#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LHX8	431707	broad.mit.edu	37	1	75626511	75626511	+	Silent	SNP	A	A	C			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr1:75626511A>C	ENST00000294638.5	+	10	1666	c.1002A>C	c.(1000-1002)tcA>tcC	p.S334S	LHX8_ENST00000356261.3_Silent_p.S324S	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	334					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S334S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						TAGCTCATTCACCAACAACTC	0.353																																																1	Substitution - coding silent(1)	ovary(1)	1											158.0	152.0	154.0					1																	75626511		2203	4300	6503	75399099	SO:0001819	synonymous_variant	431707			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.1002A>C	1.37:g.75626511A>C			75399099	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																				0.353	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
SLC44A5	204962	broad.mit.edu	37	1	75704260	75704260	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr1:75704260C>G	ENST00000370855.5	-	10	707	c.594G>C	c.(592-594)aaG>aaC	p.K198N	SLC44A5_ENST00000535611.1_Missense_Mutation_p.K68N|SLC44A5_ENST00000370859.3_Missense_Mutation_p.K198N	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	198					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K198N(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						GAAACATCATCTTACTTCCTA	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											178.0	155.0	163.0					1																	75704260		2203	4300	6503	75476848	SO:0001583	missense	204962			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.594G>C	1.37:g.75704260C>G	ENSP00000359892:p.Lys198Asn		75476848	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	5.170	0.216968	0.09810	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.14766	2.88;2.88;2.48	4.9	-0.562	0.11781	.	0.615681	0.18032	N	0.153888	T	0.02418	0.0074	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.0;0.001	B;B;B;B;B	0.09377	0.001;0.004;0.002;0.002;0.004	T	0.45673	-0.9245	10	0.20519	T	0.43	-0.5292	5.4773	0.16702	0.0:0.4357:0.1395:0.4248	.	192;237;198;198;237	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	N	198;237;198;68;191	ENSP00000359896:K198N;ENSP00000359892:K198N;ENSP00000443090:K68N	ENSP00000359892:K198N	K	-	3	2	SLC44A5	75476848	0.347000	0.24853	0.000000	0.03702	0.000000	0.00434	-0.023000	0.12456	-0.066000	0.12998	-1.210000	0.01631	AAG		0.333	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
DNMBP	23268	broad.mit.edu	37	10	101731833	101731833	+	Missense_Mutation	SNP	C	C	T	rs373271192	byFrequency	TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr10:101731833C>T	ENST00000324109.4	-	2	140	c.49G>A	c.(49-51)Gta>Ata	p.V17I	DNMBP_ENST00000342239.3_Missense_Mutation_p.V17I	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	17	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V17I(2)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		TCTTCTGATACGCTAGGGCAG	0.418													c|||	4	0.000798722	0.0	0.0	5008	,	,		15722	0.0		0.0	False		,,,				2504	0.0041															2	Substitution - Missense(2)	ovary(1)|lung(1)	10							ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	127.0	128.0	128.0		49	4.9	0.2	10		128	2,8598	2.2+/-6.3	0,2,4298	no	missense	DNMBP	NM_015221.2	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	17/1578	101731833	3,13003	2203	4300	6503	101721823	SO:0001583	missense	23268			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.49G>A	10.37:g.101731833C>T	ENSP00000315659:p.Val17Ile		101721823	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913694	0.92178	2.27E-4	2.33E-4	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.47869	0.83;0.83	4.93	4.93	0.64822	Src homology-3 domain (4);	0.000000	0.42682	D	0.000664	T	0.49932	0.1586	N	0.05351	-0.065	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.57195	-0.7853	10	0.38643	T	0.18	-13.6492	18.3335	0.90279	0.0:1.0:0.0:0.0	.	17	Q6XZF7	DNMBP_HUMAN	I	17	ENSP00000344914:V17I;ENSP00000315659:V17I	ENSP00000315659:V17I	V	-	1	0	DNMBP	101721823	1.000000	0.71417	0.250000	0.24296	0.886000	0.51366	7.539000	0.82063	2.571000	0.86741	0.555000	0.69702	GTA		0.418	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
MRGPRX2	117194	broad.mit.edu	37	11	19077485	19077485	+	Silent	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr11:19077485G>A	ENST00000329773.2	-	2	552	c.465C>T	c.(463-465)gcC>gcT	p.A155A		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	155					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)	p.A155A(1)		NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GTAGGGACAGGGCCCAGAGCA	0.577																																					GBM(198;1966 2199 4849 37227 49954)											1	Substitution - coding silent(1)	ovary(1)	11											66.0	60.0	62.0					11																	19077485		2199	4293	6492	19034061	SO:0001819	synonymous_variant	117194				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.465C>T	11.37:g.19077485G>A			19034061	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Silent	SNP	ENST00000329773.2	37	CCDS7847.1																																																																																				0.577	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030	
RCOR2	283248	broad.mit.edu	37	11	63681556	63681556	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr11:63681556C>T	ENST00000301459.4	-	8	1148	c.761G>A	c.(760-762)cGa>cAa	p.R254Q	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	254					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R254Q(2)		kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						ACGCCGGGTTCGCAAGGGATG	0.637																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											105.0	97.0	100.0					11																	63681556		2201	4297	6498	63438132	SO:0001583	missense	283248			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.761G>A	11.37:g.63681556C>T	ENSP00000301459:p.Arg254Gln		63438132	Q96FP3	Missense_Mutation	SNP	ENST00000301459.4	37	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.136161	0.77662	.	.	ENSG00000167771	ENST00000301459	T	0.46451	0.87	4.58	4.58	0.56647	.	0.162858	0.43747	D	0.000524	T	0.60599	0.2281	M	0.76574	2.34	0.51482	D	0.999924	D	0.76494	0.999	P	0.58331	0.837	T	0.66164	-0.5992	10	0.66056	D	0.02	.	16.6689	0.85260	0.0:1.0:0.0:0.0	.	254	Q8IZ40	RCOR2_HUMAN	Q	254	ENSP00000301459:R254Q	ENSP00000301459:R254Q	R	-	2	0	RCOR2	63438132	0.998000	0.40836	0.363000	0.25875	0.076000	0.17211	5.842000	0.69417	2.532000	0.85374	0.561000	0.74099	CGA		0.637	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
ADAMTS8	11095	broad.mit.edu	37	11	130275745	130275745	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr11:130275745A>G	ENST00000257359.6	-	9	3084	c.2378T>C	c.(2377-2379)gTc>gCc	p.V793A		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	793	Spacer.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V822A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CTCGCCAGGGACTGTCAGGAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											151.0	159.0	156.0					11																	130275745		2026	4182	6208	129780955	SO:0001583	missense	11095			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.2378T>C	11.37:g.130275745A>G	ENSP00000257359:p.Val793Ala		129780955	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.991009	0.35131	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	T	0.51325	0.71	5.34	4.19	0.49359	ADAM-TS Spacer 1 (1);	0.160615	0.56097	D	0.000032	T	0.54013	0.1832	M	0.62209	1.925	0.38130	D	0.938111	P;P	0.46987	0.888;0.786	P;P	0.50440	0.474;0.641	T	0.59397	-0.7462	10	0.54805	T	0.06	.	11.3529	0.49598	0.9278:0.0:0.0722:0.0	.	793;274	Q9UP79;B3KVX9	ATS8_HUMAN;.	A	191;793;822	ENSP00000257359:V793A	ENSP00000257359:V793A	V	-	2	0	ADAMTS8	129780955	0.561000	0.26578	0.295000	0.24960	0.090000	0.18270	4.802000	0.62539	0.841000	0.35020	0.377000	0.23210	GTC		0.567	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
ATP2A2	488	broad.mit.edu	37	12	110783104	110783104	+	Silent	SNP	T	T	C			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr12:110783104T>C	ENST00000539276.2	+	18	2767	c.2658T>C	c.(2656-2658)gaT>gaC	p.D886D	ATP2A2_ENST00000395494.2_Silent_p.D859D|ATP2A2_ENST00000308664.6_Silent_p.D886D			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	886					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.D886D(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						AAGGCGTGGATTGTGCAATCT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	12											193.0	175.0	181.0					12																	110783104		2203	4300	6503	109267487	SO:0001819	synonymous_variant	488				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2658T>C	12.37:g.110783104T>C			109267487	A6NDN7|B4DF05|P16614|Q86VJ2	Silent	SNP	ENST00000539276.2	37	CCDS9144.1																																																																																				0.443	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
ANKRD11	29123	broad.mit.edu	37	16	89347030	89347030	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr16:89347030G>A	ENST00000301030.4	-	9	6380	c.5920C>T	c.(5920-5922)Cct>Tct	p.P1974S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.P1974S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1974	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P1974S(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GAGCCCACAGGCCAGCTCACA	0.677																																																1	Substitution - Missense(1)	ovary(1)	16											30.0	33.0	32.0					16																	89347030		2164	4218	6382	87874531	SO:0001583	missense	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5920C>T	16.37:g.89347030G>A	ENSP00000301030:p.Pro1974Ser		87874531	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	g	10.24	1.296705	0.23650	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.34667	1.35;1.35	5.29	3.11	0.35812	.	0.347098	0.24363	N	0.039169	T	0.20088	0.0483	L	0.29908	0.895	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.10109	-1.0644	10	0.25751	T	0.34	.	2.2547	0.04052	0.2118:0.1351:0.4965:0.1566	.	1974	Q6UB99	ANR11_HUMAN	S	1974	ENSP00000301030:P1974S;ENSP00000367581:P1974S	ENSP00000301030:P1974S	P	-	1	0	ANKRD11	87874531	1.000000	0.71417	0.995000	0.50966	0.076000	0.17211	3.060000	0.49955	1.229000	0.43630	0.450000	0.29827	CCT		0.677	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ATP2A3	489	broad.mit.edu	37	17	3831596	3831596	+	Silent	SNP	C	C	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr17:3831596C>T	ENST00000352011.3	-	21	3060	c.3006G>A	c.(3004-3006)agG>agA	p.R1002R	ATP2A3_ENST00000397041.3_Intron|ATP2A3_ENST00000397043.3_Intron|ATP2A3_ENST00000309890.7_Silent_p.R1002R|ATP2A3_ENST00000397039.1_Intron|ATP2A3_ENST00000359983.3_Silent_p.R1002R|ATP2A3_ENST00000397035.3_Silent_p.R1002R			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	1002					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.R1002R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		GCGAGACTGTCCTGAGAAGGC	0.622																																					GBM(32;29 774 15719 37967)											1	Substitution - coding silent(1)	ovary(1)	17											38.0	31.0	33.0					17																	3831596		2202	4300	6502	3778345	SO:0001819	synonymous_variant	489				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.3006G>A	17.37:g.3831596C>T			3778345	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Silent	SNP	ENST00000352011.3	37	CCDS11041.1																																																																																				0.622	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
TP53	7157	broad.mit.edu	37	17	7577586	7577586	+	Missense_Mutation	SNP	A	A	T	rs587781589		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr17:7577586A>T	ENST00000269305.4	-	7	884	c.695T>A	c.(694-696)aTc>aAc	p.I232N	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.I232N|TP53_ENST00000413465.2_Missense_Mutation_p.I232N|TP53_ENST00000359597.4_Missense_Mutation_p.I232N|TP53_ENST00000445888.2_Missense_Mutation_p.I232N|TP53_ENST00000420246.2_Missense_Mutation_p.I232N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	232	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I232T(8)|p.I232N(6)|p.?(5)|p.I232_H233insG(3)|p.I232S(2)|p.T230fs*6(2)|p.C229_H233delCTTIH(2)|p.I232_Y236delIHYNY(1)|p.T230_Y234delTTIHY(1)|p.C229_I232del(1)|p.I139T(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.I139_H140insG(1)|p.I232fs*5(1)|p.S227_I232delSDCTTI(1)|p.I232fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGTAGTGGATGGTGGTACA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(5)|Insertion - In frame(4)|Insertion - Frameshift(1)	biliary_tract(5)|haematopoietic_and_lymphoid_tissue(5)|upper_aerodigestive_tract(4)|endometrium(4)|breast(4)|NS(4)|bone(4)|lung(3)|oesophagus(3)|liver(3)|stomach(2)|central_nervous_system(2)|ovary(2)|thymus(1)	17											113.0	90.0	98.0					17																	7577586		2203	4300	6503	7518311	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.695T>A	17.37:g.7577586A>T	ENSP00000269305:p.Ile232Asn		7518311	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964883	0.74131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99811	-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.174276	0.51477	D	0.000096	D	0.99576	0.9847	L	0.60455	1.87	0.54753	D	0.999987	D;D;D;D;D;D	0.71674	0.988;0.967;0.99;0.99;0.99;0.998	D;P;D;D;D;D	0.76575	0.979;0.816;0.954;0.988;0.984;0.94	D	0.97647	1.0152	10	0.87932	D	0	-25.5076	12.3101	0.54924	1.0:0.0:0.0:0.0	.	232;232;139;232;232;232	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	N	232;232;232;232;232;232;221;139;100;139	ENSP00000410739:I232N;ENSP00000352610:I232N;ENSP00000269305:I232N;ENSP00000398846:I232N;ENSP00000391127:I232N;ENSP00000391478:I232N;ENSP00000425104:I100N;ENSP00000423862:I139N	ENSP00000269305:I232N	I	-	2	0	TP53	7518311	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.061000	0.93913	2.074000	0.62210	0.379000	0.24179	ATC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7681663	7681663	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr17:7681663G>A	ENST00000572933.1	+	35	6877	c.5417G>A	c.(5416-5418)gGc>gAc	p.G1806D	DNAH2_ENST00000389173.2_Missense_Mutation_p.G1806D			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1806	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1806D(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GGCCCTGCAGGCACAGGCAAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	17											67.0	63.0	64.0					17																	7681663		2203	4300	6503	7622388	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.5417G>A	17.37:g.7681663G>A	ENSP00000458355:p.Gly1806Asp		7622388	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869958	0.91587	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	D	0.90620	-2.7	5.54	5.54	0.83059	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97962	1.0338	10	0.87932	D	0	.	18.419	0.90582	0.0:0.0:1.0:0.0	.	1806	Q9P225	DYH2_HUMAN	D	1806	ENSP00000373825:G1806D	ENSP00000353818:G1806D	G	+	2	0	DNAH2	7622388	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	9.474000	0.97718	2.890000	0.99128	0.650000	0.86243	GGC		0.577	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CDH2	1000	broad.mit.edu	37	18	25585846	25585846	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr18:25585846A>T	ENST00000269141.3	-	6	1237	c.814T>A	c.(814-816)Tgg>Agg	p.W272R	CDH2_ENST00000399380.3_Missense_Mutation_p.W241R	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	272	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.W272R(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTCCCATTCCAAACCTGGTGT	0.388																																																1	Substitution - Missense(1)	ovary(1)	18											143.0	136.0	138.0					18																	25585846		2203	4300	6503	23839844	SO:0001583	missense	1000			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.814T>A	18.37:g.25585846A>T	ENSP00000269141:p.Trp272Arg		23839844	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575134	0.65878	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.60171	0.21;0.21	5.54	5.54	0.83059	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	N	0.14661	0.345	0.80722	D	1	B;P	0.35923	0.068;0.528	B;B	0.28553	0.051;0.091	T	0.48603	-0.9021	10	0.87932	D	0	.	15.9599	0.79923	1.0:0.0:0.0:0.0	.	241;272	A8MWK3;P19022	.;CADH2_HUMAN	R	272;241	ENSP00000269141:W272R;ENSP00000382312:W241R	ENSP00000269141:W272R	W	-	1	0	CDH2	23839844	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.905000	0.92613	2.227000	0.72691	0.533000	0.62120	TGG		0.388	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
DSG2	1829	broad.mit.edu	37	18	29121187	29121187	+	Silent	SNP	C	C	T	rs201654341	byFrequency	TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr18:29121187C>T	ENST00000261590.8	+	13	2120	c.1911C>T	c.(1909-1911)tgC>tgT	p.C637C	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	637					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C637C(1)		breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TGTGCCATTGCGGAAAGGGCG	0.428													C|||	23	0.00459265	0.0	0.0	5008	,	,		21181	0.001		0.0	False		,,,				2504	0.0225															1	Substitution - coding silent(1)	ovary(1)	18											127.0	110.0	116.0					18																	29121187		1912	4131	6043	27375185	SO:0001819	synonymous_variant	1829			Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1911C>T	18.37:g.29121187C>T			27375185	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																				0.428	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
PCGF1	84759	broad.mit.edu	37	2	74732884	74732884	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr2:74732884T>C	ENST00000233630.6	-	6	1455	c.544A>G	c.(544-546)Aag>Gag	p.K182E	LBX2_ENST00000550249.1_5'Flank|LBX2-AS1_ENST00000603175.1_RNA|LBX2-AS1_ENST00000548978.2_RNA|LBX2_ENST00000341396.2_5'Flank|LBX2_ENST00000460508.3_5'Flank|PCGF1_ENST00000480844.2_5'UTR	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	182	Required for repressor activity.|Sufficient for interaction with BCOR and BCORL1.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.K170E(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						CTTTTATTCTTGTCTTTGCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											178.0	185.0	183.0					2																	74732884		2203	4300	6503	74586392	SO:0001583	missense	84759			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.544A>G	2.37:g.74732884T>C	ENSP00000233630:p.Lys182Glu		74586392	Q7Z506	Missense_Mutation	SNP	ENST00000233630.6	37	CCDS1946.2	.	.	.	.	.	.	.	.	.	.	T	11.96	1.794883	0.31777	.	.	ENSG00000115289	ENST00000233630	T	0.23552	1.9	4.28	4.28	0.50868	.	0.612659	0.17406	N	0.175359	T	0.15478	0.0373	L	0.34521	1.04	0.37548	D	0.918563	P	0.40360	0.714	B	0.35899	0.213	T	0.05053	-1.0909	10	0.08179	T	0.78	-11.4504	9.9913	0.41872	0.0:0.0:0.0:1.0	.	182	Q9BSM1	PCGF1_HUMAN	E	182	ENSP00000233630:K182E	ENSP00000233630:K182E	K	-	1	0	PCGF1	74586392	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.071000	0.50041	1.911000	0.55334	0.533000	0.62120	AAG		0.532	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252216.1	NM_032673	
THSD7B	80731	broad.mit.edu	37	2	138169293	138169293	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr2:138169293G>T	ENST00000409968.1	+	14	2988	c.2810G>T	c.(2809-2811)tGc>tTc	p.C937F	THSD7B_ENST00000272643.3_Missense_Mutation_p.C937F|THSD7B_ENST00000413152.2_Missense_Mutation_p.C906F|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	937	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.C937F(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGGTCAGATTGCATTCTTCCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											135.0	130.0	131.0					2																	138169293		1932	4129	6061	137885763	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2810G>T	2.37:g.138169293G>T	ENSP00000387145:p.Cys937Phe		137885763		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	22.0	4.229964	0.79688	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	D;D;D	0.98585	-5.01;-5.01;-5.01	5.84	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.98823	0.9603	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99620	1.0983	10	0.62326	D	0.03	.	16.364	0.83307	0.0:0.0:0.8669:0.1331	.	937;906	Q9C0I4;C9JKN6	THS7B_HUMAN;.	F	937;937;906	ENSP00000387145:C937F;ENSP00000272643:C937F;ENSP00000413841:C906F	ENSP00000272643:C937F	C	+	2	0	THSD7B	137885763	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.869000	0.99810	1.460000	0.47911	0.557000	0.71058	TGC		0.488	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
FASTKD1	79675	broad.mit.edu	37	2	170417203	170417203	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr2:170417203G>C	ENST00000453153.2	-	5	1011	c.665C>G	c.(664-666)aCc>aGc	p.T222S	FASTKD1_ENST00000453929.2_Missense_Mutation_p.T222S	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	222					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.T222S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						AGAATCTATGGTGTCAAAAAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											50.0	50.0	50.0					2																	170417203		2203	4298	6501	170125449	SO:0001583	missense	79675			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.665C>G	2.37:g.170417203G>C	ENSP00000400513:p.Thr222Ser		170125449	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241277	0.22711	.	.	ENSG00000138399	ENST00000453153;ENST00000453929;ENST00000417376;ENST00000438035;ENST00000445210	T;T	0.19250	2.16;2.16	5.45	2.52	0.30459	.	0.414144	0.27294	N	0.020028	T	0.18383	0.0441	L	0.52126	1.63	0.09310	N	0.999997	B;B;B	0.32693	0.38;0.373;0.256	B;B;B	0.34652	0.091;0.187;0.091	T	0.17349	-1.0372	10	0.20519	T	0.43	-0.2572	9.5254	0.39160	0.0:0.2361:0.3999:0.364	.	199;222;222	D3DPC4;Q53R41-2;Q53R41	.;.;FAKD1_HUMAN	S	222;222;50;199;222	ENSP00000400513:T222S;ENSP00000403229:T222S	ENSP00000408667:T50S	T	-	2	0	FASTKD1	170125449	0.981000	0.34729	0.184000	0.23157	0.634000	0.38068	1.805000	0.38883	0.212000	0.20703	0.655000	0.94253	ACC		0.333	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	
AOX1	316	broad.mit.edu	37	2	201527645	201527645	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr2:201527645G>A	ENST00000374700.2	+	31	3737	c.3496G>A	c.(3496-3498)Gct>Act	p.A1166T	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1166					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.A1166T(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGTTTATGGAGCTGCCTGTTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											161.0	151.0	154.0					2																	201527645		2203	4300	6503	201235890	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3496G>A	2.37:g.201527645G>A	ENSP00000363832:p.Ala1166Thr		201235890	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.455933	0.63401	.	.	ENSG00000138356	ENST00000374700;ENST00000260930;ENST00000439380	T;T;T	0.58940	0.3;0.3;0.89	5.91	4.86	0.63082	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.110120	0.64402	D	0.000009	T	0.63827	0.2544	L	0.60904	1.88	0.38339	D	0.944024	P	0.40000	0.698	P	0.48524	0.58	T	0.66870	-0.5814	10	0.46703	T	0.11	-46.0189	14.8848	0.70560	0.119:0.0:0.881:0.0	.	1166	Q06278	ADO_HUMAN	T	1166;52;6	ENSP00000363832:A1166T;ENSP00000260930:A52T;ENSP00000413326:A6T	ENSP00000260930:A52T	A	+	1	0	AOX1	201235890	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.530000	0.67141	2.809000	0.96659	0.555000	0.69702	GCT		0.468	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
ZDBF2	57683	broad.mit.edu	37	2	207172506	207172506	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr2:207172506A>G	ENST00000374423.3	+	5	3640	c.3254A>G	c.(3253-3255)gAa>gGa	p.E1085G		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1085							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E1085G(1)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TTTGATTCTGAACAACTTCAG	0.313																																																1	Substitution - Missense(1)	ovary(1)	2											47.0	46.0	47.0					2																	207172506		1812	4075	5887	206880751	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.3254A>G	2.37:g.207172506A>G	ENSP00000363545:p.Glu1085Gly		206880751	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	A	2.970	-0.212708	0.06140	.	.	ENSG00000204186	ENST00000374423	T	0.52295	0.67	3.89	-7.79	0.01218	.	1.868530	0.03517	N	0.220362	T	0.27454	0.0674	N	0.25647	0.755	0.09310	N	1	B	0.15719	0.014	B	0.12837	0.008	T	0.10245	-1.0638	10	0.21014	T	0.42	.	4.2939	0.10892	0.1403:0.5033:0.0927:0.2637	.	1085	Q9HCK1	ZDBF2_HUMAN	G	1085	ENSP00000363545:E1085G	ENSP00000363545:E1085G	E	+	2	0	ZDBF2	206880751	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.496000	0.06436	-2.096000	0.00852	-1.255000	0.01485	GAA		0.313	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
MITF	4286	broad.mit.edu	37	3	70008522	70008522	+	Missense_Mutation	SNP	G	G	T	rs542163629		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr3:70008522G>T	ENST00000448226.2	+	9	1257	c.1130G>T	c.(1129-1131)cGa>cTa	p.R377L	MITF_ENST00000314589.5_Missense_Mutation_p.R355L|MITF_ENST00000328528.6_Missense_Mutation_p.R370L|MITF_ENST00000314557.6_Missense_Mutation_p.R264L|MITF_ENST00000394355.2_Missense_Mutation_p.R346L|MITF_ENST00000472437.1_Missense_Mutation_p.R319L|MITF_ENST00000352241.4_Missense_Mutation_p.R371L|MITF_ENST00000394351.3_Missense_Mutation_p.R270L|MITF_ENST00000531774.1_Missense_Mutation_p.R208L			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	377	Leucine-zipper.				bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.R270L(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CTTGAAAACCGACAGAAGAAA	0.463			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	1	Substitution - Missense(1)	ovary(1)	3											86.0	75.0	79.0					3																	70008522		2203	4300	6503	70091212	SO:0001583	missense	4286				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1130G>T	3.37:g.70008522G>T	ENSP00000391803:p.Arg377Leu		70091212	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.410380	0.96072	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T;T	0.34472	2.61;2.14;2.38;2.61;1.36;2.59;2.59;2.4;1.84;2.38	6.06	6.06	0.98353	.	0.049815	0.85682	D	0.000000	T	0.62258	0.2413	M	0.84219	2.685	0.58432	D	0.999999	D;D;D;D;D;P;D	0.76494	0.993;0.996;0.996;0.998;0.999;0.867;0.996	D;D;D;D;D;P;D	0.74023	0.932;0.969;0.969;0.982;0.982;0.697;0.969	T	0.64076	-0.6492	9	.	.	.	.	13.7717	0.63029	0.0697:0.0:0.9303:0.0	.	319;270;264;346;355;370;371	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	L	371;377;319;370;361;355;346;264;270;208	ENSP00000295600:R371L;ENSP00000391803:R377L;ENSP00000418845:R319L;ENSP00000327867:R370L;ENSP00000398639:R361L;ENSP00000324443:R355L;ENSP00000377884:R346L;ENSP00000324246:R264L;ENSP00000377880:R270L;ENSP00000435909:R208L	.	R	+	2	0	MITF	70091212	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	8.061000	0.89467	2.882000	0.98803	0.655000	0.94253	CGA		0.463	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
UGT2B10	7365	broad.mit.edu	37	4	69681921	69681921	+	Missense_Mutation	SNP	C	C	A	rs200957276		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr4:69681921C>A	ENST00000265403.7	+	1	211	c.184C>A	c.(184-186)Ctt>Att	p.L62I	UGT2B10_ENST00000458688.2_Missense_Mutation_p.L62I	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	62					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.L62I(1)		endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						AGCTTCCATTCTTTTTGATCC	0.388																																					Melanoma(133;755 1763 25578 26334 46021)											1	Substitution - Missense(1)	ovary(1)	4											92.0	99.0	96.0					4																	69681921		2203	4296	6499	69716510	SO:0001583	missense	7365			X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.184C>A	4.37:g.69681921C>A	ENSP00000265403:p.Leu62Ile		69716510	A8K9M3|B4DPP1|Q14CR8	Missense_Mutation	SNP	ENST00000265403.7	37		.	.	.	.	.	.	.	.	.	.	c	5.738	0.320603	0.10845	.	.	ENSG00000109181	ENST00000265403;ENST00000458688	T;T	0.60299	0.2;0.21	2.63	-5.27	0.02763	.	0.107986	0.36167	U	0.002758	T	0.45094	0.1325	L	0.55990	1.75	0.09310	N	1	B;B	0.19583	0.003;0.037	B;B	0.23419	0.019;0.046	T	0.22521	-1.0214	10	0.41790	T	0.15	.	9.893	0.41300	0.0:0.4043:0.0:0.5957	.	62;62	B4DPP1;P36537	.;UDB10_HUMAN	I	62	ENSP00000265403:L62I;ENSP00000413420:L62I	ENSP00000265403:L62I	L	+	1	0	UGT2B10	69716510	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.108000	0.03313	-1.555000	0.01697	-1.140000	0.01884	CTT		0.388	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365169.1	NM_001075	
PCDH1	5097	broad.mit.edu	37	5	141248436	141248436	+	Missense_Mutation	SNP	C	C	T	rs566915735		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr5:141248436C>T	ENST00000394536.3	-	2	740	c.601G>A	c.(601-603)Ggt>Agt	p.G201S	PCDH1_ENST00000536585.1_Missense_Mutation_p.G179S|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000503492.1_Missense_Mutation_p.G201S|PCDH1_ENST00000456271.1_Missense_Mutation_p.G201S|PCDH1_ENST00000287008.3_Missense_Mutation_p.G201S	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	201	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G201S(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GATGCCACACCGTTGGGACCA	0.597																																					Ovarian(132;1609 1739 4190 14731 45037)											1	Substitution - Missense(1)	ovary(1)	5											192.0	185.0	188.0					5																	141248436		2203	4300	6503	141228620	SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.601G>A	5.37:g.141248436C>T	ENSP00000378043:p.Gly201Ser		141228620	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	c	26.8	4.772396	0.90108	.	.	ENSG00000156453	ENST00000503492;ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T;T	0.60672	0.79;0.17;0.17;0.17;0.17;0.17	4.39	4.39	0.52855	Cadherin (4);Cadherin-like (1);	0.000000	0.52532	D	0.000067	T	0.66597	0.2805	L	0.37561	1.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.67465	-0.5664	10	0.49607	T	0.09	.	14.8544	0.70326	0.0:1.0:0.0:0.0	.	201;201	Q08174;Q08174-2	PCDH1_HUMAN;.	S	201;201;201;201;212;179	ENSP00000424667:G201S;ENSP00000287008:G201S;ENSP00000378043:G201S;ENSP00000403497:G201S;ENSP00000350122:G212S;ENSP00000438825:G179S	ENSP00000287008:G201S	G	-	1	0	PCDH1	141228620	1.000000	0.71417	0.938000	0.37757	0.977000	0.68977	5.811000	0.69187	2.442000	0.82660	0.550000	0.68814	GGT		0.597	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
GPR151	134391	broad.mit.edu	37	5	145894800	145894800	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr5:145894800C>T	ENST00000311104.2	-	1	953	c.877G>A	c.(877-879)Gtc>Atc	p.V293I		NM_194251.2	NP_919227.2	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V293I(1)		endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(2)	14			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACATCAAGACTTGAGACAGG	0.498																																					Pancreas(78;420 1386 18535 37114 49710)											1	Substitution - Missense(1)	ovary(1)	5											74.0	78.0	77.0					5																	145894800		2203	4300	6503	145874993	SO:0001583	missense	134391			AY255557	CCDS34266.1	5q32	2012-08-21						"""GPCR / Class A : Orphans"""	23624	protein-coding gene	gene with protein product	"""galanin receptor 4"""					12679517	Standard	NM_194251		Approved	PGR7, GALR4	uc003lod.1	Q8TDV0		ENST00000311104.2:c.877G>A	5.37:g.145894800C>T	ENSP00000308733:p.Val293Ile		145874993	Q86SN8|Q8NGV2	Missense_Mutation	SNP	ENST00000311104.2	37	CCDS34266.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483687	0.44147	.	.	ENSG00000173250	ENST00000311104	T	0.72282	-0.64	6.17	6.17	0.99709	GPCR, rhodopsin-like superfamily (1);	0.142484	0.48767	D	0.000167	T	0.58495	0.2126	L	0.29908	0.895	0.38507	D	0.948385	B	0.32283	0.362	B	0.35278	0.199	T	0.55988	-0.8053	10	0.12430	T	0.62	.	12.9056	0.58149	0.0:0.9255:0.0:0.0745	.	293	Q8TDV0	GP151_HUMAN	I	293	ENSP00000308733:V293I	ENSP00000308733:V293I	V	-	1	0	GPR151	145874993	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.124000	0.42006	2.941000	0.99782	0.655000	0.94253	GTC		0.498	GPR151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373457.1	NM_194251	
FAXDC2	10826	broad.mit.edu	37	5	154203153	154203153	+	Splice_Site	SNP	C	C	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr5:154203153C>T	ENST00000326080.5	-	6	790		c.e6-1		FAXDC2_ENST00000517938.1_Splice_Site|FAXDC2_ENST00000523997.1_Splice_Site	NM_032385.3	NP_115761.2	Q96IV6	FXDC2_HUMAN	fatty acid hydroxylase domain containing 2						fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.?(1)									CAGGATCCACCTGCCCAAGGG	0.527																																																1	Unknown(1)	ovary(1)	5											65.0	68.0	67.0					5																	154203153		2011	4147	6158	154183346	SO:0001630	splice_region_variant	10826			AF159165	CCDS43390.1	5q31-q32	2013-03-04	2013-03-04	2013-03-04	ENSG00000170271	ENSG00000170271		"""Fatty acid hydroxylase domain containing"""	1334	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 4"""	C5orf4		10843801	Standard	NM_032385		Approved	FLJ13758	uc003lvs.4	Q96IV6	OTTHUMG00000164141	ENST00000326080.5:c.367-1G>A	5.37:g.154203153C>T			154183346	B4DIE1|Q9BSX6|Q9H8C7	Splice_Site	SNP	ENST00000326080.5	37	CCDS43390.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385564	0.61956	.	.	ENSG00000170271	ENST00000326080;ENST00000517938;ENST00000519501	.	.	.	4.78	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2021	0.54333	0.0:0.9163:0.0:0.0837	.	.	.	.	.	-1	.	.	.	-	.	.	C5orf4	154183346	1.000000	0.71417	0.970000	0.41538	0.845000	0.48019	7.204000	0.77872	1.003000	0.39130	0.561000	0.74099	.		0.527	FAXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377429.1	NM_032385	Intron
AIMP2	7965	broad.mit.edu	37	7	6057486	6057486	+	Silent	SNP	G	G	T			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr7:6057486G>T	ENST00000223029.3	+	3	503	c.384G>T	c.(382-384)ccG>ccT	p.P128P	AIMP2_ENST00000395236.2_Silent_p.P59P|AIMP2_ENST00000400479.2_Silent_p.P50P|SNORA42_ENST00000384488.1_RNA	NM_006303.3	NP_006294.2	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 2	128	Interaction with PARK2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|tRNA aminoacylation for protein translation (GO:0006418)|Type II pneumocyte differentiation (GO:0060510)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P128P(1)		large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACGCAAACCCGGCCTCCCCTC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	7											83.0	54.0	64.0					7																	6057486		2203	4300	6503	6024012	SO:0001819	synonymous_variant	7965			U24169	CCDS5344.1	7p22.1	2009-05-29			ENSG00000106305	ENSG00000106305			20609	protein-coding gene	gene with protein product		600859				8666379, 18695251	Standard	NM_006303		Approved	p38, PRO0992, JTV-1, JTV1	uc003spo.3	Q13155	OTTHUMG00000122077	ENST00000223029.3:c.384G>T	7.37:g.6057486G>T			6024012	Q75MR1|Q96CZ5|Q9P1L2	Silent	SNP	ENST00000223029.3	37	CCDS5344.1																																																																																				0.592	AIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242834.2	NM_006303	
CHRNB3	1142	broad.mit.edu	37	8	42587044	42587044	+	Silent	SNP	C	C	T	rs544144336		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr8:42587044C>T	ENST00000289957.2	+	5	722	c.594C>T	c.(592-594)aaC>aaT	p.N198N		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	198					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)	p.N198N(1)		endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	TCTTCGATAACGGAGAATGGG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	8											96.0	95.0	95.0					8																	42587044		2203	4300	6503	42706201	SO:0001819	synonymous_variant	1142			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.594C>T	8.37:g.42587044C>T			42706201	Q15827	Silent	SNP	ENST00000289957.2	37	CCDS6134.1																																																																																				0.463	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
TAF2	6873	broad.mit.edu	37	8	120809290	120809290	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chr8:120809290C>G	ENST00000378164.2	-	8	1329	c.1031G>C	c.(1030-1032)aGg>aCg	p.R344T		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	344					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R344T(1)		NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GGCTAAACACCTTCTAGTCAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											98.0	94.0	95.0					8																	120809290		2203	4300	6503	120878471	SO:0001583	missense	6873			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.1031G>C	8.37:g.120809290C>G	ENSP00000367406:p.Arg344Thr		120878471	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375350	0.42105	.	.	ENSG00000064313	ENST00000378164	T	0.41065	1.01	5.87	5.87	0.94306	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.054297	0.85682	D	0.000000	T	0.29716	0.0742	N	0.11927	0.2	0.53688	D	0.999973	B	0.14012	0.009	B	0.15484	0.013	T	0.07654	-1.0761	10	0.20519	T	0.43	-0.8406	20.5827	0.99408	0.0:1.0:0.0:0.0	.	344	Q6P1X5	TAF2_HUMAN	T	344	ENSP00000367406:R344T	ENSP00000367406:R344T	R	-	2	0	TAF2	120878471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.978000	0.70501	2.941000	0.99782	0.655000	0.94253	AGG		0.363	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
GPR143	4935	broad.mit.edu	37	X	9711619	9711619	+	Silent	SNP	C	C	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:9711619C>A	ENST00000467482.1	-	6	899	c.753G>T	c.(751-753)ctG>ctT	p.L251L	GPR143_ENST00000380929.2_Silent_p.L271L			P51810	GP143_HUMAN	G protein-coupled receptor 143	251					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)	p.L271L(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				TAATTAAAACCAGCATGATTT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	X											126.0	111.0	116.0					X																	9711619		2203	4299	6502	9671619	SO:0001819	synonymous_variant	4935			Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.753G>T	X.37:g.9711619C>A			9671619	Q6NTI7	Silent	SNP	ENST00000467482.1	37	CCDS14134.2	.	.	.	.	.	.	.	.	.	.	C	1.776	-0.483132	0.04383	.	.	ENSG00000101850	ENST00000447366	.	.	.	5.15	3.37	0.38596	.	.	.	.	.	T	0.59473	0.2196	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52939	-0.8508	4	.	.	.	-3.274	9.7819	0.40653	0.0:0.8238:0.0:0.1762	.	.	.	.	C	187	.	.	G	-	1	0	GPR143	9671619	1.000000	0.71417	0.997000	0.53966	0.294000	0.27393	2.923000	0.48868	0.398000	0.25338	0.513000	0.50165	GGT		0.413	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055714.2	NM_000273	
BEND2	139105	broad.mit.edu	37	X	18221738	18221738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:18221738G>A	ENST00000380033.4	-	5	922	c.790C>T	c.(790-792)Cga>Tga	p.R264*	BEND2_ENST00000380030.3_Nonsense_Mutation_p.R264*	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	264								p.R264*(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						GATTCTCTTCGTGACAGAACT	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	X											146.0	125.0	132.0					X																	18221738		2203	4300	6503	18131659	SO:0001587	stop_gained	139105			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.790C>T	X.37:g.18221738G>A	ENSP00000369372:p.Arg264*		18131659	E9PFY2|Q4V9S2|Q5JXE5	Nonsense_Mutation	SNP	ENST00000380033.4	37	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047836	0.75846	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	.	.	.	3.93	0.851	0.18989	.	3.166820	0.01285	U	0.009860	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	0.829	3.7036	0.08391	0.1276:0.0:0.4394:0.433	.	.	.	.	X	264	.	ENSP00000369369:R264X	R	-	1	2	BEND2	18131659	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.926000	0.28804	0.288000	0.22398	-0.568000	0.04159	CGA		0.463	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
TFE3	7030	broad.mit.edu	37	X	48891027	48891027	+	Silent	SNP	G	G	A	rs201808352		TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:48891027G>A	ENST00000315869.7	-	8	1348	c.1089C>T	c.(1087-1089)aaC>aaT	p.N363N	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	363	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N363N(1)	NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						TGATCCTGTCGTTAATGTTGA	0.552			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""								G|||	1	0.000264901	0.0	0.0	3775	,	,		14829	0.001		0.0	False		,,,				2504	0.0						Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	1	Substitution - coding silent(1)	ovary(1)	X											94.0	71.0	79.0					X																	48891027		2203	4300	6503	48777971	SO:0001819	synonymous_variant	7030			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1089C>T	X.37:g.48891027G>A			48777971	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Silent	SNP	ENST00000315869.7	37	CCDS14315.3																																																																																				0.552	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	NM_006521	
KIF4A	24137	broad.mit.edu	37	X	69626849	69626849	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:69626849G>A	ENST00000374403.3	+	28	3261	c.3179G>A	c.(3178-3180)gGt>gAt	p.G1060D	KIF4A_ENST00000374388.3_Missense_Mutation_p.G1060D	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	1060	Globular.|Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.G1060D(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						gatggtgatggtgatgatgat	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	71.0	75.0					X																	69626849		2203	4300	6503	69543574	SO:0001583	missense	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3179G>A	X.37:g.69626849G>A	ENSP00000363524:p.Gly1060Asp		69543574	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.585123	0.00872	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.68181	-0.28;-0.31	5.06	0.147	0.14838	.	0.821953	0.10570	N	0.659188	T	0.51092	0.1654	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32587	-0.9901	9	.	.	.	.	7.3289	0.26571	0.5463:0.0:0.4537:0.0	.	1060	O95239	KIF4A_HUMAN	D	1060;1060;362	ENSP00000363509:G1060D;ENSP00000363524:G1060D	.	G	+	2	0	KIF4A	69543574	0.797000	0.28877	0.045000	0.18777	0.226000	0.24999	-0.115000	0.10741	-0.014000	0.14175	0.594000	0.82650	GGT		0.443	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
ZMAT1	84460	broad.mit.edu	37	X	101152861	101152861	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:101152861G>A	ENST00000372782.3	-	5	532	c.485C>T	c.(484-486)tCa>tTa	p.S162L	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.S162L	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	162						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S162L(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TTGAAATCCTGATGGAGATGC	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											123.0	94.0	104.0					X																	101152861		2203	4300	6503	101039517	SO:0001583	missense	84460			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.485C>T	X.37:g.101152861G>A	ENSP00000361868:p.Ser162Leu		101039517	Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	37	CCDS35348.1	.	.	.	.	.	.	.	.	.	.	G	2.356	-0.347745	0.05208	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.15487	2.42;2.42	4.45	2.62	0.31277	.	1.178140	0.06628	N	0.758610	T	0.20047	0.0482	M	0.72353	2.195	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.33650	-0.9860	10	0.30854	T	0.27	1.3418	5.3452	0.16006	0.1153:0.2026:0.6821:0.0	.	162	Q5H9K5	ZMAT1_HUMAN	L	162	ENSP00000361868:S162L;ENSP00000437529:S162L	ENSP00000361868:S162L	S	-	2	0	ZMAT1	101039517	0.939000	0.31865	0.007000	0.13788	0.210000	0.24377	1.226000	0.32563	0.444000	0.26612	0.590000	0.80494	TCA		0.408	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
ZIC3	7547	broad.mit.edu	37	X	136649869	136649869	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2019-01A-02W-0722-08	TCGA-24-2019-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	857459f1-444c-4205-ae00-449ff7a263c6	3689ea37-ad0e-4647-acb3-690f98b9d104	g.chrX:136649869C>G	ENST00000287538.5	+	1	1569	c.1019C>G	c.(1018-1020)gCc>gGc	p.A340G	ZIC3_ENST00000370606.3_Missense_Mutation_p.A340G	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	340	Nuclear localization signal.				anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A340G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					AAGATCTTTGCCCGTTCTGAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											60.0	65.0	63.0					X																	136649869		2201	4296	6497	136477535	SO:0001583	missense	7547			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1019C>G	X.37:g.136649869C>G	ENSP00000287538:p.Ala340Gly		136477535	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.634252	0.67130	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.41400	1.0;1.0	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	N	0.20807	0.61	0.80722	D	1	P	0.45474	0.859	P	0.56648	0.803	T	0.52049	-0.8627	10	0.87932	D	0	.	16.2665	0.82581	0.0:1.0:0.0:0.0	.	340	O60481	ZIC3_HUMAN	G	340	ENSP00000287538:A340G;ENSP00000359638:A340G	ENSP00000287538:A340G	A	+	2	0	ZIC3	136477535	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.646000	0.83445	2.299000	0.77371	0.596000	0.82720	GCC		0.582	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
