372807.5_Missense_Mutation_p.A287S|ODF2_ENST00000351030.3_Missense_Mutation_p.A287S|ODF2_ENST00000604420.1_Missense_Mutation_p.A292S|ODF2_ENST00000372791.3_Missense_Mutation_p.A273S|ODF2_ENST00000393533.2_Missense_Mutation_p.A292S	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	292					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GCAACAAGGAGCACTGCTGAA	0.463																																																0			9											97.0	92.0	94.0					9																	131243889		2203	4300	6503	130283710	SO:0001583	missense	4957			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.874G>T	9.37:g.131243889G>T	ENSP00000403453:p.Ala292Ser		130283710	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	NULL	p.A268S	ENST00000434106.3	37	c.802	CCDS56588.1	9	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604132	0.28534	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;1.93;0.92;0.92;0.92	5.74	-1.96	0.07525	.	0.753119	0.13555	N	0.379208	T	0.22205	0.0535	N	0.14661	0.345	0.09310	N	0.999999	B;B;B;B;B;B;B;B;B;B	0.28055	0.034;0.191;0.137;0.098;0.199;0.089;0.023;0.034;0.089;0.191	B;B;B;B;B;B;B;B;B;B	0.29862	0.036;0.075;0.058;0.079;0.075;0.075;0.032;0.036;0.075;0.108	T	0.28933	-1.0028	10	0.10902	T	0.67	0.2133	12.2075	0.54361	0.5428:0.0:0.4571:0.0	.	273;287;211;226;292;336;287;273;292;268	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	S	292;336;287;292;268;211;273;273	ENSP00000377166:A292S;ENSP00000361901:A336S;ENSP00000342581:A287S;ENSP00000361882:A292S;ENSP00000307781:A268S;ENSP00000396687:A211S;ENSP00000437579:A273S;ENSP00000361877:A273S	ENSP00000307781:A268S	A	+	1	0	ODF2	130283710	0.004000	0.15560	0.063000	0.19743	0.671000	0.39405	-0.317000	0.08060	-0.234000	0.09782	0.655000	0.94253	GCA	-	NULL		0.463	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	protein_coding	OTTHUMT00000054449.3	G			130283710	+1	no_errors	NM_002540	genbank	human	reviewed	54_36p	missense	SNP	0.007	T
TMEM200A	114801	genome.wustl.edu	37	6	130761674	130761674	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:130761674A>G	ENST00000296978.3	+	3	978	c.107A>G	c.(106-108)gAg>gGg	p.E36G	TMEM200A_ENST00000392429.1_Missense_Mutation_p.E36G|TMEM200A_ENST00000545622.1_Missense_Mutation_p.E36G	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	36						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GCTACCCAAGAGAAGAAGCCC	0.537																																																0			6											112.0	120.0	118.0					6																	130761674		2203	4300	6503	130803367	SO:0001583	missense	114801			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.107A>G	6.37:g.130761674A>G	ENSP00000296978:p.Glu36Gly		130803367	Q96PX5	Missense_Mutation	SNP	HMMPfam_DUF2371	p.E36G	ENST00000296978.3	37	c.107	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	A	15.54	2.864939	0.51482	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.6	5.6	0.85130	.	0.207404	0.49916	D	0.000140	T	0.50017	0.1591	L	0.44542	1.39	0.54753	D	0.999986	B	0.30542	0.284	B	0.38327	0.271	T	0.58504	-0.7625	9	0.66056	D	0.02	.	15.781	0.78260	1.0:0.0:0.0:0.0	.	36	Q86VY9	T200A_HUMAN	G	36	.	ENSP00000296978:E36G	E	+	2	0	TMEM200A	130803367	1.000000	0.71417	0.881000	0.34555	0.463000	0.32649	4.713000	0.61895	2.120000	0.65058	0.528000	0.53228	GAG	-	HMMPfam_DUF2371		0.537	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	protein_coding	OTTHUMT00000042201.1	A	NM_052913		130803367	+1	no_errors	NM_052913	genbank	human	provisional	54_36p	missense	SNP	0.996	G
POTEJ	653781	genome.wustl.edu	37	2	131414793	131414793	+	Silent	SNP	C	C	T	rs201738463	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:131414793C>T	ENST00000409602.1	+	15	2512	c.2460C>T	c.(2458-2460)gaC>gaT	p.D820D		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	820	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						ACTCTGGTGACGGGGTCACCC	0.597													c|||	17	0.00339457	0.0038	0.0086	5008	,	,		21979	0.001		0.003	False		,,,				2504	0.002															0			2																																								131131263	SO:0001819	synonymous_variant	653781				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.2460C>T	2.37:g.131414793C>T			131131263		Silent	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248,superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268,PatternScan_ACTINS_ACT_LIKE,PatternScan_ACTINS_2	p.D820	ENST00000409602.1	37	c.2460	CCDS59432.1	2																																																																																			-	HMMPfam_Actin,HMMSmart_SM00268,superfamily_Actin-like ATPase domain		0.597	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC653781	protein_coding	OTTHUMT00000333665.1	C	XM_929706		131131263	+1	no_errors	XM_929706	genbank	human	model	54_36p	silent	SNP	0.998	T
ENPP1	5167	genome.wustl.edu	37	6	132211633	132211633	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:132211633C>T	ENST00000360971.2	+	25	2780	c.2760C>T	c.(2758-2760)acC>acT	p.T920T		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	920	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ATTTGCCAACCTTTAGCCAAG	0.363																																					Colon(104;336 1535 5856 11019 33782)											0			6											88.0	85.0	86.0					6																	132211633		2203	4300	6503	132253326	SO:0001819	synonymous_variant	5167			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2760C>T	6.37:g.132211633C>T			132253326	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Silent	SNP	HMMSmart_SM00201,HMMPfam_Somatomedin_B,superfamily_Somatomedin B domain,PatternScan_SMB_1,superfamily_Alkaline phosphatase-like,HMMPfam_Phosphodiest,superfamily_His-Me finger endonucleases,HMMSmart_SM00477	p.T868	ENST00000360971.2	37	c.2604	CCDS5150.2	6																																																																																			-	superfamily_His-Me finger endonucleases		0.363	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	protein_coding	OTTHUMT00000042238.2	C			132253326	+1	no_errors	NM_006208	genbank	human	reviewed	54_36p	silent	SNP	0.622	T
SLA	6503	genome.wustl.edu	37	8	134060176	134060176	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:134060176C>T	ENST00000338087.5	-	6	1070	c.251G>A	c.(250-252)tGg>tAg	p.W84*	TG_ENST00000220616.4_Intron|SLA_ENST00000517648.1_Nonsense_Mutation_p.W101*|SLA_ENST00000427060.2_Nonsense_Mutation_p.W124*|TG_ENST00000542445.1_Intron|SLA_ENST00000518565.1_5'Flank|TG_ENST00000519543.1_Intron|TG_ENST00000377869.1_Intron|SLA_ENST00000395352.3_Nonsense_Mutation_p.W101*|SLA_ENST00000524345.1_5'UTR	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	84	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			CTCAAACAGCCAGCTGGGAAG	0.567																																																0			8											41.0	41.0	41.0					8																	134060176		2203	4300	6503	134129358	SO:0001587	stop_gained	6503				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.251G>A	8.37:g.134060176C>T	ENSP00000337548:p.Trp84*		134129358	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Nonsense_Mutation	SNP	HMMSmart_SM00326,HMMPfam_SH3_1,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2	p.W84*	ENST00000338087.5	37	c.251	CCDS6370.1	8	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060467	0.76074	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000517648;ENST00000522119;ENST00000519341	.	.	.	5.6	5.6	0.85130	.	0.052169	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.954	17.4647	0.87629	0.0:1.0:0.0:0.0	.	.	.	.	X	84;124;101;101;84;84	.	ENSP00000337548:W84X	W	-	2	0	SLA	134129358	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	7.095000	0.76952	2.793000	0.96121	0.563000	0.77884	TGG	-	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2		0.567	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA	protein_coding	OTTHUMT00000378771.1	C			134129358	-1	no_errors	NM_001045556	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
VENTX	27287	genome.wustl.edu	37	10	135053310	135053310	+	Silent	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr10:135053310G>A	ENST00000325980.9	+	2	883	c.372G>A	c.(370-372)ctG>ctA	p.L124L		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	124					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		GGAAGAGGCTGGCCAGGGAGA	0.687																																																0			10											23.0	26.0	25.0					10																	135053310		2201	4298	6499	134903300	SO:0001819	synonymous_variant	27287			AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.372G>A	10.37:g.135053310G>A			134903300	Q32MZ3	Silent	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L124	ENST00000325980.9	37	c.372	CCDS7675.1	10																																																																																			-	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1		0.687	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VENTX	protein_coding	OTTHUMT00000051116.4	G	NM_014468		134903300	+1	no_errors	NM_014468	genbank	human	reviewed	54_36p	silent	SNP	0.943	A
IL20RB	53833	genome.wustl.edu	37	3	136708310	136708310	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:136708310T>C	ENST00000329582.4	+	4	683	c.434T>C	c.(433-435)aTc>aCc	p.I145T	IL20RB_ENST00000309741.5_Missense_Mutation_p.I98T|IL20RB_ENST00000484501.1_3'UTR	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	145	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						GGGATGGAGATCACCAAAGAT	0.577																																																0			3											89.0	83.0	85.0					3																	136708310		2203	4300	6503	138191000	SO:0001583	missense	53833			BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.434T>C	3.37:g.136708310T>C	ENSP00000328133:p.Ile145Thr		138191000	B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Missense_Mutation	SNP	HMMPfam_fn3,superfamily_Fibronectin type III	p.I145T	ENST00000329582.4	37	c.434	CCDS3093.1	3	.	.	.	.	.	.	.	.	.	.	T	13.06	2.124113	0.37533	.	.	ENSG00000174564	ENST00000329582;ENST00000309741	T;T	0.78364	-1.17;-1.17	4.9	4.9	0.64082	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.914921	0.09330	N	0.817037	T	0.67487	0.2898	N	0.19112	0.55	0.09310	N	1	B	0.30563	0.285	B	0.31946	0.138	T	0.60692	-0.7213	10	0.66056	D	0.02	-2.8205	10.841	0.46715	0.0:0.0:0.0:1.0	.	145	Q6UXL0	I20RB_HUMAN	T	145;98	ENSP00000328133:I145T;ENSP00000311979:I98T	ENSP00000311979:I98T	I	+	2	0	IL20RB	138191000	0.111000	0.22076	0.245000	0.24217	0.793000	0.44817	2.675000	0.46875	2.071000	0.62044	0.533000	0.62120	ATC	-	superfamily_Fibronectin type III		0.577	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20RB	protein_coding	OTTHUMT00000357277.2	T	NM_144717		138191000	+1	no_errors	NM_144717	genbank	human	validated	54_36p	missense	SNP	0.023	C
PCDHB3	56132	genome.wustl.edu	37	5	140480783	140480783	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:140480783A>T	ENST00000231130.2	+	1	550	c.550A>T	c.(550-552)Agt>Tgt	p.S184C	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCACTCGCAGTCGTAGGGA	0.532																																																0			5											85.0	83.0	84.0					5																	140480783		2203	4300	6503	140460967	SO:0001583	missense	56132			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.550A>T	5.37:g.140480783A>T	ENSP00000231130:p.Ser184Cys		140460967	B2R8P2	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.S184C	ENST00000231130.2	37	c.550	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	A	15.73	2.920313	0.52653	.	.	ENSG00000113205	ENST00000231130	T	0.54866	0.55	5.08	-2.33	0.06724	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.64821	0.2633	M	0.89353	3.025	0.09310	N	1	D	0.59767	0.986	P	0.58391	0.838	T	0.56238	-0.8012	9	0.72032	D	0.01	.	2.8119	0.05444	0.3338:0.3648:0.2047:0.0967	.	184	Q9Y5E6	PCDB3_HUMAN	C	184	ENSP00000231130:S184C	ENSP00000231130:S184C	S	+	1	0	PCDHB3	140460967	0.000000	0.05858	0.000000	0.03702	0.957000	0.61999	-0.274000	0.08537	-0.292000	0.08999	0.533000	0.62120	AGT	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.532	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	protein_coding	OTTHUMT00000251817.2	A	NM_018937		140460967	+1	no_errors	NM_018937	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
PCDHB14	56122	genome.wustl.edu	37	5	140603479	140603479	+	Silent	SNP	A	A	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:140603479A>C	ENST00000239449.4	+	1	402	c.402A>C	c.(400-402)ctA>ctC	p.L134L	PCDHB14_ENST00000515856.2_Splice_Site	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	134					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTACATTTCTAGACAAGGAAA	0.408																																					Ovarian(141;50 1831 27899 33809 37648)											0			5											70.0	77.0	75.0					5																	140603479		2200	4299	6499	140583663	SO:0001819	synonymous_variant	56122			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.402A>C	5.37:g.140603479A>C			140583663	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_CA	p.L134	ENST00000239449.4	37	c.402	CCDS4256.1	5																																																																																			-	superfamily_Cadherin		0.408	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	protein_coding	OTTHUMT00000251814.2	A	NM_018934		140583663	+1	no_errors	NM_018934	genbank	human	reviewed	54_36p	silent	SNP	0.000	C
ZC3H3	23144	genome.wustl.edu	37	8	144621327	144621327	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:144621327C>G	ENST00000262577.5	-	2	241	c.210G>C	c.(208-210)tgG>tgC	p.W70C	RP11-661A12.5_ENST00000530600.1_RNA|7SK_ENST00000517300.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	70					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			ATTTCTTGCGCCACGAAGGCC	0.677																																																0			8											71.0	67.0	69.0					8																	144621327		2202	4294	6496	144692470	SO:0001583	missense	23144			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.210G>C	8.37:g.144621327C>G	ENSP00000262577:p.Trp70Cys		144692470	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	superfamily_CCCH zinc finger,HMMPfam_zf-CCCH,HMMSmart_SM00356	p.W70C	ENST00000262577.5	37	c.210	CCDS6402.1	8	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527031	0.64860	.	.	ENSG00000014164	ENST00000262577	T	0.20881	2.04	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000016	T	0.47563	0.1452	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.52305	-0.8593	10	0.87932	D	0	.	17.8863	0.88855	0.0:1.0:0.0:0.0	.	70	Q8IXZ2	ZC3H3_HUMAN	C	70	ENSP00000262577:W70C	ENSP00000262577:W70C	W	-	3	0	ZC3H3	144692470	1.000000	0.71417	0.998000	0.56505	0.885000	0.51271	5.258000	0.65479	2.217000	0.71921	0.655000	0.94253	TGG	-	NULL		0.677	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	protein_coding	OTTHUMT00000382011.2	C	NM_015117		144692470	-1	no_errors	NM_015117	genbank	human	validated	54_36p	missense	SNP	1.000	G
GRINA	2907	genome.wustl.edu	37	8	145066086	145066086	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:145066086C>A	ENST00000313269.5	+	4	811	c.533C>A	c.(532-534)tCc>tAc	p.S178Y	GRINA_ENST00000395068.4_Missense_Mutation_p.S178Y	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	178						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGACCCTGTCCACGGTGTCT	0.572																																																0			8											212.0	207.0	209.0					8																	145066086		2203	4300	6503	145138074	SO:0001583	missense	2907			NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.533C>A	8.37:g.145066086C>A	ENSP00000314380:p.Ser178Tyr		145138074	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	PatternScan_BI1,HMMPfam_UPF0005	p.S178Y	ENST00000313269.5	37	c.533	CCDS34961.1	8	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251227	0.80135	.	.	ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000537637	T;T;T	0.09538	2.97;2.97;2.97	4.7	4.7	0.59300	.	0.131035	0.52532	D	0.000066	T	0.17492	0.0420	L	0.49126	1.545	0.49582	D	0.999801	D	0.55800	0.973	P	0.50537	0.643	T	0.00308	-1.1829	10	0.56958	D	0.05	-47.0539	13.0659	0.59032	0.0:1.0:0.0:0.0	.	178	Q7Z429	GRINA_HUMAN	Y	178;178;178;159	ENSP00000314380:S178Y;ENSP00000432706:S178Y;ENSP00000378507:S178Y	ENSP00000314380:S178Y	S	+	2	0	GRINA	145138074	0.290000	0.24343	0.978000	0.43139	0.991000	0.79684	2.030000	0.41108	2.460000	0.83146	0.650000	0.86243	TCC	-	HMMPfam_UPF0005		0.572	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GRINA	protein_coding	OTTHUMT00000384048.1	C	NM_001009184		145138074	+1	no_errors	NM_000837	genbank	human	validated	54_36p	missense	SNP	0.996	A
SHARPIN	81858	genome.wustl.edu	37	8	145154282	145154282	+	Missense_Mutation	SNP	G	G	A	rs77359862	byFrequency	TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr8:145154282G>A	ENST00000398712.2	-	6	1256	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	SHARPIN_ENST00000533948.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	274	Interaction with SHANK1. {ECO:0000250}.|Ubiquitin-like.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CACAGGCACCGTCCGATGACC	0.632													G|||	45	0.00898562	0.0	0.0014	5008	,	,		20405	0.0397		0.001	False		,,,				2504	0.0031															0			8						G	TRP/ARG	1,4315		0,1,2157	52.0	62.0	58.0		820	-0.9	0.0	8	dbSNP_132	58	1,8515		0,1,4257	yes	missense	SHARPIN	NM_030974.3	101	0,2,6414	AA,AG,GG		0.0117,0.0232,0.0156	probably-damaging	274/388	145154282	2,12830	2158	4258	6416	145226270	SO:0001583	missense	81858			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.820C>T	8.37:g.145154282G>A	ENSP00000381698:p.Arg274Trp		145226270	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	superfamily_Ubiquitin-like,superfamily_NZF domain,HMMPfam_zf-RanBP,HMMSmart_SM00547,PatternScan_ZF_RANBP2_1	p.R274W	ENST00000398712.2	37	c.820	CCDS43777.1	8	16	0.007326007326007326	0	0.0	0	0.0	15	0.026223776223776224	1	0.0013192612137203166	G	16.22	3.062349	0.55432	2.32E-4	1.17E-4	ENSG00000179526	ENST00000398712;ENST00000359551	T;T	0.43688	0.94;0.94	4.63	-0.917	0.10485	.	0.445596	0.24748	N	0.035935	T	0.09642	0.0237	L	0.44542	1.39	0.09310	N	1	D	0.56287	0.975	B	0.36666	0.23	T	0.15838	-1.0423	10	0.87932	D	0	.	7.4785	0.27391	0.0:0.2735:0.2763:0.4502	.	274	Q9H0F6	SHRPN_HUMAN	W	274	ENSP00000381698:R274W;ENSP00000352551:R274W	ENSP00000352551:R274W	R	-	1	2	SHARPIN	145226270	1.000000	0.71417	0.001000	0.08648	0.601000	0.36947	2.614000	0.46359	-0.398000	0.07679	0.555000	0.69702	CGG	-	superfamily_Ubiquitin-like		0.632	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	protein_coding	OTTHUMT00000382901.1	G	NM_030974		145226270	-1	no_errors	NM_030974	genbank	human	validated	54_36p	missense	SNP	0.855	A
MBD5	55777	genome.wustl.edu	37	2	149226657	149226657	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:149226657A>C	ENST00000407073.1	+	9	2142	c.1145A>C	c.(1144-1146)cAt>cCt	p.H382P	MBD5_ENST00000404807.1_Missense_Mutation_p.H382P	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	382	Pro-rich.				glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ACCAGTTTCCATTCAAATGTC	0.418																																																0			2											195.0	194.0	194.0					2																	149226657		2203	4300	6503	148943127	SO:0001583	missense	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.1145A>C	2.37:g.149226657A>C	ENSP00000386049:p.His382Pro		148943127	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	HMMSmart_SM00391,HMMPfam_MBD,superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP	p.H382P	ENST00000407073.1	37	c.1145	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.68|14.68	2.607904|2.607904	0.46527|0.46527	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.32515|.	1.45;1.45|.	5.45|5.45	4.29|4.29	0.51040|0.51040	.|.	0.093959|.	0.47455|.	D|.	0.000240|.	T|T	0.39118|0.39118	0.1066|0.1066	N|N	0.14661|0.14661	0.345|0.345	0.50171|0.50171	D|D	0.999855|0.999855	P|.	0.40794|.	0.729|.	B|.	0.38056|.	0.264|.	T|T	0.15350|0.15350	-1.0440|-1.0440	10|5	0.46703|.	T|.	0.11|.	-4.8091|-4.8091	11.2446|11.2446	0.48990|0.48990	0.9285:0.0:0.0715:0.0|0.9285:0.0:0.0715:0.0	.|.	382|.	Q9P267|.	MBD5_HUMAN|.	P|L	382|122	ENSP00000386049:H382P;ENSP00000384672:H382P|.	ENSP00000384672:H382P|.	H|I	+|+	2|1	0|0	MBD5|MBD5	148943127|148943127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.212000|7.212000	0.77941|0.77941	1.021000|1.021000	0.39600|0.39600	0.533000|0.533000	0.62120|0.62120	CAT|ATT	-	NULL		0.418	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	protein_coding	OTTHUMT00000318111.2	A			148943127	+1	no_errors	NM_018328	genbank	human	validated	54_36p	missense	SNP	1.000	C
ZNF767P	79970	genome.wustl.edu	37	7	149317067	149317067	+	RNA	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr7:149317067G>C	ENST00000463567.1	-	0	547					NR_027788.1		Q75MW2	ZN767_HUMAN												central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)	5	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)			GGCGGCGCCAGTTGCAGGGCT	0.552																																																0			7											85.0	80.0	82.0					7																	149317067		2203	4300	6503	148948000			79970																															7.37:g.149317067G>C			148948000	D3DWG6|Q86WY4|Q9H9J3	Missense_Mutation	SNP	NULL	p.T129S	ENST00000463567.1	37	c.386		7																																																																																			-	NULL		0.552	ZNF767-001	KNOWN	basic	processed_transcript	ZNF767	pseudogene	OTTHUMT00000352753.2	G			148948000	-1	no_errors	NM_024910	genbank	human	provisional	54_36p	missense	SNP	0.690	C
PDGFRB	5159	genome.wustl.edu	37	5	149502764	149502764	+	Splice_Site	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr5:149502764C>T	ENST00000261799.4	-	15	2493	c.2024G>A	c.(2023-2025)gGa>gAa	p.G675E		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	675	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATAGATGGGTCCTGCAGAGGG	0.582			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0			5											106.0	87.0	93.0					5																	149502764		2203	4300	6503	149482957	SO:0001630	splice_region_variant	5159			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2024-1G>A	5.37:g.149502764C>T			149482957	B5A957|Q8N5L4	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR	p.G675E	ENST00000261799.4	37	c.2024	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780954	0.90282	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	D	0.89270	-2.49	4.06	4.06	0.47325	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000173	D	0.89757	0.6807	N	0.20766	0.605	0.80722	D	1	D;D	0.89917	0.969;1.0	P;D	0.71414	0.83;0.973	D	0.91868	0.5505	10	0.87932	D	0	.	16.7915	0.85590	0.0:1.0:0.0:0.0	.	675;675	A8KAM8;P09619	.;PGFRB_HUMAN	E	675;345	ENSP00000261799:G675E	ENSP00000261799:G675E	G	-	2	0	PDGFRB	149482957	1.000000	0.71417	0.992000	0.48379	0.926000	0.56050	7.567000	0.82357	2.263000	0.75096	0.462000	0.41574	GGA	-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc		0.582	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	protein_coding	OTTHUMT00000252332.1	C	NM_002609	Missense_Mutation	149482957	-1	no_errors	NM_002609	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CELF3	11189	genome.wustl.edu	37	1	151687080	151687080	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:151687080G>A	ENST00000290583.4	-	2	1011	c.218C>T	c.(217-219)aCg>aTg	p.T73M	AL589765.1_ENST00000442233.2_Intron|RIIAD1_ENST00000326413.3_Intron|CELF3_ENST00000290585.4_Missense_Mutation_p.T73M	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	73	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.T73M(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CCCTGGAAGCGTCTTCTGTTC	0.602																																																1	Substitution - Missense(1)	large_intestine(1)	1											36.0	31.0	33.0					1																	151687080		2188	4267	6455	149953704	SO:0001583	missense	11189			U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.218C>T	1.37:g.151687080G>A	ENSP00000290583:p.Thr73Met		149953704	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	HMMSmart_SM00360,superfamily_RNA-binding domain RBD,HMMPfam_RRM_1	p.T73M	ENST00000290583.4	37	c.218	CCDS1002.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	3.994740|3.994740	0.74703|0.74703	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290585;ENST00000290583;ENST00000368833	.|T;T	.|0.73789	.|-0.78;1.36	4.64|4.64	3.73|3.73	0.42828|0.42828	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.124055	.|0.53938	.|D	.|0.000059	T|T	0.76399|0.76399	0.3982|0.3982	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.996;0.999;1.0;1.0	.|P;D;D;D	.|0.71870	.|0.908;0.954;0.975;0.972	T|T	0.79505|0.79505	-0.1776|-0.1776	5|10	.|0.87932	.|D	.|0	-11.5238|-11.5238	10.5805|10.5805	0.45252|0.45252	0.0946:0.0:0.9054:0.0|0.0946:0.0:0.9054:0.0	.|.	.|73;73;73;73	.|Q5SZQ7;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.|.;.;CELF3_HUMAN;.	C|M	75|73	.|ENSP00000290585:T73M;ENSP00000290583:T73M	.|ENSP00000290583:T73M	R|T	-|-	1|2	0|0	CELF3|CELF3	149953704|149953704	1.000000|1.000000	0.71417|0.71417	0.904000|0.904000	0.35570|0.35570	0.924000|0.924000	0.55760|0.55760	9.235000|9.235000	0.95353|0.95353	1.176000|1.176000	0.42840|0.42840	0.563000|0.563000	0.77884|0.77884	CGC|ACG	-	HMMSmart_SM00360,superfamily_RNA-binding domain RBD,HMMPfam_RRM_1		0.602	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC4	protein_coding	OTTHUMT00000036663.2	G	NM_007185		149953704	-1	no_errors	NM_007185	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RORC	6097	genome.wustl.edu	37	1	151787421	151787421	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:151787421G>A	ENST00000318247.6	-	5	886	c.779C>T	c.(778-780)cCg>cTg	p.P260L	RORC_ENST00000480719.1_5'Flank|RORC_ENST00000356728.6_Missense_Mutation_p.P239L|RORC_ENST00000392697.3_Missense_Mutation_p.P314L	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	260	Hinge. {ECO:0000255}.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGGTGCCTCCGGTGTGCTGCG	0.607																																																0			1											50.0	48.0	49.0					1																	151787421		2203	4300	6503	150054045	SO:0001583	missense	6097			U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.779C>T	1.37:g.151787421G>A	ENSP00000327025:p.Pro260Leu		150054045	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.P260L	ENST00000318247.6	37	c.779	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505732	0.26949	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.94537	-3.4;-3.45;-3.41	5.29	3.05	0.35203	.	1.061520	0.07517	N	0.909915	T	0.78207	0.4247	N	0.04043	-0.29	0.44976	D	0.997998	B;B;B;B	0.12630	0.001;0.006;0.0;0.001	B;B;B;B	0.09377	0.0;0.004;0.001;0.001	T	0.69312	-0.5178	10	0.48119	T	0.1	.	7.6151	0.28152	0.2874:0.0:0.7126:0.0	.	260;314;260;239	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	L	239;314;260	ENSP00000349164:P239L;ENSP00000376461:P314L;ENSP00000327025:P260L	ENSP00000327025:P260L	P	-	2	0	RORC	150054045	0.976000	0.34144	0.973000	0.42090	0.560000	0.35617	1.775000	0.38584	1.210000	0.43336	0.563000	0.77884	CCG	-	NULL		0.607	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	protein_coding	OTTHUMT00000036626.1	G			150054045	-1	no_errors	NM_005060	genbank	human	reviewed	54_36p	missense	SNP	0.081	A
AKAP12	9590	genome.wustl.edu	37	6	151674542	151674542	+	Silent	SNP	A	A	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr6:151674542A>G	ENST00000253332.1	+	3	5205	c.5016A>G	c.(5014-5016)acA>acG	p.T1672T	AKAP12_ENST00000402676.2_Silent_p.T1672T|AKAP12_ENST00000359755.5_Silent_p.T1567T|AKAP12_ENST00000354675.6_Silent_p.T1574T			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1672					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAGCTGGAACAAAGTCTGTGC	0.453																																					Melanoma(141;1616 1805 10049 24534 51979)											0			6											89.0	79.0	82.0					6																	151674542		2203	4300	6503	151716235	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.5016A>G	6.37:g.151674542A>G			151716235	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	HMMPfam_WSK,HMMPfam_RII_binding_1	p.T1672	ENST00000253332.1	37	c.5016	CCDS5229.1	6																																																																																			-	NULL		0.453	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	protein_coding	OTTHUMT00000042712.1	A			151716235	+1	no_errors	NM_005100	genbank	human	reviewed	54_36p	silent	SNP	0.005	G
PAQR6	79957	genome.wustl.edu	37	1	156214682	156214682	+	Silent	SNP	C	C	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:156214682C>T	ENST00000292291.5	-	7	788	c.630G>A	c.(628-630)agG>agA	p.R210R	PAQR6_ENST00000540423.1_Silent_p.R207R|PAQR6_ENST00000335852.1_Silent_p.R104R|PAQR6_ENST00000356983.2_Silent_p.R104R|PAQR6_ENST00000368270.1_Silent_p.R186R|PAQR6_ENST00000492619.1_5'UTR	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI	210						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					AGCCGTGGCCCCTGCCCCAGC	0.642																																					GBM(16;219 398 12385 32425 38531)											0			1											23.0	25.0	25.0					1																	156214682		2201	4298	6499	154481306	SO:0001819	synonymous_variant	79957			AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.630G>A	1.37:g.156214682C>T			154481306	B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Silent	SNP	HMMPfam_HlyIII	p.R104	ENST00000292291.5	37	c.312	CCDS1136.1	1																																																																																			-	HMMPfam_HlyIII		0.642	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAQR6	protein_coding	OTTHUMT00000046297.2	C	NM_024897		154481306	-1	no_errors	NM_024897	genbank	human	provisional	54_36p	silent	SNP	0.000	T
KCNH7	90134	genome.wustl.edu	37	2	163361026	163361026	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:163361026G>T	ENST00000332142.5	-	6	1154	c.1055C>A	c.(1054-1056)cCt>cAt	p.P352H	KCNH7_ENST00000477019.1_5'UTR|KCNH7_ENST00000328032.4_Missense_Mutation_p.P345H	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	352					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ATCTGAAGAAGGAGGTGATGA	0.373																																					GBM(196;1492 2208 17507 24132 45496)											0			2											193.0	190.0	191.0					2																	163361026		2203	4300	6503	163069272	SO:0001583	missense	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1055C>A	2.37:g.163361026G>T	ENSP00000331727:p.Pro352His		163069272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain),superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.P352H	ENST00000332142.5	37	c.1055	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	G	15.04	2.713962	0.48622	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.98345	-4.88;-4.88	5.5	5.5	0.81552	.	0.047339	0.85682	D	0.000000	D	0.96806	0.8957	L	0.56769	1.78	0.54753	D	0.999983	B;P	0.39094	0.016;0.659	B;B	0.37888	0.042;0.26	D	0.96362	0.9267	10	0.15066	T	0.55	.	19.775	0.96388	0.0:0.0:1.0:0.0	.	345;352	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	H	352;345	ENSP00000331727:P352H;ENSP00000333781:P345H	ENSP00000333781:P345H	P	-	2	0	KCNH7	163069272	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.847000	0.86896	2.741000	0.93983	0.585000	0.79938	CCT	-	NULL		0.373	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	G	NM_033272		163069272	-1	no_errors	NM_033272	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC38A11	151258	genome.wustl.edu	37	2	165755172	165755172	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:165755172T>A	ENST00000409149.3	-	11	1287	c.996A>T	c.(994-996)gaA>gaT	p.E332D	SLC38A11_ENST00000409058.1_Missense_Mutation_p.E363D|SLC38A11_ENST00000303735.4_Missense_Mutation_p.E310D|SLC38A11_ENST00000409662.1_Missense_Mutation_p.E332D|RNA5SP111_ENST00000411386.1_RNA	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11	332					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						GTGTCCTTGGTTCTTCAGACA	0.413																																																0			2											117.0	104.0	108.0					2																	165755172		2203	4300	6503	165463418	SO:0001583	missense	151258				CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.996A>T	2.37:g.165755172T>A	ENSP00000386272:p.Glu332Asp		165463418	B4DF99|Q8N887	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.E310D	ENST00000409149.3	37	c.930	CCDS56142.1	2	.	.	.	.	.	.	.	.	.	.	T	8.490	0.861902	0.17178	.	.	ENSG00000169507	ENST00000303735;ENST00000409149;ENST00000409058;ENST00000409662	T;T;T;T	0.02301	4.35;4.35;4.35;4.35	5.42	1.78	0.24846	.	0.094927	0.64402	D	0.000001	T	0.02267	0.0070	L	0.37800	1.135	0.32725	N	0.509718	B;B	0.23540	0.055;0.087	B;B	0.29353	0.101;0.061	T	0.26744	-1.0094	10	0.33940	T	0.23	-17.551	7.2454	0.26119	0.0:0.504:0.0:0.496	.	332;310	Q08AI6;Q08AI6-2	S38AB_HUMAN;.	D	310;332;363;332	ENSP00000306178:E310D;ENSP00000386272:E332D;ENSP00000387345:E363D;ENSP00000386774:E332D	ENSP00000306178:E310D	E	-	3	2	SLC38A11	165463418	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.788000	0.38714	0.366000	0.24427	0.379000	0.24179	GAA	-	HMMPfam_Aa_trans		0.413	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A11	protein_coding	OTTHUMT00000333390.1	T	NM_173512		165463418	-1	no_errors	NM_173512	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ANXA10	11199	genome.wustl.edu	37	4	169098940	169098940	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:169098940C>A	ENST00000359299.3	+	7	716	c.530C>A	c.(529-531)gCa>gAa	p.A177E		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	177						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		GCTCAGGATGCAATGGTAACT	0.468																																																0			4											135.0	127.0	130.0					4																	169098940		2203	4300	6503	169335515	SO:0001583	missense	11199			AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.530C>A	4.37:g.169098940C>A	ENSP00000352248:p.Ala177Glu		169335515	Q96IQ5|Q9UJV4	Missense_Mutation	SNP	superfamily_Annexin,HMMPfam_Annexin,HMMSmart_ANX,PatternScan_ANNEXIN	p.A177E	ENST00000359299.3	37	c.530	CCDS34096.1	4	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602096	0.46423	.	.	ENSG00000109511	ENST00000359299;ENST00000393751	T	0.08634	3.07	5.34	4.5	0.54988	.	0.000000	0.64402	D	0.000001	T	0.36358	0.0964	M	0.91406	3.205	0.53005	D	0.999967	D;D	0.76494	0.958;0.999	P;D	0.79784	0.802;0.993	T	0.48896	-0.8994	10	0.87932	D	0	.	14.2773	0.66189	0.0:0.928:0.0:0.072	.	49;177	Q6ITU8;Q9UJ72	.;ANX10_HUMAN	E	177	ENSP00000352248:A177E	ENSP00000352248:A177E	A	+	2	0	ANXA10	169335515	1.000000	0.71417	0.994000	0.49952	0.009000	0.06853	5.419000	0.66435	1.388000	0.46506	-0.136000	0.14681	GCA	-	superfamily_Annexin,HMMPfam_Annexin		0.468	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA10	protein_coding	OTTHUMT00000364348.2	C	NM_007193		169335515	+1	no_errors	NM_007193	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ATP11B	23200	genome.wustl.edu	37	3	182577091	182577091	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr3:182577091G>A	ENST00000323116.5	+	12	1404	c.1144G>A	c.(1144-1146)Gaa>Aaa	p.E382K		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	382					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			GTATCATGAAGAATCAGATCA	0.323																																																0			3											44.0	42.0	43.0					3																	182577091		2203	4299	6502	184059785	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1144G>A	3.37:g.182577091G>A	ENSP00000321195:p.Glu382Lys		184059785	Q96FN1|Q9UKK7	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_SSF81660	p.E382K	ENST00000323116.5	37	c.1144	CCDS33896.1	3	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303611	0.81136	.	.	ENSG00000058063	ENST00000323116	T	0.71461	-0.57	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	N	0.17248	0.465	0.80722	D	1	B	0.17852	0.024	B	0.19148	0.024	T	0.53078	-0.8489	10	0.42905	T	0.14	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	382	Q9Y2G3	AT11B_HUMAN	K	382	ENSP00000321195:E382K	ENSP00000321195:E382K	E	+	1	0	ATP11B	184059785	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.836000	0.97738	0.655000	0.94253	GAA	-	NULL		0.323	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	protein_coding	OTTHUMT00000350598.1	G	NM_014616		184059785	+1	no_errors	NM_014616	genbank	human	validated	54_36p	missense	SNP	1.000	A
SNX25	83891	genome.wustl.edu	37	4	186278865	186278865	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:186278865G>T	ENST00000504273.1	+	16	2427	c.2133G>T	c.(2131-2133)caG>caT	p.Q711H	SNX25_ENST00000264694.8_Missense_Mutation_p.Q711H|SNX25_ENST00000512853.1_3'UTR			Q9H3E2	SNX25_HUMAN	sorting nexin 25	711					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CCCTCGTTCAGGTCACTTTTG	0.373																																																0			4											160.0	153.0	156.0					4																	186278865		2203	4300	6503	186515859	SO:0001583	missense	83891			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.2133G>T	4.37:g.186278865G>T	ENSP00000426255:p.Gln711His		186515859	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	HMMPfam_PXA,superfamily_Regulat_G_prot_signal_superfam,HMMPfam_RGS,HMMSmart_RGS,superfamily_PX,HMMSmart_PX,HMMPfam_PX,HMMPfam_Nexin_C	p.Q711H	ENST00000504273.1	37	c.2133	CCDS34116.1	4	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805170	0.70682	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.34472	1.36;1.36	5.9	3.88	0.44766	Sorting nexin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	M	0.74546	2.27	0.49687	D	0.999814	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.992;0.999	T	0.51568	-0.8689	10	0.30854	T	0.27	-18.1578	6.5675	0.22521	0.3522:0.0:0.6478:0.0	.	427;244;711	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	H	711;711;244	ENSP00000426255:Q711H;ENSP00000264694:Q711H	ENSP00000264693:Q244H	Q	+	3	2	SNX25	186515859	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.493000	0.45320	1.515000	0.48885	0.655000	0.94253	CAG	-	HMMPfam_Nexin_C		0.373	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX25	protein_coding	OTTHUMT00000360756.1	G	NM_031953		186515859	+1	no_errors	NM_031953	genbank	human	validated	54_36p	missense	SNP	1.000	T
FRG1	2483	genome.wustl.edu	37	4	190878564	190878564	+	Silent	SNP	T	T	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:190878564T>A	ENST00000226798.4	+	6	666	c.444T>A	c.(442-444)gcT>gcA	p.A148A	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	148					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GGAAAATGGCTTTGTTGGCCT	0.368																																																0			4											12.0	17.0	16.0					4																	190878564		2131	4257	6388	191115558	SO:0001819	synonymous_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.444T>A	4.37:g.190878564T>A			191115558	A8K775	Silent	SNP	PatternScan_LIPOCALIN,superfamily_Actin-crosslinking proteins,HMMPfam_FRG1	p.A148	ENST00000226798.4	37	c.444	CCDS34121.1	4																																																																																			-	superfamily_Actin-crosslinking proteins,HMMPfam_FRG1		0.368	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	protein_coding	OTTHUMT00000359622.4	T	NM_004477		191115558	+1	no_errors	NM_004477	genbank	human	reviewed	54_36p	silent	SNP	0.986	A
TUBB7P	56604	genome.wustl.edu	37	4	190904329	190904329	+	IGR	SNP	G	G	T			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr4:190904329G>T								FRG1 (19970 upstream) : RNA5SP174 (31963 downstream)																							AGGTGGGTGTGGGCAGTTTTA	0.542																																																0			4											14.0	21.0	19.0					4																	190904329		1888	4034	5922	191141323	SO:0001628	intergenic_variant	56604																															4.37:g.190904329G>T			191141323		Silent	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.P218		37	c.654		4																																																																																			-	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin	0	0.542					TUBB4Q			G			191141323	-1	no_start_codon	NM_020040	genbank	human	validated	54_36p	silent	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	1	210438941	210438941	+	IGR	SNP	C	C	G	rs560617285		TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:210438941C>G								SERTAD4 (19341 upstream) : HHAT (62654 downstream)																							ATGTAGGTTGCTTTCCCTTCA	0.418																																																0			1																																								208505564	SO:0001628	intergenic_variant	0																															1.37:g.210438941C>G			208505564		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.418					LOC100131961			C			208505564	-1	pseudogene	XR_036984	genbank	human	model	54_36p	rna	SNP	0.174	G
IRS1	3667	genome.wustl.edu	37	2	227660565	227660565	+	Silent	SNP	T	T	G			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:227660565T>G	ENST00000305123.5	-	1	3910	c.2890A>C	c.(2890-2892)Aga>Cga	p.R964R	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	964					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGCCCAGTCTGCCCATCTCG	0.647																																																0			2											44.0	50.0	48.0					2																	227660565		2203	4299	6502	227368809	SO:0001819	synonymous_variant	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2890A>C	2.37:g.227660565T>G			227368809		Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_IRS,HMMSmart_PTBI	p.R964	ENST00000305123.5	37	c.2890	CCDS2463.1	2																																																																																			-	NULL		0.647	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	T	NM_005544		227368809	-1	no_errors	NM_005544	genbank	human	validated	54_36p	silent	SNP	0.865	G
ARMC9	80210	genome.wustl.edu	37	2	232079714	232079714	+	Splice_Site	SNP	G	G	C			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr2:232079714G>C	ENST00000349938.4	+	4	542	c.348G>C	c.(346-348)ccG>ccC	p.P116P	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	116						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TGGGGAGACCGGTGGGTTTAC	0.498																																																0			2											84.0	87.0	86.0					2																	232079714		2203	4300	6503	231787958	SO:0001630	splice_region_variant	80210			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.348+1G>C	2.37:g.232079714G>C			231787958	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	HMMSmart_LisH,superfamily_ARM-type_fold	p.P116	ENST00000349938.4	37	c.348	CCDS2484.1	2																																																																																			-	superfamily_ARM-type_fold		0.498	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	protein_coding	OTTHUMT00000256966.3	G	NM_025139	Silent	231787958	+1	no_errors	NM_025139	genbank	human	validated	54_36p	silent	SNP	0.975	C
OR14I1	401994	genome.wustl.edu	37	1	248844847	248844847	+	Silent	SNP	C	C	A			TCGA-23-2645-01A-01W-1091-09	TCGA-23-2645-10A-01W-1091-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1e852b4-62ce-4cfb-a0cf-9b90a7b7cbcb	63b76f9b-0709-46a2-808b-3467077a1de2	g.chr1:248844847C>A	ENST00000342623.3	-	1	782	c.759G>T	c.(757-759)ggG>ggT	p.G253G		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						CAGCAAAGAGCCCTGTGGTAA	0.493																																																0			1											107.0	99.0	102.0					1																	248844847		2203	4300	6503	246911470	SO:0001819	synonymous_variant	401994				CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.759G>T	1.37:g.248844847C>A			246911470		Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G253	ENST00000342623.3	37	c.759	CCDS31125.1	1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.493	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14I1	protein_coding	OTTHUMT00000097128.1	C	NM_001004734		246911470	-1	no_errors	NM_001004734	genbank	human	provisional	54_36p	silent	SNP	0.000	A
