#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF648	127665	broad.mit.edu	37	1	182027051	182027051	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr1:182027051T>C	ENST00000339948.3	-	2	302	c.95A>G	c.(94-96)aAc>aGc	p.N32S		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	32					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N32S(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						ACTCTCTAAGTTCATGCTCAG	0.567																																					NSCLC(71;908 1374 5429 20458 35642)											1	Substitution - Missense(1)	ovary(1)	1											95.0	88.0	90.0					1																	182027051		2203	4300	6503	180293674	SO:0001583	missense	127665			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.95A>G	1.37:g.182027051T>C	ENSP00000344129:p.Asn32Ser		180293674	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	T	4.937	0.174090	0.09391	.	.	ENSG00000179930	ENST00000339948	T	0.08984	3.03	2.76	-1.46	0.08800	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.47209	-0.9135	9	0.15499	T	0.54	.	3.9149	0.09219	0.0:0.2548:0.185:0.5602	.	32	Q5T619	ZN648_HUMAN	S	32	ENSP00000344129:N32S	ENSP00000344129:N32S	N	-	2	0	ZNF648	180293674	0.000000	0.05858	0.010000	0.14722	0.020000	0.10135	0.530000	0.23036	-0.300000	0.08895	-0.316000	0.08728	AAC		0.567	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
ASB13	79754	broad.mit.edu	37	10	5683797	5683797	+	Silent	SNP	C	C	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr10:5683797C>A	ENST00000357700.6	-	5	671	c.645G>T	c.(643-645)ggG>ggT	p.G215G	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	215					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.G215G(1)		NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		ACGGCTTCTTCCCGCGGTTGT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	10											82.0	73.0	76.0					10																	5683797		2203	4300	6503	5723803	SO:0001819	synonymous_variant	79754			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.645G>T	10.37:g.5683797C>A			5723803	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Silent	SNP	ENST00000357700.6	37	CCDS7070.1																																																																																				0.592	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
TCERG1L	256536	broad.mit.edu	37	10	133106529	133106529	+	Silent	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr10:133106529C>T	ENST00000368642.4	-	3	700	c.615G>A	c.(613-615)ccG>ccA	p.P205P		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	205								p.P164P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		AGGCAGGAGCCGGCCTGGACA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	10											57.0	55.0	56.0					10																	133106529		2203	4300	6503	132996519	SO:0001819	synonymous_variant	256536			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.615G>A	10.37:g.133106529C>T			132996519	Q5VWI2|Q86XM8	Silent	SNP	ENST00000368642.4	37	CCDS7662.2																																																																																				0.522	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
OR10A4	283297	broad.mit.edu	37	11	6898122	6898122	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr11:6898122A>T	ENST00000379829.2	+	1	267	c.244A>T	c.(244-246)Atg>Ttg	p.M82L		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	82					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M82L(1)		kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGTGCCCAAGATGCTGGGGAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											149.0	135.0	140.0					11																	6898122		2201	4296	6497	6854698	SO:0001583	missense	283297			AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.244A>T	11.37:g.6898122A>T	ENSP00000369157:p.Met82Leu		6854698	B2RNP5|B9EH36|Q96R20	Missense_Mutation	SNP	ENST00000379829.2	37	CCDS7774.1	.	.	.	.	.	.	.	.	.	.	a	11.75	1.732261	0.30684	.	.	ENSG00000170782	ENST00000379829	T	0.04862	3.54	4.91	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000042	T	0.07188	0.0182	L	0.48877	1.53	0.26001	N	0.982114	B	0.10296	0.003	B	0.10450	0.005	T	0.19745	-1.0296	10	0.42905	T	0.14	.	10.3455	0.43903	0.8349:0.1651:0.0:0.0	.	82	Q9H209	O10A4_HUMAN	L	82	ENSP00000369157:M82L	ENSP00000369157:M82L	M	+	1	0	OR10A4	6854698	0.005000	0.15991	1.000000	0.80357	0.943000	0.58893	0.216000	0.17585	0.989000	0.38761	0.533000	0.62120	ATG		0.468	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186	
OR4A15	81328	broad.mit.edu	37	11	55135464	55135464	+	Missense_Mutation	SNP	C	C	A	rs534202398		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr11:55135464C>A	ENST00000314706.3	+	1	105	c.105C>A	c.(103-105)aaC>aaA	p.N35K		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N35K(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						AAAATAAGAACAATGTGACTG	0.393													.|||	1	0.000199681	0.0	0.0014	5008	,	,		18158	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11											67.0	63.0	64.0					11																	55135464		2201	4296	6497	54892040	SO:0001583	missense	81328			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.105C>A	11.37:g.55135464C>A	ENSP00000325065:p.Asn35Lys		54892040	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	c	10.48	1.361763	0.24684	.	.	ENSG00000181958	ENST00000314706	T	0.01335	5.0	3.48	-1.32	0.09201	.	0.000000	0.43110	U	0.000620	T	0.01320	0.0043	L	0.45228	1.405	0.19300	N	0.99998	B	0.24823	0.112	B	0.24848	0.056	T	0.44221	-0.9342	10	0.56958	D	0.05	.	3.9436	0.09338	0.0:0.4743:0.179:0.3466	.	35	Q8NGL6	O4A15_HUMAN	K	35	ENSP00000325065:N35K	ENSP00000325065:N35K	N	+	3	2	OR4A15	54892040	0.261000	0.24063	0.448000	0.26945	0.191000	0.23601	0.159000	0.16442	-0.102000	0.12197	-0.454000	0.05498	AAC		0.393	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
OR4S2	219431	broad.mit.edu	37	11	55418785	55418785	+	Missense_Mutation	SNP	C	C	T	rs148733636		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr11:55418785C>T	ENST00000312422.2	+	1	406	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R136W(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				CATCATGAACCGGGAGACATG	0.433																																																1	Substitution - Missense(1)	ovary(1)	11						C	TRP/ARG	1,4363		0,1,2181	197.0	166.0	177.0		406	-1.1	0.0	11	dbSNP_134	177	1,8077		0,1,4038	no	missense	OR4S2	NM_001004059.2	101	0,2,6219	TT,TC,CC		0.0124,0.0229,0.0161	benign	136/312	55418785	2,12440	2182	4039	6221	55175361	SO:0001583	missense	219431			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.406C>T	11.37:g.55418785C>T	ENSP00000310337:p.Arg136Trp		55175361	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	C	4.357	0.065803	0.08388	2.29E-4	1.24E-4	ENSG00000174982	ENST00000312422	T	0.00949	5.51	5.09	-1.09	0.09904	GPCR, rhodopsin-like superfamily (1);	0.270733	0.25205	N	0.032358	T	0.00998	0.0033	L	0.50333	1.59	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.44757	-0.9307	10	0.44086	T	0.13	.	5.7679	0.18237	0.5214:0.3235:0.0:0.1551	.	136	Q8NH73	OR4S2_HUMAN	W	136	ENSP00000310337:R136W	ENSP00000310337:R136W	R	+	1	2	OR4S2	55175361	0.000000	0.05858	0.001000	0.08648	0.162000	0.22319	-2.203000	0.01234	0.129000	0.18514	0.542000	0.68232	CGG		0.433	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
TIRAP	114609	broad.mit.edu	37	11	126162948	126162948	+	Missense_Mutation	SNP	G	G	A	rs185114125	byFrequency	TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr11:126162948G>A	ENST00000392680.2	+	5	1049	c.644G>A	c.(643-645)cGt>cAt	p.R215H	TIRAP_ENST00000392679.1_Missense_Mutation_p.R215H|RP11-712L6.7_ENST00000533378.1_RNA|RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392678.3_Missense_Mutation_p.R215H	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	215	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)	p.R215H(1)		breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		GCTGTCATGCGTTGTAAGCTA	0.507													G|||	2	0.000399361	0.0	0.0	5008	,	,		20155	0.0		0.002	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11						G	HIS/ARG,HIS/ARG	1,4355		0,1,2177	59.0	64.0	63.0		644,644	3.9	0.1	11		63	3,8561		0,3,4279	yes	missense,missense	TIRAP	NM_001039661.1,NM_148910.2	29,29	0,4,6456	AA,AG,GG		0.035,0.023,0.031	benign,benign	215/222,215/236	126162948	4,12916	2178	4282	6460	125668158	SO:0001583	missense	114609			AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.644G>A	11.37:g.126162948G>A	ENSP00000376447:p.Arg215His		125668158	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Missense_Mutation	SNP	ENST00000392680.2	37	CCDS8472.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	13.05	2.121606	0.37436	2.3E-4	3.5E-4	ENSG00000150455	ENST00000392679;ENST00000279992;ENST00000392678;ENST00000392680	T;T;T	0.10573	4.24;2.86;4.24	5.83	3.88	0.44766	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.372591	0.27172	N	0.020584	T	0.10594	0.0259	L	0.50919	1.6	0.09310	N	1	B;B	0.15930	0.004;0.015	B;B	0.08055	0.0;0.003	T	0.24693	-1.0153	9	.	.	.	-19.3297	9.988	0.41854	0.235:0.0:0.765:0.0	.	215;215	P58753;Q56UH9	TIRAP_HUMAN;.	H	215	ENSP00000376446:R215H;ENSP00000376445:R215H;ENSP00000376447:R215H	.	R	+	2	0	TIRAP	125668158	0.001000	0.12720	0.099000	0.21106	0.977000	0.68977	0.492000	0.22435	0.716000	0.32124	0.655000	0.94253	CGT		0.507	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000277092.1	NM_148910	
TRHDE	29953	broad.mit.edu	37	12	72893404	72893404	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr12:72893404G>A	ENST00000261180.4	+	6	1672	c.1576G>A	c.(1576-1578)Gca>Aca	p.A526T		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	526					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A526T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TGACTGGATCGCATATAAAAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	12											122.0	108.0	113.0					12																	72893404		2203	4300	6503	71179671	SO:0001583	missense	29953			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1576G>A	12.37:g.72893404G>A	ENSP00000261180:p.Ala526Thr		71179671	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019354	0.75275	.	.	ENSG00000072657	ENST00000261180	T	0.04454	3.62	5.28	5.28	0.74379	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.04724	0.0128	N	0.11789	0.175	0.80722	D	1	P	0.48834	0.916	B	0.42422	0.387	T	0.54984	-0.8211	10	0.41790	T	0.15	.	18.9016	0.92444	0.0:0.0:1.0:0.0	.	526	Q9UKU6	TRHDE_HUMAN	T	526	ENSP00000261180:A526T	ENSP00000261180:A526T	A	+	1	0	TRHDE	71179671	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	9.790000	0.99075	2.456000	0.83038	0.650000	0.86243	GCA		0.388	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
LPAR6	10161	broad.mit.edu	37	13	48986113	48986113	+	Silent	SNP	T	T	G	rs199857507		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr13:48986113T>G	ENST00000378434.4	-	7	2071	c.447A>C	c.(445-447)gcA>gcC	p.A149A	LPAR6_ENST00000345941.2_Silent_p.A149A|RB1_ENST00000267163.4_Intron	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)|p.A149A(3)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						AAACGGCGGGTGCACTTCCTC	0.433																																																22	Whole gene deletion(15)|Unknown(4)|Substitution - coding silent(3)	bone(10)|breast(4)|ovary(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	13											29.0	31.0	31.0					13																	48986113		2202	4300	6502	47884114	SO:0001819	synonymous_variant	10161			AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.447A>C	13.37:g.48986113T>G			47884114	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Silent	SNP	ENST00000378434.4	37	CCDS9410.1																																																																																				0.433	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
TGM1	7051	broad.mit.edu	37	14	24723982	24723982	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr14:24723982A>G	ENST00000206765.6	-	13	2099	c.1976T>C	c.(1975-1977)cTt>cCt	p.L659P	TGM1_ENST00000544573.1_Missense_Mutation_p.L217P	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	659					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.L659P(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CTGGTCCACAAGATGGGGCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											74.0	68.0	70.0					14																	24723982		2203	4300	6503	23793822	SO:0001583	missense	7051			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1976T>C	14.37:g.24723982A>G	ENSP00000206765:p.Leu659Pro		23793822	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589081	0.86851	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	D;D	0.84442	-1.85;-1.85	5.31	5.31	0.75309	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92949	0.6379	10	0.87932	D	0	-20.5588	13.2606	0.60102	1.0:0.0:0.0:0.0	.	659	P22735	TGM1_HUMAN	P	659;217	ENSP00000206765:L659P;ENSP00000439446:L217P	ENSP00000206765:L659P	L	-	2	0	TGM1	23793822	1.000000	0.71417	0.977000	0.42913	0.954000	0.61252	8.048000	0.89442	2.223000	0.72356	0.533000	0.62120	CTT		0.622	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
SPTB	6710	broad.mit.edu	37	14	65261222	65261222	+	Silent	SNP	G	G	C			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr14:65261222G>C	ENST00000389721.5	-	12	1790	c.1758C>G	c.(1756-1758)gcC>gcG	p.A586A	SPTB_ENST00000556626.1_Silent_p.A586A|SPTB_ENST00000389720.3_Silent_p.A586A|SPTB_ENST00000389722.3_Silent_p.A586A|SPTB_ENST00000542895.1_Silent_p.A586A	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	586					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.A586A(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTGCGGTGATGGCCTTCACTT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	14											242.0	221.0	228.0					14																	65261222		2203	4300	6503	64330975	SO:0001819	synonymous_variant	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1758C>G	14.37:g.65261222G>C			64330975	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																				0.547	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
ZFYVE26	23503	broad.mit.edu	37	14	68264437	68264437	+	Missense_Mutation	SNP	G	G	A	rs573210032		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr14:68264437G>A	ENST00000347230.4	-	12	2422	c.2284C>T	c.(2284-2286)Cgt>Tgt	p.R762C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.R762C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	762					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.R762C(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CTGGGGTGACGTGTGGCAGGC	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18952	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14											74.0	65.0	68.0					14																	68264437		2203	4300	6503	67334190	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2284C>T	14.37:g.68264437G>A	ENSP00000251119:p.Arg762Cys		67334190	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127969	0.37533	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.30448	1.68;1.53	5.19	-6.55	0.01854	.	0.961963	0.08646	N	0.914717	T	0.33818	0.0876	L	0.60455	1.87	0.22710	N	0.998827	D;D;D	0.76494	0.999;0.994;0.99	P;P;B	0.59288	0.855;0.653;0.333	T	0.25363	-1.0134	10	0.54805	T	0.06	-1.8006	0.44	0.00484	0.3285:0.197:0.2709:0.2037	.	762;762;762	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	C	762;741;762	ENSP00000251119:R762C;ENSP00000450603:R762C	ENSP00000251119:R762C	R	-	1	0	ZFYVE26	67334190	0.019000	0.18553	0.000000	0.03702	0.046000	0.14306	-0.772000	0.04694	-1.283000	0.02393	0.655000	0.94253	CGT		0.537	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
SEMA4B	10509	broad.mit.edu	37	15	90760763	90760763	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr15:90760763G>A	ENST00000411539.2	+	2	510	c.250G>A	c.(250-252)Gtg>Atg	p.V84M	SEMA4B_ENST00000379122.3_Missense_Mutation_p.V79M|SEMA4B_ENST00000332496.6_Missense_Mutation_p.V84M	NM_198925.2	NP_945119.1	Q9NPR2	SEM4B_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B	79	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)	receptor activity (GO:0004872)	p.V84M(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)	12	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GACCCTGTACGTGGGTGCTCG	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											54.0	53.0	53.0					15																	90760763		1995	4164	6159	88561767	SO:0001583	missense	10509			AB051532	CCDS45347.1	15q25	2008-07-18						"""Semaphorins"""	10730	protein-coding gene	gene with protein product				SEMAC		7748561	Standard	NM_020210		Approved	SemC, KIAA1745, MGC131831	uc002boz.3	Q9NPR2		ENST00000411539.2:c.250G>A	15.37:g.90760763G>A	ENSP00000394720:p.Val84Met		88561767	Q6UXE3|Q8WVP9|Q96FK5|Q9C0B8|Q9H691|Q9NPM8|Q9NPN0	Missense_Mutation	SNP	ENST00000411539.2	37	CCDS45347.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035219	0.54896	.	.	ENSG00000185033	ENST00000332496;ENST00000379122;ENST00000411539	T;T;T	0.27104	1.69;1.69;1.69	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.58452	0.2123	M	0.90369	3.11	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.66436	-0.5924	10	0.87932	D	0	.	14.7071	0.69200	0.0:0.1458:0.8542:0.0	.	84;79	Q2NL81;Q9NPR2	.;SEM4B_HUMAN	M	84;79;84	ENSP00000332204:V84M;ENSP00000368417:V79M;ENSP00000394720:V84M	ENSP00000332204:V84M	V	+	1	0	SEMA4B	88561767	1.000000	0.71417	0.997000	0.53966	0.103000	0.19146	4.804000	0.62554	2.634000	0.89283	0.655000	0.94253	GTG		0.592	SEMA4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416810.1	NM_198925	
SYNM	23336	broad.mit.edu	37	15	99669768	99669768	+	Silent	SNP	G	G	A	rs540983762	byFrequency	TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr15:99669768G>A	ENST00000560674.1	+	4	814	c.345G>A	c.(343-345)tcG>tcA	p.S115S	SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000328642.7_Silent_p.S400S|SYNM_ENST00000336292.6_Silent_p.S400S|RP11-6O2.4_ENST00000566974.1_RNA			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	401	Coil 1B.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.S400S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						TCTTGGGCTCGGGATATTCTT	0.517																																					Pancreas(125;1071 1762 21750 40003 40381)											1	Substitution - coding silent(1)	ovary(1)	15											131.0	136.0	134.0					15																	99669768		1914	4127	6041	97487291	SO:0001819	synonymous_variant	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.345G>A	15.37:g.99669768G>A			97487291	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Silent	SNP	ENST00000560674.1	37																																																																																					0.517	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728	
CNTNAP4	85445	broad.mit.edu	37	16	76569458	76569458	+	Silent	SNP	A	A	G			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr16:76569458A>G	ENST00000476707.1	+	17	2920	c.2781A>G	c.(2779-2781)agA>agG	p.R927R	CNTNAP4_ENST00000377504.4_Silent_p.R875R|CNTNAP4_ENST00000478060.1_Silent_p.R851R|CNTNAP4_ENST00000307431.8_Silent_p.R923R|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	924	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.R923R(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CGGCCACCAGACAGAGAGGCT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	16											57.0	63.0	61.0					16																	76569458		2192	4298	6490	75126959	SO:0001819	synonymous_variant	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2781A>G	16.37:g.76569458A>G			75126959	E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37																																																																																					0.478	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
CTC1	80169	broad.mit.edu	37	17	8139569	8139569	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr17:8139569C>T	ENST00000315684.8	-	6	891	c.884G>A	c.(883-885)cGc>cAc	p.R295H	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	295					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)	p.R295H(1)		NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						AACATGCTGGCGCTGACCACG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											57.0	60.0	59.0					17																	8139569		2102	4228	6330	8080294	SO:0001583	missense	80169			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.884G>A	17.37:g.8139569C>T	ENSP00000313759:p.Arg295His		8080294	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	c	10.69	1.421894	0.25639	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.83506	-1.73;-1.73	4.76	-3.0	0.05480	.	1.478850	0.03876	N	0.276456	T	0.74974	0.3787	L	0.51422	1.61	0.09310	N	1	B	0.17465	0.022	B	0.14578	0.011	T	0.56208	-0.8017	10	0.45353	T	0.12	-0.018	2.6467	0.04986	0.141:0.2704:0.4141:0.1745	.	295	Q2NKJ3	CTC1_HUMAN	H	295;260	ENSP00000313759:R295H;ENSP00000396018:R260H	ENSP00000313759:R295H	R	-	2	0	CTC1	8080294	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-1.593000	0.02096	-0.200000	0.10300	0.556000	0.70494	CGC		0.582	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
ZNF101	94039	broad.mit.edu	37	19	19791053	19791053	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr19:19791053G>A	ENST00000592502.1	+	4	1365	c.1255G>A	c.(1255-1257)Ggg>Agg	p.G419R	ZNF101_ENST00000415784.2_Missense_Mutation_p.G299R			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G419R(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						TCATTTGGCCGGGCGTAGcca	0.483																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	41.0	41.0					19																	19791053		2202	4300	6502	19652053	SO:0001583	missense	94039			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1255G>A	19.37:g.19791053G>A	ENSP00000468049:p.Gly419Arg		19652053	C9JU83|Q0VDG9	Missense_Mutation	SNP	ENST00000592502.1	37	CCDS32971.1	.	.	.	.	.	.	.	.	.	.	G	6.481	0.457014	0.12283	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.06218	3.46;3.33	0.235	0.235	0.15431	Zinc finger, C2H2 (1);	.	.	.	.	T	0.02571	0.0078	N	0.08118	0	0.09310	N	0.999996	D	0.58970	0.984	B	0.38056	0.264	T	0.47315	-0.9127	8	.	.	.	.	6.2532	0.20859	3.0E-4:0.0:0.9997:0.0	.	419	Q8IZC7	ZN101_HUMAN	R	419;419;299	ENSP00000319716:G419R;ENSP00000400952:G299R	.	G	+	1	0	ZNF101	19652053	0.004000	0.15560	0.043000	0.18650	0.044000	0.14063	0.570000	0.23653	0.308000	0.22923	0.313000	0.20887	GGG		0.483	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
CCT4	10575	broad.mit.edu	37	2	62099331	62099331	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr2:62099331C>A	ENST00000394440.3	-	12	1673	c.1377G>T	c.(1375-1377)gaG>gaT	p.E459D	CCT4_ENST00000544185.1_Missense_Mutation_p.E309D|CCT4_ENST00000544079.1_Missense_Mutation_p.E429D|CCT4_ENST00000538252.1_Missense_Mutation_p.E403D|CCT4_ENST00000461540.2_Intron|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	459					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.E459D(1)		breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			ATGGAATGACCTCCATAGCAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	2											108.0	101.0	103.0					2																	62099331		2203	4300	6503	61952835	SO:0001583	missense	10575				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1377G>T	2.37:g.62099331C>A	ENSP00000377958:p.Glu459Asp		61952835	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288941	0.80914	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46	5.59	-7.33	0.01431	.	0.000000	0.85682	D	0.000000	D	0.88753	0.6522	M	0.88377	2.95	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.89914	0.4054	10	0.72032	D	0.01	-19.2426	17.2907	0.87156	0.0:0.6138:0.0:0.3862	.	429;459	F5H5W3;P50991	.;TCPD_HUMAN	D	459;429;309;403	ENSP00000377958:E459D;ENSP00000443061:E429D;ENSP00000443451:E309D;ENSP00000442174:E403D	ENSP00000377958:E459D	E	-	3	2	CCT4	61952835	0.965000	0.33210	0.748000	0.31131	0.998000	0.95712	0.108000	0.15396	-1.559000	0.01688	0.655000	0.94253	GAG		0.463	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
IL1RL1	9173	broad.mit.edu	37	2	102958715	102958715	+	Missense_Mutation	SNP	G	G	A	rs75320001	byFrequency	TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr2:102958715G>A	ENST00000233954.1	+	6	914	c.643G>A	c.(643-645)Gga>Aga	p.G215R	IL1RL1_ENST00000409584.1_Missense_Mutation_p.G215R|IL1RL1_ENST00000404917.2_Missense_Mutation_p.G98R|IL1RL1_ENST00000311734.2_Missense_Mutation_p.G215R	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	215	Ig-like C2-type 3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)	p.G215R(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TCCAGTAATCGGAGCCCCTGC	0.338													g|||	11	0.00219649	0.0	0.0	5008	,	,		16855	0.0109		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											92.0	96.0	94.0					2																	102958715		2202	4300	6502	102325147	SO:0001583	missense	9173			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.643G>A	2.37:g.102958715G>A	ENSP00000233954:p.Gly215Arg		102325147	A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	ENST00000233954.1	37	CCDS2057.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	g	0.547	-0.851194	0.02651	.	.	ENSG00000115602	ENST00000233954;ENST00000404917;ENST00000311734;ENST00000409584	T;T;T;T	0.13538	4.12;4.12;4.12;2.58	4.46	-1.28	0.09318	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.666150	0.02689	N	0.110471	T	0.02727	0.0082	N	0.00926	-1.1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.26849	-1.0091	10	0.38643	T	0.18	.	0.9797	0.01433	0.4173:0.1659:0.0955:0.3213	.	98;215;215	B4E0I3;Q01638-2;Q01638	.;.;ILRL1_HUMAN	R	215;98;215;215	ENSP00000233954:G215R;ENSP00000384822:G98R;ENSP00000310371:G215R;ENSP00000386618:G215R	ENSP00000233954:G215R	G	+	1	0	IL1RL1	102325147	0.001000	0.12720	0.000000	0.03702	0.029000	0.11900	-0.235000	0.09016	-0.396000	0.07703	-0.430000	0.05897	GGA		0.338	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232	
MAP2	4133	broad.mit.edu	37	2	210559155	210559155	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr2:210559155A>G	ENST00000360351.4	+	7	2767	c.2261A>G	c.(2260-2262)gAg>gGg	p.E754G	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E750G	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	754					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E754G(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CCTGCACTGGAGAAAGCCCCT	0.458																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											67.0	67.0	67.0					2																	210559155		2203	4300	6503	210267400	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2261A>G	2.37:g.210559155A>G	ENSP00000353508:p.Glu754Gly		210267400	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.439385	0.43326	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25912	1.77;1.77	5.96	5.96	0.96718	MAP2/Tau projection (1);	0.180887	0.39020	N	0.001483	T	0.39036	0.1063	L	0.55481	1.735	0.58432	D	0.999991	D;D	0.56968	0.973;0.978	P;P	0.51974	0.559;0.686	T	0.18116	-1.0347	10	0.87932	D	0	-9.0279	16.4343	0.83869	1.0:0.0:0.0:0.0	.	750;754	P11137-3;P11137	.;MAP2_HUMAN	G	754;750	ENSP00000353508:E754G;ENSP00000392164:E750G	ENSP00000353508:E754G	E	+	2	0	MAP2	210267400	1.000000	0.71417	0.996000	0.52242	0.644000	0.38419	8.730000	0.91510	2.285000	0.76669	0.528000	0.53228	GAG		0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
LIPI	149998	broad.mit.edu	37	21	15561678	15561678	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr21:15561678A>G	ENST00000536861.1	-	2	108	c.109T>C	c.(109-111)Ttt>Ctt	p.F37L	LIPI_ENST00000344577.2_Missense_Mutation_p.F58L			Q6XZB0	LIPI_HUMAN	lipase, member I	37					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.F58L(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		CTCGGAATAAATAAATCTCTG	0.348																																																1	Substitution - Missense(1)	ovary(1)	21											91.0	94.0	93.0					21																	15561678		2203	4300	6503	14483549	SO:0001583	missense	149998			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.109T>C	21.37:g.15561678A>G	ENSP00000440381:p.Phe37Leu		14483549	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		.	.	.	.	.	.	.	.	.	.	A	17.07	3.293936	0.60086	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.87412	-2.25;-2.24	5.3	4.11	0.48088	.	3.131710	0.00582	N	0.000320	D	0.85695	0.5756	L	0.52011	1.625	0.22500	N	0.999048	B	0.22414	0.069	B	0.29862	0.108	T	0.65051	-0.6262	10	0.17369	T	0.5	.	8.6053	0.33769	0.8291:0.0:0.0:0.1709	.	58	Q6XZB0-2	.	L	58;37	ENSP00000343331:F58L;ENSP00000440381:F37L	ENSP00000343331:F58L	F	-	1	0	LIPI	14483549	0.306000	0.24490	0.987000	0.45799	0.843000	0.47879	0.623000	0.24447	0.920000	0.36970	0.533000	0.62120	TTT		0.348	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
STAG1	10274	broad.mit.edu	37	3	136323296	136323296	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr3:136323296C>T	ENST00000383202.2	-	4	408	c.152G>A	c.(151-153)cGa>cAa	p.R51Q	STAG1_ENST00000434713.2_5'UTR|STAG1_ENST00000236698.5_Missense_Mutation_p.R51Q|STAG1_ENST00000480733.1_Missense_Mutation_p.R51Q	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	51					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.R51Q(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TGGAGATTTTCGAGGTTTCTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	69.0	69.0					3																	136323296		2203	4300	6503	137805986	SO:0001583	missense	10274			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.152G>A	3.37:g.136323296C>T	ENSP00000372689:p.Arg51Gln		137805986	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903007	0.72754	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000480733	T;T	0.23754	1.89;1.89	5.96	5.06	0.68205	.	0.132078	0.50627	D	0.000107	T	0.24812	0.0602	L	0.55481	1.735	0.80722	D	1	P;D;D	0.53745	0.921;0.962;0.962	B;B;B	0.38194	0.182;0.267;0.267	T	0.03852	-1.0998	10	0.32370	T	0.25	.	15.9519	0.79846	0.1361:0.8639:0.0:0.0	.	51;51;51	C9JJQ0;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	Q	51	ENSP00000372689:R51Q;ENSP00000236698:R51Q	ENSP00000236698:R51Q	R	-	2	0	STAG1	137805986	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.335000	0.79234	1.462000	0.47948	0.655000	0.94253	CGA		0.383	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
APOD	347	broad.mit.edu	37	3	195295923	195295923	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr3:195295923G>T	ENST00000343267.3	-	5	779	c.418C>A	c.(418-420)Ctt>Att	p.L140I		NM_001647.3	NP_001638.1	P05090	APOD_HUMAN	apolipoprotein D	140					aging (GO:0007568)|angiogenesis (GO:0001525)|brain development (GO:0007420)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of lipoprotein lipid oxidation (GO:0060588)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of T cell migration (GO:2000405)|peripheral nervous system axon regeneration (GO:0014012)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to reactive oxygen species (GO:0000302)|tissue regeneration (GO:0042246)	cytosolic ribosome (GO:0022626)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)	p.L140I(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ACGTGAAAAAGTTGGATGATG	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											151.0	151.0	151.0					3																	195295923		2203	4300	6503	196777212	SO:0001583	missense	347				CCDS33925.1	3q29	2013-09-19			ENSG00000189058	ENSG00000189058		"""Lipocalins"", ""Apolipoproteins"""	612	protein-coding gene	gene with protein product		107740				2439269, 3453108	Standard	NM_001647		Approved		uc003fur.2	P05090	OTTHUMG00000155854	ENST00000343267.3:c.418C>A	3.37:g.195295923G>T	ENSP00000345179:p.Leu140Ile		196777212	B2R579|D3DNW6|Q6IBG6	Missense_Mutation	SNP	ENST00000343267.3	37	CCDS33925.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660452	0.47572	.	.	ENSG00000189058	ENST00000343267;ENST00000421243;ENST00000453131	T;T;T	0.29397	1.57;1.57;1.96	6.06	5.18	0.71444	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	L	0.59436	1.845	0.58432	D	0.999991	B	0.33777	0.425	B	0.33196	0.159	T	0.04481	-1.0948	10	0.11485	T	0.65	-19.8325	11.6875	0.51494	0.082:0.0:0.918:0.0	.	140	P05090	APOD_HUMAN	I	140;168;140	ENSP00000345179:L140I;ENSP00000415235:L168I;ENSP00000393076:L140I	ENSP00000345179:L140I	L	-	1	0	APOD	196777212	1.000000	0.71417	0.991000	0.47740	0.006000	0.05464	2.191000	0.42640	1.548000	0.49413	0.655000	0.94253	CTT		0.453	APOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342004.1	NM_001647	
NAA15	80155	broad.mit.edu	37	4	140280992	140280992	+	Nonsense_Mutation	SNP	C	C	G			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr4:140280992C>G	ENST00000296543.5	+	12	1676	c.1353C>G	c.(1351-1353)taC>taG	p.Y451*	NAA15_ENST00000398947.1_Nonsense_Mutation_p.Y451*	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	451					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)	p.Y451*(1)		NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						GTGCAAAATACATGCTAAAAG	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	4											91.0	87.0	88.0					4																	140280992		1917	4158	6075	140500442	SO:0001587	stop_gained	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1353C>G	4.37:g.140280992C>G	ENSP00000296543:p.Tyr451*		140500442	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Nonsense_Mutation	SNP	ENST00000296543.5	37	CCDS43270.1	.	.	.	.	.	.	.	.	.	.	C	37	6.596196	0.97692	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	.	.	.	5.86	1.3	0.21679	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.2167	10.46	0.44575	0.0:0.5571:0.0:0.4429	.	.	.	.	X	451;325;451	.	ENSP00000296543:Y451X	Y	+	3	2	NAA15	140500442	0.785000	0.28726	0.990000	0.47175	0.993000	0.82548	-0.036000	0.12185	-0.068000	0.12953	0.585000	0.79938	TAC		0.388	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	
TBC1D9	23158	broad.mit.edu	37	4	141555170	141555170	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr4:141555170C>T	ENST00000442267.2	-	16	2752	c.2678G>A	c.(2677-2679)cGc>cAc	p.R893H		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	893	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.R893H(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CTGGAACAAGCGGGAGGCCAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	4											63.0	63.0	63.0					4																	141555170		1976	4169	6145	141774620	SO:0001583	missense	23158			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2678G>A	4.37:g.141555170C>T	ENSP00000411197:p.Arg893His		141774620	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	37	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306999	0.81247	.	.	ENSG00000109436	ENST00000442267	T	0.48836	0.8	6.17	5.33	0.75918	EF-hand-like domain (1);	0.051926	0.85682	D	0.000000	T	0.65575	0.2704	L	0.54965	1.715	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.68887	-0.5290	10	0.72032	D	0.01	-7.4715	17.7453	0.88419	0.0:0.8777:0.1223:0.0	.	893	Q6ZT07	TBCD9_HUMAN	H	893	ENSP00000411197:R893H	ENSP00000411197:R893H	R	-	2	0	TBC1D9	141774620	1.000000	0.71417	0.994000	0.49952	0.540000	0.34992	7.818000	0.86416	1.616000	0.50265	-0.165000	0.13383	CGC		0.463	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
ADAMTS16	170690	broad.mit.edu	37	5	5318299	5318299	+	Missense_Mutation	SNP	C	C	T	rs561527628		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr5:5318299C>T	ENST00000274181.7	+	22	3602	c.3464C>T	c.(3463-3465)gCt>gTt	p.A1155V		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1155	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A1155V(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGTGCCTGGCTGGGGGCCGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		17255	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	5											32.0	38.0	36.0					5																	5318299		2067	4188	6255	5371299	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3464C>T	5.37:g.5318299C>T	ENSP00000274181:p.Ala1155Val		5371299	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	0.434	-0.902040	0.02453	.	.	ENSG00000145536	ENST00000274181	T	0.55234	0.53	4.83	-2.25	0.06888	.	0.492649	0.20796	N	0.085529	T	0.28863	0.0716	N	0.25789	0.76	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.09271	-1.0682	10	0.25106	T	0.35	.	3.0219	0.06078	0.1083:0.3893:0.1068:0.3955	.	1155	Q8TE57	ATS16_HUMAN	V	1155	ENSP00000274181:A1155V	ENSP00000274181:A1155V	A	+	2	0	ADAMTS16	5371299	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.398000	0.02509	-1.139000	0.02881	-1.119000	0.02030	GCT		0.647	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
MEF2C	4208	broad.mit.edu	37	5	88027630	88027630	+	Silent	SNP	G	G	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr5:88027630G>T	ENST00000437473.2	-	7	1143	c.726C>A	c.(724-726)ccC>ccA	p.P242P	MEF2C_ENST00000514015.1_Silent_p.P242P|MEF2C_ENST00000510942.1_Silent_p.P242P|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000504921.2_Silent_p.P242P|MEF2C_ENST00000340208.5_Silent_p.P260P|MEF2C_ENST00000539796.1_Silent_p.P194P|MEF2C_ENST00000514028.1_Silent_p.P242P|MEF2C_ENST00000508569.1_Silent_p.P242P|MEF2C_ENST00000424173.2_Silent_p.P240P|MEF2C_ENST00000506554.1_Silent_p.P242P	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	242					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P242P(1)		breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		AATTCATTGGGGGAGGAGATT	0.438										HNSCC(66;0.2)																																						1	Substitution - coding silent(1)	ovary(1)	5											98.0	95.0	96.0					5																	88027630		1852	4085	5937	88063386	SO:0001819	synonymous_variant	4208			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.726C>A	5.37:g.88027630G>T			88063386	C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	ENST00000437473.2	37	CCDS47245.1																																																																																				0.438	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
FAM81B	153643	broad.mit.edu	37	5	94785911	94785911	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr5:94785911G>A	ENST00000283357.5	+	10	1330	c.1284G>A	c.(1282-1284)atG>atA	p.M428I		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	428						nucleus (GO:0005634)		p.M428I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		AAACAAAGATGGATTTAGAGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	112.0	114.0					5																	94785911		1811	4074	5885	94811667	SO:0001583	missense	153643				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.1284G>A	5.37:g.94785911G>A	ENSP00000283357:p.Met428Ile		94811667		Missense_Mutation	SNP	ENST00000283357.5	37	CCDS43341.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017539	0.54576	.	.	ENSG00000153347	ENST00000283357;ENST00000512365	T	0.17854	2.25	5.62	4.7	0.59300	.	0.238711	0.45126	D	0.000384	T	0.17874	0.0429	L	0.43152	1.355	0.25327	N	0.989065	B	0.28082	0.2	B	0.28465	0.09	T	0.09885	-1.0654	10	0.35671	T	0.21	-17.7928	17.1715	0.86832	0.0:0.1373:0.8627:0.0	.	428	Q96LP2	FA81B_HUMAN	I	428;103	ENSP00000283357:M428I	ENSP00000283357:M428I	M	+	3	0	FAM81B	94811667	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.248000	0.58760	2.640000	0.89533	0.591000	0.81541	ATG		0.338	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
PPP1R3A	5506	broad.mit.edu	37	7	113522144	113522144	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr7:113522144C>A	ENST00000284601.3	-	3	984	c.916G>T	c.(916-918)Gat>Tat	p.D306Y		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	306					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.D306Y(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CTGTTTACATCTTTTACATTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											216.0	177.0	190.0					7																	113522144		2203	4300	6503	113309380	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.916G>T	7.37:g.113522144C>A	ENSP00000284601:p.Asp306Tyr		113309380	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951561	0.53186	.	.	ENSG00000154415	ENST00000284601	T	0.26373	1.74	5.92	5.92	0.95590	.	0.088137	0.48767	D	0.000180	T	0.54029	0.1833	M	0.72894	2.215	0.48395	D	0.999642	D	0.89917	1.0	D	0.77557	0.99	T	0.52852	-0.8520	10	0.87932	D	0	-2.6119	20.3207	0.98668	0.0:1.0:0.0:0.0	.	306	Q16821	PPR3A_HUMAN	Y	306	ENSP00000284601:D306Y	ENSP00000284601:D306Y	D	-	1	0	PPP1R3A	113309380	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	5.085000	0.64468	2.813000	0.96785	0.561000	0.74099	GAT		0.348	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
LPL	4023	broad.mit.edu	37	8	19811856	19811856	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr8:19811856G>C	ENST00000311322.8	+	5	1237	c.767G>C	c.(766-768)gGa>gCa	p.G256A		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	256					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)	p.G256A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	GCAGAGAGAGGACTTGGAGGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											81.0	77.0	78.0					8																	19811856		2203	4300	6503	19856136	SO:0001583	missense	4023				CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.767G>C	8.37:g.19811856G>C	ENSP00000309757:p.Gly256Ala		19856136	B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	ENST00000311322.8	37	CCDS6012.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269004	0.59540	.	.	ENSG00000175445	ENST00000311322;ENST00000538071;ENST00000535763	D	0.94457	-3.43	6.08	6.08	0.98989	Lipase, N-terminal (1);	0.186891	0.64402	D	0.000020	D	0.96679	0.8916	L	0.61036	1.89	0.41118	D	0.985795	D	0.89917	1.0	D	0.97110	1.0	D	0.95699	0.8747	8	.	.	.	-28.4149	18.1573	0.89696	0.0:0.0:1.0:0.0	.	256	P06858	LIPL_HUMAN	A	256;180;242	ENSP00000309757:G256A	.	G	+	2	0	LPL	19856136	1.000000	0.71417	0.806000	0.32338	0.469000	0.32828	5.663000	0.68038	2.894000	0.99253	0.655000	0.94253	GGA		0.408	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
ZFAND1	79752	broad.mit.edu	37	8	82626245	82626245	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr8:82626245G>A	ENST00000220669.5	-	6	406	c.388C>T	c.(388-390)Cga>Tga	p.R130*	ZFAND1_ENST00000522520.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000521287.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000519523.1_Nonsense_Mutation_p.R130*|ZFAND1_ENST00000521895.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000523096.1_Nonsense_Mutation_p.R130*|ZFAND1_ENST00000517588.1_Nonsense_Mutation_p.R23*	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	130							zinc ion binding (GO:0008270)	p.R130*(3)		kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CCTTTCCATCGTTTACTTGCT	0.343																																																3	Substitution - Nonsense(3)	lung(1)|ovary(1)|prostate(1)	8											187.0	158.0	168.0					8																	82626245		2203	4299	6502	82788800	SO:0001587	stop_gained	79752				CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.388C>T	8.37:g.82626245G>A	ENSP00000220669:p.Arg130*		82788800	E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Nonsense_Mutation	SNP	ENST00000220669.5	37	CCDS6232.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970302	0.92919	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521895;ENST00000521287;ENST00000520635;ENST00000517588;ENST00000519523;ENST00000520604;ENST00000523361;ENST00000517450;ENST00000521742;ENST00000518419;ENST00000520076	.	.	.	5.78	2.72	0.32119	.	0.330492	0.31495	N	0.007556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	11.0672	0.47982	0.0:0.4208:0.4368:0.1425	.	.	.	.	X	130;130;23;23;23;23;23;130;23;23;23;23;23;23	.	ENSP00000220669:R130X	R	-	1	2	ZFAND1	82788800	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	2.483000	0.45233	0.725000	0.32318	0.650000	0.86243	CGA		0.343	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699	
TOPORS	10210	broad.mit.edu	37	9	32542101	32542101	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr9:32542101C>A	ENST00000360538.2	-	3	2538	c.2422G>T	c.(2422-2424)Gaa>Taa	p.E808*	TOPORS_ENST00000379858.1_Nonsense_Mutation_p.E743*	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	808	Interaction with TOP1.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E808*(1)|p.E808K(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TGAGCCACTTCGTTAGTACCC	0.423																																																2	Substitution - Nonsense(1)|Substitution - Missense(1)	ovary(1)|large_intestine(1)	9	GRCh37	CM081845	TOPORS	M							124.0	120.0	121.0					9																	32542101		2203	4300	6503	32532101	SO:0001587	stop_gained	10210			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.2422G>T	9.37:g.32542101C>A	ENSP00000353735:p.Glu808*		32532101	O43273|Q6P987|Q9NS55|Q9UNR9	Nonsense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777658	0.90195	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	.	.	.	5.91	3.98	0.46160	.	0.123059	0.37348	N	0.002126	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-10.6127	8.2296	0.31590	0.1458:0.7289:0.0:0.1252	.	.	.	.	X	808;743	.	ENSP00000353735:E808X	E	-	1	0	TOPORS	32532101	0.009000	0.17119	0.870000	0.34147	0.561000	0.35649	0.740000	0.26188	2.803000	0.96430	0.650000	0.86243	GAA		0.423	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
TCEAL6	158931	broad.mit.edu	37	X	101396192	101396192	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chrX:101396192C>T	ENST00000372774.3	-	3	361	c.112G>A	c.(112-114)Gcg>Acg	p.A38T	TCEAL6_ENST00000372773.1_Missense_Mutation_p.A38T	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	38	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A38T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						ttcccctccgcgtctggcttt	0.498																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	91.0	98.0					X																	101396192		2203	4300	6503	101282848	SO:0001583	missense	158931			BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.112G>A	X.37:g.101396192C>T	ENSP00000361860:p.Ala38Thr		101282848	Q5H9J8	Missense_Mutation	SNP	ENST00000372774.3	37	CCDS43978.1	.	.	.	.	.	.	.	.	.	.	T	0.815	-0.750600	0.03041	.	.	ENSG00000204071	ENST00000372774;ENST00000372773;ENST00000536102	T;T	0.22539	1.95;1.95	2.47	-3.18	0.05186	.	1.722260	0.03648	N	0.240630	T	0.13798	0.0334	N	0.22421	0.69	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.33111	-0.9881	10	0.13853	T	0.58	.	10.2982	0.43637	0.0:0.4839:0.0:0.5161	.	38	Q6IPX3-2	.	T	38	ENSP00000361860:A38T;ENSP00000361859:A38T	ENSP00000361859:A38T	A	-	1	0	TCEAL6	101282848	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-3.926000	0.00333	-1.795000	0.01255	-1.657000	0.00753	GCG		0.498	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938	
KIAA1210	57481	broad.mit.edu	37	X	118221320	118221320	+	Silent	SNP	C	C	T			TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chrX:118221320C>T	ENST00000402510.2	-	11	3872	c.3873G>A	c.(3871-3873)caG>caA	p.Q1291Q		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1291								p.Q1115Q(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TGGGAGACAGCTGCTCTTTAA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	X											68.0	65.0	66.0					X																	118221320		1843	4076	5919	118105348	SO:0001819	synonymous_variant	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3873G>A	X.37:g.118221320C>T			118105348	B7ZCI8|Q5JPN4	Silent	SNP	ENST00000402510.2	37	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	C	1.640	-0.516736	0.04200	.	.	ENSG00000248857	ENST00000440399	.	.	.	3.97	1.95	0.26073	.	.	.	.	.	T	0.27063	0.0663	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21895	-1.0232	4	.	.	.	.	5.6643	0.17687	0.0:0.7178:0.0:0.2822	.	.	.	.	T	698	.	.	A	-	1	0	KIAA1210	118105348	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	0.043000	0.13971	0.366000	0.24427	0.600000	0.82982	GCT		0.493	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-25-1321-01A-01W-0492-08	TCGA-25-1321-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	51051328-40ac-40f9-a7b1-2c92f814ab7f	0f808f3f-709e-40bc-bf7f-74f0aaff408a	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		7517846	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
