#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MUC6	4588	genome.wustl.edu	37	11	1016960	1016960	+	Silent	SNP	G	G	T	rs113980831		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:1016960G>T	ENST00000421673.2	-	31	5891	c.5841C>A	c.(5839-5841)acC>acA	p.T1947T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1947	Approximate repeats.|Thr-rich.			NITPKHTSTGTRTPV -> KITTNPTSIGSSTPM (in Ref. 5; AAA35866). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGGGTTCTGGTGCCTGTAC	0.572																																																0			11											516.0	536.0	529.0					11																	1016960		2200	4292	6492	1006960	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5841C>A	11.37:g.1016960G>T			1006960	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00215,HMMSmart_SM00041	p.T1947	ENST00000421673.2	37	c.5841	CCDS44513.1	11																																																																																			-	NULL		0.572	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	protein_coding	OTTHUMT00000382120.2	G	XM_290540		1006960	-1	no_errors	NM_005961	genbank	human	validated	54_36p	silent	SNP	0.002	T
GMDS	2762	genome.wustl.edu	37	6	1930358	1930358	+	Silent	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr6:1930358G>C	ENST00000380815.4	-	7	1019	c.750C>G	c.(748-750)ggC>ggG	p.G250G	GMDS_ENST00000530927.1_Silent_p.G220G	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	250					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		CCTTGGCATGGCCCCAATCTC	0.413																																																0			6											152.0	131.0	138.0					6																	1930358		2203	4300	6503	1875357	SO:0001819	synonymous_variant	2762			AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.750C>G	6.37:g.1930358G>C			1875357	E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Silent	SNP	superfamily_NAD(P)-bd,HMMPfam_Epimerase	p.G250	ENST00000380815.4	37	c.750	CCDS4474.1	6																																																																																			-	superfamily_NAD(P)-bd,HMMPfam_Epimerase		0.413	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GMDS	protein_coding	OTTHUMT00000043380.3	G			1875357	-1	no_errors	NM_001500	genbank	human	validated	54_36p	silent	SNP	1.000	C
FOXM1	2305	genome.wustl.edu	37	12	2968344	2968344	+	Silent	SNP	A	A	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr12:2968344A>G	ENST00000359843.3	-	9	1820	c.1752T>C	c.(1750-1752)ccT>ccC	p.P584P	FOXM1_ENST00000361953.3_Silent_p.P569P|Y_RNA_ENST00000410561.1_RNA|ITFG2_ENST00000545509.1_Intron|AC005841.1_ENST00000382678.3_5'Flank|FOXM1_ENST00000342628.2_Silent_p.P622P	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	584					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GCTGGGAGGCAGGGTCAGAGG	0.612																																																0			12											42.0	48.0	46.0					12																	2968344		2196	4290	6486	2838605	SO:0001819	synonymous_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1752T>C	12.37:g.2968344A>G			2838605	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.P622	ENST00000359843.3	37	c.1866	CCDS8515.1	12																																																																																			-	NULL		0.612	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	protein_coding	OTTHUMT00000398272.1	A	NM_021953		2838605	-1	no_errors	NM_202002	genbank	human	validated	54_36p	silent	SNP	0.014	G
FGF23	8074	genome.wustl.edu	37	12	4479675	4479675	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr12:4479675G>T	ENST00000237837.1	-	3	735	c.590C>A	c.(589-591)gCc>gAc	p.A197D		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	197					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.A197V(1)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			GGTCATCCGGGCCCGGGGCTT	0.687																																																1	Substitution - Missense(1)	skin(1)	12											16.0	20.0	19.0					12																	4479675		2191	4291	6482	4349936	SO:0001583	missense	8074			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.590C>A	12.37:g.4479675G>T	ENSP00000237837:p.Ala197Asp		4349936	Q4V758	Missense_Mutation	SNP	PatternScan_HBGF_FGF,superfamily_Cytok_IL1_like,HMMSmart_FGF,HMMPfam_FGF	p.A197D	ENST00000237837.1	37	c.590	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	G	0.692	-0.794072	0.02862	.	.	ENSG00000118972	ENST00000237837	D	0.94280	-3.39	4.84	2.02	0.26589	.	0.835496	0.11122	N	0.597373	D	0.84428	0.5470	N	0.19112	0.55	0.09310	N	1	B	0.17465	0.022	B	0.12837	0.008	T	0.67043	-0.5770	10	0.06891	T	0.86	-10.1763	8.2474	0.31698	0.2528:0.0:0.7472:0.0	.	197	Q9GZV9	FGF23_HUMAN	D	197	ENSP00000237837:A197D	ENSP00000237837:A197D	A	-	2	0	FGF23	4349936	0.992000	0.36948	0.224000	0.23877	0.010000	0.07245	0.581000	0.23819	0.244000	0.21351	-0.272000	0.10252	GCC	-	NULL		0.687	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	protein_coding	OTTHUMT00000398936.1	G			4349936	-1	no_errors	NM_020638	genbank	human	reviewed	54_36p	missense	SNP	0.250	T
NLGN4X	57502	genome.wustl.edu	37	X	6069176	6069176	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chrX:6069176G>A	ENST00000381095.3	-	2	959	c.332C>T	c.(331-333)cCc>cTc	p.P111L	NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381092.1_Missense_Mutation_p.P111L|NLGN4X_ENST00000275857.6_Missense_Mutation_p.P111L|NLGN4X_ENST00000538097.1_Missense_Mutation_p.P111L|NLGN4X_ENST00000381093.2_Missense_Mutation_p.P111L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	111					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CAGGTGCTGGGGGCACACAGC	0.522																																																0			X											121.0	103.0	109.0					X																	6069176		2203	4300	6503	6079176	SO:0001583	missense	57502			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.332C>T	X.37:g.6069176G>A	ENSP00000370485:p.Pro111Leu		6079176	Q6UX10|Q9ULG0	Missense_Mutation	SNP	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.P111L	ENST00000381095.3	37	c.332	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208489	0.58343	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	4.09	4.09	0.47781	Carboxylesterase, type B (1);	.	.	.	.	T	0.77184	0.4093	L	0.58428	1.81	0.80722	D	1	P;D;D	0.89917	0.938;1.0;0.996	P;D;P	0.97110	0.759;1.0;0.886	T	0.75107	-0.3434	9	0.27785	T	0.31	.	14.8007	0.69913	0.0:0.0:1.0:0.0	.	111;111;111	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	L	111	ENSP00000370485:P111L;ENSP00000370483:P111L;ENSP00000275857:P111L;ENSP00000370482:P111L;ENSP00000439203:P111L	ENSP00000275857:P111L	P	-	2	0	NLGN4X	6079176	1.000000	0.71417	0.868000	0.34077	0.161000	0.22273	8.047000	0.89440	1.660000	0.50760	0.600000	0.82982	CCC	-	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases		0.522	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	protein_coding	OTTHUMT00000055673.1	G	NM_020742		6079176	-1	no_errors	NM_020742	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LPCAT3	10162	genome.wustl.edu	37	12	7087774	7087774	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr12:7087774C>G	ENST00000261407.4	-	8	949	c.864G>C	c.(862-864)tgG>tgC	p.W288C	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'UTR	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	288					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						CTGTGACCAGCCAACAGGTGA	0.498																																																0			12											103.0	95.0	98.0					12																	7087774		2203	4300	6503	6958035	SO:0001583	missense	10162			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.864G>C	12.37:g.7087774C>G	ENSP00000261407:p.Trp288Cys		6958035	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	HMMPfam_MBOAT	p.W288C	ENST00000261407.4	37	c.864	CCDS8572.1	12	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320683	0.81469	.	.	ENSG00000111684	ENST00000261407	T	0.73363	-0.74	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.89726	0.6798	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91518	0.5232	10	0.87932	D	0	-10.4171	19.5899	0.95506	0.0:1.0:0.0:0.0	.	288	Q6P1A2	MBOA5_HUMAN	C	288	ENSP00000261407:W288C	ENSP00000261407:W288C	W	-	3	0	LPCAT3	6958035	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.376000	0.79658	2.612000	0.88384	0.655000	0.94253	TGG	-	HMMPfam_MBOAT		0.498	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	protein_coding	OTTHUMT00000401812.1	C	NM_005768		6958035	-1	no_errors	NM_005768	genbank	human	validated	54_36p	missense	SNP	1.000	G
NLRP14	338323	genome.wustl.edu	37	11	7091590	7091590	+	Missense_Mutation	SNP	A	A	C	rs199475889		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:7091590A>C	ENST00000299481.4	+	11	3395	c.3049A>C	c.(3049-3051)Ata>Cta	p.I1017L		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	1017					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CAAAAGACTGATAAAAATGAA	0.363																																																0			11											101.0	100.0	100.0					11																	7091590		2201	4296	6497	7048166	SO:0001583	missense	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.3049A>C	11.37:g.7091590A>C	ENSP00000299481:p.Ile1017Leu		7048166	Q7RTR6	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_NACHT,superfamily_SSF52047	p.I1017L	ENST00000299481.4	37	c.3049	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	A	8.646	0.897225	0.17686	.	.	ENSG00000158077	ENST00000299481	T	0.41065	1.01	4.13	1.83	0.25207	.	0.841768	0.10382	N	0.681446	T	0.32315	0.0825	L	0.41961	1.31	0.19300	N	0.999979	B	0.12013	0.005	B	0.08055	0.003	T	0.26780	-1.0093	10	0.48119	T	0.1	.	5.5578	0.17125	0.7776:0.0:0.2224:0.0	.	1017	Q86W24	NAL14_HUMAN	L	1017	ENSP00000299481:I1017L	ENSP00000299481:I1017L	I	+	1	0	NLRP14	7048166	0.545000	0.26449	0.046000	0.18839	0.087000	0.18053	0.901000	0.28445	0.404000	0.25506	0.455000	0.32223	ATA	-	superfamily_SSF52047		0.363	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	protein_coding	OTTHUMT00000384551.1	A	NM_176822		7048166	+1	no_errors	NM_176822	genbank	human	reviewed	54_36p	missense	SNP	0.159	C
RBFOX1	54715	genome.wustl.edu	37	16	7383021	7383021	+	Intron	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr16:7383021G>T	ENST00000550418.1	+	5	1015				RBFOX1_ENST00000340209.4_5'UTR|RBFOX1_ENST00000422070.4_Intron|RBFOX1_ENST00000535565.2_Intron|RBFOX1_ENST00000553186.1_Intron|RBFOX1_ENST00000436368.2_Missense_Mutation_p.V7F|RBFOX1_ENST00000311745.5_Missense_Mutation_p.V7F|RBFOX1_ENST00000355637.4_Missense_Mutation_p.V7F|RBFOX1_ENST00000552089.1_Intron|RBFOX1_ENST00000547338.1_Intron|RBFOX1_ENST00000547372.1_Intron	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1						mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GTCTCAAGGAGTTCTCCTGCA	0.478																																					Ovarian(157;934 2567 15163 39509)											0			16											232.0	188.0	203.0					16																	7383021		2197	4300	6497	7323022	SO:0001627	intron_variant	54715			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.28-185128G>T	16.37:g.7383021G>T			7323022	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.V7F	ENST00000550418.1	37	c.19	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340592	0.41498	.	.	ENSG00000078328	ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951	T;T;T	0.32988	1.43;1.63;1.59	5.75	4.77	0.60923	.	0.773898	0.11888	N	0.519903	T	0.17619	0.0423	N	0.14661	0.345	0.80722	D	1	B;B;P;B	0.43701	0.275;0.403;0.815;0.403	B;B;B;B	0.37047	0.082;0.112;0.24;0.112	T	0.02676	-1.1125	10	0.87932	D	0	-5.5015	7.2681	0.26242	0.1417:0.1437:0.7147:0.0	.	7;7;7;7	F8WAC5;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5	.;.;.;.	F	7	ENSP00000402745:V7F;ENSP00000309117:V7F;ENSP00000347855:V7F	ENSP00000309117:V7F	V	+	1	0	RBFOX1	7323022	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.325000	0.43840	1.375000	0.46248	0.650000	0.86243	GTT	-	NULL		0.478	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	A2BP1	protein_coding	OTTHUMT00000409492.2	G	NM_145891		7323022	+1	no_errors	NM_145891	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
C16orf72	29035	genome.wustl.edu	37	16	9186847	9186847	+	Missense_Mutation	SNP	A	A	G	rs374431071		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr16:9186847A>G	ENST00000327827.7	+	2	693	c.296A>G	c.(295-297)aAt>aGt	p.N99S		NM_014117.2	NP_054836.2	Q14CZ0	CP072_HUMAN	chromosome 16 open reading frame 72	99										endometrium(4)|large_intestine(2)|lung(2)	8						GCCGTCACCAATCTCTACAAA	0.522																																																0			16						A	SER/ASN	0,4394		0,0,2197	44.0	39.0	41.0		296	1.8	1.0	16		41	1,8599	1.2+/-3.3	0,1,4299	no	missense	C16orf72	NM_014117.2	46	0,1,6496	GG,GA,AA		0.0116,0.0,0.0077	benign	99/276	9186847	1,12993	2197	4300	6497	9094348	SO:0001583	missense	29035			AK123266	CCDS10538.1	16p13.2	2012-11-19			ENSG00000182831	ENSG00000182831			30103	protein-coding gene	gene with protein product						8889548	Standard	NM_014117		Approved	FLJ41272, PRO0149	uc002czm.3	Q14CZ0	OTTHUMG00000178147	ENST00000327827.7:c.296A>G	16.37:g.9186847A>G	ENSP00000331720:p.Asn99Ser		9094348		Missense_Mutation	SNP	NULL	p.N99S	ENST00000327827.7	37	c.296	CCDS10538.1	16	.	.	.	.	.	.	.	.	.	.	A	9.574	1.121799	0.20877	0.0	1.16E-4	ENSG00000182831	ENST00000327827	T	0.37235	1.21	4.09	1.84	0.25277	.	0.045909	0.85682	D	0.000000	T	0.11623	0.0283	N	0.02960	-0.455	0.53688	D	0.999979	B	0.09022	0.002	B	0.09377	0.004	T	0.30880	-0.9963	10	0.02654	T	1	-1.6693	7.9382	0.29941	0.829:0.0:0.171:0.0	.	99	Q14CZ0	CP072_HUMAN	S	99	ENSP00000331720:N99S	ENSP00000331720:N99S	N	+	2	0	C16orf72	9094348	1.000000	0.71417	0.991000	0.47740	0.954000	0.61252	8.938000	0.92943	0.167000	0.19631	-0.250000	0.11733	AAT	-	NULL		0.522	C16orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf72	protein_coding	OTTHUMT00000440760.2	A	NM_014117		9094348	+1	no_errors	NM_014117	genbank	human	validated	54_36p	missense	SNP	1.000	G
COL5A3	50509	genome.wustl.edu	37	19	10116775	10116775	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr19:10116775C>G	ENST00000264828.3	-	2	306	c.221G>C	c.(220-222)gGc>gCc	p.G74A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	74	Laminin G-like.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CGTGGGGATGCCGAGCGTGCT	0.667																																																0			19											37.0	35.0	35.0					19																	10116775		2203	4300	6503	9977775	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.221G>C	19.37:g.10116775C>G	ENSP00000264828:p.Gly74Ala		9977775	Q9NZQ6	Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.G74A	ENST00000264828.3	37	c.221	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	8.670	0.902673	0.17760	.	.	ENSG00000080573	ENST00000264828	T	0.02140	4.43	4.13	4.13	0.48395	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.199950	0.41500	U	0.000871	T	0.03783	0.0107	L	0.59436	1.845	0.09310	N	1	B	0.23591	0.088	B	0.24701	0.055	T	0.21314	-1.0249	10	0.66056	D	0.02	.	11.7741	0.51975	0.0:1.0:0.0:0.0	.	74	P25940	CO5A3_HUMAN	A	74	ENSP00000264828:G74A	ENSP00000264828:G74A	G	-	2	0	COL5A3	9977775	0.114000	0.22134	0.003000	0.11579	0.036000	0.12997	2.576000	0.46033	2.151000	0.67156	0.462000	0.41574	GGC	-	HMMSmart_SM00210		0.667	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	C	NM_015719		9977775	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	missense	SNP	0.433	G
ICAM5	7087	genome.wustl.edu	37	19	10404451	10404451	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr19:10404451G>C	ENST00000221980.4	+	7	1606	c.1543G>C	c.(1543-1545)Gtg>Ctg	p.V515L		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	515	Ig-like C2-type 6.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GCTGAGCTGTGTGGCGCACGG	0.652																																																0			19											85.0	86.0	85.0					19																	10404451		2203	4300	6503	10265451	SO:0001583	missense	7087			U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1543G>C	19.37:g.10404451G>C	ENSP00000221980:p.Val515Leu		10265451	Q9Y6F3	Missense_Mutation	SNP	HMMPfam_ICAM_N,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set	p.V515L	ENST00000221980.4	37	c.1543	CCDS12233.1	19	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215907	0.58452	.	.	ENSG00000105376	ENST00000221980	T	0.12039	2.72	4.85	3.76	0.43208	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.985596	0.08248	N	0.974998	T	0.14485	0.0350	N	0.16016	0.355	0.28119	N	0.930677	P	0.48407	0.91	P	0.51806	0.68	T	0.13818	-1.0495	10	0.34782	T	0.22	-26.6001	10.1831	0.42980	0.0:0.2195:0.7805:0.0	.	515	Q9UMF0	ICAM5_HUMAN	L	515	ENSP00000221980:V515L	ENSP00000221980:V515L	V	+	1	0	ICAM5	10265451	0.966000	0.33281	0.995000	0.50966	0.233000	0.25261	2.001000	0.40825	2.528000	0.85240	0.448000	0.29417	GTG	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.652	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM5	protein_coding	OTTHUMT00000451217.1	G	NM_003259		10265451	+1	no_errors	NM_003259	genbank	human	reviewed	54_36p	missense	SNP	0.333	C
C3orf20	84077	genome.wustl.edu	37	3	14769977	14769977	+	Missense_Mutation	SNP	G	G	C	rs144355189		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr3:14769977G>C	ENST00000253697.3	+	12	2174	c.1722G>C	c.(1720-1722)aaG>aaC	p.K574N	C3orf20_ENST00000435614.1_Missense_Mutation_p.K452N|C3orf20_ENST00000412910.1_Missense_Mutation_p.K452N	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	574						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CCACCAAAAAGGAGGAGGAAG	0.473																																																0			3						G	ASN/LYS,ASN/LYS,ASN/LYS	0,4406		0,0,2203	79.0	80.0	80.0		1356,1356,1722	-4.7	0.0	3	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	C3orf20	NM_001184957.1,NM_001184958.1,NM_032137.4	94,94,94	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign,benign,benign	452/783,452/783,574/905	14769977	1,13005	2203	4300	6503	14744981	SO:0001583	missense	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1722G>C	3.37:g.14769977G>C	ENSP00000253697:p.Lys574Asn		14744981	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	NULL	p.K574N	ENST00000253697.3	37	c.1722	CCDS33706.1	3	.	.	.	.	.	.	.	.	.	.	G	6.931	0.541528	0.13250	0.0	1.16E-4	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.10288	3.18;2.89;2.89	3.3	-4.71	0.03279	.	1.696370	0.03486	N	0.215871	T	0.09423	0.0232	L	0.36672	1.1	0.09310	N	1	B;B	0.30281	0.026;0.275	B;B	0.33196	0.017;0.159	T	0.31081	-0.9956	10	0.51188	T	0.08	-0.0763	5.5295	0.16976	0.5025:0.2802:0.2173:0.0	.	452;574	Q8ND61-2;Q8ND61	.;CC020_HUMAN	N	574;452;452	ENSP00000253697:K574N;ENSP00000402933:K452N;ENSP00000396081:K452N	ENSP00000253697:K574N	K	+	3	2	C3orf20	14744981	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.154000	0.16343	-1.318000	0.02289	-2.786000	0.00116	AAG	-	NULL		0.473	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	protein_coding	OTTHUMT00000340586.1	G	NM_032137		14744981	+1	no_errors	NM_032137	genbank	human	predicted	54_36p	missense	SNP	0.000	C
MRGPRX3	117195	genome.wustl.edu	37	11	18159377	18159377	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:18159377C>A	ENST00000396275.2	+	3	989	c.628C>A	c.(628-630)Ccg>Acg	p.P210T		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CCGGAAGATGCCGCTGACCAG	0.547																																																0			11											113.0	106.0	108.0					11																	18159377		2200	4293	6493	18115953	SO:0001583	missense	117195				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.628C>A	11.37:g.18159377C>A	ENSP00000379571:p.Pro210Thr		18115953	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P210T	ENST00000396275.2	37	c.628	CCDS7830.1	11	.	.	.	.	.	.	.	.	.	.	C	9.981	1.228176	0.22542	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.36699	1.24;1.24	1.46	0.326	0.15908	GPCR, rhodopsin-like superfamily (1);	0.845766	0.10294	N	0.692007	T	0.57592	0.2064	M	0.88640	2.97	0.09310	N	1	D	0.76494	0.999	D	0.76071	0.987	T	0.43814	-0.9368	10	0.56958	D	0.05	.	1.9069	0.03279	0.3259:0.4559:0.0:0.2181	.	210	Q96LB0	MRGX3_HUMAN	T	210	ENSP00000379571:P210T;ENSP00000436242:P210T	ENSP00000379571:P210T	P	+	1	0	MRGPRX3	18115953	0.010000	0.17322	0.003000	0.11579	0.001000	0.01503	2.415000	0.44635	0.095000	0.17434	0.430000	0.28490	CCG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.547	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	protein_coding	OTTHUMT00000389767.1	C	NM_054031		18115953	+1	no_errors	NM_054031	genbank	human	provisional	54_36p	missense	SNP	0.001	A
OR4K17	390436	genome.wustl.edu	37	14	20586281	20586281	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr14:20586281T>A	ENST00000315543.4	+	1	716	c.716T>A	c.(715-717)cTg>cAg	p.L239Q		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		ATAATCTCCCTGAGCTGTTTC	0.413																																																0			14											164.0	156.0	159.0					14																	20586281		2203	4300	6503	19656121	SO:0001583	missense	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.716T>A	14.37:g.20586281T>A	ENSP00000319197:p.Leu239Gln		19656121	Q6IF12	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L239Q	ENST00000315543.4	37	c.716	CCDS32030.1	14	.	.	.	.	.	.	.	.	.	.	.	10.46	1.355977	0.24598	.	.	ENSG00000176230	ENST00000315543	T	0.45276	0.9	2.86	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.243452	0.19358	U	0.116201	T	0.66297	0.2775	M	0.91406	3.205	0.09310	N	1	D	0.53462	0.96	P	0.62885	0.908	T	0.58989	-0.7538	10	0.87932	D	0	.	10.2538	0.43385	0.0:0.0:0.0:1.0	.	211	Q8NGC6	OR4KH_HUMAN	Q	239	ENSP00000319197:L239Q	ENSP00000319197:L239Q	L	+	2	0	OR4K17	19656121	0.010000	0.17322	0.926000	0.36857	0.211000	0.24417	2.014000	0.40951	1.292000	0.44672	0.332000	0.21555	CTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.413	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K17	protein_coding	OTTHUMT00000410346.1	T			19656121	+1	no_errors	NM_001004715	genbank	human	provisional	54_36p	missense	SNP	0.014	A
PLA2G5	5322	genome.wustl.edu	37	1	20412612	20412612	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:20412612A>G	ENST00000375108.3	+	3	345	c.77A>G	c.(76-78)aAa>aGa	p.K26R	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	26					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)			NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		CTGGACCTAAAATCAATGATC	0.602																																																0			1											107.0	91.0	96.0					1																	20412612		2203	4300	6503	20285199	SO:0001583	missense	5322			U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.77A>G	1.37:g.20412612A>G	ENSP00000364249:p.Lys26Arg		20285199	Q8N435	Missense_Mutation	SNP	superfamily_PhospholipaseA2,HMMPfam_Phospholip_A2_1,HMMSmart_PA2c,PatternScan_PA2_HIS,PatternScan_PA2_ASP	p.K26R	ENST00000375108.3	37	c.77	CCDS202.1	1	.	.	.	.	.	.	.	.	.	.	A	3.518	-0.098420	0.07010	.	.	ENSG00000127472	ENST00000375108	T	0.27557	1.66	5.26	4.14	0.48551	Phospholipase A2 (3);	0.321300	0.26995	N	0.021451	T	0.15305	0.0369	N	0.12853	0.265	0.09310	N	1	B	0.10296	0.003	B	0.18263	0.021	T	0.26360	-1.0105	10	0.15952	T	0.53	-20.3214	8.0773	0.30724	0.9079:0.0:0.0921:0.0	.	26	P39877	PA2G5_HUMAN	R	26	ENSP00000364249:K26R	ENSP00000364249:K26R	K	+	2	0	PLA2G5	20285199	0.002000	0.14202	0.026000	0.17262	0.010000	0.07245	0.302000	0.19192	0.954000	0.37851	0.533000	0.62120	AAA	-	superfamily_PhospholipaseA2,HMMPfam_Phospholip_A2_1,HMMSmart_PA2c		0.602	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G5	protein_coding	OTTHUMT00000007668.1	A	NM_000929		20285199	+1	no_errors	NM_000929	genbank	human	reviewed	54_36p	missense	SNP	0.006	G
PDLIM2	64236	genome.wustl.edu	37	8	22442878	22442878	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr8:22442878G>C	ENST00000397760.4	+	6	906	c.506G>C	c.(505-507)cGc>cCc	p.R169P	PDLIM2_ENST00000409141.1_Missense_Mutation_p.R169P|PDLIM2_ENST00000409417.1_Missense_Mutation_p.R169P|PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000397761.2_Missense_Mutation_p.R169P|PDLIM2_ENST00000339162.7_Missense_Mutation_p.R169P|PDLIM2_ENST00000308354.7_Missense_Mutation_p.R419P|PDLIM2_ENST00000265810.4_Missense_Mutation_p.R169P			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	169						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		GCTGCTGACCGCCTGTCCTAC	0.667																																																0			8											34.0	26.0	29.0					8																	22442878		2202	4300	6502	22498823	SO:0001583	missense	64236			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.506G>C	8.37:g.22442878G>C	ENSP00000380867:p.Arg169Pro		22498823	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	HMMPfam_PDZ,superfamily_PDZ,HMMSmart_PDZ,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM	p.R169P	ENST00000397760.4	37	c.506		8	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009095	0.54361	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000397761;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T	0.25250	2.03;3.54;2.61;2.61;2.61;2.61;1.85;1.81;2.61;2.7;2.61	5.51	-3.19	0.05171	.	0.740175	0.12294	N	0.481829	T	0.23451	0.0567	L	0.56769	1.78	0.09310	N	1	P;B;B;B	0.47604	0.898;0.001;0.001;0.001	P;B;B;B	0.45712	0.491;0.003;0.002;0.002	T	0.15009	-1.0452	10	0.44086	T	0.13	-7.5445	5.3312	0.15934	0.4899:0.2835:0.2266:0.0	.	169;169;169;169	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	P	169;419;169;169;169;169;169;169;169;169;169	ENSP00000401992:R169P;ENSP00000312634:R419P;ENSP00000394376:R169P;ENSP00000380867:R169P;ENSP00000342035:R169P;ENSP00000380868:R169P;ENSP00000392920:R169P;ENSP00000407643:R169P;ENSP00000386868:R169P;ENSP00000265810:R169P;ENSP00000387084:R169P	ENSP00000265810:R169P	R	+	2	0	PDLIM2	22498823	0.000000	0.05858	0.006000	0.13384	0.712000	0.41017	-0.453000	0.06778	-0.211000	0.10124	0.561000	0.74099	CGC	-	NULL		0.667	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	protein_coding	OTTHUMT00000334167.1	G			22498823	+1	no_errors	NM_176871	genbank	human	validated	54_36p	missense	SNP	0.000	C
DDX53	168400	genome.wustl.edu	37	X	23019108	23019108	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chrX:23019108G>A	ENST00000327968.5	+	1	1022	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	312	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GGCTCTTCACGTGGAAGCTGA	0.408													G|||	1	0.000264901	0.0008	0.0	3775	,	,		16112	0.0		0.0	False		,,,				2504	0.0															0			X											74.0	73.0	73.0					X																	23019108		2203	4300	6503	22929029	SO:0001583	missense	168400			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.934G>A	X.37:g.23019108G>A	ENSP00000368667:p.Val312Met		22929029	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	superfamily_SSF54791,HMMSmart_KH,HMMPfam_KH_1,superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C	p.V312M	ENST00000327968.5	37	c.934	CCDS35214.1	X	.	.	.	.	.	.	.	.	.	.	G	9.356	1.066739	0.20067	.	.	ENSG00000184735	ENST00000327968	T	0.05139	3.49	4.3	1.28	0.21552	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.300009	0.31370	N	0.007767	T	0.24586	0.0596	M	0.91920	3.255	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02877	-1.1099	10	0.87932	D	0	-6.7638	4.8973	0.13757	0.2269:0.1801:0.593:0.0	.	312	Q86TM3	DDX53_HUMAN	M	312	ENSP00000368667:V312M	ENSP00000368667:V312M	V	+	1	0	DDX53	22929029	1.000000	0.71417	0.029000	0.17559	0.023000	0.10783	2.224000	0.42945	0.759000	0.33084	0.600000	0.82982	GTG	-	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD		0.408	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX53	protein_coding	OTTHUMT00000056043.1	G	NM_182699		22929029	+1	no_errors	NM_182699	genbank	human	validated	54_36p	missense	SNP	0.913	A
SEZ6L	23544	genome.wustl.edu	37	22	26688766	26688766	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr22:26688766G>T	ENST00000248933.6	+	2	584	c.489G>T	c.(487-489)aaG>aaT	p.K163N	SEZ6L_ENST00000360929.3_Missense_Mutation_p.K163N|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000404234.3_Missense_Mutation_p.K163N|SEZ6L_ENST00000529632.2_Missense_Mutation_p.K163N|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000343706.4_Missense_Mutation_p.K163N			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	163					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCACGGAGAAGCCTGGCCCAC	0.667																																																0			22											42.0	41.0	42.0					22																	26688766		2203	4300	6503	25018766	SO:0001583	missense	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.489G>T	22.37:g.26688766G>T	ENSP00000248933:p.Lys163Asn		25018766	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_CUB	p.K163N	ENST00000248933.6	37	c.489	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121630	0.37436	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.28895	1.83;1.95;2.01;1.84;1.59	3.8	2.78	0.32641	.	0.817322	0.10085	U	0.717887	T	0.26484	0.0647	N	0.08118	0	0.20926	N	0.99983	P;P;D;D;P;P	0.67145	0.933;0.933;0.993;0.996;0.933;0.933	B;B;P;P;B;B	0.58721	0.343;0.343;0.677;0.844;0.343;0.343	T	0.16808	-1.0390	10	0.14656	T	0.56	.	9.9453	0.41604	0.1818:0.0:0.8182:0.0	.	163;163;163;163;163;163	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	N	163	ENSP00000384772:K163N;ENSP00000437037:K163N;ENSP00000354185:K163N;ENSP00000248933:K163N;ENSP00000342661:K163N	ENSP00000248933:K163N	K	+	3	2	SEZ6L	25018766	0.951000	0.32395	0.036000	0.18154	0.002000	0.02628	1.136000	0.31467	0.921000	0.36994	-0.300000	0.09419	AAG	-	NULL		0.667	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	G			25018766	+1	no_errors	NM_021115	genbank	human	validated	54_36p	missense	SNP	0.374	T
ZDHHC18	84243	genome.wustl.edu	37	1	27180284	27180284	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:27180284C>G	ENST00000374142.4	+	8	1212	c.1117C>G	c.(1117-1119)Cca>Gca	p.P373A		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	373					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		AAGCGATGAGCCAGCCTGCAG	0.597											OREG0013274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											196.0	182.0	187.0					1																	27180284		2203	4300	6503	27052871	SO:0001583	missense	84243			AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.1117C>G	1.37:g.27180284C>G	ENSP00000363257:p.Pro373Ala	792	27052871	A6NHY9|B4DQ84|Q5JYH0|Q9H020	Missense_Mutation	SNP	HMMPfam_zf-DHHC	p.P373A	ENST00000374142.4	37	c.1117	CCDS30650.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.034|5.034	0.191872|0.191872	0.09547|0.09547	.|.	.|.	ENSG00000204160|ENSG00000204160	ENST00000488397|ENST00000374142;ENST00000374141	.|T;T	.|0.50001	.|0.95;0.76	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	.|0.531539	.|0.20517	.|N	.|0.090769	T|T	0.42675|0.42675	0.1213|0.1213	N|N	0.24115|0.24115	0.695|0.695	0.45867|0.45867	D|D	0.998722|0.998722	.|D	.|0.56521	.|0.976	.|P	.|0.47603	.|0.551	T|T	0.27571|0.27571	-1.0070|-1.0070	5|10	.|0.30854	.|T	.|0.27	.|.	18.1778|18.1778	0.89767|0.89767	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|373	.|Q9NUE0	.|ZDH18_HUMAN	G|A	137|373;238	.|ENSP00000363257:P373A;ENSP00000363256:P238A	.|ENSP00000363256:P238A	A|P	+|+	2|1	0|0	ZDHHC18|ZDHHC18	27052871|27052871	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.738000|0.738000	0.42128|0.42128	3.678000|3.678000	0.54627|0.54627	2.509000|2.509000	0.84616|0.84616	0.561000|0.561000	0.74099|0.74099	GCC|CCA	-	NULL		0.597	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC18	protein_coding	OTTHUMT00000011706.3	C	NM_032283		27052871	+1	no_errors	NM_032283	genbank	human	provisional	54_36p	missense	SNP	0.972	G
C16orf58	64755	genome.wustl.edu	37	16	31503377	31503377	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr16:31503377T>C	ENST00000327237.2	-	12	1301	c.1262A>G	c.(1261-1263)aAg>aGg	p.K421R	C16orf58_ENST00000567994.1_Missense_Mutation_p.K376R|C16orf58_ENST00000570164.1_Missense_Mutation_p.K419R			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	421						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						GTGTGTCTCCTTGACGACGAC	0.567																																																0			16											95.0	75.0	82.0					16																	31503377		2197	4300	6497	31410878	SO:0001583	missense	64755			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.1262A>G	16.37:g.31503377T>C	ENSP00000317579:p.Lys421Arg		31410878	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	HMMPfam_DUF647	p.K421R	ENST00000327237.2	37	c.1262	CCDS10715.1	16	.	.	.	.	.	.	.	.	.	.	T	4.227	0.041085	0.08196	.	.	ENSG00000140688	ENST00000327237;ENST00000452223	T	0.44083	0.93	4.94	-3.88	0.04205	.	0.816876	0.11866	N	0.521856	T	0.15262	0.0368	N	0.02011	-0.69	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.10450	0.001;0.005	T	0.26849	-1.0091	10	0.15066	T	0.55	-10.6564	12.7517	0.57312	0.0:0.7891:0.0:0.2109	.	421;159	Q96GQ5;Q96GQ5-2	CP058_HUMAN;.	R	421;375	ENSP00000317579:K421R	ENSP00000317579:K421R	K	-	2	0	C16orf58	31410878	0.478000	0.25917	0.681000	0.30009	0.016000	0.09150	-0.641000	0.05434	-0.790000	0.04492	-0.256000	0.11100	AAG	-	HMMPfam_DUF647		0.567	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf58	protein_coding	OTTHUMT00000255629.2	T	NM_022744		31410878	-1	no_errors	NM_022744	genbank	human	predicted	54_36p	missense	SNP	0.131	C
SYNJ1	8867	genome.wustl.edu	37	21	34038437	34038437	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr21:34038437G>A	ENST00000322229.7	-	16	1960	c.1961C>T	c.(1960-1962)gCa>gTa	p.A654V	SYNJ1_ENST00000357345.3_Missense_Mutation_p.A654V|SYNJ1_ENST00000382491.3_Missense_Mutation_p.A649V|SYNJ1_ENST00000433931.2_Missense_Mutation_p.A693V|SYNJ1_ENST00000382499.2_Missense_Mutation_p.A693V			O43426	SYNJ1_HUMAN	synaptojanin 1	654	Catalytic. {ECO:0000255}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AGTATCAACTGCAACATCCCT	0.393																																																0			21											62.0	48.0	53.0					21																	34038437		2203	4300	6503	32960308	SO:0001583	missense	8867			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1961C>T	21.37:g.34038437G>A	ENSP00000322234:p.Ala654Val		32960308	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	HMMPfam_Syja_N,superfamily_DNase I-like,HMMSmart_SM00128,HMMPfam_Exo_endo_phos,HMMPfam_DUF1866,superfamily_RNA-binding domain RBD	p.A654V	ENST00000322229.7	37	c.1961	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	G	31	5.090985	0.94149	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35;-1.35	6.04	5.12	0.69794	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.098210	0.64402	D	0.000002	D	0.88455	0.6441	M	0.67625	2.065	0.80722	D	1	D;B;D;P;P	0.57899	0.981;0.422;0.976;0.87;0.843	D;P;P;P;P	0.64595	0.927;0.491;0.882;0.644;0.609	D	0.89006	0.3425	10	0.87932	D	0	.	18.9861	0.92771	0.0:0.1239:0.8761:0.0	.	649;693;654;654;654	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	V	649;654;693;693;654;649	ENSP00000371931:A649V;ENSP00000349903:A654V;ENSP00000371939:A693V;ENSP00000409667:A693V;ENSP00000322234:A654V;ENSP00000413649:A649V	ENSP00000322234:A654V	A	-	2	0	SYNJ1	32960308	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	7.783000	0.85696	2.873000	0.98535	0.561000	0.74099	GCA	-	superfamily_DNase I-like,HMMSmart_SM00128,HMMPfam_Exo_endo_phos		0.393	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	protein_coding		G			32960308	-1	no_errors	NM_003895	genbank	human	validated	54_36p	missense	SNP	1.000	A
COL8A2	1296	genome.wustl.edu	37	1	36563246	36563246	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:36563246G>A	ENST00000397799.1	-	4	2260	c.2036C>T	c.(2035-2037)tCg>tTg	p.S679L	COL8A2_ENST00000303143.4_Missense_Mutation_p.S679L|COL8A2_ENST00000481785.1_Missense_Mutation_p.S614L			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	679	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCCTGGTCCGACGGCATCTG	0.622																																																0			1											49.0	49.0	49.0					1																	36563246		2203	4300	6503	36335833	SO:0001583	missense	1296			M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.2036C>T	1.37:g.36563246G>A	ENSP00000380901:p.Ser679Leu		36335833	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	HMMPfam_Collagen,HMMSmart_SM00110,superfamily_TNF-like,HMMPfam_C1q	p.S679L	ENST00000397799.1	37	c.2036	CCDS403.1	1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837027	0.91117	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785;ENST00000373172	T;T;T	0.75367	-0.93;-0.93;-0.93	5.05	5.05	0.67936	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	L	0.52573	1.65	0.80722	D	1	D	0.56035	0.974	P	0.56278	0.795	T	0.79848	-0.1630	10	0.44086	T	0.13	.	18.5973	0.91234	0.0:0.0:1.0:0.0	.	679	P25067	CO8A2_HUMAN	L	679;679;614;403	ENSP00000305913:S679L;ENSP00000380901:S679L;ENSP00000436433:S614L	ENSP00000305913:S679L	S	-	2	0	COL8A2	36335833	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.657000	0.98554	2.620000	0.88729	0.563000	0.77884	TCG	-	HMMSmart_SM00110,superfamily_TNF-like,HMMPfam_C1q		0.622	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	COL8A2	protein_coding	OTTHUMT00000313674.1	G	NM_005202		36335833	-1	no_errors	NM_005202	genbank	human	validated	54_36p	missense	SNP	1.000	A
UBTF	7343	genome.wustl.edu	37	17	42288464	42288464	+	Silent	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr17:42288464G>A	ENST00000302904.4	-	12	1638	c.1146C>T	c.(1144-1146)atC>atT	p.I382I	UBTF_ENST00000533177.1_Silent_p.I345I|UBTF_ENST00000343638.5_Silent_p.I345I|UBTF_ENST00000527034.1_Silent_p.I345I|UBTF_ENST00000529383.1_Silent_p.I382I|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000393606.3_Silent_p.I345I|UBTF_ENST00000526094.1_Silent_p.I345I|UBTF_ENST00000436088.1_Silent_p.I382I			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	382					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTTCTTGTTGATGTTCAGCA	0.662																																																0			17											99.0	88.0	92.0					17																	42288464		2203	4300	6503	39643990	SO:0001819	synonymous_variant	7343			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1146C>T	17.37:g.42288464G>A			39643990	A8K6R8	Silent	SNP	superfamily_HMG-box,HMMSmart_SM00398,HMMPfam_HMG_box	p.I382	ENST00000302904.4	37	c.1146	CCDS11480.1	17																																																																																			-	superfamily_HMG-box		0.662	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	protein_coding	OTTHUMT00000395205.1	G	NM_014233		39643990	-1	no_errors	NM_014233	genbank	human	validated	54_36p	silent	SNP	1.000	A
HNRNPA3P1	10151	genome.wustl.edu	37	10	44284932	44284932	+	IGR	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr10:44284932C>A								RP11-272J7.4 (10659 upstream) : LINC00619 (55821 downstream)																							GCCACCATATCCACCACCTTG	0.468																																																0			10																																								43604938	SO:0001628	intergenic_variant	10151																															10.37:g.44284932C>A			43604938		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.468					HNRNPA3P1			C			43604938	-1	pseudogene	NR_002726	genbank	human	validated	54_36p	rna	SNP	0.998	A
SAMD4B	55095	genome.wustl.edu	37	19	39847636	39847636	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr19:39847636C>T	ENST00000314471.6	+	5	1138	c.103C>T	c.(103-105)Cgt>Tgt	p.R35C	SAMD4B_ENST00000598913.1_Missense_Mutation_p.R35C|SAMD4B_ENST00000594204.1_3'UTR|SAMD4B_ENST00000596368.1_Missense_Mutation_p.R35C	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			ACGGGTCACCCGTACCCAGGC	0.602																																																0			19											62.0	47.0	52.0					19																	39847636		2203	4300	6503	44539476	SO:0001583	missense	55095				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.103C>T	19.37:g.39847636C>T	ENSP00000317224:p.Arg35Cys		44539476	A5Z0M6|Q6P194	Missense_Mutation	SNP	HMMSmart_SM00454,HMMPfam_SAM_1,superfamily_SAM/Pointed domain	p.R35C	ENST00000314471.6	37	c.103	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	C	27.9	4.877404	0.91664	.	.	ENSG00000179134	ENST00000314471;ENST00000429637	T	0.32272	1.46	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	M	0.65975	2.015	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	P;P	0.61328	0.887;0.887	T	0.48410	-0.9038	10	0.66056	D	0.02	.	12.5309	0.56115	0.1665:0.8335:0.0:0.0	.	35;35	Q5PRF9;A5Z0M6	SMAG2_HUMAN;.	C	35	ENSP00000317224:R35C	ENSP00000317224:R35C	R	+	1	0	SAMD4B	44539476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.901000	0.69861	2.756000	0.94617	0.563000	0.77884	CGT	-	NULL		0.602	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	protein_coding	OTTHUMT00000464467.1	C	NM_018028		44539476	+1	no_errors	NM_018028	genbank	human	provisional	54_36p	missense	SNP	1.000	T
POLE2	5427	genome.wustl.edu	37	14	50131833	50131833	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr14:50131833T>G	ENST00000216367.5	-	8	724	c.625A>C	c.(625-627)Agt>Cgt	p.S209R	POLE2_ENST00000539565.2_Missense_Mutation_p.S183R|POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000554396.1_Missense_Mutation_p.S209R	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	209					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	ATAGCTTTACTAAGGTCTAGT	0.294																																																0			14											48.0	48.0	48.0					14																	50131833		2200	4291	6491	49201583	SO:0001583	missense	5427			AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.625A>C	14.37:g.50131833T>G	ENSP00000216367:p.Ser209Arg		49201583	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	HMMPfam_DNA_pol_E_B	p.S209R	ENST00000216367.5	37	c.625	CCDS32073.1	14	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704496	0.68615	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.36157	1.68;1.7;1.27	5.28	5.28	0.74379	.	0.324215	0.40908	D	0.000998	T	0.44350	0.1289	M	0.78285	2.405	0.45108	D	0.998125	P	0.40970	0.734	B	0.40101	0.319	T	0.51212	-0.8734	10	0.54805	T	0.06	-11.7366	15.5126	0.75795	0.0:0.0:0.0:1.0	.	209	P56282	DPOE2_HUMAN	R	209;183;209	ENSP00000216367:S209R;ENSP00000446313:S183R;ENSP00000451621:S209R	ENSP00000216367:S209R	S	-	1	0	POLE2	49201583	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.025000	0.70864	2.136000	0.66102	0.454000	0.30748	AGT	-	NULL		0.294	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	POLE2	protein_coding	OTTHUMT00000410512.1	T	NM_002692		49201583	-1	no_errors	NM_002692	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TYMP	1890	genome.wustl.edu	37	22	50966077	50966077	+	Missense_Mutation	SNP	C	C	T	rs367723039		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr22:50966077C>T	ENST00000252029.3	-	5	748	c.586G>A	c.(586-588)Gga>Aga	p.G196R	TYMP_ENST00000395681.1_Missense_Mutation_p.G196R|TYMP_ENST00000395680.1_Missense_Mutation_p.G196R|TYMP_ENST00000395678.3_Missense_Mutation_p.G196R|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000535425.1_5'Flank|SCO2_ENST00000543927.1_5'Flank|SCO2_ENST00000395693.3_5'Flank|SCO2_ENST00000252785.3_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	196					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	TATAGGATTCCGTCCGCAGGA	0.577																																																0			22						C	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	110.0	96.0	101.0		586,586,586	4.1	1.0	22		101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TYMP	NM_001953.3,NM_001113756.1,NM_001113755.1	125,125,125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	196/483,196/483,196/483	50966077	1,13005	2203	4300	6503	49312943	SO:0001583	missense	1890			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.586G>A	22.37:g.50966077C>T	ENSP00000252029:p.Gly196Arg		49312943	A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	superfamily_Glyco_trans_3,HMMPfam_Glycos_trans_3N,HMMPfam_Glycos_transf_3,PatternScan_THYMID_PHOSPHORYLASE,superfamily_PYNP_C,HMMPfam_PYNP_C	p.G196R	ENST00000252029.3	37	c.586	CCDS14096.1	22	.	.	.	.	.	.	.	.	.	.	C	6.167	0.399042	0.11696	0.0	1.16E-4	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678;ENST00000425169	D;D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77;-4.77	5.12	4.1	0.47936	Glycosyl transferase, family 3 (3);	0.305128	0.31427	N	0.007679	D	0.89636	0.6772	N	0.01091	-1.02	0.35265	D	0.779904	B;B;B;B	0.34313	0.448;0.287;0.287;0.287	B;B;B;B	0.28638	0.092;0.029;0.029;0.029	D	0.90880	0.4753	10	0.87932	D	0	-4.7417	6.8759	0.24147	0.0:0.8092:0.0:0.1908	.	196;196;196;196	B4DVR2;B2RBL3;E5KRG5;P19971	.;.;.;TYPH_HUMAN	R	196;196;196;196;163	ENSP00000379037:G196R;ENSP00000379038:G196R;ENSP00000252029:G196R;ENSP00000379036:G196R;ENSP00000395875:G163R	ENSP00000252029:G196R	G	-	1	0	TYMP	49312943	0.137000	0.22531	0.957000	0.39632	0.536000	0.34869	0.791000	0.26915	2.393000	0.81446	0.561000	0.74099	GGA	-	superfamily_Glyco_trans_3,HMMPfam_Glycos_transf_3		0.577	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TYMP	protein_coding	OTTHUMT00000317081.1	C	NM_001953		49312943	-1	no_errors	NM_001953	genbank	human	reviewed	54_36p	missense	SNP	0.883	T
GPR4	2828	genome.wustl.edu	37	19	46094336	46094336	+	Silent	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr19:46094336G>A	ENST00000323040.4	-	2	1733	c.789C>T	c.(787-789)cgC>cgT	p.R263R	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	263					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		CAGAAAAGACGCGCTCCTCGA	0.637																																					Esophageal Squamous(117;181 1612 1673 14956 42937)											0			19											37.0	41.0	40.0					19																	46094336		2203	4300	6503	50786176	SO:0001819	synonymous_variant	2828			BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.789C>T	19.37:g.46094336G>A			50786176	A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R263	ENST00000323040.4	37	c.789	CCDS12669.1	19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.637	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR4	protein_coding	OTTHUMT00000459603.1	G	NM_005282		50786176	-1	no_errors	NM_005282	genbank	human	validated	54_36p	silent	SNP	0.140	A
WDR7	23335	genome.wustl.edu	37	18	54424291	54424291	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr18:54424291C>T	ENST00000254442.3	+	15	2678	c.2467C>T	c.(2467-2469)Cgc>Tgc	p.R823C	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.R823C	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	823					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TTGCCTGGATCGCCTTGGAAT	0.473																																																0			18											197.0	185.0	189.0					18																	54424291		2203	4300	6503	52575289	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2467C>T	18.37:g.54424291C>T	ENSP00000254442:p.Arg823Cys		52575289	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_Prolyl oligopeptidase N-terminal domain,PatternScan_WD_REPEATS_1,superfamily_WD40 repeat-like	p.R823C	ENST00000254442.3	37	c.2467	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051400	0.75960	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.68903	-0.36;-0.35	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.79516	0.4459	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.985;0.99	T	0.79962	-0.1582	10	0.87932	D	0	.	19.7075	0.96079	0.0:1.0:0.0:0.0	.	823;823	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	C	823;823;148;823	ENSP00000254442:R823C;ENSP00000350187:R823C	ENSP00000254442:R823C	R	+	1	0	WDR7	52575289	1.000000	0.71417	0.998000	0.56505	0.846000	0.48090	5.795000	0.69074	2.749000	0.94314	0.655000	0.94253	CGC	-	NULL		0.473	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	protein_coding	OTTHUMT00000256062.1	C			52575289	+1	no_errors	NM_015285	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SEPT14	346288	genome.wustl.edu	37	7	55863655	55863655	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:55863655T>G	ENST00000388975.3	-	10	1366	c.1250A>C	c.(1249-1251)cAg>cCg	p.Q417P		NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	417					cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAGCTGAGTCTGCAGTGCTTC	0.393																																																0			7											75.0	95.0	88.0					7																	55863655		1373	2318	3691	55831149	SO:0001583	missense	346288			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.1250A>C	7.37:g.55863655T>G	ENSP00000373627:p.Gln417Pro		55831149	A6NCC2|B4DXD6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Septin	p.Q417P	ENST00000388975.3	37	c.1250	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	.	9.821	1.185777	0.21870	.	.	ENSG00000154997	ENST00000388975	D	0.82619	-1.63	1.32	-0.00979	0.13999	.	1.204540	0.06461	N	0.729379	T	0.78110	0.4232	L	0.55103	1.725	0.21579	N	0.999636	B	0.17852	0.024	B	0.19666	0.026	T	0.63910	-0.6530	10	0.62326	D	0.03	.	5.3994	0.16286	0.0:0.0:0.2897:0.7103	.	417	Q6ZU15	SEP14_HUMAN	P	417	ENSP00000373627:Q417P	ENSP00000373627:Q417P	Q	-	2	0	SEPT14	55831149	0.997000	0.39634	0.003000	0.11579	0.458000	0.32498	2.587000	0.46128	0.000000	0.14550	0.248000	0.18094	CAG	-	NULL		0.393	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	protein_coding	OTTHUMT00000251489.2	T	NM_207366		55831149	-1	no_errors	NM_207366	genbank	human	validated	54_36p	missense	SNP	0.064	G
OR5M9	390162	genome.wustl.edu	37	11	56230434	56230434	+	Silent	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:56230434G>C	ENST00000279791.1	-	1	443	c.444C>G	c.(442-444)gtC>gtG	p.V148V		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					AGAATCCATAGACATAAGGCA	0.453																																																0			11											99.0	100.0	100.0					11																	56230434		2201	4296	6497	55987010	SO:0001819	synonymous_variant	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.444C>G	11.37:g.56230434G>C			55987010	Q6IEW5|Q96RB9	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.V148	ENST00000279791.1	37	c.444	CCDS31531.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.453	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	protein_coding	OTTHUMT00000391638.1	G	NM_001004743		55987010	-1	no_errors	NM_001004743	genbank	human	provisional	54_36p	silent	SNP	0.015	C
EXOC3L1	283849	genome.wustl.edu	37	16	67222695	67222695	+	Missense_Mutation	SNP	G	G	A	rs141404625		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr16:67222695G>A	ENST00000314586.6	-	4	596	c.356C>T	c.(355-357)cCc>cTc	p.P119L	EXOC3L1_ENST00000562887.1_Intron	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	119	Mediates interaction with EXOC2, EXOC4 and EXOC5. {ECO:0000250}.				exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CTCCCGTAGGGGCTCTAGAGT	0.682																																																0			16						G	LEU/PRO	0,4396		0,0,2198	45.0	47.0	46.0		356	5.7	0.7	16	dbSNP_134	46	1,8599	1.2+/-3.3	0,1,4299	no	missense	EXOC3L1	NM_178516.3	98	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	119/747	67222695	1,12995	2198	4300	6498	65780196	SO:0001583	missense	283849			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.356C>T	16.37:g.67222695G>A	ENSP00000325674:p.Pro119Leu		65780196	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	HMMPfam_Sec6	p.P119L	ENST00000314586.6	37	c.356	CCDS10832.1	16	.	.	.	.	.	.	.	.	.	.	G	8.864	0.947730	0.18356	0.0	1.16E-4	ENSG00000179044	ENST00000314586	T	0.07908	3.15	5.71	5.71	0.89125	.	0.470758	0.22816	N	0.055285	T	0.12050	0.0293	M	0.70595	2.14	0.35772	D	0.820971	P	0.35077	0.483	B	0.32864	0.154	T	0.12967	-1.0527	10	0.25751	T	0.34	-9.7261	14.1929	0.65649	0.0:0.0:0.8499:0.1501	.	119	Q86VI1	EX3L1_HUMAN	L	119	ENSP00000325674:P119L	ENSP00000325674:P119L	P	-	2	0	EXOC3L1	65780196	1.000000	0.71417	0.747000	0.31113	0.092000	0.18411	1.986000	0.40677	2.680000	0.91292	0.655000	0.94253	CCC	-	NULL		0.682	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L	protein_coding	OTTHUMT00000268827.2	G	NM_178516		65780196	-1	no_errors	NM_178516	genbank	human	validated	54_36p	missense	SNP	0.702	A
ANKRA2	57763	genome.wustl.edu	37	5	72857055	72857055	+	Silent	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr5:72857055G>C	ENST00000296785.3	-	3	1006	c.348C>G	c.(346-348)acC>acG	p.T116T		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	116						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		TTGTAGAGGGGGTGTAGACAT	0.388																																																0			5											265.0	236.0	246.0					5																	72857055		2203	4300	6503	72892811	SO:0001819	synonymous_variant	57763			AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.348C>G	5.37:g.72857055G>C			72892811		Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.T116	ENST00000296785.3	37	c.348	CCDS4020.1	5																																																																																			-	NULL		0.388	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRA2	protein_coding	OTTHUMT00000219814.2	G	NM_023039		72892811	-1	no_errors	NM_023039	genbank	human	provisional	54_36p	silent	SNP	0.982	C
AAMDC	28971	genome.wustl.edu	37	11	77553635	77553635	+	Silent	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:77553635G>T	ENST00000526415.1	+	3	266	c.93G>T	c.(91-93)ggG>ggT	p.G31G	AAMDC_ENST00000525034.1_Silent_p.G50G|AAMDC_ENST00000527134.1_Silent_p.G31G|AAMDC_ENST00000525409.1_Silent_p.G31G|AAMDC_ENST00000533193.1_Silent_p.G31G|AAMDC_ENST00000304716.8_Silent_p.G31G|AAMDC_ENST00000532481.1_Silent_p.G31G|RP11-91P24.7_ENST00000525594.1_RNA|AAMDC_ENST00000393427.2_Silent_p.G31G			Q9H7C9	AAMDC_HUMAN	adipogenesis associated, Mth938 domain containing	31	MTH138-like domain. {ECO:0000250}.				negative regulation of apoptotic process (GO:0043066)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)											TATGGCCAGGGGGTAGTCGGA	0.428																																																0			11											70.0	68.0	69.0					11																	77553635		2200	4292	6492	77231283	SO:0001819	synonymous_variant	28971			BC016854	CCDS8254.1	11q14.1	2012-10-08	2012-10-08	2012-10-08	ENSG00000087884	ENSG00000087884			30205	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 67"""	C11orf67		12477932	Standard	NM_024684		Approved	PTD015, FLJ21035, CK067	uc001oyq.3	Q9H7C9	OTTHUMG00000166651	ENST00000526415.1:c.93G>T	11.37:g.77553635G>T			77231283	Q96AQ4|Q9Y6B1	Silent	SNP	superfamily_Hypothetical protein MT938 (MTH938),HMMPfam_DUF498	p.G31	ENST00000526415.1	37	c.93	CCDS8254.1	11																																																																																			-	superfamily_Hypothetical protein MT938 (MTH938),HMMPfam_DUF498		0.428	AAMDC-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C11orf67	protein_coding	OTTHUMT00000390976.1	G	NM_024684		77231283	+1	no_errors	NM_024684	genbank	human	predicted	54_36p	silent	SNP	0.998	T
ANKRD34C-AS1	729911	genome.wustl.edu	37	15	79529016	79529016	+	lincRNA	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr15:79529016C>A	ENST00000560533.1	-	0	349																											CTATGACTATCAAGGTGATTA	0.488																																																0			15																																								77316071			646956																															15.37:g.79529016C>A			77316071		RNA	SNP	-	NULL	ENST00000560533.1	37	NULL		15																																																																																			-	-		0.488	RP11-17L5.4-007	KNOWN	basic	lincRNA	LOC646956	lincRNA	OTTHUMT00000417804.1	C			77316071	+1	pseudogene	XR_017376	genbank	human	model	54_36p	rna	SNP	1.000	A
RIPPLY2	134701	genome.wustl.edu	37	6	84563457	84563457	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr6:84563457A>C	ENST00000369689.1	+	2	290	c.139A>C	c.(139-141)Aaa>Caa	p.K47Q	RIPPLY2_ENST00000369687.1_5'UTR	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	47					bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)				large_intestine(2)|lung(4)|urinary_tract(1)	7						CGGAGGCAAGAAAGAAGAGGA	0.677																																																0			6											24.0	32.0	29.0					6																	84563457		2200	4288	6488	84620176	SO:0001583	missense	134701			BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.139A>C	6.37:g.84563457A>C	ENSP00000358703:p.Lys47Gln		84620176	Q5TAB6	Missense_Mutation	SNP	NULL	p.K47Q	ENST00000369689.1	37	c.139	CCDS34493.1	6	.	.	.	.	.	.	.	.	.	.	A	10.02	1.235992	0.22626	.	.	ENSG00000203877	ENST00000369689	.	.	.	3.94	-1.28	0.09318	.	1.500020	0.04543	N	0.388511	T	0.13970	0.0338	L	0.54323	1.7	0.09310	N	1	B	0.28636	0.218	B	0.30495	0.116	T	0.13388	-1.0511	9	0.13470	T	0.59	-3.5407	4.2173	0.10540	0.3756:0.2078:0.4166:0.0	.	47	Q5TAB7	RIPP2_HUMAN	Q	47	.	ENSP00000358703:K47Q	K	+	1	0	RIPPLY2	84620176	0.000000	0.05858	0.000000	0.03702	0.218000	0.24690	-0.213000	0.09305	-0.088000	0.12506	0.374000	0.22700	AAA	-	NULL		0.677	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPPLY2	protein_coding	OTTHUMT00000041360.1	A	NM_001009994		84620176	+1	no_errors	NM_001009994	genbank	human	provisional	54_36p	missense	SNP	0.000	C
ASB2	51676	genome.wustl.edu	37	14	94413738	94413738	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr14:94413738C>T	ENST00000315988.4	-	5	1353	c.865G>A	c.(865-867)Ggc>Agc	p.G289S	ASB2_ENST00000556337.1_Intron|MIR4506_ENST00000584693.1_RNA|ASB2_ENST00000555019.1_Missense_Mutation_p.G337S	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	289					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGGAGCAAGCCGTCCTTGTTG	0.622																																																0			14											192.0	152.0	165.0					14																	94413738		2203	4300	6503	93483491	SO:0001583	missense	51676			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.865G>A	14.37:g.94413738C>T	ENSP00000320675:p.Gly289Ser		93483491	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	HMMSmart_SM00248,superfamily_Ankyrin repeat,HMMPfam_Ank,PatternScan_ODR_DC_2_1,PatternScan_C_TYPE_LECTIN_1,HMMSmart_SM00253,HMMPfam_SOCS_box	p.G289S	ENST00000315988.4	37	c.865	CCDS9915.1	14	.	.	.	.	.	.	.	.	.	.	C	35	5.573766	0.96553	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;D;T	0.86297	1.62;-2.1;-1.12	5.19	5.19	0.71726	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94554	0.7756	10	0.87932	D	0	-10.2576	18.7174	0.91680	0.0:1.0:0.0:0.0	.	305;337;289	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	S	337;305;289;235;235	ENSP00000451575:G337S;ENSP00000320675:G289S;ENSP00000450940:G235S	ENSP00000320675:G289S	G	-	1	0	ASB2	93483491	1.000000	0.71417	0.996000	0.52242	0.940000	0.58332	7.818000	0.86416	2.417000	0.82017	0.462000	0.41574	GGC	-	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248		0.622	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	protein_coding	OTTHUMT00000412845.1	C			93483491	-1	no_errors	NM_016150	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FAM120A	23196	genome.wustl.edu	37	9	96233573	96233573	+	Missense_Mutation	SNP	G	G	C	rs371528215		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr9:96233573G>C	ENST00000277165.6	+	2	819	c.625G>C	c.(625-627)Ggg>Cgg	p.G209R	FAM120A_ENST00000375389.3_Missense_Mutation_p.G209R|FAM120A_ENST00000340893.4_Missense_Mutation_p.G209R|FAM120A_ENST00000333936.5_Missense_Mutation_p.G209R	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	209						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GAGCCGGAACGGGAAAAGTCT	0.458																																																0			9											163.0	138.0	147.0					9																	96233573		2203	4300	6503	95273394	SO:0001583	missense	23196			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.625G>C	9.37:g.96233573G>C	ENSP00000277165:p.Gly209Arg		95273394	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	superfamily_PIN domain-like	p.G209R	ENST00000277165.6	37	c.625	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153219	0.78114	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.14	4.23	0.50019	.	0.000000	0.64402	D	0.000001	T	0.65984	0.2744	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.97110	0.977;1.0	T	0.70949	-0.4733	10	0.87932	D	0	-14.0476	15.5469	0.76108	0.0:0.0:0.861:0.139	.	209;209	Q9NZB2;Q9NZB2-2	F120A_HUMAN;.	R	209	ENSP00000364538:G209R;ENSP00000277165:G209R;ENSP00000334918:G209R;ENSP00000344698:G209R	ENSP00000277165:G209R	G	+	1	0	FAM120A	95273394	1.000000	0.71417	0.981000	0.43875	0.802000	0.45316	9.389000	0.97243	1.522000	0.49001	-0.169000	0.13324	GGG	-	superfamily_PIN domain-like		0.458	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	protein_coding	OTTHUMT00000053160.2	G	NM_014612		95273394	+1	no_errors	NM_014612	genbank	human	validated	54_36p	missense	SNP	1.000	C
JAG2	3714	genome.wustl.edu	37	14	105614675	105614675	+	Missense_Mutation	SNP	T	T	C	rs200164540		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr14:105614675T>C	ENST00000331782.3	-	16	2525	c.2122A>G	c.(2122-2124)Acc>Gcc	p.T708A	JAG2_ENST00000347004.2_Missense_Mutation_p.T670A	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	708	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GAGTGGCAGGTCTTGCCCTTC	0.692																																																0			14											20.0	18.0	19.0					14																	105614675		2192	4281	6473	104685720	SO:0001583	missense	3714			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.2122A>G	14.37:g.105614675T>C	ENSP00000328169:p.Thr708Ala		104685720	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	HMMPfam_MNNL,HMMPfam_DSL,HMMSmart_SM00051,HMMSmart_SM00181,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,HMMSmart_SM00215,HMMSmart_SM00214	p.T708A	ENST00000331782.3	37	c.2122	CCDS9998.1	14	.	.	.	.	.	.	.	.	.	.	T	24.1	4.496870	0.85069	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.94457	-3.43;-3.43	4.73	4.73	0.59995	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.057421	0.64402	D	0.000002	D	0.96321	0.8800	M	0.73319	2.225	0.41950	D	0.990653	D;D	0.62365	0.988;0.991	D;D	0.68353	0.957;0.942	D	0.96549	0.9406	10	0.62326	D	0.03	.	12.1399	0.53993	0.0:0.0:0.0:1.0	.	670;708	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	A	708;670	ENSP00000328169:T708A;ENSP00000328566:T670A	ENSP00000328169:T708A	T	-	1	0	JAG2	104685720	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.709000	0.47160	1.756000	0.51951	0.397000	0.26171	ACC	-	superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2		0.692	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG2	protein_coding	OTTHUMT00000276506.2	T			104685720	-1	no_errors	NM_002226	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PPP1R3A	5506	genome.wustl.edu	37	7	113519201	113519201	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:113519201C>T	ENST00000284601.3	-	4	2014	c.1946G>A	c.(1945-1947)aGc>aAc	p.S649N		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	649					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATGCTGTGGGCTATTATCCTG	0.348																																																0			7											109.0	106.0	107.0					7																	113519201		2203	4299	6502	113306437	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1946G>A	7.37:g.113519201C>T	ENSP00000284601:p.Ser649Asn		113306437	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	HMMPfam_CBM_21	p.S649N	ENST00000284601.3	37	c.1946	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.814417	0.00600	.	.	ENSG00000154415	ENST00000284601	T	0.15139	2.45	6.01	0.318	0.15867	.	0.719956	0.13565	N	0.378485	T	0.02533	0.0077	N	0.00170	-1.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43909	-0.9362	10	0.08381	T	0.77	-0.4262	4.6439	0.12563	0.198:0.4096:0.0:0.3925	.	649	Q16821	PPR3A_HUMAN	N	649	ENSP00000284601:S649N	ENSP00000284601:S649N	S	-	2	0	PPP1R3A	113306437	0.260000	0.24053	0.001000	0.08648	0.002000	0.02628	0.494000	0.22467	0.164000	0.19529	-0.300000	0.09419	AGC	-	NULL		0.348	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	C	NM_002711		113306437	-1	no_errors	NM_002711	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
IL10RA	3587	genome.wustl.edu	37	11	117869480	117869480	+	Silent	SNP	A	A	T	rs143169554		TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr11:117869480A>T	ENST00000227752.3	+	7	981	c.861A>T	c.(859-861)ccA>ccT	p.P287P	IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000545409.1_Silent_p.P138P|IL10RA_ENST00000541785.1_Silent_p.P267P	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	287					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GTCCCTCCCCAGAGACCCAAG	0.582																																																0			11											91.0	73.0	79.0					11																	117869480		2200	4296	6496	117374690	SO:0001819	synonymous_variant	3587			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.861A>T	11.37:g.117869480A>T			117374690	A8K6I0|B0YJ27	Silent	SNP	HMMPfam_IL10Ra-bind,superfamily_Fibronectin type III	p.P287	ENST00000227752.3	37	c.861	CCDS8388.1	11																																																																																			-	NULL		0.582	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RA	protein_coding	OTTHUMT00000390167.1	A			117374690	+1	no_errors	NM_001558	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
INPP5F	22876	genome.wustl.edu	37	10	121551040	121551040	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr10:121551040G>T	ENST00000361976.2	+	4	493	c.327G>T	c.(325-327)aaG>aaT	p.K109N	INPP5F_ENST00000369083.3_Missense_Mutation_p.K109N|INPP5F_ENST00000369081.1_Missense_Mutation_p.K13N	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TCTGTAAGAAGCATCATTTTG	0.353																																																0			10											106.0	111.0	110.0					10																	121551040		2203	4298	6501	121541030	SO:0001583	missense	22876			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.327G>T	10.37:g.121551040G>T	ENSP00000354519:p.Lys109Asn		121541030	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	HMMPfam_Syja_N	p.K109N	ENST00000361976.2	37	c.327	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319929	0.60634	.	.	ENSG00000198825	ENST00000361976;ENST00000369083;ENST00000369081	T;T	0.60299	0.73;0.2	5.63	4.72	0.59763	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	L	0.53671	1.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.70375	-0.4889	10	0.66056	D	0.02	-27.6384	9.2076	0.37298	0.2659:0.0:0.7341:0.0	.	109;109	Q9Y2H2;Q9Y2H2-3	SAC2_HUMAN;.	N	109;109;13	ENSP00000354519:K109N;ENSP00000358079:K109N	ENSP00000354519:K109N	K	+	3	2	INPP5F	121541030	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.210000	0.51129	1.513000	0.48852	-0.145000	0.13849	AAG	-	HMMPfam_Syja_N		0.353	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	protein_coding	OTTHUMT00000050679.1	G	NM_014937		121541030	+1	no_errors	NM_014937	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ACTRT1	139741	genome.wustl.edu	37	X	127185282	127185282	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chrX:127185282C>A	ENST00000371124.3	-	1	1100	c.904G>T	c.(904-906)Ggg>Tgg	p.G302W		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	302						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GTGGTGCCCCCGGAGAGTACA	0.517																																																0			X											99.0	86.0	90.0					X																	127185282		2203	4300	6503	127012963	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.904G>T	X.37:g.127185282C>A	ENSP00000360165:p.Gly302Trp		127012963	Q6X7C1|Q96L10	Missense_Mutation	SNP	HMMPfam_Actin,superfamily_SSF53067,HMMSmart_ACTIN	p.G302W	ENST00000371124.3	37	c.904	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610502	0.28712	.	.	ENSG00000123165	ENST00000371124	D	0.88741	-2.42	3.58	2.71	0.32032	.	0.000000	0.64402	D	0.000010	D	0.96436	0.8837	H	0.99454	4.575	0.49130	D	0.999759	D	0.89917	1.0	D	0.97110	1.0	D	0.94961	0.8108	10	0.87932	D	0	.	8.3487	0.32288	0.0:0.8768:0.0:0.1232	.	302	Q8TDG2	ACTT1_HUMAN	W	302	ENSP00000360165:G302W	ENSP00000360165:G302W	G	-	1	0	ACTRT1	127012963	1.000000	0.71417	0.873000	0.34254	0.016000	0.09150	5.261000	0.65496	0.883000	0.36040	-0.191000	0.12829	GGG	-	HMMPfam_Actin,HMMSmart_ACTIN,superfamily_SSF53067		0.517	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	protein_coding	OTTHUMT00000058192.1	C	NM_138289		127012963	-1	no_errors	NM_138289	genbank	human	provisional	54_36p	missense	SNP	1.000	A
GPC3	2719	genome.wustl.edu	37	X	132887741	132887741	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chrX:132887741C>T	ENST00000370818.3	-	3	1245	c.800G>A	c.(799-801)gGa>gAa	p.G267E	GPC3_ENST00000543339.1_Missense_Mutation_p.G213E|GPC3_ENST00000394299.2_Missense_Mutation_p.G267E	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	267					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CATCATCAGTCCCTGGCAGTA	0.468			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	0			X											621.0	395.0	472.0					X																	132887741		2203	4300	6503	132715407	SO:0001583	missense	2719	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.800G>A	X.37:g.132887741C>T	ENSP00000359854:p.Gly267Glu		132715407	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	HMMPfam_Glypican,PatternScan_GLYPICAN	p.G267E	ENST00000370818.3	37	c.800	CCDS14638.1	X	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142797	0.57044	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	T;T;T	0.65732	-0.17;-0.17;-0.17	5.82	5.82	0.92795	Glypican, conserved site (1);	0.105245	0.64402	D	0.000003	T	0.78521	0.4296	M	0.70595	2.14	0.38315	D	0.943357	D;D;P;D	0.65815	0.971;0.995;0.854;0.971	P;D;P;P	0.67103	0.902;0.949;0.803;0.902	T	0.82242	-0.0554	10	0.87932	D	0	.	17.9336	0.89006	0.0:1.0:0.0:0.0	.	251;213;267;267	B4DTD8;G3V1R0;C9JLE3;P51654	.;.;.;GPC3_HUMAN	E	267;267;213	ENSP00000359854:G267E;ENSP00000377836:G267E;ENSP00000444222:G213E	ENSP00000359854:G267E	G	-	2	0	GPC3	132715407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.913000	0.48790	2.455000	0.83008	0.594000	0.82650	GGA	-	HMMPfam_Glypican,PatternScan_GLYPICAN		0.468	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC3	protein_coding	OTTHUMT00000058356.1	C	NM_004484		132715407	-1	no_errors	NM_004484	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ATP6V0A4	50617	genome.wustl.edu	37	7	138441222	138441222	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:138441222T>A	ENST00000310018.2	-	9	985	c.703A>T	c.(703-705)Atc>Ttc	p.I235F	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.I235F|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.I235F	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	235					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ATCTTCTTGATTTTCTGCCTG	0.393																																																0			7											214.0	216.0	215.0					7																	138441222		2203	4300	6503	138091762	SO:0001583	missense	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.703A>T	7.37:g.138441222T>A	ENSP00000308122:p.Ile235Phe		138091762	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	HMMPfam_V_ATPase_I	p.I235F	ENST00000310018.2	37	c.703	CCDS5849.1	7	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985462	0.74589	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.87571	-2.27;-2.27;-2.27	5.45	0.184	0.15086	.	0.138564	0.49916	D	0.000134	D	0.93341	0.7877	H	0.94462	3.54	0.48087	D	0.999581	D	0.56968	0.978	P	0.61874	0.895	D	0.92078	0.5670	10	0.87932	D	0	-23.0236	9.7142	0.40265	0.0:0.2458:0.0:0.7542	.	235	Q9HBG4	VPP4_HUMAN	F	235	ENSP00000308122:I235F;ENSP00000376774:I235F;ENSP00000253856:I235F	ENSP00000308122:I235F	I	-	1	0	ATP6V0A4	138091762	0.882000	0.30256	0.990000	0.47175	0.996000	0.88848	1.156000	0.31712	-0.120000	0.11809	0.459000	0.35465	ATC	-	HMMPfam_V_ATPase_I		0.393	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	protein_coding	OTTHUMT00000347514.1	T	NM_020632		138091762	-1	no_errors	NM_020632	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PCDHA2	56146	genome.wustl.edu	37	5	140175418	140175418	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr5:140175418A>C	ENST00000526136.1	+	1	869	c.869A>C	c.(868-870)cAg>cCg	p.Q290P	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.Q290P|PCDHA2_ENST00000520672.2_Missense_Mutation_p.Q290P|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	290	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACTATACAGACTAAGTTT	0.423																																																0			5											96.0	92.0	93.0					5																	140175418		2203	4300	6503	140155602	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.869A>C	5.37:g.140175418A>C	ENSP00000431748:p.Gln290Pro		140155602	O75287|Q9BTV3	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMSmart_SM00112,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.Q290P	ENST00000526136.1	37	c.869	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	a	8.651	0.898147	0.17686	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.51325	0.71;0.71;0.71	4.02	-3.95	0.04118	Cadherin (4);Cadherin-like (1);	1.388430	0.05725	U	0.598539	T	0.28532	0.0706	N	0.21324	0.655	0.09310	N	1	B;B;B	0.15141	0.012;0.009;0.012	B;B;B	0.24155	0.017;0.051;0.017	T	0.25082	-1.0142	10	0.40728	T	0.16	.	1.9859	0.03436	0.2772:0.3707:0.2303:0.1219	.	290;290;290	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	P	290	ENSP00000430584:Q290P;ENSP00000367372:Q290P;ENSP00000431748:Q290P	ENSP00000367372:Q290P	Q	+	2	0	PCDHA2	140155602	0.000000	0.05858	0.000000	0.03702	0.946000	0.59487	-0.247000	0.08866	-0.389000	0.07786	0.528000	0.53228	CAG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.423	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	protein_coding	OTTHUMT00000372877.3	A	NM_018905		140155602	+1	no_errors	NM_018905	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
SPANXN1	494118	genome.wustl.edu	37	X	144337311	144337311	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chrX:144337311C>A	ENST00000370493.3	+	2	955	c.196C>A	c.(196-198)Caa>Aaa	p.Q66K		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	66										endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					ACATTCAAATCAACTGGAGAA	0.438																																																0			X											189.0	163.0	172.0					X																	144337311		2203	4298	6501	144145003	SO:0001583	missense	494118				CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.196C>A	X.37:g.144337311C>A	ENSP00000359524:p.Gln66Lys		144145003		Missense_Mutation	SNP	HMMPfam_SPAN-X	p.Q66K	ENST00000370493.3	37	c.196	CCDS35421.1	X	.	.	.	.	.	.	.	.	.	.	-	10.88	1.474347	0.26423	.	.	ENSG00000203923	ENST00000370493	T	0.07800	3.16	1.19	0.224	0.15297	.	.	.	.	.	T	0.20047	0.0482	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.76071	0.987	T	0.10405	-1.0631	8	0.72032	D	0.01	.	3.5901	0.07985	0.0:0.7089:0.0:0.2911	.	66	Q5VSR9	SPXN1_HUMAN	K	66	ENSP00000359524:Q66K	ENSP00000359524:Q66K	Q	+	1	0	SPANXN1	144145003	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.206000	0.09398	0.020000	0.15106	0.151000	0.16131	CAA	-	NULL		0.438	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN1	protein_coding	OTTHUMT00000058631.2	C	NM_001009614		144145003	+1	no_errors	NM_001009614	genbank	human	validated	54_36p	missense	SNP	0.039	A
CNTNAP2	26047	genome.wustl.edu	37	7	146805326	146805326	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:146805326C>T	ENST00000361727.3	+	5	1154	c.638C>T	c.(637-639)gCc>gTc	p.A213V		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	213					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GATGTCATTGCCTTGAACTTT	0.388										HNSCC(39;0.1)																																						0			7											128.0	117.0	121.0					7																	146805326		2203	4300	6503	146436259	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.638C>T	7.37:g.146805326C>T	ENSP00000354778:p.Ala213Val		146436259	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1,HMMSmart_SM00294	p.A213V	ENST00000361727.3	37	c.638	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170380	0.78452	.	.	ENSG00000174469	ENST00000361727	T	0.79033	-1.23	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.64402	D	0.000010	T	0.74733	0.3755	L	0.42245	1.32	0.80722	D	1	B	0.12013	0.005	B	0.17098	0.017	T	0.69124	-0.5228	10	0.72032	D	0.01	.	19.1533	0.93499	0.0:1.0:0.0:0.0	.	213	Q9UHC6	CNTP2_HUMAN	V	213	ENSP00000354778:A213V	ENSP00000354778:A213V	A	+	2	0	CNTNAP2	146436259	0.738000	0.28186	0.984000	0.44739	0.914000	0.54420	5.675000	0.68123	2.868000	0.98415	0.557000	0.71058	GCC	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282		0.388	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	C			146436259	+1	no_errors	NM_014141	genbank	human	reviewed	54_36p	missense	SNP	0.847	T
PDIA4	9601	genome.wustl.edu	37	7	148702414	148702414	+	Silent	SNP	C	C	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:148702414C>T	ENST00000286091.4	-	9	1573	c.1341G>A	c.(1339-1341)gaG>gaA	p.E447E		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	447					cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CAAAGGTGTACTCAGGGAAGT	0.587											OREG0018420	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			7											148.0	126.0	133.0					7																	148702414		2203	4300	6503	148333347	SO:0001819	synonymous_variant	9601			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1341G>A	7.37:g.148702414C>T		1719	148333347	A8K4K6|Q549T6	Silent	SNP	superfamily_Thioredoxin-like,HMMPfam_Thioredoxin,PatternScan_THIOREDOXIN_1	p.E447	ENST00000286091.4	37	c.1341	CCDS5893.1	7																																																																																			-	NULL		0.587	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	protein_coding	OTTHUMT00000317077.1	C	NM_004911		148333347	-1	no_errors	NM_004911	genbank	human	validated	54_36p	silent	SNP	1.000	T
ZNF282	8427	genome.wustl.edu	37	7	148895804	148895804	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr7:148895804T>G	ENST00000262085.3	+	2	650	c.545T>G	c.(544-546)gTc>gGc	p.V182G	ZNF282_ENST00000479907.1_Missense_Mutation_p.V182G	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	182					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		AACTTCTGGGTCCTGCGGCTG	0.632																																																0			7											44.0	54.0	51.0					7																	148895804		2203	4299	6502	148526737	SO:0001583	missense	8427			D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.545T>G	7.37:g.148895804T>G	ENSP00000262085:p.Val182Gly		148526737	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.V182G	ENST00000262085.3	37	c.545	CCDS5895.1	7	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665035	0.67700	.	.	ENSG00000170265	ENST00000430197;ENST00000262085;ENST00000479907	T;T	0.08193	3.12;4.83	4.11	4.11	0.48088	.	0.000000	0.38436	N	0.001697	T	0.16471	0.0396	L	0.42245	1.32	0.58432	D	0.999994	D;P;P;D	0.67145	0.996;0.938;0.938;0.964	P;P;P;P	0.60541	0.876;0.478;0.601;0.601	T	0.00617	-1.1642	10	0.87932	D	0	-28.8088	9.7671	0.40567	0.0:0.0:0.0:1.0	.	182;133;154;182	B4DRI5;Q86YG2;Q7Z2V4;Q9UDV7	.;.;.;ZN282_HUMAN	G	97;182;182	ENSP00000262085:V182G;ENSP00000418840:V182G	ENSP00000262085:V182G	V	+	2	0	ZNF282	148526737	0.996000	0.38824	1.000000	0.80357	0.968000	0.65278	4.593000	0.61034	1.640000	0.50565	0.260000	0.18958	GTC	-	NULL		0.632	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF282	protein_coding	OTTHUMT00000352746.1	T	NM_003575		148526737	+1	no_errors	NM_003575	genbank	human	validated	54_36p	missense	SNP	1.000	G
WWTR1	25937	genome.wustl.edu	37	3	149290703	149290703	+	Silent	SNP	G	G	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr3:149290703G>A	ENST00000465804.1	-	4	772	c.516C>T	c.(514-516)gtC>gtT	p.V172V	WWTR1_ENST00000467467.1_Silent_p.V172V|WWTR1_ENST00000360632.3_Silent_p.V172V	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	172					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GTGTGGAACTGACGGCAGGGT	0.418			T	CAMTA1	epitheliod hemangioendothelioma																																		Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	0			3											134.0	125.0	128.0					3																	149290703		2203	4300	6503	150773393	SO:0001819	synonymous_variant	25937			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.516C>T	3.37:g.149290703G>A			150773393	D3DNH7|Q8N3P2|Q9Y3W6	Silent	SNP	superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1	p.V172	ENST00000465804.1	37	c.516	CCDS3144.1	3																																																																																			-	NULL		0.418	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	protein_coding	OTTHUMT00000356498.1	G	NM_015472		150773393	-1	no_errors	NM_015472	genbank	human	provisional	54_36p	silent	SNP	0.909	A
LCE2C	353140	genome.wustl.edu	37	1	152648665	152648665	+	Silent	SNP	C	C	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:152648665C>A	ENST00000368783.1	+	2	229	c.174C>A	c.(172-174)ccC>ccA	p.P58P	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	58	Cys-rich.				keratinization (GO:0031424)					endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTGGTCCCAGCTCTGGGG	0.662																																																0			1											81.0	92.0	88.0					1																	152648665		2203	4300	6503	150915289	SO:0001819	synonymous_variant	353140				CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.174C>A	1.37:g.152648665C>A			150915289		Silent	SNP	NULL	p.P58	ENST00000368783.1	37	c.174	CCDS1019.1	1																																																																																			-	NULL		0.662	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2C	protein_coding	OTTHUMT00000034509.1	C	NM_178429		150915289	+1	no_errors	NM_178429	genbank	human	validated	54_36p	silent	SNP	0.899	A
ERICH6	131831	genome.wustl.edu	37	3	150400031	150400031	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr3:150400031C>G	ENST00000295910.6	-	7	908	c.856G>C	c.(856-858)Gat>Cat	p.D286H	FAM194A_ENST00000491361.1_Missense_Mutation_p.D140H	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GAGGAAACATCCACATTAGAA	0.353																																																0			3											82.0	83.0	83.0					3																	150400031		2203	4300	6503	151882721	SO:0001583	missense	131831																														ENST00000295910.6:c.856G>C	3.37:g.150400031C>G	ENSP00000295910:p.Asp286His		151882721		Missense_Mutation	SNP	NULL	p.D286H	ENST00000295910.6	37	c.856	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631603	0.46944	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.16897	2.4;2.31	4.21	4.21	0.49690	.	0.105781	0.42172	D	0.000755	T	0.32645	0.0836	L	0.55481	1.735	0.19300	N	0.999975	D	0.69078	0.997	D	0.63877	0.919	T	0.03673	-1.1014	10	0.72032	D	0.01	-29.801	12.2659	0.54679	0.0:1.0:0.0:0.0	.	286	Q7L0X2	F194A_HUMAN	H	286;140;244	ENSP00000295910:D286H;ENSP00000419366:D140H	ENSP00000295910:D286H	D	-	1	0	FAM194A	151882721	0.913000	0.31002	0.323000	0.25347	0.032000	0.12392	2.226000	0.42963	2.342000	0.79632	0.561000	0.74099	GAT	-	NULL		0.353	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf44	protein_coding	OTTHUMT00000257666.1	C			151882721	-1	no_errors	NM_152394	genbank	human	validated	54_36p	missense	SNP	0.170	G
SYNE1	23345	genome.wustl.edu	37	6	152557382	152557382	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr6:152557382A>T	ENST00000367255.5	-	110	20857	c.20256T>A	c.(20254-20256)gaT>gaA	p.D6752E	SYNE1_ENST00000356820.4_Missense_Mutation_p.D1276E|SYNE1_ENST00000448038.1_Missense_Mutation_p.D6681E|SYNE1_ENST00000341594.5_Missense_Mutation_p.D6364E|SYNE1_ENST00000265368.4_Missense_Mutation_p.D6752E|SYNE1_ENST00000423061.1_Missense_Mutation_p.D6681E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6752					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCGTTTCCCATCATCTAATA	0.333										HNSCC(10;0.0054)																																						0			6											122.0	118.0	120.0					6																	152557382		2203	4300	6503	152599075	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20256T>A	6.37:g.152557382A>T	ENSP00000356224:p.Asp6752Glu		152599075	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,HMMPfam_KASH	p.D6752E	ENST00000367255.5	37	c.20256	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	5.634	0.301667	0.10678	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4	5.76	0.696	0.18075	.	0.093021	0.46442	N	0.000292	T	0.07503	0.0189	L	0.28649	0.875	0.38415	D	0.946024	B;B;B	0.32781	0.266;0.266;0.384	B;B;B	0.36666	0.115;0.115;0.23	T	0.23119	-1.0197	10	0.02654	T	1	.	6.0148	0.19596	0.6716:0.1271:0.2013:0.0	.	6752;6752;6681	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	E	6752;6681;6752;6681;6364;1276	ENSP00000356224:D6752E;ENSP00000396024:D6681E;ENSP00000265368:D6752E;ENSP00000390975:D6681E;ENSP00000341887:D6364E;ENSP00000349276:D1276E	ENSP00000265368:D6752E	D	-	3	2	SYNE1	152599075	0.981000	0.34729	1.000000	0.80357	0.951000	0.60555	0.387000	0.20718	0.101000	0.17610	-0.290000	0.09829	GAT	-	superfamily_Spectrin repeat,HMMSmart_SM00150		0.333	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	A	NM_182961		152599075	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LPAL2	80350	genome.wustl.edu	37	6	160903704	160903704	+	RNA	SNP	T	T	A			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr6:160903704T>A	ENST00000335388.5	-	0	1164					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		ATTTGGGTACTTTTCTGGGGT	0.463																																																0			6																																								160823694			0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160903704T>A			160823694	E1P5B4	Missense_Mutation	SNP	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle	p.K95M	ENST00000335388.5	37	c.284		6																																																																																			-	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle		0.463	LPAL2-003	KNOWN	basic	processed_transcript	ENSG00000164711	pseudogene	OTTHUMT00000042950.1	T	NM_024492		160823694	-1	no_errors	ENST00000297289	ensembl	human	known	54_36p	missense	SNP	0.355	A
SLC19A2	10560	genome.wustl.edu	37	1	169454935	169454935	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:169454935G>C	ENST00000236137.5	-	1	306	c.70C>G	c.(70-72)Cgg>Ggg	p.R24G	SLC19A2_ENST00000367804.4_Missense_Mutation_p.R24G	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	24					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	CGACGGACCCGAGCGGTCCGC	0.751																																																0			1											5.0	8.0	7.0					1																	169454935		1978	3836	5814	167721559	SO:0001583	missense	10560			AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.70C>G	1.37:g.169454935G>C	ENSP00000236137:p.Arg24Gly		167721559	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_Folate_carrier,PatternScan_G_PROTEIN_RECEP_F1_1	p.R24G	ENST00000236137.5	37	c.70	CCDS1280.1	1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521344	0.44866	.	.	ENSG00000117479	ENST00000236137;ENST00000367804;ENST00000367802	D;D;D	0.86497	-2.13;-1.59;-2.13	4.22	3.31	0.37934	.	0.334286	0.19875	N	0.104107	T	0.64789	0.2630	L	0.27053	0.805	0.27431	N	0.954006	B;B	0.34290	0.447;0.114	B;B	0.32624	0.149;0.071	T	0.58228	-0.7673	9	0.33940	T	0.23	-15.4959	9.2556	0.37581	0.1038:0.0:0.8962:0.0	.	24;24	O60779-2;O60779	.;S19A2_HUMAN	G	24	ENSP00000236137:R24G;ENSP00000356778:R24G;ENSP00000356776:R24G	ENSP00000236137:R24G	R	-	1	2	SLC19A2	167721559	0.962000	0.33011	0.198000	0.23420	0.004000	0.04260	2.578000	0.46051	0.975000	0.38392	-0.373000	0.07131	CGG	-	NULL		0.751	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A2	protein_coding	OTTHUMT00000086106.1	G	NM_006996		167721559	-1	no_errors	NM_006996	genbank	human	reviewed	54_36p	missense	SNP	0.935	C
ATF2	1386	genome.wustl.edu	37	2	175962273	175962273	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr2:175962273C>G	ENST00000264110.2	-	11	1175	c.877G>C	c.(877-879)Gat>Cat	p.D293H	ATF2_ENST00000392543.2_Intron|ATF2_ENST00000345739.5_Missense_Mutation_p.D235H|ATF2_ENST00000392544.1_Missense_Mutation_p.D293H|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000409437.1_Missense_Mutation_p.D177H|ATF2_ENST00000409635.1_Missense_Mutation_p.D235H|ATF2_ENST00000538946.1_Missense_Mutation_p.D275H|ATF2_ENST00000426833.3_Missense_Mutation_p.D275H|ATF2_ENST00000409499.1_Intron	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	293					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	TTGACAGTATCACCATTGGTA	0.423																																					Pancreas(17;87 705 4534 15538 30988)											0			2											127.0	112.0	117.0					2																	175962273		2203	4300	6503	175670519	SO:0001583	missense	1386			X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.877G>C	2.37:g.175962273C>G	ENSP00000264110:p.Asp293His		175670519	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_bZIP_1,HMMSmart_SM00338,PatternScan_BZIP_BASIC	p.D293H	ENST00000264110.2	37	c.877	CCDS2262.1	2	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190714	0.38707	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000426833;ENST00000538946	T;T;T;T;T;T;T	0.77489	-1.1;0.48;-0.5;0.48;-1.1;-1.05;-0.65	5.58	4.71	0.59529	.	0.237648	0.40640	N	0.001051	T	0.78451	0.4285	L	0.56769	1.78	0.58432	D	0.999996	P;P;B;B	0.50819	0.61;0.939;0.044;0.196	B;P;B;B	0.48114	0.193;0.567;0.017;0.03	T	0.77130	-0.2701	10	0.33141	T	0.24	-8.7288	14.4841	0.67603	0.0:0.9295:0.0:0.0705	.	275;270;235;293	A4D7U4;B3KY57;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	H	293;235;270;177;235;293;275;275	ENSP00000264110:D293H;ENSP00000340576:D235H;ENSP00000386326:D177H;ENSP00000387093:D235H;ENSP00000376327:D293H;ENSP00000407911:D275H;ENSP00000437952:D275H	ENSP00000264110:D293H	D	-	1	0	ATF2	175670519	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	4.328000	0.59253	1.365000	0.46057	-0.145000	0.13849	GAT	-	NULL		0.423	ATF2-001	KNOWN	basic|CCDS	protein_coding	ATF2	protein_coding	OTTHUMT00000255562.1	C	NM_001880		175670519	-1	no_errors	NM_001880	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PRG4	10216	genome.wustl.edu	37	1	186266037	186266037	+	Silent	SNP	G	G	T			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:186266037G>T	ENST00000445192.2	+	2	75	c.30G>T	c.(28-30)ctG>ctT	p.L10L	PRG4_ENST00000367485.4_Silent_p.L10L|PRG4_ENST00000367486.3_Silent_p.L10L|PRG4_ENST00000367483.4_Silent_p.L10L|PRG4_ENST00000367484.3_Silent_p.L10L	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	10					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCATTTACCTGTTGTTGCTGC	0.368																																																0			1											209.0	159.0	176.0					1																	186266037		2203	4300	6503	184532660	SO:0001819	synonymous_variant	10216			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.30G>T	1.37:g.186266037G>T			184532660	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	HMMSmart_SM00201,HMMPfam_Somatomedin_B,superfamily_Somatomedin B domain,PatternScan_SMB_1,superfamily_Hemopexin-like domain,HMMPfam_Hemopexin,HMMSmart_SM00120,PatternScan_HEMOPEXIN	p.L10	ENST00000445192.2	37	c.30	CCDS1369.1	1																																																																																			-	NULL		0.368	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	protein_coding	OTTHUMT00000086346.1	G	NM_005807		184532660	+1	no_errors	NM_005807	genbank	human	reviewed	54_36p	silent	SNP	0.051	T
MDM4	4194	genome.wustl.edu	37	1	204513713	204513713	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2647-01A-01D-1526-09	TCGA-23-2647-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	91a0e33a-5276-4a41-90bf-4355cb635318	53a93b80-fb59-496c-bf1a-c039810b942d	g.chr1:204513713G>C	ENST00000367182.3	+	9	885	c.723G>C	c.(721-723)ttG>ttC	p.L241F	MDM4_ENST00000507825.2_Intron|MDM4_ENST00000391947.2_3'UTR|MDM4_ENST00000463049.1_3'UTR|MDM4_ENST00000367183.3_Intron|MDM4_ENST00000454264.2_Intron	NM_001204171.1|NM_001278516.1|NM_001278517.1|NM_001278518.1|NM_001278519.1|NM_002393.4	NP_001191100.1|NP_001265445.1|NP_001265446.1|NP_001265447.1|NP_001265448.1|NP_002384.2	O15151	MDM4_HUMAN	MDM4, p53 regulator	241					cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|G0 to G1 transition (GO:0045023)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGTGGTTTTTGAATGAGTCAG	0.368			A		"""GBM, bladder, retinoblastoma"""																																		Dom	yes		1	1q32	4194	Mdm4 p53 binding protein homolog		M	0			1											143.0	137.0	139.0					1																	204513713		2203	4300	6503	202780336	SO:0001583	missense	4194			AF007111	CCDS1447.1, CCDS55674.1, CCDS55675.1, CCDS60396.1, CCDS73007.1, CCDS73008.1, CCDS73009.1	1q32	2014-03-03	2014-03-03		ENSG00000198625	ENSG00000198625			6974	protein-coding gene	gene with protein product		602704	"""mouse double minute 4, human homolog of; p53-binding protein"", ""Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)"", ""Mdm4 p53 binding protein homolog (mouse)"""			9226370, 14660608	Standard	NM_002393		Approved	MDMX, HDMX	uc001hba.3	O15151	OTTHUMG00000035877	ENST00000367182.3:c.723G>C	1.37:g.204513713G>C	ENSP00000356150:p.Leu241Phe		202780336	Q2M2Y2|Q32SL2|Q6GS18|Q8IV83	Missense_Mutation	SNP	superfamily_SWIB/MDM2 domain,HMMPfam_SWIB,PatternScan_ZF_RANBP2_1,superfamily_RING/U-box	p.L241F	ENST00000367182.3	37	c.723	CCDS1447.1	1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.334468	0.41297	.	.	ENSG00000198625	ENST00000367182;ENST00000367179	T;T	0.10382	2.88;2.88	5.72	4.77	0.60923	.	0.069203	0.56097	N	0.000023	T	0.08626	0.0214	L	0.38175	1.15	0.80722	D	1	B	0.19583	0.037	B	0.22152	0.038	T	0.20974	-1.0259	10	0.34782	T	0.22	-1.762	5.9456	0.19217	0.1177:0.2675:0.6148:0.0	.	241	O15151	MDM4_HUMAN	F	241;126	ENSP00000356150:L241F;ENSP00000356147:L126F	ENSP00000356147:L126F	L	+	3	2	MDM4	202780336	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.144000	0.42197	1.288000	0.44600	0.561000	0.74099	TTG	-	NULL		0.368	MDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDM4	protein_coding	OTTHUMT00000087415.2	G	NM_002393		202780336	+1	no_errors	NM_002393	genbank	human	validated	54_36p	missense	SNP	1.000	C
