#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM69	51249	broad.mit.edu	37	1	46159420	46159420	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr1:46159420C>T	ENST00000372025.4	+	3	1744	c.587C>T	c.(586-588)gCa>gTa	p.A196V	RP11-767N6.7_ENST00000430643.1_RNA|TMEM69_ENST00000496366.1_3'UTR	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	196						integral component of membrane (GO:0016021)		p.A196V(1)		kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					ATGGGAGTAGCATTCCACCTT	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	104.0	107.0					1																	46159420		1857	4102	5959	45932007	SO:0001583	missense	51249			BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.587C>T	1.37:g.46159420C>T	ENSP00000361095:p.Ala196Val		45932007	Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	ENST00000372025.4	37	CCDS41325.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299308	0.60195	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.62	5.62	0.85841	.	0.288147	0.39146	N	0.001454	T	0.75273	0.3827	M	0.75777	2.31	0.58432	D	0.999997	D	0.60160	0.987	P	0.58620	0.842	T	0.70063	-0.4975	9	0.16420	T	0.52	-3.544	19.6559	0.95842	0.0:1.0:0.0:0.0	.	196	Q5SWH9	TMM69_HUMAN	V	196	.	ENSP00000361095:A196V	A	+	2	0	TMEM69	45932007	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	5.720000	0.68470	2.657000	0.90304	0.491000	0.48974	GCA		0.393	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098390.1	NM_016486	
NEXN	91624	broad.mit.edu	37	1	78383899	78383899	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr1:78383899G>T	ENST00000334785.7	+	5	572	c.388G>T	c.(388-390)Gag>Tag	p.E130*	NEXN_ENST00000457030.1_Nonsense_Mutation_p.E130*|NEXN_ENST00000330010.8_Nonsense_Mutation_p.E66*|NEXN_ENST00000294624.8_Nonsense_Mutation_p.E130*	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)									p.E130*(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		ACGCAGAATTGAGCAGGATAT	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	1											130.0	127.0	128.0					1																	78383899		1908	4117	6025	78156487	SO:0001587	stop_gained	91624			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.388G>T	1.37:g.78383899G>T	ENSP00000333938:p.Glu130*		78156487		Nonsense_Mutation	SNP	ENST00000334785.7	37	CCDS41351.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.939585|6.939585	0.97948|0.97948	.|.	.|.	ENSG00000162614|ENSG00000162614	ENST00000401035;ENST00000457030;ENST00000330010;ENST00000294624;ENST00000334785;ENST00000440324|ENST00000342754	.|.	.|.	.|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.53938|.	D|.	0.000060|.	.|T	.|0.71476	.|0.3344	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68085	.|-0.5502	.|3	0.62326|.	D|.	0.03|.	-16.3273|-16.3273	19.2924|19.2924	0.94105|0.94105	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|F	66;130;66;130;130;130|29	.|.	ENSP00000294624:E130X|.	E|L	+|+	1|3	0|2	NEXN|NEXN	78156487|78156487	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	6.794000|6.794000	0.75135|0.75135	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GAG|TTG		0.373	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097549.1	NM_144573	
RBMXL1	494115	broad.mit.edu	37	1	89448770	89448770	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr1:89448770C>G	ENST00000321792.5	-	2	1167	c.740G>C	c.(739-741)gGt>gCt	p.G247A	CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.G247A|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000260508.4_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	247					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G247A(1)									ACTGGAATGACCATAATCACG	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											177.0	156.0	163.0					1																	89448770		2203	4298	6501	89221358	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.740G>C	1.37:g.89448770C>G	ENSP00000318415:p.Gly247Ala		89221358		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548961	0.27652	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.79845	-1.31;-1.31	1.76	1.76	0.24704	.	0.206159	0.42964	D	0.000622	T	0.64305	0.2586	M	0.62266	1.93	0.29879	N	0.826229	P	0.34977	0.478	B	0.37731	0.257	T	0.58393	-0.7644	10	0.42905	T	0.14	.	9.1404	0.36899	0.0:1.0:0.0:0.0	.	247	Q96E39	RBMXL_HUMAN	A	247	ENSP00000318415:G247A;ENSP00000446099:G247A	ENSP00000318415:G247A	G	-	2	0	RBMXL1	89221358	1.000000	0.71417	0.786000	0.31890	0.675000	0.39556	3.753000	0.55180	0.982000	0.38575	0.306000	0.20318	GGT		0.428	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
LYST	1130	broad.mit.edu	37	1	235993636	235993636	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr1:235993636C>T	ENST00000389794.3	-	3	256	c.82G>A	c.(82-84)Gag>Aag	p.E28K	LYST_ENST00000536965.1_Missense_Mutation_p.E28K|LYST_ENST00000389793.2_Missense_Mutation_p.E28K			Q99698	LYST_HUMAN	lysosomal trafficking regulator	28					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.E28K(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCCCTGGCCTCCACCCTCTGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	83.0	85.0					1																	235993636		2203	4300	6503	234060259	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.82G>A	1.37:g.235993636C>T	ENSP00000374444:p.Glu28Lys		234060259	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	36	5.839809	0.97009	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.72505	-0.66;-0.66;0.49	5.86	5.86	0.93980	.	0.203176	0.42294	D	0.000728	D	0.83202	0.5203	L	0.60455	1.87	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.998;0.994;0.997	D	0.83576	0.0115	10	0.87932	D	0	.	20.1813	0.98205	0.0:1.0:0.0:0.0	.	28;28;28	B7ZMN7;Q99698-3;Q99698	.;.;LYST_HUMAN	K	28	ENSP00000374444:E28K;ENSP00000374443:E28K;ENSP00000438315:E28K	ENSP00000374443:E28K	E	-	1	0	LYST	234060259	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.177000	0.77650	2.763000	0.94921	0.585000	0.79938	GAG		0.493	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
ARHGAP21	57584	broad.mit.edu	37	10	24874369	24874369	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr10:24874369C>T	ENST00000396432.2	-	26	5335	c.4849G>A	c.(4849-4851)Gac>Aac	p.D1617N		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1616	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.D1616N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TCTGCCTCGTCCCCCTTGCTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											77.0	77.0	77.0					10																	24874369		2203	4300	6503	24914375	SO:0001583	missense	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4849G>A	10.37:g.24874369C>T	ENSP00000379709:p.Asp1617Asn		24914375	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607998	0.46527	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.13657	2.57	5.19	3.24	0.37175	.	0.272342	0.40640	N	0.001057	T	0.16854	0.0405	L	0.59436	1.845	0.80722	D	1	B	0.31383	0.321	B	0.31812	0.136	T	0.07328	-1.0778	10	0.72032	D	0.01	.	14.1659	0.65475	0.2723:0.7277:0.0:0.0	.	1616	Q5T5U3	RHG21_HUMAN	N	1617;1066	ENSP00000379709:D1617N	ENSP00000379709:D1617N	D	-	1	0	ARHGAP21	24914375	1.000000	0.71417	0.019000	0.16419	0.526000	0.34562	4.777000	0.62361	1.151000	0.42436	0.591000	0.81541	GAC		0.567	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
FAM196A	642938	broad.mit.edu	37	10	128974383	128974383	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr10:128974383G>A	ENST00000522781.1	-	4	832	c.277C>T	c.(277-279)Cgc>Tgc	p.R93C	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.R93C	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	93								p.R93C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						ATGGACCTGCGTGCGGGCACT	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											123.0	106.0	112.0					10																	128974383		2203	4300	6503	128864373	SO:0001583	missense	642938				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.277C>T	10.37:g.128974383G>A	ENSP00000429763:p.Arg93Cys		128864373	B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	37	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247164	0.80024	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.51325	0.71;0.71	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62923	-0.6751	10	0.59425	D	0.04	.	18.9361	0.92586	0.0:0.0:1.0:0.0	.	93;93	B7ZME7;Q6ZSG2	.;F196A_HUMAN	C	93	ENSP00000429763:R93C;ENSP00000428730:R93C	ENSP00000428730:R93C	R	-	1	0	FAM196A	128864373	0.999000	0.42202	0.366000	0.25914	0.978000	0.69477	2.855000	0.48333	2.552000	0.86080	0.563000	0.77884	CGC		0.617	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
CORO1B	57175	broad.mit.edu	37	11	67210003	67210003	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr11:67210003G>A	ENST00000341356.5	-	2	207	c.97C>T	c.(97-99)Cgt>Tgt	p.R33C	CORO1B_ENST00000545016.1_Missense_Mutation_p.R33C|CORO1B_ENST00000453768.2_Missense_Mutation_p.R33C|CORO1B_ENST00000393893.1_Missense_Mutation_p.R33C|CORO1B_ENST00000539724.1_5'Flank	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	33					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)	p.R33C(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CAGGTAACACGGGACACGCGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	94.0	106.0					11																	67210003		2199	4295	6494	66966579	SO:0001583	missense	57175			AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.97C>T	11.37:g.67210003G>A	ENSP00000340211:p.Arg33Cys		66966579	B2RD45	Missense_Mutation	SNP	ENST00000341356.5	37	CCDS8164.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889250	0.91889	.	.	ENSG00000172725	ENST00000393893;ENST00000341356;ENST00000393886;ENST00000453768;ENST00000545016	T;T;T;T	0.78246	-0.0;-0.0;1.76;-1.16	4.31	3.39	0.38822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.000000	0.44285	D	0.000474	D	0.86464	0.5939	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	0.995;0.998;1.0	P;P;D	0.67725	0.892;0.886;0.953	D	0.87582	0.2485	10	0.62326	D	0.03	-13.6447	12.3892	0.55348	0.0839:0.0:0.9161:0.0	.	33;33;33	E7EW44;F5H0D2;Q9BR76	.;.;COR1B_HUMAN	C	33;33;60;33;33	ENSP00000377471:R33C;ENSP00000340211:R33C;ENSP00000416006:R33C;ENSP00000438056:R33C	ENSP00000340211:R33C	R	-	1	0	CORO1B	66966579	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.577000	0.46042	1.145000	0.42336	0.563000	0.77884	CGT		0.597	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
ARID2	196528	broad.mit.edu	37	12	46230406	46230406	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr12:46230406G>A	ENST00000334344.6	+	7	912	c.740G>A	c.(739-741)cGt>cAt	p.R247H	ARID2_ENST00000422737.1_Missense_Mutation_p.R98H|ARID2_ENST00000444670.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	247					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R247H(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AATGAAGTTCGTGACCTCATT	0.274			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											70.0	72.0	72.0					12																	46230406		2203	4300	6503	44516673	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.740G>A	12.37:g.46230406G>A	ENSP00000335044:p.Arg247His		44516673	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310954	0.81358	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	T	0.36340	1.26	5.42	5.42	0.78866	.	0.054227	0.64402	D	0.000001	T	0.54498	0.1862	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.49844	-0.8896	10	0.46703	T	0.11	-9.6962	19.5742	0.95434	0.0:0.0:1.0:0.0	.	247	Q68CP9	ARID2_HUMAN	H	247;98	ENSP00000335044:R247H	ENSP00000335044:R247H	R	+	2	0	ARID2	44516673	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.704000	0.74639	2.698000	0.92095	0.591000	0.81541	CGT		0.274	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
KRT4	3851	broad.mit.edu	37	12	53207919	53207919	+	Missense_Mutation	SNP	C	C	G	rs199899456		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr12:53207919C>G	ENST00000293774.4	-	1	416	c.146G>C	c.(145-147)cGa>cCa	p.R49P	KRT4_ENST00000458244.2_5'Flank|KRT4_ENST00000551956.1_5'UTR			P19013	K2C4_HUMAN	keratin 4	0	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.R49P(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCTCAGCCTTCGTCTCTTATA	0.567																																					Pancreas(190;284 2995 41444 45903)											1	Substitution - Missense(1)	ovary(1)	12											30.0	36.0	34.0					12																	53207919		1972	4165	6137	51494186	SO:0001583	missense	3851				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000293774.4:c.146G>C	12.37:g.53207919C>G	ENSP00000293774:p.Arg49Pro		51494186	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000293774.4	37		.	.	.	.	.	.	.	.	.	.	G	0.852	-0.738341	0.03111	.	.	ENSG00000170477	ENST00000293774	D	0.83506	-1.73	5.12	3.08	0.35506	.	.	.	.	.	T	0.74535	0.3729	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.62305	-0.6882	6	0.33141	T	0.24	.	4.0943	0.09983	0.0712:0.2193:0.3623:0.3472	.	.	.	.	P	49	ENSP00000293774:R49P	ENSP00000293774:R49P	R	-	2	0	KRT4	51494186	0.000000	0.05858	0.662000	0.29724	0.522000	0.34438	-0.529000	0.06186	0.637000	0.30526	-0.120000	0.15030	CGA		0.567	KRT4-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002272	
STAT6	6778	broad.mit.edu	37	12	57501507	57501507	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr12:57501507C>T	ENST00000300134.3	-	3	461	c.136G>A	c.(136-138)Gac>Aac	p.D46N	STAT6_ENST00000537215.2_5'UTR|STAT6_ENST00000556155.1_Missense_Mutation_p.D46N|STAT6_ENST00000538913.2_Intron|STAT6_ENST00000543873.2_Missense_Mutation_p.D46N|STAT6_ENST00000454075.3_Missense_Mutation_p.D46N	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	46					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.D46N(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						CAGAAGGCGTCGGAGCCGACC	0.602																																																1	Substitution - Missense(1)	ovary(1)	12																																								55787774	SO:0001583	missense	6778			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.136G>A	12.37:g.57501507C>T	ENSP00000300134:p.Asp46Asn		55787774	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.380239	0.24944	.	.	ENSG00000166888	ENST00000300134;ENST00000543873;ENST00000556155;ENST00000454075;ENST00000542516;ENST00000555849;ENST00000556259;ENST00000553499;ENST00000553397;ENST00000554663;ENST00000554825;ENST00000557635;ENST00000553275	T;T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	4.88	4.88	0.63580	STAT transcription factor, protein interaction (4);	0.185209	0.45606	D	0.000347	T	0.45357	0.1338	N	0.13235	0.315	0.80722	D	1	D;P	0.89917	1.0;0.951	D;B	0.91635	0.999;0.411	T	0.30504	-0.9976	10	0.02654	T	1	-16.9118	13.4016	0.60887	0.0:1.0:0.0:0.0	.	46;46	A8K4S9;P42226	.;STAT6_HUMAN	N	46	ENSP00000300134:D46N;ENSP00000438451:D46N;ENSP00000451742:D46N;ENSP00000401486:D46N;ENSP00000452394:D46N;ENSP00000452373:D46N;ENSP00000451074:D46N;ENSP00000452203:D46N;ENSP00000450665:D46N;ENSP00000451209:D46N;ENSP00000450747:D46N;ENSP00000450732:D46N	ENSP00000300134:D46N	D	-	1	0	STAT6	55787774	0.688000	0.27680	0.127000	0.21898	0.512000	0.34134	1.937000	0.40193	2.532000	0.85374	0.655000	0.94253	GAC		0.602	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
TPCN1	53373	broad.mit.edu	37	12	113706676	113706676	+	Splice_Site	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr12:113706676C>T	ENST00000335509.6	+	6	972	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C	TPCN1_ENST00000550785.1_Splice_Site_p.R292C|TPCN1_ENST00000392569.4_Splice_Site_p.R152C|TPCN1_ENST00000541517.1_Splice_Site_p.R292C	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	220					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)	p.R220C(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						TGGCGTCCGGCGGTAAGGCCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	12											112.0	86.0	95.0					12																	113706676		2203	4300	6503	112191059	SO:0001630	splice_region_variant	53373			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.659+1C>T	12.37:g.113706676C>T			112191059	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	37	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717531	0.89205	.	.	ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569	D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0	4.9	4.9	0.64082	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98861	0.9615	M	0.88310	2.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.98667	1.0686	10	0.44086	T	0.13	-22.5982	11.1773	0.48607	0.3138:0.6862:0.0:0.0	.	220;292;220	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	C	220;292;292;152	ENSP00000335300:R220C;ENSP00000448083:R292C;ENSP00000438125:R292C;ENSP00000376350:R152C	ENSP00000335300:R220C	R	+	1	0	TPCN1	112191059	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.029000	0.64121	2.533000	0.85409	0.655000	0.94253	CGC		0.632	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	Missense_Mutation
L2HGDH	79944	broad.mit.edu	37	14	50735979	50735979	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr14:50735979T>C	ENST00000267436.4	-	7	1205	c.808A>G	c.(808-810)Agt>Ggt	p.S270G	L2HGDH_ENST00000261699.4_Missense_Mutation_p.S270G|L2HGDH_ENST00000421284.3_Missense_Mutation_p.S270G			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	270					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)	p.S270G(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					GTGCAGCCACTCAACTCTGAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	14											128.0	124.0	125.0					14																	50735979		2203	4300	6503	49805729	SO:0001583	missense	79944				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.808A>G	14.37:g.50735979T>C	ENSP00000267436:p.Ser270Gly		49805729	Q9BRR1	Missense_Mutation	SNP	ENST00000267436.4	37	CCDS9698.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.241125|4.241125	0.79912|0.79912	.|.	.|.	ENSG00000087299|ENSG00000087299	ENST00000557131|ENST00000261699;ENST00000267436;ENST00000421284	.|D;D;D	.|0.85702	.|-2.02;-2.02;-2.02	5.57|5.57	5.57|5.57	0.84162|0.84162	.|FAD dependent oxidoreductase (1);	.|0.088247	.|0.85682	.|D	.|0.000000	.|D	.|0.90222	.|0.6943	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D	.|0.63880	.|0.993;0.993	.|D;D	.|0.69307	.|0.963;0.963	.|D	.|0.89395	.|0.3691	.|10	.|0.38643	.|T	.|0.18	.|-10.2095	16.0372|16.0372	0.80640|0.80640	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|270;270	.|C9JVN9;Q9H9P8	.|.;L2HDH_HUMAN	.|G	-1|270	.|ENSP00000261699:S270G;ENSP00000267436:S270G;ENSP00000405559:S270G	.|ENSP00000261699:S270G	.|S	-|-	.|1	.|0	L2HGDH|L2HGDH	49805729|49805729	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.986000|5.986000	0.70563|0.70563	2.254000|2.254000	0.74563|0.74563	0.523000|0.523000	0.50628|0.50628	.|AGT		0.398	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
PCNX	22990	broad.mit.edu	37	14	71492844	71492844	+	Missense_Mutation	SNP	G	G	A	rs373015087		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr14:71492844G>A	ENST00000304743.2	+	14	3640	c.3194G>A	c.(3193-3195)cGt>cAt	p.R1065H	PCNX_ENST00000439984.3_Missense_Mutation_p.R954H|PCNX_ENST00000238570.5_Missense_Mutation_p.R1065H	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1065						integral component of membrane (GO:0016021)		p.R1065H(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GGTCATAATCGTATCATTGCC	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17142	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14						G	HIS/ARG	0,4406		0,0,2203	144.0	132.0	136.0		3194	5.6	1.0	14		136	1,8599	1.2+/-3.3	0,1,4299	no	missense	PCNX	NM_014982.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1065/2342	71492844	1,13005	2203	4300	6503	70562597	SO:0001583	missense	22990			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3194G>A	14.37:g.71492844G>A	ENSP00000304192:p.Arg1065His		70562597	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.932368|4.932368	0.92389|0.92389	0.0|0.0	1.16E-4|1.16E-4	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.62232|.	0.04;0.04;0.04|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72220|0.72220	0.3433|0.3433	L|L	0.55743|0.55743	1.74|1.74	0.80722|0.80722	D|D	1|1	P;D|.	0.89917|.	0.872;1.0|.	B;D|.	0.78314|.	0.301;0.991|.	T|T	0.68254|0.68254	-0.5457|-0.5457	10|5	0.34782|.	T|.	0.22|.	.|.	19.6932|19.6932	0.96010|0.96010	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	954;1065|.	B2RTR6;Q96RV3|.	.;PCX1_HUMAN|.	H|I	1065;1065;954|124	ENSP00000304192:R1065H;ENSP00000238570:R1065H;ENSP00000396617:R954H|.	ENSP00000238570:R1065H|.	R|V	+|+	2|1	0|0	PCNX|PCNX	70562597|70562597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.951000|7.951000	0.87819|0.87819	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	CGT|GTA		0.348	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
TDRD9	122402	broad.mit.edu	37	14	104457534	104457534	+	Nonsense_Mutation	SNP	C	C	T	rs377183290		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr14:104457534C>T	ENST00000409874.4	+	9	1201	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*	TDRD9_ENST00000339063.5_Nonsense_Mutation_p.R385*	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	385	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R100*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TGTGTTGGAGCGAAGCAGTGT	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	14											193.0	173.0	180.0					14																	104457534		2203	4300	6503	103527287	SO:0001587	stop_gained	122402			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1153C>T	14.37:g.104457534C>T	ENSP00000387303:p.Arg385*		103527287	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Nonsense_Mutation	SNP	ENST00000409874.4	37	CCDS9987.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.442261|5.442261	0.96187|0.96187	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000557332|ENST00000409874;ENST00000339063	.|.	.|.	.|.	5.63|5.63	4.72|4.72	0.59763|0.59763	.|.	.|0.224693	.|0.31145	.|N	.|0.008165	T|.	0.34308|.	0.0893|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35276|.	-0.9795|.	3|.	.|0.02654	.|T	.|1	.|.	13.7168|13.7168	0.62702|0.62702	0.1545:0.8455:0.0:0.0|0.1545:0.8455:0.0:0.0	.|.	.|.	.|.	.|.	V|X	111|385	.|.	.|ENSP00000343545:R385X	A|R	+|+	2|1	0|2	TDRD9|TDRD9	103527287|103527287	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.933000|0.933000	0.57130|0.57130	0.920000|0.920000	0.28705|0.28705	1.323000|1.323000	0.45263|0.45263	0.655000|0.655000	0.94253|0.94253	GCG|CGA		0.408	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
TRPM7	54822	broad.mit.edu	37	15	50901807	50901807	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr15:50901807C>A	ENST00000313478.7	-	19	2832	c.2551G>T	c.(2551-2553)Gca>Tca	p.A851S	TRPM7_ENST00000560955.1_Missense_Mutation_p.A851S	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	851					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.A851S(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ACAATTGGTGCATGATAAAAG	0.343																																																1	Substitution - Missense(1)	ovary(1)	15											171.0	158.0	162.0					15																	50901807		1826	4072	5898	48689099	SO:0001583	missense	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2551G>T	15.37:g.50901807C>A	ENSP00000320239:p.Ala851Ser		48689099	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	33	5.217128	0.95104	.	.	ENSG00000092439	ENST00000313478	T	0.74737	-0.87	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.83982	0.5372	M	0.69463	2.115	0.80722	D	1	D	0.57899	0.981	P	0.58970	0.849	D	0.85246	0.1041	10	0.87932	D	0	-17.1912	19.5869	0.95493	0.0:1.0:0.0:0.0	.	851	Q96QT4	TRPM7_HUMAN	S	851	ENSP00000320239:A851S	ENSP00000320239:A851S	A	-	1	0	TRPM7	48689099	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.645000	0.89757	0.467000	0.42956	GCA		0.343	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
KIAA0556	23247	broad.mit.edu	37	16	27720106	27720106	+	Silent	SNP	G	G	A	rs375213710		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr16:27720106G>A	ENST00000261588.4	+	13	1489	c.1470G>A	c.(1468-1470)tcG>tcA	p.S490S	KIAA0556_ENST00000567894.1_3'UTR|CTD-2049O4.1_ENST00000568831.1_RNA|CTD-2049O4.1_ENST00000564893.1_RNA|CTD-2049O4.1_ENST00000563052.1_RNA	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	490						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S490S(1)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGGGCAACTCGTGGTGGGTGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	16											109.0	96.0	100.0					16																	27720106		2197	4300	6497	27627607	SO:0001819	synonymous_variant	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1470G>A	16.37:g.27720106G>A			27627607	A7E2C2	Silent	SNP	ENST00000261588.4	37	CCDS32415.1																																																																																				0.488	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
SRSF1	6426	broad.mit.edu	37	17	56084348	56084348	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr17:56084348G>A	ENST00000258962.4	-	1	359	c.151C>T	c.(151-153)Cgc>Tgc	p.R51C	SRSF1_ENST00000584773.1_Missense_Mutation_p.R51C|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000585096.1_Missense_Mutation_p.R51C|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000582730.2_Missense_Mutation_p.R51C	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	51	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R51C(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGTCCCCCGCGGCGATTCTTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											126.0	112.0	117.0					17																	56084348		2203	4300	6503	53439347	SO:0001583	missense	6426				CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.151C>T	17.37:g.56084348G>A	ENSP00000258962:p.Arg51Cys		53439347	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	ENST00000258962.4	37	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330547	0.41297	.	.	ENSG00000136450	ENST00000258962	T	0.06294	3.32	5.58	5.58	0.84498	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.15176	0.0366	M	0.89840	3.065	0.80722	D	1	B;B	0.33022	0.376;0.394	B;B	0.33690	0.168;0.117	T	0.00544	-1.1679	10	0.41790	T	0.15	.	13.4445	0.61134	0.0:0.0:0.8431:0.1569	.	83;51	Q59FA2;Q07955	.;SRSF1_HUMAN	C	51	ENSP00000258962:R51C	ENSP00000258962:R51C	R	-	1	0	SRSF1	53439347	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.039000	0.57325	2.906000	0.99361	0.655000	0.94253	CGC		0.582	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
RYR1	6261	broad.mit.edu	37	19	39019037	39019037	+	Missense_Mutation	SNP	C	C	T	rs369390137		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr19:39019037C>T	ENST00000359596.3	+	74	10916	c.10916C>T	c.(10915-10917)aCg>aTg	p.T3639M	RYR1_ENST00000355481.4_Missense_Mutation_p.T3634M|AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000360985.3_Missense_Mutation_p.T3639M			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3639	Interaction with CALM.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.T3639M(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTCCGTATGACGCCCCTGTAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	19						C	MET/THR,MET/THR	0,4406		0,0,2203	54.0	50.0	51.0		10916,10901	4.8	1.0	19		51	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	3639/5039,3634/5034	39019037	1,13005	2203	4300	6503	43710877	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10916C>T	19.37:g.39019037C>T	ENSP00000352608:p.Thr3639Met		43710877	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.979303	0.53827	0.0	1.16E-4	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96913	-4.17;-4.17;-4.17	4.8	4.8	0.61643	.	0.000000	0.64402	U	0.000001	D	0.97704	0.9247	M	0.74258	2.255	0.46356	D	0.999007	D;D;D	0.89917	1.0;0.999;0.998	D;D;P	0.67231	0.95;0.917;0.828	D	0.98262	1.0499	10	0.66056	D	0.02	.	16.7746	0.85548	0.0:1.0:0.0:0.0	.	3639;3634;3639	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	M	3639;3634;3639;559	ENSP00000352608:T3639M;ENSP00000347667:T3634M;ENSP00000354254:T3639M	ENSP00000347667:T3634M	T	+	2	0	RYR1	43710877	0.997000	0.39634	0.995000	0.50966	0.982000	0.71751	3.653000	0.54446	2.504000	0.84457	0.555000	0.69702	ACG		0.612	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
HTRA2	27429	broad.mit.edu	37	2	74758044	74758044	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:74758044C>T	ENST00000258080.3	+	3	1348	c.718C>T	c.(718-720)Ctc>Ttc	p.L240F	HTRA2_ENST00000467961.1_3'UTR|HTRA2_ENST00000352222.3_Intron|AUP1_ENST00000377526.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	240	Serine protease.				adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)	p.L240F(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						TTAGGAGCCTCTCCCCACGCT	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											199.0	211.0	207.0					2																	74758044		2203	4300	6503	74611552	SO:0001583	missense	27429				CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.718C>T	2.37:g.74758044C>T	ENSP00000258080:p.Leu240Phe		74611552	Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	ENST00000258080.3	37	CCDS1951.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454454	0.63290	.	.	ENSG00000115317	ENST00000258080;ENST00000437202	D;D	0.89875	-2.58;-2.58	4.64	4.64	0.57946	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.000000	0.85682	D	0.000000	D	0.92538	0.7630	L	0.60012	1.86	0.80722	D	1	D;D;D	0.67145	0.994;0.996;0.994	D;P;D	0.67231	0.95;0.898;0.938	D	0.93064	0.6477	10	0.72032	D	0.01	-13.419	15.3795	0.74641	0.0:1.0:0.0:0.0	.	240;240;240	A8K7G2;O43464-3;O43464	.;.;HTRA2_HUMAN	F	240;227	ENSP00000258080:L240F;ENSP00000399166:L227F	ENSP00000258080:L240F	L	+	1	0	HTRA2	74611552	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.761000	0.55242	2.584000	0.87258	0.462000	0.41574	CTC		0.567	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
KCNH7	90134	broad.mit.edu	37	2	163302673	163302673	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:163302673A>C	ENST00000332142.5	-	7	1508	c.1409T>G	c.(1408-1410)tTc>tGc	p.F470C	KCNH7_ENST00000328032.4_Missense_Mutation_p.F463C	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	470					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.F470C(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TGTTGTTCTGAAGTTTATTAA	0.358																																					GBM(196;1492 2208 17507 24132 45496)											1	Substitution - Missense(1)	ovary(1)	2											99.0	92.0	94.0					2																	163302673		2203	4300	6503	163010919	SO:0001583	missense	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1409T>G	2.37:g.163302673A>C	ENSP00000331727:p.Phe470Cys		163010919	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133414	0.77662	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.96041	-3.89;-3.89	5.7	5.7	0.88788	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98140	0.9386	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.99	D	0.99243	1.0885	10	0.87932	D	0	.	15.9661	0.79970	1.0:0.0:0.0:0.0	.	463;470	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	C	470;463	ENSP00000331727:F470C;ENSP00000333781:F463C	ENSP00000333781:F463C	F	-	2	0	KCNH7	163010919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.182000	0.69389	0.528000	0.53228	TTC		0.358	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
SCN9A	6335	broad.mit.edu	37	2	167085346	167085346	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:167085346G>T	ENST00000409435.1	-	21	4060	c.4061C>A	c.(4060-4062)aCa>aAa	p.T1354K	SCN9A_ENST00000375387.4_Missense_Mutation_p.T1355K|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.T1355K|SCN9A_ENST00000409672.1_Missense_Mutation_p.T1343K			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1354					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.T1343K(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGACCCATCTGTGGTGTTAAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											206.0	213.0	210.0					2																	167085346		2098	4260	6358	166793592	SO:0001583	missense	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4061C>A	2.37:g.167085346G>T	ENSP00000386330:p.Thr1354Lys		166793592	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632473	0.87660	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000011	D	0.99080	0.9684	M	0.88241	2.94	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	D	0.99675	1.0997	10	0.87932	D	0	.	18.8019	0.92022	0.0:0.0:1.0:0.0	.	1343	E7EUN6	.	K	1343;1355;1355;1354	ENSP00000386306:T1343K;ENSP00000364536:T1355K;ENSP00000304748:T1355K;ENSP00000386330:T1354K	ENSP00000304748:T1355K	T	-	2	0	SCN9A	166793592	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	7.858000	0.86971	2.454000	0.82982	0.557000	0.71058	ACA		0.398	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
RAPH1	65059	broad.mit.edu	37	2	204304938	204304938	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:204304938G>A	ENST00000319170.5	-	14	3274	c.2975C>T	c.(2974-2976)cCc>cTc	p.P992L	RAPH1_ENST00000374493.3_Missense_Mutation_p.P1044L|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000295851.5_3'UTR	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	992					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.P992L(1)		breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGTCTCTTGGGCTCGGGGTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	92.0	91.0					2																	204304938		2203	4300	6503	204013183	SO:0001583	missense	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.2975C>T	2.37:g.204304938G>A	ENSP00000316543:p.Pro992Leu		204013183	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.692909	0.48202	.	.	ENSG00000173166	ENST00000319170;ENST00000374493	T;T	0.44083	0.93;0.93	4.24	4.24	0.50183	.	0.245513	0.21192	U	0.078639	T	0.30417	0.0764	N	0.14661	0.345	0.80722	D	1	B	0.21606	0.058	B	0.21151	0.033	T	0.21861	-1.0233	10	0.87932	D	0	.	17.1608	0.86803	0.0:0.0:1.0:0.0	.	992	Q70E73	RAPH1_HUMAN	L	992;1044	ENSP00000316543:P992L;ENSP00000363617:P1044L	ENSP00000316543:P992L	P	-	2	0	RAPH1	204013183	.	.	0.968000	0.41197	0.410000	0.31052	.	.	2.368000	0.80403	0.467000	0.42956	CCC		0.597	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
TTLL4	9654	broad.mit.edu	37	2	219603723	219603723	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:219603723G>T	ENST00000392102.1	+	3	1664	c.1324G>T	c.(1324-1326)Gac>Tac	p.D442Y	TTLL4_ENST00000442769.1_Missense_Mutation_p.D442Y|TTLL4_ENST00000258398.4_Missense_Mutation_p.D442Y|TTLL4_ENST00000457313.1_Missense_Mutation_p.D277Y	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	442					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)	p.D442Y(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		ATCTGTAATTGACTCCTCAGC	0.527																																					GBM(172;1818 2053 15407 20943 49753)											1	Substitution - Missense(1)	ovary(1)	2											105.0	101.0	102.0					2																	219603723		2203	4300	6503	219311967	SO:0001583	missense	9654				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1324G>T	2.37:g.219603723G>T	ENSP00000375951:p.Asp442Tyr		219311967	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	G	7.473	0.647125	0.14516	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.05081	3.69;3.93;3.5;3.93	4.67	0.478	0.16789	.	0.655728	0.15203	N	0.274909	T	0.05456	0.0144	L	0.29908	0.895	0.09310	N	1	P;B;P	0.39576	0.679;0.146;0.679	B;B;B	0.41723	0.365;0.127;0.365	T	0.32851	-0.9891	10	0.59425	D	0.04	.	5.6115	0.17408	0.2743:0.1486:0.5771:0.0	.	277;442;442	E9PH58;E7EX20;Q14679	.;.;TTLL4_HUMAN	Y	277;442;442;442	ENSP00000393332:D277Y;ENSP00000375951:D442Y;ENSP00000396555:D442Y;ENSP00000258398:D442Y	ENSP00000258398:D442Y	D	+	1	0	TTLL4	219311967	0.000000	0.05858	0.000000	0.03702	0.452000	0.32318	-0.080000	0.11339	0.207000	0.20607	0.561000	0.74099	GAC		0.527	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
CAPN10	11132	broad.mit.edu	37	2	241534673	241534673	+	Silent	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr2:241534673G>A	ENST00000391984.2	+	7	1426	c.1230G>A	c.(1228-1230)gcG>gcA	p.A410A	CAPN10_ENST00000404753.3_Silent_p.A410A|CAPN10_ENST00000391982.2_Silent_p.A410A|CAPN10_ENST00000354082.4_Silent_p.A410A|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000352879.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	410	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.A410A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GGAGCCCAGCGAGCATCCCGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	2											38.0	40.0	39.0					2																	241534673		2203	4300	6503	241183346	SO:0001819	synonymous_variant	11132			AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1230G>A	2.37:g.241534673G>A			241183346	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Silent	SNP	ENST00000391984.2	37	CCDS42838.1																																																																																				0.657	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083	
TMC2	117532	broad.mit.edu	37	20	2605002	2605002	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr20:2605002G>A	ENST00000358864.1	+	17	2281	c.2266G>A	c.(2266-2268)Gcc>Acc	p.A756T		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	756					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)	p.A756T(1)		NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGCTTTCCTCGCCAATCCAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											171.0	127.0	142.0					20																	2605002		2203	4300	6503	2553002	SO:0001583	missense	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2266G>A	20.37:g.2605002G>A	ENSP00000351732:p.Ala756Thr		2553002	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301654	0.40694	.	.	ENSG00000149488	ENST00000358864	T	0.62941	-0.01	4.99	4.99	0.66335	.	0.162897	0.53938	D	0.000051	T	0.49864	0.1582	L	0.37630	1.12	0.40865	D	0.983868	B	0.30851	0.297	B	0.21708	0.036	T	0.48399	-0.9039	10	0.21014	T	0.42	-18.013	16.1587	0.81683	0.0:0.0:1.0:0.0	.	756	Q8TDI7	TMC2_HUMAN	T	756	ENSP00000351732:A756T	ENSP00000351732:A756T	A	+	1	0	TMC2	2553002	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	4.579000	0.60936	2.486000	0.83907	0.557000	0.71058	GCC		0.488	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
OSBPL2	9885	broad.mit.edu	37	20	60847220	60847220	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr20:60847220C>T	ENST00000313733.3	+	5	500	c.298C>T	c.(298-300)Cct>Tct	p.P100S	OSBPL2_ENST00000439951.2_Missense_Mutation_p.P8S|OSBPL2_ENST00000358053.2_Missense_Mutation_p.P88S	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	100					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.P100S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CTTCAACGAGCCTCTGAGCTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	20											113.0	87.0	96.0					20																	60847220		2203	4300	6503	60280615	SO:0001583	missense	9885			AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.298C>T	20.37:g.60847220C>T	ENSP00000316649:p.Pro100Ser		60280615	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	ENST00000313733.3	37	CCDS13495.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150513	0.78001	.	.	ENSG00000130703	ENST00000358053;ENST00000313733;ENST00000439951	T;T;T	0.56275	0.47;0.47;0.47	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.82263	0.4999	H	0.96208	3.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87797	0.2622	10	0.87932	D	0	-18.3947	19.0302	0.92953	0.0:1.0:0.0:0.0	.	8;88;100	E7ET92;Q9H1P3-2;Q9H1P3	.;.;OSBL2_HUMAN	S	88;100;8	ENSP00000350755:P88S;ENSP00000316649:P100S;ENSP00000397602:P8S	ENSP00000316649:P100S	P	+	1	0	OSBPL2	60280615	1.000000	0.71417	0.997000	0.53966	0.246000	0.25737	7.597000	0.82733	2.659000	0.90383	0.561000	0.74099	CCT		0.612	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835	
ADRBK2	157	broad.mit.edu	37	22	26100154	26100154	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr22:26100154C>T	ENST00000324198.6	+	15	1498	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.R436W(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	CGTTAGCAAGCGGCTGGGCTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	22											73.0	72.0	72.0					22																	26100154		2203	4300	6503	24430154	SO:0001583	missense	157			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.1306C>T	22.37:g.26100154C>T	ENSP00000317578:p.Arg436Trp		24430154	Q9UGW9	Missense_Mutation	SNP	ENST00000324198.6	37	CCDS13832.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104666	0.37145	.	.	ENSG00000100077	ENST00000324198	T	0.72051	-0.62	5.75	3.64	0.41730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88433	0.6435	H	0.98612	4.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.986	D	0.87780	0.2611	10	0.87932	D	0	-20.7452	7.3848	0.26876	0.3997:0.5234:0.0:0.0769	.	436;436	A8K869;P35626	.;ARBK2_HUMAN	W	436	ENSP00000317578:R436W	ENSP00000317578:R436W	R	+	1	2	ADRBK2	24430154	1.000000	0.71417	0.155000	0.22561	0.039000	0.13416	1.561000	0.36342	0.758000	0.33059	-0.136000	0.14681	CGG		0.478	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4	NM_005160	
SETD5	55209	broad.mit.edu	37	3	9470678	9470678	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr3:9470678T>C	ENST00000406341.1	+	2	246	c.56T>C	c.(55-57)aTg>aCg	p.M19T	AC018506.1_ENST00000578447.1_RNA|SETD5_ENST00000407969.1_Missense_Mutation_p.M19T|SETD5_ENST00000402466.1_5'UTR|SETD5_ENST00000302463.6_5'Flank|SETD5_ENST00000402198.1_Missense_Mutation_p.M19T			Q9C0A6	SETD5_HUMAN	SET domain containing 5	19								p.M19T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TACTCAGATATGGCTGCTGGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	102.0	102.0					3																	9470678		2018	4186	6204	9445678	SO:0001583	missense	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.56T>C	3.37:g.9470678T>C	ENSP00000383939:p.Met19Thr		9445678	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.598999	0.66332	.	.	ENSG00000168137	ENST00000450326;ENST00000402198;ENST00000406341;ENST00000407969	T;D;D;D	0.95103	1.08;-3.61;-3.61;-3.41	6.16	6.16	0.99307	.	.	.	.	.	D	0.96632	0.8901	M	0.65498	2.005	0.80722	D	1	D	0.60160	0.987	D	0.66196	0.942	D	0.96993	0.9723	9	0.87932	D	0	-10.4331	16.8061	0.85666	0.0:0.0:0.0:1.0	.	19	Q9C0A6	SETD5_HUMAN	T	19	ENSP00000413786:M19T;ENSP00000385852:M19T;ENSP00000383939:M19T;ENSP00000384114:M19T	ENSP00000385852:M19T	M	+	2	0	SETD5	9445678	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.414000	0.80117	2.367000	0.80283	0.528000	0.53228	ATG		0.433	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
SNRK	54861	broad.mit.edu	37	3	43388910	43388910	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr3:43388910G>T	ENST00000296088.7	+	7	1463	c.1159G>T	c.(1159-1161)Gtc>Ttc	p.V387F	SNRK_ENST00000429705.2_Missense_Mutation_p.V387F|SNRK_ENST00000454177.1_Missense_Mutation_p.V387F|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000437827.1_Missense_Mutation_p.V181F|RP11-188P20.3_ENST00000607513.1_RNA	NM_017719.4	NP_060189.3			SNF related kinase									p.V387F(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		CCACGCGACTGTCCCTCAGTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											68.0	73.0	72.0					3																	43388910		2042	4197	6239	43363914	SO:0001583	missense	54861			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1159G>T	3.37:g.43388910G>T	ENSP00000296088:p.Val387Phe		43363914		Missense_Mutation	SNP	ENST00000296088.7	37	CCDS43075.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141596	0.57044	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.65916	-0.18;-0.18;-0.18;2.75	5.07	5.07	0.68467	.	0.061993	0.64402	D	0.000004	T	0.43433	0.1247	N	0.14661	0.345	0.58432	D	0.999998	P	0.45283	0.855	B	0.38327	0.271	T	0.42224	-0.9464	10	0.09084	T	0.74	.	18.8287	0.92128	0.0:0.0:1.0:0.0	.	387	Q9NRH2	SNRK_HUMAN	F	387;387;387;181	ENSP00000401246:V387F;ENSP00000411375:V387F;ENSP00000296088:V387F;ENSP00000409516:V181F	ENSP00000296088:V387F	V	+	1	0	SNRK	43363914	1.000000	0.71417	0.988000	0.46212	0.902000	0.53008	9.392000	0.97252	2.535000	0.85469	0.655000	0.94253	GTC		0.547	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
TIPARP	25976	broad.mit.edu	37	3	156421399	156421399	+	Silent	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr3:156421399C>T	ENST00000461166.1	+	5	2022	c.1434C>T	c.(1432-1434)taC>taT	p.Y478Y	TIPARP_ENST00000295924.7_Silent_p.Y478Y|TIPARP_ENST00000486483.1_Silent_p.Y478Y|TIPARP_ENST00000542783.1_Silent_p.Y478Y	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	478	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.Y478Y(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GGATCATTTACAATCTTTTTC	0.368																																					Ovarian(171;276 1987 3319 6837 11197)											1	Substitution - coding silent(1)	ovary(1)	3											83.0	86.0	85.0					3																	156421399		2203	4300	6503	157904093	SO:0001819	synonymous_variant	25976			BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.1434C>T	3.37:g.156421399C>T			157904093	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Silent	SNP	ENST00000461166.1	37	CCDS3177.1	.	.	.	.	.	.	.	.	.	.	C	8.557	0.876841	0.17395	.	.	ENSG00000163659	ENST00000495891	.	.	.	5.35	-4.48	0.03515	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4916	0.75611	0.0:0.1318:0.0:0.8682	.	.	.	.	X	181	.	.	Q	+	1	0	TIPARP	157904093	0.999000	0.42202	0.931000	0.37212	0.982000	0.71751	0.584000	0.23864	-0.873000	0.04032	-0.145000	0.13849	CAA		0.368	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508	
YTHDC1	91746	broad.mit.edu	37	4	69184446	69184446	+	Splice_Site	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr4:69184446G>A	ENST00000344157.4	-	14	2058	c.1723C>T	c.(1723-1725)Cga>Tga	p.R575*	YTHDC1_ENST00000579690.1_Nonsense_Mutation_p.R583*|YTHDC1_ENST00000355665.3_Splice_Site_p.R557*	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	575	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R575*(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CCTGAAAATCGTCTGTTGGGA	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	4											62.0	63.0	63.0					4																	69184446		2203	4300	6503	68867041	SO:0001630	splice_region_variant	91746			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1722-1C>T	4.37:g.69184446G>A			68867041	Q4W5Q3|Q7Z622|Q8TF35	Nonsense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	G	42	9.508581	0.99190	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.362	0.66779	0.0:0.0:0.852:0.148	.	.	.	.	X	575;557	.	ENSP00000339245:R575X	R	-	1	2	YTHDC1	68867041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.321000	0.65846	2.615000	0.88500	0.591000	0.81541	CGA		0.343	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	Nonsense_Mutation
PCDH10	57575	broad.mit.edu	37	4	134073508	134073508	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr4:134073508T>G	ENST00000264360.5	+	1	3039	c.2213T>G	c.(2212-2214)gTg>gGg	p.V738G		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	738					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V738G(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GTGCTGGCCGTGCGTTGCCAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	4											88.0	95.0	93.0					4																	134073508		2203	4300	6503	134292958	SO:0001583	missense	57575			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2213T>G	4.37:g.134073508T>G	ENSP00000264360:p.Val738Gly		134292958	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.430485	0.62844	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.57595	0.39	4.48	4.48	0.54585	.	0.000000	0.40818	N	0.001004	T	0.60625	0.2283	L	0.52266	1.64	0.80722	D	1	D;P	0.57899	0.981;0.91	P;P	0.55871	0.601;0.786	T	0.65442	-0.6167	10	0.87932	D	0	.	13.6128	0.62091	0.0:0.0:0.0:1.0	.	738;738	Q9P2E7;Q96SF0	PCD10_HUMAN;.	G	738	ENSP00000264360:V738G	ENSP00000264360:V738G	V	+	2	0	PCDH10	134292958	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.957000	0.70323	1.883000	0.54544	0.459000	0.35465	GTG		0.587	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
ACSL1	2180	broad.mit.edu	37	4	185689498	185689498	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr4:185689498G>A	ENST00000515030.1	-	12	1425	c.1100C>T	c.(1099-1101)cCa>cTa	p.P367L	ACSL1_ENST00000513317.1_Missense_Mutation_p.P367L|ACSL1_ENST00000504900.1_Missense_Mutation_p.P367L|ACSL1_ENST00000437665.3_Missense_Mutation_p.P196L|ACSL1_ENST00000454703.2_Missense_Mutation_p.P196L|ACSL1_ENST00000507295.1_Missense_Mutation_p.P333L|ACSL1_ENST00000504342.1_Missense_Mutation_p.P367L|ACSL1_ENST00000281455.2_Missense_Mutation_p.P367L			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	367					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.P367L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAGCAGTCTTGGAACCACGGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	4											174.0	155.0	161.0					4																	185689498		2203	4300	6503	185926492	SO:0001583	missense	2180			BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1100C>T	4.37:g.185689498G>A	ENSP00000422607:p.Pro367Leu		185926492	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020518	0.93462	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317;ENST00000504900	T;T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63	5.64	5.64	0.86602	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	H	0.99906	4.925	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88947	0.3384	10	0.87932	D	0	-16.7893	19.2951	0.94118	0.0:0.0:1.0:0.0	.	333;367;367;367	E7EPM6;B7Z452;D6RER0;P33121	.;.;.;ACSL1_HUMAN	L	196;367;367;333;196;367;367;367	ENSP00000407165:P196L;ENSP00000422607:P367L;ENSP00000281455:P367L;ENSP00000426244:P333L;ENSP00000405687:P196L;ENSP00000425006:P367L;ENSP00000426150:P367L;ENSP00000424935:P367L	ENSP00000281455:P367L	P	-	2	0	ACSL1	185926492	1.000000	0.71417	0.192000	0.23308	0.849000	0.48306	9.679000	0.98649	2.653000	0.90120	0.655000	0.94253	CCA		0.522	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	
PRDM9	56979	broad.mit.edu	37	5	23527677	23527677	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:23527677C>G	ENST00000296682.3	+	11	2662	c.2480C>G	c.(2479-2481)aCa>aGa	p.T827R		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	827					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.T827R(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGGACACACACAGGGGAGAAG	0.582										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	ovary(1)	5											40.0	54.0	49.0					5																	23527677		2151	4273	6424	23563434	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2480C>G	5.37:g.23527677C>G	ENSP00000296682:p.Thr827Arg		23563434	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345879	0.41599	.	.	ENSG00000164256	ENST00000296682	T	0.25749	1.78	3.02	3.02	0.34903	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28001	0.0690	L	0.33753	1.03	0.45704	D	0.998611	P	0.49961	0.93	P	0.50231	0.635	T	0.09465	-1.0673	9	0.72032	D	0.01	-0.0365	12.4022	0.55420	0.0:1.0:0.0:0.0	.	827	Q9NQV7	PRDM9_HUMAN	R	827	ENSP00000296682:T827R	ENSP00000296682:T827R	T	+	2	0	PRDM9	23563434	0.992000	0.36948	0.999000	0.59377	0.158000	0.22134	3.293000	0.51779	2.038000	0.60285	0.472000	0.43445	ACA		0.582	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
DEPDC1B	55789	broad.mit.edu	37	5	59982922	59982922	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:59982922G>T	ENST00000265036.5	-	2	248	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K	DEPDC1B_ENST00000545085.1_Missense_Mutation_p.Q34K|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.Q61K	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	61	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.Q61K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				CCGAAGTTTTGACTGCACCTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	5											103.0	93.0	97.0					5																	59982922		2203	4300	6503	60018679	SO:0001583	missense	55789			AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.181C>A	5.37:g.59982922G>T	ENSP00000265036:p.Gln61Lys		60018679	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	37	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021878	0.35701	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.21191	2.02;2.02;2.02	5.64	4.77	0.60923	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.422883	0.28448	N	0.015317	T	0.15522	0.0374	N	0.16368	0.405	0.40634	D	0.981889	B;B	0.23806	0.091;0.073	B;B	0.29663	0.105;0.105	T	0.07829	-1.0752	9	.	.	.	-21.1787	16.3686	0.83344	0.0:0.0:0.8671:0.1329	.	61;61	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	K	61;61;34	ENSP00000265036:Q61K;ENSP00000389101:Q61K;ENSP00000438320:Q34K	.	Q	-	1	0	DEPDC1B	60018679	1.000000	0.71417	0.964000	0.40570	0.928000	0.56348	2.351000	0.44071	1.507000	0.48752	0.561000	0.74099	CAA		0.488	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
ADAMTS19	171019	broad.mit.edu	37	5	129019935	129019935	+	Silent	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:129019935C>T	ENST00000274487.4	+	18	2914	c.2769C>T	c.(2767-2769)agC>agT	p.S923S	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	923	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S923S(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CACACACAAGCTGGGAAGATT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	5											85.0	82.0	83.0					5																	129019935		2203	4300	6503	129047834	SO:0001819	synonymous_variant	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2769C>T	5.37:g.129019935C>T			129047834		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																				0.408	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PCDHGB6	56100	broad.mit.edu	37	5	140789004	140789004	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:140789004G>A	ENST00000520790.1	+	1	1235	c.1235G>A	c.(1234-1236)cGa>cAa	p.R412Q	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCTGGACCGAGAGCAGACA	0.453																																																0			5											64.0	69.0	67.0					5																	140789004		2018	4192	6210	140769188	SO:0001583	missense	56100			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1235G>A	5.37:g.140789004G>A	ENSP00000428603:p.Arg412Gln		140769188	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	g	17.21	3.331940	0.60853	.	.	ENSG00000253305	ENST00000520790	T	0.01725	4.67	5.36	5.36	0.76844	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.24431	0.0592	H	0.99357	4.53	0.33398	D	0.576957	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62872	-0.6762	9	0.87932	D	0	.	18.7032	0.91629	0.0:0.0:1.0:0.0	.	412;412	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	Q	412	ENSP00000428603:R412Q	ENSP00000428603:R412Q	R	+	2	0	PCDHGB6	140769188	1.000000	0.71417	0.888000	0.34837	0.035000	0.12851	9.857000	0.99534	2.508000	0.84585	0.563000	0.77884	CGA		0.453	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
SPDL1	54908	broad.mit.edu	37	5	169025560	169025560	+	Silent	SNP	T	T	G			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:169025560T>G	ENST00000265295.4	+	9	1392	c.1113T>G	c.(1111-1113)ctT>ctG	p.L371L		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.L371L(1)									CAGATTTACTTCAGATGAAGC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	5											149.0	156.0	154.0					5																	169025560		2203	4300	6503	168958138	SO:0001819	synonymous_variant	54908			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1113T>G	5.37:g.169025560T>G			168958138		Silent	SNP	ENST00000265295.4	37	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	T	8.704	0.910414	0.17833	.	.	ENSG00000040275	ENST00000505977	.	.	.	5.85	3.43	0.39272	.	.	.	.	.	T	0.57784	0.2077	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50964	-0.8765	4	.	.	.	-11.0546	8.2315	0.31601	0.0:0.0681:0.2686:0.6632	.	.	.	.	A	292	.	.	S	+	1	0	CCDC99	168958138	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	0.852000	0.27764	0.467000	0.27218	-0.329000	0.08387	TCA		0.363	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
HK3	3101	broad.mit.edu	37	5	176316506	176316506	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr5:176316506C>T	ENST00000292432.5	-	8	881	c.790G>A	c.(790-792)Gac>Aac	p.D264N		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	264	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.D264N(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGCCCCGGTCTTCGTCCAGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	5											102.0	84.0	90.0					5																	176316506		2203	4300	6503	176249112	SO:0001583	missense	3101				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.790G>A	5.37:g.176316506C>T	ENSP00000292432:p.Asp264Asn		176249112	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814524	0.70912	.	.	ENSG00000160883	ENST00000292432	D	0.98105	-4.72	5.34	5.34	0.76211	Hexokinase, C-terminal (1);	0.000000	0.56097	D	0.000031	D	0.97776	0.9270	L	0.44542	1.39	0.41745	D	0.989637	D	0.62365	0.991	D	0.71870	0.975	D	0.98260	1.0498	10	0.51188	T	0.08	-29.2367	15.3232	0.74139	0.0:0.8596:0.1403:0.0	.	264	P52790	HXK3_HUMAN	N	264	ENSP00000292432:D264N	ENSP00000292432:D264N	D	-	1	0	HK3	176249112	0.999000	0.42202	0.998000	0.56505	0.030000	0.12068	3.060000	0.49955	2.492000	0.84095	0.491000	0.48974	GAC		0.642	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
TRERF1	55809	broad.mit.edu	37	6	42231079	42231079	+	Silent	SNP	C	C	T	rs148325036		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr6:42231079C>T	ENST00000372922.4	-	8	2425	c.1863G>A	c.(1861-1863)tcG>tcA	p.S621S	TRERF1_ENST00000354325.2_Intron|TRERF1_ENST00000340840.2_Intron|TRERF1_ENST00000541110.1_Silent_p.S621S|TRERF1_ENST00000372917.4_Intron	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	621	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S621S(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTCGTCGTCCGACATCGAGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	6						C		0,4406		0,0,2203	69.0	72.0	71.0		1863	3.1	1.0	6	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TRERF1	NM_033502.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		621/1201	42231079	1,13005	2203	4300	6503	42339057	SO:0001819	synonymous_variant	55809			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.1863G>A	6.37:g.42231079C>T			42339057	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	ENST00000372922.4	37	CCDS4867.1																																																																																				0.662	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
GLTSCR1L	23506	broad.mit.edu	37	6	42819929	42819929	+	Silent	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr6:42819929C>T	ENST00000314073.5	+	7	2115	c.1939C>T	c.(1939-1941)Ctg>Ttg	p.L647L	GLTSCR1L_ENST00000394168.1_Silent_p.L647L			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	647								p.L647L(1)									GAGCACCACACTGCCAGGTCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	6											95.0	76.0	83.0					6																	42819929		2203	4300	6503	42927907	SO:0001819	synonymous_variant	23506			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1939C>T	6.37:g.42819929C>T			42927907	A1L3W2|Q5TFZ3|Q92514	Silent	SNP	ENST00000314073.5	37	CCDS34451.1																																																																																				0.537	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
SDK1	221935	broad.mit.edu	37	7	4050614	4050614	+	Silent	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr7:4050614G>T	ENST00000404826.2	+	15	2287	c.2148G>T	c.(2146-2148)gtG>gtT	p.V716V	SDK1_ENST00000389531.3_Silent_p.V716V	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	716	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V716V(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CATGGAAGGTGCATCTGTCAA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	7											73.0	68.0	70.0					7																	4050614		2203	4300	6503	4017140	SO:0001819	synonymous_variant	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2148G>T	7.37:g.4050614G>T			4017140	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																				0.502	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
INHBA	3624	broad.mit.edu	37	7	41729271	41729271	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr7:41729271C>T	ENST00000242208.4	-	3	1504	c.1258G>A	c.(1258-1260)Gtg>Atg	p.V420M	INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.V420M|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	420					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.V420M(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CACTCCTCCACGATCATGTTC	0.468										TSP Lung(11;0.080)																																						1	Substitution - Missense(1)	ovary(1)	7											92.0	83.0	86.0					7																	41729271		2203	4300	6503	41695796	SO:0001583	missense	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1258G>A	7.37:g.41729271C>T	ENSP00000242208:p.Val420Met		41695796	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710691	0.68730	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.70631	-0.5;-0.5	5.71	5.71	0.89125	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90577	0.7046	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93338	0.6707	10	0.87932	D	0	-24.3042	19.8536	0.96748	0.0:1.0:0.0:0.0	.	420	P08476	INHBA_HUMAN	M	420	ENSP00000242208:V420M;ENSP00000397197:V420M	ENSP00000242208:V420M	V	-	1	0	INHBA	41695796	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.811000	0.86092	2.708000	0.92522	0.591000	0.81541	GTG		0.468	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
CALCR	799	broad.mit.edu	37	7	93108747	93108747	+	Missense_Mutation	SNP	C	C	T	rs544410123	byFrequency	TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr7:93108747C>T	ENST00000394441.1	-	3	439	c.124G>A	c.(124-126)Gtc>Atc	p.V42I	CALCR_ENST00000359558.2_Missense_Mutation_p.V60I|CALCR_ENST00000421592.1_Missense_Mutation_p.V42I|CALCR_ENST00000426151.1_Missense_Mutation_p.V42I|CALCR_ENST00000360249.4_Missense_Mutation_p.V42I	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	60					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.V42I(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CGTCCTACGACGTAAAGAAAT	0.403													C|||	2	0.000399361	0.0	0.0	5008	,	,		17833	0.002		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	7											217.0	201.0	207.0					7																	93108747		2203	4300	6503	92946683	SO:0001583	missense	799			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.124G>A	7.37:g.93108747C>T	ENSP00000377959:p.Val42Ile		92946683	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	1.739	-0.492062	0.04322	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.21	-10.4	0.00318	.	.	.	.	.	T	0.24661	0.0598	N	0.25647	0.755	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.13072	-1.0523	9	0.33141	T	0.24	.	4.8001	0.13292	0.2475:0.1518:0.0665:0.5343	.	60;42	F5H605;A4D1G6	.;.	I	60;42;42;42;42;42	ENSP00000352561:V60I;ENSP00000353385:V42I;ENSP00000399552:V42I;ENSP00000377959:V42I;ENSP00000389295:V42I	ENSP00000352561:V60I	V	-	1	0	CALCR	92946683	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.548000	0.00930	-4.171000	0.00068	-1.969000	0.00466	GTC		0.403	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
RELN	5649	broad.mit.edu	37	7	103179742	103179742	+	Silent	SNP	C	C	T	rs577520481	byFrequency	TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr7:103179742C>T	ENST00000428762.1	-	45	7122	c.6963G>A	c.(6961-6963)acG>acA	p.T2321T	RELN_ENST00000343529.5_Silent_p.T2321T|RELN_ENST00000424685.2_Silent_p.T2321T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2321					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.T2321T(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTTCCAAGACCGTATTACCAG	0.398													C|||	2	0.000399361	0.0	0.0	5008	,	,		20187	0.0		0.0	False		,,,				2504	0.002				NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - coding silent(1)	ovary(1)	7											60.0	61.0	61.0					7																	103179742		2203	4300	6503	102966978	SO:0001819	synonymous_variant	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6963G>A	7.37:g.103179742C>T			102966978	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				0.398	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
OR2A12	346525	broad.mit.edu	37	7	143792231	143792231	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr7:143792231G>T	ENST00000408949.2	+	1	91	c.31G>T	c.(31-33)Gtc>Ttc	p.V11F		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V11F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					GATCACAGAAGTCATCCTGTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											119.0	113.0	115.0					7																	143792231		1868	4110	5978	143423164	SO:0001583	missense	346525				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.31G>T	7.37:g.143792231G>T	ENSP00000386174:p.Val11Phe		143423164	Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.098087	0.00360	.	.	ENSG00000221858	ENST00000408949	T	0.00012	9.32	4.42	2.41	0.29592	.	.	.	.	.	T	0.00012	0.0000	N	0.00009	-3.065	0.29303	N	0.868536	B	0.06786	0.001	B	0.04013	0.001	T	0.36432	-0.9748	9	0.02654	T	1	-20.207	4.7032	0.12837	0.1135:0.0:0.5657:0.3208	.	11	Q8NGT7	O2A12_HUMAN	F	11	ENSP00000386174:V11F	ENSP00000386174:V11F	V	+	1	0	OR2A12	143423164	0.007000	0.16637	0.969000	0.41365	0.089000	0.18198	-0.007000	0.12810	1.067000	0.40740	0.505000	0.49811	GTC		0.413	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
CDH17	1015	broad.mit.edu	37	8	95186438	95186438	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr8:95186438G>T	ENST00000027335.3	-	6	599	c.475C>A	c.(475-477)Ccc>Acc	p.P159T	CDH17_ENST00000450165.2_Missense_Mutation_p.P159T|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	159	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.P159T(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TGGCCATTGGGAGTGGCCGGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											168.0	169.0	169.0					8																	95186438		2203	4300	6503	95255614	SO:0001583	missense	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.475C>A	8.37:g.95186438G>T	ENSP00000027335:p.Pro159Thr		95255614	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195173	0.78902	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.54479	0.57;0.57	5.96	5.96	0.96718	Cadherin (4);Cadherin-like (1);	0.474847	0.19998	N	0.101407	T	0.64227	0.2579	L	0.42529	1.33	0.52501	D	0.999951	D	0.65815	0.995	P	0.62740	0.906	T	0.54091	-0.8345	10	0.22706	T	0.39	-0.1113	19.1934	0.93677	0.0:0.0:1.0:0.0	.	159	Q12864	CAD17_HUMAN	T	159	ENSP00000027335:P159T;ENSP00000401468:P159T	ENSP00000027335:P159T	P	-	1	0	CDH17	95255614	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	6.631000	0.74277	2.832000	0.97577	0.655000	0.94253	CCC		0.408	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
NDUFB9	4715	broad.mit.edu	37	8	125551521	125551521	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr8:125551521G>T	ENST00000276689.3	+	1	178	c.94G>T	c.(94-96)Gtc>Ttc	p.V32F	NDUFB9_ENST00000522532.1_Missense_Mutation_p.V32F|TATDN1_ENST00000276692.6_5'Flank|TATDN1_ENST00000605953.1_5'Flank|TATDN1_ENST00000521546.1_5'Flank|NDUFB9_ENST00000517367.1_Missense_Mutation_p.V32F|NDUFB9_ENST00000518008.1_Missense_Mutation_p.V32F|TATDN1_ENST00000517678.1_5'Flank|TATDN1_ENST00000519548.1_5'Flank	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	32					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.V32F(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GTCGTGGTGCGTCCAGAGGTA	0.637																																																1	Substitution - Missense(1)	ovary(1)	8											48.0	48.0	48.0					8																	125551521		2203	4300	6503	125620702	SO:0001583	missense	4715			AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.94G>T	8.37:g.125551521G>T	ENSP00000276689:p.Val32Phe		125620702	B2R8M6|Q9UQE8	Missense_Mutation	SNP	ENST00000276689.3	37	CCDS6352.1	.	.	.	.	.	.	.	.	.	.	G	9.033	0.987864	0.18966	.	.	ENSG00000147684	ENST00000276689;ENST00000518008;ENST00000522532;ENST00000517367	T;T;T;T	0.75050	-0.32;-0.32;-0.32;-0.9	5.38	-10.8	0.00216	.	1.219440	0.05558	N	0.568770	T	0.68550	0.3013	M	0.80982	2.52	0.22240	N	0.99926	B;B	0.20459	0.045;0.004	B;B	0.25884	0.064;0.017	T	0.46205	-0.9208	10	0.10377	T	0.69	-0.6504	11.2716	0.49142	0.7337:0.0789:0.1081:0.0793	.	32;32	E9PF49;Q9Y6M9	.;NDUB9_HUMAN	F	32	ENSP00000276689:V32F;ENSP00000428282:V32F;ENSP00000431115:V32F;ENSP00000430322:V32F	ENSP00000276689:V32F	V	+	1	0	NDUFB9	125620702	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-0.381000	0.07417	-2.989000	0.00280	-0.882000	0.02950	GTC		0.637	NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381606.1	NM_005005	
MAGEB4	4115	broad.mit.edu	37	X	30261039	30261039	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chrX:30261039A>C	ENST00000378982.2	+	1	983	c.787A>C	c.(787-789)Agt>Cgt	p.S263R	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	263	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.S263R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GGTGCCCAACAGTGATCCCCC	0.493																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	66.0	67.0					X																	30261039		2202	4300	6502	30170960	SO:0001583	missense	4115				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.787A>C	X.37:g.30261039A>C	ENSP00000368266:p.Ser263Arg		30170960	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478432	0.44044	.	.	ENSG00000120289	ENST00000378982	T	0.05649	3.41	3.17	3.17	0.36434	.	0.145319	0.42964	U	0.000638	T	0.28830	0.0715	M	0.93375	3.41	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.10064	-1.0646	10	0.87932	D	0	.	7.1843	0.25791	1.0:0.0:0.0:0.0	.	263	O15481	MAGB4_HUMAN	R	263	ENSP00000368266:S263R	ENSP00000368266:S263R	S	+	1	0	MAGEB4	30170960	0.044000	0.20184	0.011000	0.14972	0.017000	0.09413	0.828000	0.27435	1.504000	0.48704	0.430000	0.28490	AGT		0.493	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
SPIN4	139886	broad.mit.edu	37	X	62570404	62570404	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chrX:62570404C>A	ENST00000335144.3	-	1	814	c.295G>T	c.(295-297)Gag>Tag	p.E99*	SPIN4-AS1_ENST00000451979.1_RNA|SPIN4_ENST00000374884.2_Nonsense_Mutation_p.E81*	NM_001012968.2	NP_001012986.2	Q56A73	SPIN4_HUMAN	spindlin family, member 4	99					gamete generation (GO:0007276)			p.E99*(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	11						GGAAGGATCTCTAGCGCTAAA	0.473																																																1	Substitution - Nonsense(1)	ovary(1)	X											70.0	69.0	69.0					X																	62570404		2018	4171	6189	62487129	SO:0001587	stop_gained	139886			AK126931	CCDS43964.1	Xq11.1	2008-02-05			ENSG00000186767	ENSG00000186767			27040	protein-coding gene	gene with protein product						12477932	Standard	NM_001012968		Approved	FLJ44984	uc004dvf.3	Q56A73	OTTHUMG00000021696	ENST00000335144.3:c.295G>T	X.37:g.62570404C>A	ENSP00000334163:p.Glu99*		62487129	B3KX90|Q5JUL2	Nonsense_Mutation	SNP	ENST00000335144.3	37	CCDS43964.1	.	.	.	.	.	.	.	.	.	.	.	42	9.309086	0.99132	.	.	ENSG00000186767	ENST00000374884;ENST00000335144	.	.	.	4.73	4.73	0.59995	.	0.071187	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-37.4055	14.7469	0.69494	0.0:1.0:0.0:0.0	.	.	.	.	X	81;99	.	ENSP00000334163:E99X	E	-	1	0	SPIN4	62487129	1.000000	0.71417	0.950000	0.38849	0.992000	0.81027	6.206000	0.72154	2.283000	0.76528	0.544000	0.68410	GAG		0.473	SPIN4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001012968	
ARMCX1	51309	broad.mit.edu	37	X	100808226	100808226	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chrX:100808226G>C	ENST00000372829.3	+	4	684	c.313G>C	c.(313-315)Gag>Cag	p.E105Q		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	105						integral component of membrane (GO:0016021)		p.E105Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						AGGTGGCCTAGAGGCCAAGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	63.0	65.0					X																	100808226		2203	4300	6503	100694882	SO:0001583	missense	51309			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.313G>C	X.37:g.100808226G>C	ENSP00000361917:p.Glu105Gln		100694882	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	g	13.92	2.380354	0.42207	.	.	ENSG00000126947	ENST00000372829	T	0.40225	1.04	3.71	3.71	0.42584	.	.	.	.	.	T	0.45478	0.1344	N	0.24115	0.695	0.28271	N	0.924423	D	0.63880	0.993	D	0.70227	0.968	T	0.21314	-1.0249	9	0.25751	T	0.34	-16.0616	9.919	0.41453	0.0:0.0:1.0:0.0	.	105	Q9P291	ARMX1_HUMAN	Q	105	ENSP00000361917:E105Q	ENSP00000361917:E105Q	E	+	1	0	ARMCX1	100694882	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.785000	0.55424	2.091000	0.63221	0.556000	0.70494	GAG		0.572	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
PLXNA3	55558	broad.mit.edu	37	X	153699459	153699459	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chrX:153699459G>A	ENST00000369682.3	+	31	5343	c.5168G>A	c.(5167-5169)cGc>cAc	p.R1723H		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1723					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.R1723H(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGCCGCTGCGCTTCTGGGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											88.0	78.0	82.0					X																	153699459		2203	4300	6503	153352653	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5168G>A	X.37:g.153699459G>A	ENSP00000358696:p.Arg1723His		153352653	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	G	33	5.194168	0.94960	.	.	ENSG00000130827	ENST00000369682	T	0.26373	1.74	5.39	5.39	0.77823	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.62938	0.2469	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74380	-0.3684	10	0.87932	D	0	.	16.9192	0.86159	0.0:0.0:1.0:0.0	.	1723	P51805	PLXA3_HUMAN	H	1723	ENSP00000358696:R1723H	ENSP00000358696:R1723H	R	+	2	0	PLXNA3	153352653	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.860000	0.99555	2.257000	0.74773	0.529000	0.55759	CGC		0.602	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-25-1319-01A-01W-0492-08	TCGA-25-1319-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Sequenom;Capture			Illumina GAIIx	6647b8a8-58c2-4edc-aec2-3f559aaeb2ac	4e7cf06a-669f-4fa9-ade0-fae3de697e86	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	17	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	7518915	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		7518915	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
