#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCEB3	6924	broad.mit.edu	37	1	24077510	24077510	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr1:24077510C>A	ENST00000418390.2	+	4	764	c.493C>A	c.(493-495)Ctc>Atc	p.L165I	TCEB3_ENST00000609199.1_Missense_Mutation_p.L139I	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	165					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.L139I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ACTCTCGGAGCTCGAGAGACC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	68.0	67.0					1																	24077510		2203	4300	6503	23950097	SO:0001583	missense	6924			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.493C>A	1.37:g.24077510C>A	ENSP00000395574:p.Leu165Ile		23950097	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	37	CCDS239.2	.	.	.	.	.	.	.	.	.	.	C	8.491	0.862058	0.17178	.	.	ENSG00000011007	ENST00000418390	T	0.06768	3.26	5.95	0.31	0.15825	.	1.282700	0.05178	N	0.500796	T	0.08626	0.0214	L	0.39898	1.24	0.09310	N	1	B	0.20887	0.049	B	0.22386	0.039	T	0.43572	-0.9383	10	0.25106	T	0.35	0.0406	8.541	0.33393	0.0:0.6344:0.105:0.2606	.	165	Q14241	ELOA1_HUMAN	I	165	ENSP00000395574:L165I	ENSP00000395574:L165I	L	+	1	0	TCEB3	23950097	0.604000	0.26932	0.106000	0.21319	0.747000	0.42532	0.700000	0.25601	0.137000	0.18759	-0.175000	0.13238	CTC		0.522	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
ECM1	1893	broad.mit.edu	37	1	150483554	150483554	+	Silent	SNP	A	A	G			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr1:150483554A>G	ENST00000369047.4	+	6	713	c.588A>G	c.(586-588)ccA>ccG	p.P196P	ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000369049.4_Silent_p.P223P|ECM1_ENST00000346569.6_Silent_p.P196P	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	196	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.P196P(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GGAACCTACCACAGTCCAGCT	0.582																																					Melanoma(156;1696 2560 11093 19685)											1	Substitution - coding silent(1)	ovary(1)	1											144.0	147.0	146.0					1																	150483554		2203	4300	6503	148750178	SO:0001819	synonymous_variant	1893			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.588A>G	1.37:g.150483554A>G			148750178	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Silent	SNP	ENST00000369047.4	37	CCDS953.1																																																																																				0.582	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425	
SMG5	23381	broad.mit.edu	37	1	156230371	156230371	+	Silent	SNP	T	T	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr1:156230371T>C	ENST00000361813.5	-	15	2298	c.2154A>G	c.(2152-2154)gaA>gaG	p.E718E	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	718					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.E718E(1)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GGTCAGGCAGTTCACAACCTT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	1											79.0	65.0	69.0					1																	156230371		2203	4300	6503	154496995	SO:0001819	synonymous_variant	23381			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2154A>G	1.37:g.156230371T>C			154496995	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Silent	SNP	ENST00000361813.5	37	CCDS1137.1																																																																																				0.567	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
ATP1B1	481	broad.mit.edu	37	1	169080710	169080710	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr1:169080710C>T	ENST00000367816.1	+	3	729	c.200C>T	c.(199-201)aCa>aTa	p.T67I	ATP1B1_ENST00000367815.4_Missense_Mutation_p.T67I|ATP1B1_ENST00000499679.3_Missense_Mutation_p.T11I|ATP1B1_ENST00000367813.3_Missense_Mutation_p.T59I			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	67					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.T67I(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					TTTAAGCCCACATATCAGGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	102.0	103.0					1																	169080710		2203	4300	6503	167347334	SO:0001583	missense	481			U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.200C>T	1.37:g.169080710C>T	ENSP00000356790:p.Thr67Ile		167347334	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	37	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224540	0.79576	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.17	4.13	0.48395	.	0.110120	0.64402	D	0.000009	T	0.33089	0.0851	M	0.75884	2.315	0.37639	D	0.921976	D	0.58268	0.982	P	0.52386	0.697	T	0.28964	-1.0027	9	0.62326	D	0.03	-23.2109	10.8612	0.46827	0.4097:0.5903:0.0:0.0	.	67	P05026	AT1B1_HUMAN	I	67;67;11;59	ENSP00000356790:T67I;ENSP00000356789:T67I;ENSP00000423450:T11I;ENSP00000356787:T59I	ENSP00000356787:T59I	T	+	2	0	ATP1B1	167347334	0.999000	0.42202	0.959000	0.39883	0.994000	0.84299	4.443000	0.59994	2.559000	0.86315	0.650000	0.86243	ACA		0.433	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
MTR	4548	broad.mit.edu	37	1	237015827	237015827	+	Silent	SNP	T	T	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr1:237015827T>C	ENST00000366577.5	+	17	2096	c.1702T>C	c.(1702-1704)Tta>Cta	p.L568L	MTR_ENST00000535889.1_Silent_p.L568L	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	568	Pterin-binding. {ECO:0000255|PROSITE- ProRule:PRU00334}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.L568L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CCAGGAAACATTACCTGGAGC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											63.0	67.0	66.0					1																	237015827		2203	4300	6503	235082450	SO:0001819	synonymous_variant	4548			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.1702T>C	1.37:g.237015827T>C			235082450	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	ENST00000366577.5	37	CCDS1614.1																																																																																				0.388	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
OR56A1	120796	broad.mit.edu	37	11	6048913	6048913	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr11:6048913G>T	ENST00000316650.5	-	1	58	c.22C>A	c.(22-24)Ccc>Acc	p.P8T		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P8T(2)|p.P8N(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGTTGCTGGGTGACGCCATA	0.488																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	11											119.0	120.0	120.0					11																	6048913		2201	4296	6497	6005489	SO:0001583	missense	120796			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.22C>A	11.37:g.6048913G>T	ENSP00000321246:p.Pro8Thr		6005489	B2RNI2|Q6IFL0	Missense_Mutation	SNP	ENST00000316650.5	37	CCDS31405.1	.	.	.	.	.	.	.	.	.	.	G	6.046	0.376870	0.11466	.	.	ENSG00000180934	ENST00000316650	T	0.37058	1.22	3.83	-0.559	0.11792	.	0.667620	0.12147	U	0.495246	T	0.11196	0.0273	N	0.02721	-0.515	0.09310	N	1	B	0.20550	0.046	B	0.23275	0.045	T	0.25984	-1.0116	10	0.17832	T	0.49	.	0.5535	0.00666	0.334:0.1727:0.3172:0.1761	.	8	Q8NGH5	O56A1_HUMAN	T	8	ENSP00000321246:P8T	ENSP00000321246:P8T	P	-	1	0	OR56A1	6005489	0.000000	0.05858	0.001000	0.08648	0.299000	0.27559	-0.652000	0.05366	0.077000	0.16863	0.563000	0.77884	CCC		0.488	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917	
LGR4	55366	broad.mit.edu	37	11	27389448	27389448	+	Missense_Mutation	SNP	C	C	A	rs202048946		TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr11:27389448C>A	ENST00000379214.4	-	18	3265	c.2822G>T	c.(2821-2823)cGc>cTc	p.R941L	LGR4_ENST00000389858.4_Missense_Mutation_p.R917L	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	941					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.R941L(1)		NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						GTAAGCATAGCGCACCAAAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	108.0	107.0					11																	27389448		2202	4299	6501	27346024	SO:0001583	missense	55366			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2822G>T	11.37:g.27389448C>A	ENSP00000368516:p.Arg941Leu		27346024	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	ENST00000379214.4	37	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308799	0.81247	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	T;T	0.60548	0.18;0.3	5.88	5.88	0.94601	.	0.157428	0.64402	D	0.000014	T	0.61813	0.2377	N	0.24115	0.695	0.80722	D	1	D;D	0.57257	0.979;0.965	P;P	0.56216	0.794;0.627	T	0.64782	-0.6326	10	0.72032	D	0.01	.	20.221	0.98325	0.0:1.0:0.0:0.0	.	917;941	G5E9B3;Q9BXB1	.;LGR4_HUMAN	L	941;917	ENSP00000368516:R941L;ENSP00000374508:R917L	ENSP00000368516:R941L	R	-	2	0	LGR4	27346024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.393000	0.66279	2.792000	0.96026	0.555000	0.69702	CGC		0.458	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
FAT3	120114	broad.mit.edu	37	11	92495129	92495129	+	Nonsense_Mutation	SNP	C	C	A	rs201043437		TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr11:92495129C>A	ENST00000298047.6	+	4	3794	c.3777C>A	c.(3775-3777)taC>taA	p.Y1259*	RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Nonsense_Mutation_p.Y1259*|FAT3_ENST00000525166.1_Nonsense_Mutation_p.Y1109*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1259	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y1259*(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGAAGGTCTACCAGATCAAGC	0.488										TCGA Ovarian(4;0.039)																																						1	Substitution - Nonsense(1)	ovary(1)	11											180.0	175.0	176.0					11																	92495129		1912	4129	6041	92134777	SO:0001587	stop_gained	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3777C>A	11.37:g.92495129C>A	ENSP00000298047:p.Tyr1259*		92134777	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	43	9.936552	0.99299	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	5.58	2.68	0.31781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3228	0.32138	0.0:0.619:0.0:0.381	.	.	.	.	X	1259;1259;1109	.	ENSP00000298047:Y1259X	Y	+	3	2	FAT3	92134777	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.533000	0.23082	1.355000	0.45865	0.563000	0.77884	TAC		0.488	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
PRB4	5545	broad.mit.edu	37	12	11461282	11461282	+	Missense_Mutation	SNP	T	T	A	rs368003440		TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr12:11461282T>A	ENST00000535904.1	-	3	668	c.635A>T	c.(634-636)aAt>aTt	p.N212I	PRB4_ENST00000279575.1_Missense_Mutation_p.N212I|PRB4_ENST00000445719.2_Missense_Mutation_p.N143I			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	234	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)		p.N212I(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CTGCTGGGGATTGCCTCCTGC	0.652										HNSCC(22;0.051)																																						1	Substitution - Missense(1)	ovary(1)	12											102.0	115.0	110.0					12																	11461282		2203	4300	6503	11352549	SO:0001583	missense	5545				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.635A>T	12.37:g.11461282T>A	ENSP00000442834:p.Asn212Ile		11352549	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	4.603	0.112126	0.08831	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.05580	3.42;3.42;3.42	0.916	-1.83	0.07833	.	.	.	.	.	T	0.06781	0.0173	L	0.59436	1.845	0.09310	N	1	D	0.58268	0.982	P	0.44422	0.449	T	0.15321	-1.0441	9	0.54805	T	0.06	.	1.4043	0.02277	0.3277:0.2656:0.0:0.4067	.	212	E9PAL0	.	I	212;212;143	ENSP00000279575:N212I;ENSP00000442834:N212I;ENSP00000412740:N143I	ENSP00000279575:N212I	N	-	2	0	PRB4	11352549	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-0.598000	0.05706	-0.855000	0.04125	0.329000	0.21502	AAT		0.652	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
EML5	161436	broad.mit.edu	37	14	89129375	89129375	+	Splice_Site	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr14:89129375C>T	ENST00000380664.5	-	24	3497	c.3498G>A	c.(3496-3498)gaG>gaA	p.E1166E	EML5_ENST00000352093.5_Splice_Site_p.E1128E|EML5_ENST00000554922.1_Splice_Site_p.E1166E			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1166						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.E1166E(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GTTGTCCTACCTCCACGCTGG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	14											54.0	55.0	55.0					14																	89129375		1819	3981	5800	88199128	SO:0001630	splice_region_variant	161436			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3498+1G>A	14.37:g.89129375C>T			88199128	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	ENST00000380664.5	37	CCDS45148.1																																																																																				0.408	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		Silent
BDKRB1	623	broad.mit.edu	37	14	96730768	96730768	+	Missense_Mutation	SNP	C	C	T	rs2229459	byFrequency	TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr14:96730768C>T	ENST00000216629.6	+	3	1355	c.749C>T	c.(748-750)gCg>gTg	p.A250V	BDKRB1_ENST00000553356.1_Intron|RP11-404P21.3_ENST00000553638.1_RNA	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	250			A -> V (in dbSNP:rs2229459).		cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)	p.A250V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		AAGACCACAGCGCTGATCCTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	14						C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	90.0	79.0	83.0		749	-0.5	0.7	14	dbSNP_98	83	7,8593	5.7+/-21.5	0,7,4293	yes	missense	BDKRB1	NM_000710.3	64	0,8,6495	TT,TC,CC		0.0814,0.0227,0.0615	benign	250/354	96730768	8,12998	2203	4300	6503	95800521	SO:0001583	missense	623			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.749C>T	14.37:g.96730768C>T	ENSP00000216629:p.Ala250Val		95800521	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	ENST00000216629.6	37	CCDS9943.1	.	.	.	.	.	.	.	.	.	.	C	7.944	0.743487	0.15642	2.27E-4	8.14E-4	ENSG00000100739	ENST00000216629	T	0.36340	1.26	5.04	-0.479	0.12089	GPCR, rhodopsin-like superfamily (1);	1.697010	0.03103	N	0.161339	T	0.18676	0.0448	N	0.04768	-0.165	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.16188	-1.0411	10	0.36615	T	0.2	-5.0333	4.9788	0.14155	0.1064:0.2771:0.4686:0.1478	rs2229459;rs2229459	250	P46663	BKRB1_HUMAN	V	250	ENSP00000216629:A250V	ENSP00000216629:A250V	A	+	2	0	BDKRB1	95800521	0.000000	0.05858	0.709000	0.30452	0.488000	0.33401	-1.606000	0.02072	-0.082000	0.12640	0.555000	0.69702	GCG		0.597	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413300.1		
TLN2	83660	broad.mit.edu	37	15	63125721	63125721	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr15:63125721G>A	ENST00000561311.1	+	54	7251	c.7021G>A	c.(7021-7023)Gac>Aac	p.D2341N	RP11-1069G10.1_ENST00000558888.1_RNA|TLN2_ENST00000306829.6_Missense_Mutation_p.D2341N|RP11-1069G10.1_ENST00000558404.1_RNA			Q9Y4G6	TLN2_HUMAN	talin 2	2341	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D2341N(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TGAGACCCTGGACTTTGAGGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	15											161.0	162.0	162.0					15																	63125721		2203	4300	6503	60912774	SO:0001583	missense	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7021G>A	15.37:g.63125721G>A	ENSP00000453508:p.Asp2341Asn		60912774	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051295	0.55218	.	.	ENSG00000171914	ENST00000306829	T	0.30981	1.51	5.84	4.92	0.64577	I/LWEQ (3);	0.042477	0.85682	D	0.000000	T	0.08758	0.0217	N	0.00599	-1.345	0.50467	D	0.999878	B	0.02656	0.0	B	0.06405	0.002	T	0.30090	-0.9990	10	0.02654	T	1	-20.3183	15.3454	0.74334	0.0679:0.0:0.9321:0.0	.	2341	Q9Y4G6	TLN2_HUMAN	N	2341	ENSP00000303476:D2341N	ENSP00000303476:D2341N	D	+	1	0	TLN2	60912774	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.742000	0.68646	2.767000	0.95098	0.561000	0.74099	GAC		0.507	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
PRSS54	221191	broad.mit.edu	37	16	58327680	58327680	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr16:58327680C>T	ENST00000219301.4	-	3	435	c.41G>A	c.(40-42)cGa>cAa	p.R14Q	PRSS54_ENST00000567164.1_Missense_Mutation_p.R14Q|PRSS54_ENST00000543437.1_5'UTR	NM_001080492.1	NP_001073961.1	Q6PEW0	PRS54_HUMAN	protease, serine, 54	14						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R14Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAGCACCCCTCGCATCTTGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											90.0	66.0	74.0					16																	58327680		2198	4300	6498	56885181	SO:0001583	missense	221191			AK058068	CCDS32463.1	16q21	2010-05-07			ENSG00000103023	ENSG00000103023		"""Serine peptidases / Serine peptidases"""	26336	protein-coding gene	gene with protein product	"""cancer/testis antigen 67"""					17521433	Standard	NM_001080492		Approved	FLJ25339, KLKBL4, CT67	uc002enf.3	Q6PEW0		ENST00000219301.4:c.41G>A	16.37:g.58327680C>T	ENSP00000219301:p.Arg14Gln		56885181	Q96LN9|Q9NT77	Missense_Mutation	SNP	ENST00000219301.4	37	CCDS32463.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236359	0.39498	.	.	ENSG00000103023	ENST00000219301	D	0.89746	-2.56	4.38	3.42	0.39159	.	0.105490	0.38778	N	0.001565	T	0.78641	0.4315	L	0.36672	1.1	0.28425	N	0.917563	D	0.53745	0.962	B	0.33196	0.159	T	0.74621	-0.3604	10	0.54805	T	0.06	-12.4193	8.9302	0.35666	0.0:0.8922:0.0:0.1078	.	14	Q6PEW0	PRS54_HUMAN	Q	14	ENSP00000219301:R14Q	ENSP00000219301:R14Q	R	-	2	0	PRSS54	56885181	0.000000	0.05858	0.867000	0.34043	0.090000	0.18270	-0.546000	0.06062	1.133000	0.42147	-0.266000	0.10368	CGA		0.577	PRSS54-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422556.1	NM_001080492	
NEURL4	84461	broad.mit.edu	37	17	7229863	7229863	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr17:7229863C>T	ENST00000399464.2	-	5	1112	c.1097G>A	c.(1096-1098)cGt>cAt	p.R366H	NEURL4_ENST00000570460.1_Missense_Mutation_p.R344H|NEURL4_ENST00000315614.7_Missense_Mutation_p.R366H	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	366	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R366H(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTTGTCGATACGGATCTGGCA	0.547																																																2	Substitution - Missense(2)	ovary(2)	17											87.0	93.0	91.0					17																	7229863		2024	4185	6209	7170587	SO:0001583	missense	84461				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.1097G>A	17.37:g.7229863C>T	ENSP00000382390:p.Arg366His		7170587	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450527	0.84101	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.38560	1.14;1.13	5.28	5.28	0.74379	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.68495	0.3007	M	0.86028	2.79	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.72994	-0.4122	10	0.72032	D	0.01	-17.15	15.9324	0.79675	0.0:1.0:0.0:0.0	.	366;366	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	H	366	ENSP00000319826:R366H;ENSP00000382390:R366H	ENSP00000319826:R366H	R	-	2	0	NEURL4	7170587	1.000000	0.71417	0.997000	0.53966	0.881000	0.50899	7.192000	0.77771	2.755000	0.94549	0.655000	0.94253	CGT		0.547	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
FKBP10	60681	broad.mit.edu	37	17	39976624	39976624	+	Silent	SNP	T	T	G			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr17:39976624T>G	ENST00000321562.4	+	7	1271	c.1167T>G	c.(1165-1167)tcT>tcG	p.S389S	FKBP10_ENST00000544340.1_Silent_p.S162S	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	389					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.S389S(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		CCCGGCCATCTGAGACCTGCA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	17											164.0	153.0	157.0					17																	39976624		2203	4300	6503	37230150	SO:0001819	synonymous_variant	60681			AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.1167T>G	17.37:g.39976624T>G			37230150	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Silent	SNP	ENST00000321562.4	37	CCDS11409.1	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.480280	0.01027	.	.	ENSG00000141756	ENST00000455106	.	.	.	4.31	-8.63	0.00878	.	.	.	.	.	T	0.45054	0.1323	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.65294	-0.6203	4	.	.	.	-26.3745	5.882	0.18860	0.0721:0.3699:0.3836:0.1744	.	.	.	.	R	193	.	.	L	+	2	0	FKBP10	37230150	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-4.304000	0.00256	-5.649000	0.00011	-2.339000	0.00246	CTG		0.542	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939	
TANC2	26115	broad.mit.edu	37	17	61495768	61495768	+	Splice_Site	SNP	G	G	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr17:61495768G>A	ENST00000424789.2	+	24	4020	c.4016G>A	c.(4015-4017)aGa>aAa	p.R1339K	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Splice_Site_p.R1349K	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1339					in utero embryonic development (GO:0001701)			p.R1349K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CGCAGCAGCAGGTGAGGAGAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											44.0	40.0	41.0					17																	61495768		1997	4166	6163	58849500	SO:0001630	splice_region_variant	26115			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.4016+1G>A	17.37:g.61495768G>A			58849500	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	37	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	G	36	5.736616	0.96865	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.59224	0.28;0.28	5.93	5.93	0.95920	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.041735	0.85682	D	0.000000	T	0.61677	0.2366	N	0.11673	0.155	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.63301	-0.6668	10	0.33141	T	0.24	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	1339	Q9HCD6	TANC2_HUMAN	K	1349;1339	ENSP00000374171:R1349K;ENSP00000387593:R1339K	ENSP00000374171:R1349K	R	+	2	0	TANC2	58849500	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.821000	0.97095	0.555000	0.69702	AGA		0.498	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		Missense_Mutation
ZNF121	7675	broad.mit.edu	37	19	9677501	9677501	+	Silent	SNP	G	G	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr19:9677501G>C	ENST00000586602.1	-	6	704	c.288C>G	c.(286-288)gcC>gcG	p.A96A	ZNF121_ENST00000320451.6_Silent_p.A96A			P58317	ZN121_HUMAN	zinc finger protein 121	96				AF -> NS (in Ref. 2; M99593). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A96A(1)		breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						GATCAACAAAGGCTTCCTCAC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	19											118.0	97.0	104.0					19																	9677501		2203	4300	6503	9538501	SO:0001819	synonymous_variant	7675			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.288C>G	19.37:g.9677501G>C			9538501		Silent	SNP	ENST00000586602.1	37																																																																																					0.428	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727	
CILP2	148113	broad.mit.edu	37	19	19653197	19653197	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr19:19653197C>G	ENST00000291495.5	+	5	691	c.606C>G	c.(604-606)gaC>gaG	p.D202E	CILP2_ENST00000586018.1_Missense_Mutation_p.D208E|CILP2_ENST00000588333.2_3'UTR	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	202						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.D202E(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCAGCCTTGACACCTGTGAAT	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											33.0	32.0	32.0					19																	19653197		2203	4300	6503	19514197	SO:0001583	missense	148113			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.606C>G	19.37:g.19653197C>G	ENSP00000291495:p.Asp202Glu		19514197	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	10.01	1.234637	0.22626	.	.	ENSG00000160161	ENST00000291495	T	0.52295	0.67	5.23	0.437	0.16555	.	0.424079	0.27664	N	0.018380	T	0.35799	0.0944	L	0.49126	1.545	0.09310	N	1	B;B	0.18863	0.031;0.031	B;B	0.24155	0.039;0.051	T	0.31806	-0.9930	10	0.66056	D	0.02	-21.5872	3.6921	0.08350	0.2799:0.4951:0.1415:0.0835	.	202;202	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	E	202	ENSP00000291495:D202E	ENSP00000291495:D202E	D	+	3	2	CILP2	19514197	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	0.229000	0.17833	0.190000	0.20209	0.555000	0.69702	GAC		0.592	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
RTN2	6253	broad.mit.edu	37	19	45992716	45992716	+	Missense_Mutation	SNP	C	C	T	rs146778767		TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr19:45992716C>T	ENST00000245923.4	-	6	1364	c.1129G>A	c.(1129-1131)Gtg>Atg	p.V377M	RTN2_ENST00000430715.2_Missense_Mutation_p.V37M|RTN2_ENST00000590526.1_Missense_Mutation_p.V103M|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000344680.4_Missense_Mutation_p.V304M	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	377	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.V377M(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GCCACGGACACGATGCTAAAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19							MET/VAL,MET/VAL,MET/VAL	0,4404		0,0,2202	86.0	49.0	62.0		1129,910,109	3.4	1.0	19	dbSNP_134	62	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	RTN2	NM_005619.3,NM_206900.1,NM_206901.1	21,21,21	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	377/546,304/473,37/206	45992716	1,13003	2202	4300	6502	50684556	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1129G>A	19.37:g.45992716C>T	ENSP00000245923:p.Val377Met		50684556	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981305	0.34942	0.0	1.16E-4	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.50277	0.75;0.75;0.75	4.47	3.42	0.39159	.	0.063689	0.64402	D	0.000010	T	0.61009	0.2313	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.983;0.988	T	0.62737	-0.6791	10	0.87932	D	0	-14.6599	9.673	0.40023	0.2074:0.7926:0.0:0.0	.	304;377	O75298-2;O75298	.;RTN2_HUMAN	M	304;377;37	ENSP00000345127:V304M;ENSP00000245923:V377M;ENSP00000398178:V37M	ENSP00000245923:V377M	V	-	1	0	RTN2	50684556	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	1.137000	0.31479	1.093000	0.41377	-0.188000	0.12872	GTG		0.622	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619	
USP34	9736	broad.mit.edu	37	2	61436105	61436105	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr2:61436105T>C	ENST00000398571.2	-	70	8924	c.8848A>G	c.(8848-8850)Aga>Gga	p.R2950G	USP34_ENST00000472689.1_5'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2950					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R2950G(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AATAGTATTCTGAAGGCACTA	0.294																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	73.0	73.0					2																	61436105		1811	4053	5864	61289609	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8848A>G	2.37:g.61436105T>C	ENSP00000381577:p.Arg2950Gly		61289609	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.040782|4.040782	0.75732|0.75732	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000411912|ENST00000263989;ENST00000398571	.|T	.|0.63744	.|-0.06	6.0|6.0	4.83|4.83	0.62350|0.62350	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59280|0.59280	0.2182|0.2182	L|L	0.58101|0.58101	1.795|1.795	0.50813|0.50813	D|D	0.999896|0.999896	.|B	.|0.17667	.|0.023	.|B	.|0.18871	.|0.023	T|T	0.57929|0.57929	-0.7726|-0.7726	5|10	.|0.87932	.|D	.|0	.|.	12.6368|12.6368	0.56687|0.56687	0.0:0.0:0.2606:0.7394|0.0:0.0:0.2606:0.7394	.|.	.|2950	.|Q70CQ2	.|UBP34_HUMAN	R|G	709|2798;2950	.|ENSP00000381577:R2950G	.|ENSP00000263989:R2798G	Q|R	-|-	2|1	0|2	USP34|USP34	61289609|61289609	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.781000|2.781000	0.47750|0.47750	1.067000|1.067000	0.40740|0.40740	0.528000|0.528000	0.53228|0.53228	CAG|AGA		0.294	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
LRRTM1	347730	broad.mit.edu	37	2	80529398	80529398	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr2:80529398G>T	ENST00000295057.3	-	2	2203	c.1547C>A	c.(1546-1548)cCc>cAc	p.P516H	CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.P516H|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	516					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P516H(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						TTCCCTCGCGGGCTGCTGGTG	0.602										HNSCC(69;0.2)																																						1	Substitution - Missense(1)	ovary(1)	2											81.0	69.0	73.0					2																	80529398		2203	4300	6503	80382909	SO:0001583	missense	347730			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1547C>A	2.37:g.80529398G>T	ENSP00000295057:p.Pro516His		80382909	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473402	0.84640	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.45668	0.89;0.89	4.99	4.99	0.66335	.	0.000000	0.64402	U	0.000001	T	0.47930	0.1472	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.43540	-0.9385	9	.	.	.	.	18.2542	0.90014	0.0:0.0:1.0:0.0	.	516	Q86UE6	LRRT1_HUMAN	H	516	ENSP00000295057:P516H;ENSP00000386646:P516H	.	P	-	2	0	LRRTM1	80382909	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	9.745000	0.98856	2.276000	0.75962	0.561000	0.74099	CCC		0.602	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
ANKZF1	55139	broad.mit.edu	37	2	220099841	220099841	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr2:220099841G>C	ENST00000323348.5	+	10	1672	c.1498G>C	c.(1498-1500)Gct>Cct	p.A500P	GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000409849.1_Missense_Mutation_p.A290P|ANKZF1_ENST00000410034.3_Missense_Mutation_p.A500P	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	500						membrane (GO:0016020)	metal ion binding (GO:0046872)	p.A500P(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCACTGCTTGCTGCTTGCCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											52.0	56.0	55.0					2																	220099841		2020	4180	6200	219808085	SO:0001583	missense	55139			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1498G>C	2.37:g.220099841G>C	ENSP00000321617:p.Ala500Pro		219808085	Q9NVZ4	Missense_Mutation	SNP	ENST00000323348.5	37	CCDS42821.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999766	0.54147	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.54675	0.56;0.56;0.56	5.41	4.51	0.55191	Ankyrin repeat-containing domain (2);	0.050173	0.85682	D	0.000000	T	0.61527	0.2354	M	0.63428	1.95	0.36600	D	0.874593	D	0.63880	0.993	P	0.59288	0.855	T	0.68903	-0.5286	10	0.72032	D	0.01	-6.021	8.2297	0.31590	0.1588:0.0:0.8412:0.0	.	500	Q9H8Y5	ANKZ1_HUMAN	P	500;290;500	ENSP00000321617:A500P;ENSP00000386815:A290P;ENSP00000386337:A500P	ENSP00000321617:A500P	A	+	1	0	ANKZF1	219808085	0.278000	0.24230	0.957000	0.39632	0.623000	0.37688	1.952000	0.40343	2.814000	0.96858	0.591000	0.81541	GCT		0.607	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
BPI	671	broad.mit.edu	37	20	36956004	36956004	+	Silent	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr20:36956004C>T	ENST00000262865.4	+	11	1277	c.1188C>T	c.(1186-1188)tcC>tcT	p.S396S	BPI_ENST00000489102.1_3'UTR|CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	396					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.S396S(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				CAACTGGTTCCATGGAGGTCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	20											138.0	111.0	120.0					20																	36956004		2203	4300	6503	36389418	SO:0001819	synonymous_variant	671			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.1188C>T	20.37:g.36956004C>T			36389418	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	37	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	C	2.812	-0.246815	0.05867	.	.	ENSG00000101425	ENST00000417318	.	.	.	4.02	-8.04	0.01110	.	.	.	.	.	T	0.17492	0.0420	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17592	-1.0364	4	.	.	.	-7.1243	3.9515	0.09371	0.1104:0.4736:0.2472:0.1689	.	.	.	.	L	222	.	.	P	+	2	0	BPI	36389418	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.211000	0.01226	-2.313000	0.00648	-0.355000	0.07637	CCA		0.577	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725	
TXNRD2	10587	broad.mit.edu	37	22	19902746	19902746	+	Nonsense_Mutation	SNP	G	G	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr22:19902746G>C	ENST00000400521.1	-	7	588	c.582C>G	c.(580-582)taC>taG	p.Y194*	TXNRD2_ENST00000535882.1_Nonsense_Mutation_p.Y193*|TXNRD2_ENST00000334363.9_Nonsense_Mutation_p.Y194*|TXNRD2_ENST00000400518.1_Nonsense_Mutation_p.Y164*|TXNRD2_ENST00000542719.1_Nonsense_Mutation_p.Y164*|TXNRD2_ENST00000400519.1_Nonsense_Mutation_p.Y193*|TXNRD2_ENST00000491939.1_5'UTR	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	194					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)	p.Y194*(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CGTGCGTGGGGTATCTCGGCC	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	22											53.0	63.0	60.0					22																	19902746		2058	4189	6247	18282746	SO:0001587	stop_gained	10587			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.582C>G	22.37:g.19902746G>C	ENSP00000383365:p.Tyr194*		18282746	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Nonsense_Mutation	SNP	ENST00000400521.1	37	CCDS42981.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.308366	0.81247	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719;ENST00000334363	.	.	.	4.58	3.42	0.39159	.	0.149123	0.46442	D	0.000295	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9342	8.0235	0.30423	0.3317:0.0:0.6683:0.0	.	.	.	.	X	164;194;194;171;98;193;193;164;194	.	ENSP00000334451:Y194X	Y	-	3	2	TXNRD2	18282746	1.000000	0.71417	0.995000	0.50966	0.619000	0.37552	2.666000	0.46799	1.128000	0.42052	0.505000	0.49811	TAC		0.567	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440	
CHRD	8646	broad.mit.edu	37	3	184102421	184102421	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr3:184102421G>A	ENST00000204604.1	+	13	1783	c.1537G>A	c.(1537-1539)Gga>Aga	p.G513R	CHRD_ENST00000450923.1_Missense_Mutation_p.G513R|CHRD_ENST00000348986.3_Missense_Mutation_p.G473R|CHRD_ENST00000545352.1_Missense_Mutation_p.G143R|EIF2B5_ENST00000444495.1_Intron	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	513	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)	p.G513R(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTTCCCAGACGGAGAGCTTCG	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											66.0	61.0	63.0					3																	184102421		2203	4300	6503	185585115	SO:0001583	missense	8646			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1537G>A	3.37:g.184102421G>A	ENSP00000204604:p.Gly513Arg		185585115	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818007	0.90790	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.08	5.08	0.68730	CHRD (3);	0.000000	0.85682	D	0.000000	T	0.78027	0.4219	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.998;0.99;1.0	T	0.80792	-0.1224	10	0.87932	D	0	-9.4521	17.931	0.88998	0.0:0.0:1.0:0.0	.	143;473;513;513	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	R	513;513;473;143;226	ENSP00000204604:G513R;ENSP00000408972:G513R;ENSP00000334036:G473R;ENSP00000442948:G143R	ENSP00000204604:G513R	G	+	1	0	CHRD	185585115	1.000000	0.71417	0.978000	0.43139	0.883000	0.51084	8.798000	0.91888	2.744000	0.94065	0.655000	0.94253	GGA		0.627	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
HTR1A	3350	broad.mit.edu	37	5	63257368	63257368	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr5:63257368G>A	ENST00000323865.3	-	1	412	c.179C>T	c.(178-180)gCc>gTc	p.A60V	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	60					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.A60V(1)		cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CAAGGCGATGGCAGCCACCAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											68.0	70.0	69.0					5																	63257368		2203	4300	6503	63293124	SO:0001583	missense	3350			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.179C>T	5.37:g.63257368G>A	ENSP00000316244:p.Ala60Val		63293124	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782295	0.70222	.	.	ENSG00000178394	ENST00000323865	T	0.33216	1.42	4.51	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	T	0.57373	0.2049	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62946	-0.6746	10	0.87932	D	0	.	11.5623	0.50785	0.088:0.0:0.912:0.0	.	60	P08908	5HT1A_HUMAN	V	60	ENSP00000316244:A60V	ENSP00000316244:A60V	A	-	2	0	HTR1A	63293124	1.000000	0.71417	0.997000	0.53966	0.876000	0.50452	9.824000	0.99380	0.895000	0.36342	-0.258000	0.10820	GCC		0.607	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
IQGAP2	10788	broad.mit.edu	37	5	75979615	75979615	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr5:75979615G>A	ENST00000274364.6	+	30	4075	c.3778G>A	c.(3778-3780)Gac>Aac	p.D1260N	IQGAP2_ENST00000379730.3_Missense_Mutation_p.D762N|IQGAP2_ENST00000502745.1_Missense_Mutation_p.D756N|IQGAP2_ENST00000396234.3_Missense_Mutation_p.D756N	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1260					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.D1260N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGGAGCAGTTGACCCCAATGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	89.0	92.0					5																	75979615		2203	4300	6503	76015371	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3778G>A	5.37:g.75979615G>A	ENSP00000274364:p.Asp1260Asn		76015371	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945750	0.53079	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.66	4.79	0.61399	.	0.047529	0.85682	D	0.000000	T	0.45256	0.1333	L	0.58428	1.81	0.80722	D	1	B;B;B	0.15141	0.01;0.01;0.012	B;B;B	0.24155	0.034;0.051;0.023	T	0.34153	-0.9840	10	0.17832	T	0.49	-29.1511	14.7584	0.69588	0.0696:0.0:0.9304:0.0	.	762;756;1260	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	N	1260;762;1210;756;756	ENSP00000274364:D1260N;ENSP00000442313:D762N;ENSP00000421097:D1210N;ENSP00000379535:D756N;ENSP00000426027:D756N	ENSP00000274364:D1260N	D	+	1	0	IQGAP2	76015371	1.000000	0.71417	0.542000	0.28115	0.984000	0.73092	6.522000	0.73783	1.382000	0.46385	0.650000	0.86243	GAC		0.418	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
TMEM181	57583	broad.mit.edu	37	6	158994457	158994457	+	Missense_Mutation	SNP	C	C	T	rs371659971		TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr6:158994457C>T	ENST00000367090.3	+	2	436	c.425C>T	c.(424-426)gCg>gTg	p.A142V		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	142					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)	p.A142V(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		CCCAGGCTGGCGCCCATGCGG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		14184	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	6						C	VAL/ALA	1,4255		0,1,2127	46.0	48.0	47.0		425	4.8	1.0	6		47	0,8424		0,0,4212	no	missense	TMEM181	NM_020823.1	64	0,1,6339	TT,TC,CC		0.0,0.0235,0.0079	benign	142/613	158994457	1,12679	2128	4212	6340	158914445	SO:0001583	missense	57583			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.425C>T	6.37:g.158994457C>T	ENSP00000356057:p.Ala142Val		158914445	Q5VTU1	Missense_Mutation	SNP	ENST00000367090.3	37	CCDS43520.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873089	0.51695	2.35E-4	0.0	ENSG00000146433	ENST00000367090	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.14356	0.0347	N	0.04335	-0.225	0.80722	D	1	D	0.59767	0.986	P	0.46253	0.509	T	0.13098	-1.0522	9	0.02654	T	1	.	16.9834	0.86334	0.0:1.0:0.0:0.0	.	142	Q9P2C4	TM181_HUMAN	V	142	.	ENSP00000356057:A142V	A	+	2	0	TMEM181	158914445	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.640000	0.74319	2.358000	0.79984	0.557000	0.71058	GCG		0.617	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
STEAP2	261729	broad.mit.edu	37	7	89854832	89854832	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr7:89854832T>C	ENST00000287908.3	+	2	829	c.436T>C	c.(436-438)Ttt>Ctt	p.F146L	STEAP2_ENST00000394622.2_Missense_Mutation_p.F146L|STEAP2_ENST00000394632.1_Missense_Mutation_p.F146L|STEAP2_ENST00000394626.1_Missense_Mutation_p.F146L|STEAP2_ENST00000402625.2_Missense_Mutation_p.F146L|STEAP2_ENST00000394629.2_Missense_Mutation_p.F146L|STEAP2_ENST00000394621.2_Missense_Mutation_p.F146L	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	146					copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.F146L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					TGTCAAAGGATTTAATGTTGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	7											101.0	104.0	103.0					7																	89854832		2203	4300	6503	89692768	SO:0001583	missense	261729			AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.436T>C	7.37:g.89854832T>C	ENSP00000287908:p.Phe146Leu		89692768	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	ENST00000287908.3	37	CCDS5615.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606790	0.87157	.	.	ENSG00000157214	ENST00000428074;ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	T;T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.71	5.71	0.89125	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.42832	0.1220	M	0.72118	2.19	0.52501	D	0.999959	P;B;D;D	0.89917	0.778;0.324;1.0;1.0	B;B;D;D	0.85130	0.155;0.04;0.997;0.997	T	0.33266	-0.9875	10	0.66056	D	0.02	-23.4642	15.9837	0.80133	0.0:0.0:0.0:1.0	.	146;146;146;146	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	L	146	ENSP00000401783:F146L;ENSP00000287908:F146L;ENSP00000378123:F146L;ENSP00000378120:F146L;ENSP00000378128:F146L;ENSP00000378119:F146L;ENSP00000384191:F146L;ENSP00000378125:F146L	ENSP00000287908:F146L	F	+	1	0	STEAP2	89692768	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.279000	0.72620	2.185000	0.69588	0.528000	0.53228	TTT		0.378	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999	
PTDSS1	9791	broad.mit.edu	37	8	97342500	97342500	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chr8:97342500C>A	ENST00000517309.1	+	11	1559	c.1233C>A	c.(1231-1233)caC>caA	p.H411Q	PTDSS1_ENST00000455950.2_Missense_Mutation_p.H265Q|PTDSS1_ENST00000522072.1_Missense_Mutation_p.H208Q	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	411					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.H411Q(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ACTATGGTCACCGAGAAAAGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											113.0	100.0	104.0					8																	97342500		2203	4300	6503	97411676	SO:0001583	missense	9791			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1233C>A	8.37:g.97342500C>A	ENSP00000430548:p.His411Gln		97411676	E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	37	CCDS6271.1	.	.	.	.	.	.	.	.	.	.	C	4.551	0.102225	0.08731	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.42131	1.04;1.03;0.98	5.6	2.76	0.32466	.	0.213391	0.50627	N	0.000112	T	0.14056	0.0340	N	0.02539	-0.55	0.32902	D	0.513285	B	0.06786	0.001	B	0.04013	0.001	T	0.14337	-1.0476	10	0.13853	T	0.58	-15.3401	4.5244	0.11975	0.158:0.6065:0.1524:0.0831	.	411	P48651	PTSS1_HUMAN	Q	411;265;208	ENSP00000430548:H411Q;ENSP00000401248:H265Q;ENSP00000430928:H208Q	ENSP00000401248:H265Q	H	+	3	2	PTDSS1	97411676	1.000000	0.71417	0.975000	0.42487	0.467000	0.32768	0.817000	0.27281	0.285000	0.22329	-0.268000	0.10319	CAC		0.463	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2		
RAB9A	9367	broad.mit.edu	37	X	13727278	13727278	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chrX:13727278C>T	ENST00000464506.1	+	3	692	c.413C>T	c.(412-414)gCc>gTc	p.A138V	RAB9A_ENST00000243325.5_3'UTR	NM_001195328.1|NM_004251.4	NP_001182257.1|NP_004242.1	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	138					GTP catabolic process (GO:0006184)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A138V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						ACAGAAGAAGCCCAAGCTTGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	X											102.0	103.0	103.0					X																	13727278		2203	4300	6503	13637199	SO:0001583	missense	9367			U44103	CCDS14156.1	Xp22.2	2010-04-19	2007-01-15	2007-01-15	ENSG00000123595	ENSG00000123595		"""RAB, member RAS oncogene"""	9792	protein-coding gene	gene with protein product		300284	"""RAB9, member RAS oncogene family"""	RAB9		9126495	Standard	NM_004251		Approved		uc010neh.3	P51151	OTTHUMG00000021156	ENST00000464506.1:c.413C>T	X.37:g.13727278C>T	ENSP00000420127:p.Ala138Val		13637199	A8K390|Q6ICN1	Missense_Mutation	SNP	ENST00000464506.1	37	CCDS14156.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576163	0.65878	.	.	ENSG00000123595	ENST00000464506	T	0.79653	-1.29	5.51	5.51	0.81932	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.77831	0.4189	L	0.49778	1.585	0.80722	D	1	B	0.26318	0.146	B	0.28709	0.093	T	0.73091	-0.4092	9	.	.	.	-5.7751	18.4388	0.90656	0.0:1.0:0.0:0.0	.	138	P51151	RAB9A_HUMAN	V	138	ENSP00000420127:A138V	.	A	+	2	0	RAB9A	13637199	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.618000	0.83043	2.296000	0.77279	0.594000	0.82650	GCC		0.453	RAB9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055802.1	NM_004251	
ACOT9	23597	broad.mit.edu	37	X	23723953	23723953	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1431-01A-01D-0472-08	TCGA-24-1431-10A-01D-0472-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	c77ddff7-b3f0-47c7-bac1-dc8b4279bef5	4a04759c-2616-4ad7-95b3-c382bec6e10d	g.chrX:23723953C>A	ENST00000336430.7	-	11	969	c.838G>T	c.(838-840)Gtt>Ttt	p.V280F	ACOT9_ENST00000379303.5_Missense_Mutation_p.V289F|ACOT9_ENST00000379295.1_Missense_Mutation_p.V220F	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	280					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)	p.V280F(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						GAGGGTAAAACTCGACTCCGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	X											105.0	116.0	112.0					X																	23723953		2203	4300	6503	23633874	SO:0001583	missense	23597			AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.838G>T	X.37:g.23723953C>A	ENSP00000336580:p.Val280Phe		23633874	B3KNC9|B7ZM94	Missense_Mutation	SNP	ENST00000336430.7	37	CCDS35216.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371273	0.61624	.	.	ENSG00000123130	ENST00000379303;ENST00000336430;ENST00000379295;ENST00000473710	T;T;T	0.33654	1.4;1.4;1.43	5.36	-0.547	0.11836	.	0.435922	0.27072	N	0.021073	T	0.40222	0.1108	M	0.62016	1.91	0.52501	D	0.999955	P;P;P	0.43909	0.821;0.586;0.534	P;B;P	0.48030	0.517;0.439;0.564	T	0.34153	-0.9840	10	0.62326	D	0.03	-6.966	10.7235	0.46055	0.0:0.4422:0.0:0.5578	.	247;280;289	Q9Y305-2;Q9Y305;Q9Y305-4	.;ACOT9_HUMAN;.	F	289;280;220;206	ENSP00000368605:V289F;ENSP00000336580:V280F;ENSP00000368597:V220F	ENSP00000336580:V280F	V	-	1	0	ACOT9	23633874	0.273000	0.24181	0.982000	0.44146	0.959000	0.62525	-0.197000	0.09518	-0.216000	0.10048	-0.380000	0.06706	GTT		0.353	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
