#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								7845	SO:0001628	intergenic_variant	0																															Unknown.37:g.0A>G			7845		Missense_Mutation	SNP	HMMPfam_COX2_TM,superfamily_Cytochrome c oxidase subunit II-like transmembrane region,superfamily_Cupredoxins,HMMPfam_COX2,PatternScan_COX2	p.T87A		37	c.259		MT																																																																																			-	superfamily_Cytochrome c oxidase subunit II-like transmembrane region	0	0					MT-CO2			A			7845	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	missense	SNP	NULL	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8937	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0T>C			8937		Missense_Mutation	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.L137P		37	c.410		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			T			8937	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8949	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0T>C			8949		Missense_Mutation	SNP	HMMPfam_ATP-synt_A,PatternScan_ATPASE_A,superfamily_ATPase_F0_A	p.L141P		37	c.422		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			T			8949	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8994	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0T>C			8994		Missense_Mutation	SNP	HMMPfam_ATP-synt_A,PatternScan_ATPASE_A,superfamily_ATPase_F0_A	p.L156P		37	c.467		MT																																																																																			-	HMMPfam_ATP-synt_A,PatternScan_ATPASE_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			T			8994	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113888																																								11090	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A			11090		Splice_Site	SNP	-	NULL		37	c.NULL		NT_113888																																																																																			-	-	0	0					ENSG00000215746			G			11090	-1	no_coding_region:pseudogene	ENST00000400836	ensembl	human	novel	54_36p	splice_site	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								11173	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0A>G			11173		Missense_Mutation	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.N138S		37	c.413		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND4			A			11173	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	missense	SNP	NULL	G
LONP1	9361	genome.wustl.edu	37	19	5707747	5707747	+	Silent	SNP	G	G	A	rs146893125		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:5707747G>A	ENST00000360614.3	-	6	1180	c.1023C>T	c.(1021-1023)gcC>gcT	p.A341A	LONP1_ENST00000540670.2_Silent_p.A145A|LONP1_ENST00000593119.1_Silent_p.A277A|LONP1_ENST00000590729.1_Silent_p.A211A|LONP1_ENST00000585374.1_Silent_p.A227A	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATGGGACTCGGCCCCGGTGA	0.657																																																0			19						G		0,4406		0,0,2203	58.0	60.0	59.0		1023	-7.7	0.9	19	dbSNP_134	59	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	LONP1	NM_004793.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		341/960	5707747	1,13003	2203	4299	6502	5658747	SO:0001819	synonymous_variant	9361			U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1023C>T	19.37:g.5707747G>A			5658747		Silent	SNP	HMMPfam_LON,HMMSmart_LON,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,HMMPfam_Lon_C,superfamily_Ribosomal_S5_D2-typ_fold,PatternScan_LON_SER	p.A341	ENST00000360614.3	37	c.1023	CCDS12148.1	19																																																																																			-	HMMPfam_LON,HMMSmart_LON		0.657	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP1	protein_coding	OTTHUMT00000451662.1	G	NM_004793		5658747	-1	no_errors	NM_004793	genbank	human	reviewed	54_36p	silent	SNP	0.974	A
CLSTN3	9746	genome.wustl.edu	37	12	7282962	7282962	+	5'UTR	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr12:7282962A>G	ENST00000266546.6	+	0	168				CLSTN3_ENST00000537408.1_5'Flank|RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000544657.1_RNA|RP11-273B20.1_ENST00000538062.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GGCTGTGCTGACGTCATCCTG	0.672																																																0			12																																								7174229	SO:0001623	5_prime_UTR_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.-283A>G	12.37:g.7282962A>G			7174229	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	NULL	p.V42A	ENST00000266546.6	37	c.125	CCDS8575.1	12																																																																																			-	NULL		0.672	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133229	protein_coding	OTTHUMT00000398560.2	A	NM_014718		7174229	-1	no_errors	XM_001721004	genbank	human	model	54_36p	missense	SNP	1.000	G
CD68	968	genome.wustl.edu	37	17	7483560	7483560	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr17:7483560C>T	ENST00000250092.6	+	2	693	c.482C>T	c.(481-483)aCg>aTg	p.T161M	CD68_ENST00000380498.6_Missense_Mutation_p.T134M|SNORA67_ENST00000384423.1_RNA|AC113189.5_ENST00000415124.1_RNA|AC113189.5_ENST00000417897.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|AC113189.5_ENST00000573187.1_RNA|AC113189.5_ENST00000572046.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule	161					cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						GGAGACTACACGTGGACCAAT	0.562																																																0			17											91.0	73.0	79.0					17																	7483560		2203	4300	6503	7424284	SO:0001583	missense	968			S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146	ENST00000250092.6:c.482C>T	17.37:g.7483560C>T	ENSP00000250092:p.Thr161Met		7424284	B4DVT4|Q53HR6|Q53XI3|Q96BI7	Missense_Mutation	SNP	HMMPfam_Lamp,PatternScan_LAMP_2	p.T161M	ENST00000250092.6	37	c.482	CCDS11114.1	17	.	.	.	.	.	.	.	.	.	.	C	6.450	0.451202	0.12223	.	.	ENSG00000129226	ENST00000250092;ENST00000380498	T	0.35048	1.33	5.99	-7.51	0.01346	.	1.147460	0.06271	N	0.695675	T	0.35799	0.0944	M	0.72118	2.19	0.09310	N	0.999999	B;B	0.23377	0.035;0.084	B;B	0.19391	0.025;0.025	T	0.35847	-0.9772	10	0.34782	T	0.22	3.1767	14.9224	0.70851	0.0:0.3852:0.0:0.6148	.	161;134	P34810;B4DVT4	CD68_HUMAN;.	M	161;104	ENSP00000250092:T161M	ENSP00000250092:T161M	T	+	2	0	CD68	7424284	0.000000	0.05858	0.002000	0.10522	0.119000	0.20118	-2.446000	0.01010	-1.195000	0.02680	-1.021000	0.02439	ACG	-	HMMPfam_Lamp		0.562	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD68	protein_coding	OTTHUMT00000226949.3	C	NM_001251		7424284	+1	no_errors	NM_001251	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr17:7578403C>A	ENST00000269305.4	-	5	716	c.527G>T	c.(526-528)tGc>tTc	p.C176F	TP53_ENST00000413465.2_Missense_Mutation_p.C176F|TP53_ENST00000359597.4_Missense_Mutation_p.C176F|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.C176F|TP53_ENST00000455263.2_Missense_Mutation_p.C176F|TP53_ENST00000445888.2_Missense_Mutation_p.C176F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	17											49.0	49.0	49.0					17																	7578403		2203	4300	6503	7519128	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>T	17.37:g.7578403C>A	ENSP00000269305:p.Cys176Phe		7519128	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C176F	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433429	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.994;0.996;0.998;0.997;0.995;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176F;ENSP00000352610:C176F;ENSP00000269305:C176F;ENSP00000398846:C176F;ENSP00000391127:C176F;ENSP00000391478:C176F;ENSP00000425104:C44F;ENSP00000423862:C83F	ENSP00000269305:C176F	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519128	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TPTE	7179	genome.wustl.edu	37	21	10944684	10944684	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr21:10944684G>A	ENST00000361285.4	-	11	879	c.550C>T	c.(550-552)Ctt>Ttt	p.L184F	TPTE_ENST00000298232.7_Missense_Mutation_p.L166F|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.L146F	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	184					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATATTCCTAAGCAACTTAATG	0.289																																																0			21											154.0	169.0	164.0					21																	10944684		2203	4300	6503	9966555	SO:0001583	missense	7179			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.550C>T	21.37:g.10944684G>A	ENSP00000355208:p.Leu184Phe		9966555	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,superfamily_(Phosphotyrosine protein) phosphatases II,PatternScan_TYR_PHOSPHATASE_1,HMMPfam_PTEN_C2,superfamily_C2 domain (Calcium/lipid-binding domain CaLB)	p.L184F	ENST00000361285.4	37	c.550	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	5.950	0.359298	0.11239	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98455	-4.94;-4.94;-4.94	2.31	-3.14	0.05250	Ion transport (1);	0.435272	0.21413	N	0.074943	D	0.94387	0.8195	L	0.47716	1.5	0.09310	N	1	B;B;B	0.27140	0.043;0.084;0.169	B;B;B	0.26517	0.023;0.042;0.07	D	0.88162	0.2858	10	0.56958	D	0.05	-2.1205	3.9106	0.09201	0.2744:0.3855:0.3401:0.0	.	146;166;184	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	F	166;184;146	ENSP00000298232:L166F;ENSP00000355208:L184F;ENSP00000344441:L146F	ENSP00000298232:L166F	L	-	1	0	TPTE	9966555	0.000000	0.05858	0.000000	0.03702	0.218000	0.24690	-1.358000	0.02604	-0.745000	0.04772	0.194000	0.17425	CTT	-	superfamily_Voltage-gated potassium channels		0.289	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	protein_coding	OTTHUMT00000157413.1	G			9966555	-1	no_errors	NM_199261	genbank	human	validated	54_36p	missense	SNP	0.000	A
ATG4D	84971	genome.wustl.edu	37	19	10659588	10659588	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:10659588G>A	ENST00000309469.4	+	6	1017	c.844G>A	c.(844-846)Gcg>Acg	p.A282T	RNU7-140P_ENST00000459546.1_RNA|ATG4D_ENST00000540862.1_Intron	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	282					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			AGTGTACAAGGCGGATGTGGC	0.647																																																0			19											91.0	78.0	82.0					19																	10659588		2203	4300	6503	10520588	SO:0001583	missense	84971			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.844G>A	19.37:g.10659588G>A	ENSP00000311318:p.Ala282Thr		10520588	Q969K0	Missense_Mutation	SNP	HMMPfam_Peptidase_C54	p.A282T	ENST00000309469.4	37	c.844	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401441	0.83120	.	.	ENSG00000130734	ENST00000309469	T	0.42513	0.97	5.73	5.73	0.89815	.	0.156244	0.56097	D	0.000031	T	0.49167	0.1541	L	0.35593	1.075	0.80722	D	1	P;P	0.51240	0.891;0.943	B;P	0.54706	0.326;0.759	T	0.35076	-0.9803	10	0.41790	T	0.15	-13.7051	18.6439	0.91404	0.0:0.0:1.0:0.0	.	219;282	B4DGM8;Q86TL0	.;ATG4D_HUMAN	T	282	ENSP00000311318:A282T	ENSP00000311318:A282T	A	+	1	0	ATG4D	10520588	1.000000	0.71417	0.994000	0.49952	0.937000	0.57800	6.426000	0.73374	2.708000	0.92522	0.549000	0.68633	GCG	-	HMMPfam_Peptidase_C54		0.647	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	protein_coding	OTTHUMT00000452022.1	G	NM_032885		10520588	+1	no_errors	NM_032885	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TRDMT1	1787	genome.wustl.edu	37	10	17199454	17199454	+	Silent	SNP	C	C	A	rs542664811		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr10:17199454C>A	ENST00000377799.3	-	8	920	c.873G>T	c.(871-873)gtG>gtT	p.V291V	TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000412821.3_Silent_p.V267V|TRDMT1_ENST00000457442.2_Silent_p.V210V|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000377766.5_3'UTR|TRDMT1_ENST00000488990.1_Silent_p.V168V|TRDMT1_ENST00000351358.4_Silent_p.V245V	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	291	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	TGGTAAAGCACACGGACCTTC	0.373																																																0			10											92.0	91.0	91.0					10																	17199454		2203	4300	6503	17239460	SO:0001819	synonymous_variant	1787			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.873G>T	10.37:g.17199454C>A			17239460	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Silent	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_DNA_methylase,PatternScan_C5_MTASE_2	p.V291	ENST00000377799.3	37	c.873	CCDS7114.1	10	.	.	.	.	.	.	.	.	.	.	C	0.204	-1.042608	0.01997	.	.	ENSG00000107614	ENST00000313936	T	0.62364	0.03	5.03	-5.34	0.02705	.	0.626673	0.18364	N	0.143474	T	0.50616	0.1626	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45279	-0.9272	7	0.22109	T	0.4	4.3366	8.1386	0.31069	0.1858:0.2342:0.0:0.58	.	.	.	.	L	225	ENSP00000324263:V225L	ENSP00000324263:V225L	V	-	1	0	TRDMT1	17239460	0.000000	0.05858	0.006000	0.13384	0.285000	0.27093	-3.203000	0.00559	-1.481000	0.01863	-0.142000	0.14014	GTG	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.373	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	protein_coding	OTTHUMT00000047024.3	C	NM_004412		17239460	-1	no_errors	NM_004412	genbank	human	reviewed	54_36p	silent	SNP	0.700	A
MAP1S	55201	genome.wustl.edu	37	19	17836856	17836856	+	Silent	SNP	G	G	A	rs142794572	byFrequency	TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:17836856G>A	ENST00000324096.4	+	5	814	c.663G>A	c.(661-663)ccG>ccA	p.P221P	MAP1S_ENST00000544059.2_Silent_p.P195P|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	221	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TGGAGCCACCGTCCCCCTTCG	0.701																																																0			19											24.0	25.0	25.0					19																	17836856		2202	4300	6502	17697856	SO:0001819	synonymous_variant	55201			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.663G>A	19.37:g.17836856G>A			17697856	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	NULL	p.P221	ENST00000324096.4	37	c.663	CCDS32954.1	19																																																																																			-	NULL		0.701	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	protein_coding	OTTHUMT00000466027.1	G	NM_018174		17697856	+1	no_errors	NM_018174	genbank	human	validated	54_36p	silent	SNP	0.081	A
ETNK1	55500	genome.wustl.edu	37	12	22796710	22796710	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr12:22796710G>C	ENST00000266517.4	+	2	526	c.437G>C	c.(436-438)gGa>gCa	p.G146A	ETNK1_ENST00000335148.3_Missense_Mutation_p.G146A	NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1	146					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTCACAGATGGAATCACAAAT	0.333																																					Esophageal Squamous(42;87 913 3224 6226 43339)											0			12											58.0	60.0	59.0					12																	22796710		2202	4299	6501	22687977	SO:0001583	missense	55500			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.437G>C	12.37:g.22796710G>C	ENSP00000266517:p.Gly146Ala		22687977	G5E969	Missense_Mutation	SNP	superfamily_Kinase_like,HMMPfam_Choline_kinase	p.G146A	ENST00000266517.4	37	c.437	CCDS8698.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.507373|4.507373	0.85282|0.85282	.|.	.|.	ENSG00000139163|ENSG00000139163	ENST00000538218;ENST00000541247|ENST00000266517;ENST00000381409;ENST00000335148	.|D;D	.|0.86366	.|-2.11;-2.11	5.26|5.26	5.26|5.26	0.73747|0.73747	.|Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93314|0.93314	0.7869|0.7869	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.92683|0.92683	0.6160|0.6160	5|10	.|0.45353	.|T	.|0.12	-11.4435|-11.4435	19.2182|19.2182	0.93786|0.93786	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|146;146;146	.|E9PD44;Q9HBU6;G5E969	.|.;EKI1_HUMAN;.	Q|A	137;26|146	.|ENSP00000266517:G146A;ENSP00000334041:G146A	.|ENSP00000266517:G146A	E|G	+|+	1|2	0|0	ETNK1|ETNK1	22687977|22687977	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	8.946000|8.946000	0.92992|0.92992	2.618000|2.618000	0.88619|0.88619	0.557000|0.557000	0.71058|0.71058	GAA|GGA	-	superfamily_Kinase_like		0.333	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK1	protein_coding	OTTHUMT00000401926.2	G	NM_018638		22687977	+1	no_errors	NM_018638	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PPARGC1A	10891	genome.wustl.edu	37	4	23803944	23803944	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:23803944C>T	ENST00000264867.2	-	11	2163	c.2044G>A	c.(2044-2046)Ggt>Agt	p.G682S	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	682	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CTGATTTTACCGACATAAATC	0.517																																					Esophageal Squamous(29;694 744 13796 34866 44181)											0			4											110.0	106.0	107.0					4																	23803944		2203	4300	6503	23413042	SO:0001583	missense	10891			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.2044G>A	4.37:g.23803944C>T	ENSP00000264867:p.Gly682Ser		23413042	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.G682S	ENST00000264867.2	37	c.2044	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	c	18.19	3.567943	0.65651	.	.	ENSG00000109819	ENST00000264867	T	0.21031	2.03	5.16	5.16	0.70880	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.093133	0.85682	D	0.000000	T	0.50292	0.1607	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51934	-0.8642	10	0.56958	D	0.05	-7.6558	19.0215	0.92917	0.0:1.0:0.0:0.0	.	682	Q9UBK2	PRGC1_HUMAN	S	682	ENSP00000264867:G682S	ENSP00000264867:G682S	G	-	1	0	PPARGC1A	23413042	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.737000	0.68606	2.582000	0.87167	0.457000	0.33378	GGT	-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1		0.517	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	protein_coding	OTTHUMT00000214976.1	C	NM_013261		23413042	-1	no_errors	NM_013261	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
STK31	56164	genome.wustl.edu	37	7	23854788	23854788	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:23854788A>G	ENST00000355870.3	+	23	2905	c.2786A>G	c.(2785-2787)gAg>gGg	p.E929G	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Intron|STK31_ENST00000354639.3_Missense_Mutation_p.E906G|STK31_ENST00000428484.1_Missense_Mutation_p.E906G	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	929	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CAGGAGTTTGAGATAAATAAA	0.338																																																0			7											107.0	107.0	107.0					7																	23854788		2203	4300	6503	23821313	SO:0001583	missense	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2786A>G	7.37:g.23854788A>G	ENSP00000348132:p.Glu929Gly		23821313	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	HMMPfam_TUDOR,superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)	p.E929G	ENST00000355870.3	37	c.2786	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	A	11.97	1.798791	0.31777	.	.	ENSG00000196335	ENST00000355870;ENST00000354639;ENST00000428484	T;T;T	0.66638	-0.22;-0.22;-0.22	4.49	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.313274	0.27567	N	0.018798	T	0.52565	0.1742	L	0.33245	0.995	0.25064	N	0.991044	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.38866	-0.9641	10	0.30078	T	0.28	-5.5619	10.3844	0.44132	1.0:0.0:0.0:0.0	.	929;929	A4D159;Q9BXU1	.;STK31_HUMAN	G	929;906;906	ENSP00000348132:E929G;ENSP00000346660:E906G;ENSP00000406146:E906G	ENSP00000346660:E906G	E	+	2	0	STK31	23821313	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.468000	0.45102	2.023000	0.59567	0.392000	0.25879	GAG	-	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)		0.338	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	protein_coding	OTTHUMT00000214036.2	A	NM_031414		23821313	+1	no_errors	NM_031414	genbank	human	reviewed	54_36p	missense	SNP	0.991	G
ADAMTS5	11096	genome.wustl.edu	37	21	28302267	28302267	+	Silent	SNP	G	G	A	rs201435455		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr21:28302267G>A	ENST00000284987.5	-	7	2284	c.2163C>T	c.(2161-2163)tgC>tgT	p.C721C	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	721	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CACATACTCCGCACTTGTCAT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		18598	0.0		0.001	False		,,,				2504	0.0				Esophageal Squamous(53;683 1080 10100 14424 45938)											0			21						G		0,4406		0,0,2203	211.0	188.0	196.0		2163	-3.7	0.8	21		196	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS5	NM_007038.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		721/931	28302267	1,13005	2203	4300	6503	27224138	SO:0001819	synonymous_variant	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2163C>T	21.37:g.28302267G>A			27224138	Q52LV4|Q9UKP2	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.C721	ENST00000284987.5	37	c.2163	CCDS13579.1	21																																																																																			-	NULL		0.443	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	protein_coding	OTTHUMT00000171648.1	G			27224138	-1	no_errors	NM_007038	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
ADAMTS5	11096	genome.wustl.edu	37	21	28315730	28315730	+	Silent	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr21:28315730G>A	ENST00000284987.5	-	3	1495	c.1374C>T	c.(1372-1374)gcC>gcT	p.A458A		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	458	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CTGTGATGGTGGCTGAAGTGC	0.423																																					Esophageal Squamous(53;683 1080 10100 14424 45938)											0			21											112.0	93.0	99.0					21																	28315730		2203	4300	6503	27237601	SO:0001819	synonymous_variant	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1374C>T	21.37:g.28315730G>A			27237601	Q52LV4|Q9UKP2	Silent	SNP	"HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat,HMMPfam_Reprolysin,HMMPfam_Pep_M12B_propep,HMMSmart_SM00608,HMMPfam_ADAM_spacer1,superfamily_Metalloproteases (""zincins"") catalytic domain"	p.A458	ENST00000284987.5	37	c.1374	CCDS13579.1	21																																																																																			-	"HMMPfam_Reprolysin,superfamily_Metalloproteases (""zincins"") catalytic domain"		0.423	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	protein_coding	OTTHUMT00000171648.1	G			27237601	-1	no_errors	NM_007038	genbank	human	reviewed	54_36p	silent	SNP	0.998	A
CFB	629	genome.wustl.edu	37	6	31919723	31919723	+	Silent	SNP	C	C	T	rs537918200		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr6:31919723C>T	ENST00000425368.2	+	18	2724	c.2211C>T	c.(2209-2211)caC>caT	p.H737H	CFB_ENST00000456570.1_Silent_p.H1239H|CFB_ENST00000477310.1_Silent_p.H1088H|CFB_ENST00000556679.1_Silent_p.H1239H	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	737	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						TACCTGCTCACGCCCGAGACT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		20377	0.0		0.0	False		,,,				2504	0.001															0			6											236.0	251.0	246.0					6																	31919723		1511	2709	4220	32027702	SO:0001819	synonymous_variant	629			L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.2211C>T	6.37:g.31919723C>T			32027702	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	superfamily_Complement control module/SCR domain,HMMSmart_SM00032,HMMPfam_Sushi,HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA,superfamily_Trypsin-like serine proteases,HMMPfam_Trypsin,HMMSmart_SM00020,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.H737	ENST00000425368.2	37	c.2211	CCDS4729.1	6	.	.	.	.	.	.	.	.	.	.	C	5.992	0.366968	0.11352	.	.	ENSG00000243649	ENST00000483004	.	.	.	5.54	-11.1	0.00147	.	.	.	.	.	T	0.52240	0.1722	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74203	-0.3741	4	.	.	.	-6.2326	20.2611	0.98445	0.0:0.7005:0.0:0.2995	.	.	.	.	M	278	.	.	T	+	2	0	CFB	32027702	0.000000	0.05858	0.003000	0.11579	0.993000	0.82548	-3.396000	0.00485	-2.362000	0.00609	-0.302000	0.09304	ACG	-	superfamily_Trypsin-like serine proteases,HMMPfam_Trypsin,HMMSmart_SM00020		0.517	CFB-001	KNOWN	basic|CCDS	protein_coding	CFB	protein_coding	OTTHUMT00000076395.3	C	NM_001710		32027702	+1	no_errors	NM_001710	genbank	human	reviewed	54_36p	silent	SNP	0.311	T
GPI	2821	genome.wustl.edu	37	19	34856216	34856216	+	Silent	SNP	A	A	G	rs572523544	byFrequency	TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:34856216A>G	ENST00000356487.5	+	1	286	c.45A>G	c.(43-45)caA>caG	p.Q15Q	GPI_ENST00000586425.1_Silent_p.Q15Q|GPI_ENST00000415930.3_Silent_p.Q54Q	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	15					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					AGCTGCAGCAATGGTACCGCG	0.672													A|||	2	0.000399361	0.0	0.0	5008	,	,		7823	0.0		0.0	False		,,,				2504	0.002															0			19											35.0	36.0	35.0					19																	34856216		2203	4300	6503	39548056	SO:0001819	synonymous_variant	2821			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.45A>G	19.37:g.34856216A>G			39548056	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	superfamily_SSF53697,HMMPfam_PGI	p.M18V	ENST00000356487.5	37	c.52	CCDS12437.1	19	.	.	.	.	.	.	.	.	.	.	A	2.241	-0.373814	0.05034	.	.	ENSG00000105220	ENST00000392234	.	.	.	4.85	-7.64	0.01286	.	.	.	.	.	T	0.58235	0.2108	.	.	.	0.80722	D	1	B	0.13594	0.008	B	0.06405	0.002	T	0.25082	-1.0142	7	0.87932	D	0	-8.0E-4	19.6364	0.95735	0.2144:0.0:0.7856:0.0	.	18	Q59F85	.	V	18	.	ENSP00000376067:M18V	M	+	1	0	GPI	39548056	0.015000	0.18098	0.011000	0.14972	0.091000	0.18340	-1.162000	0.03141	-1.617000	0.01570	-0.464000	0.05259	ATG	-	NULL		0.672	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPI	protein_coding	OTTHUMT00000451693.3	A			39548056	+1	no_start_codon	ENST00000392234	ensembl	human	known	54_36p	missense	SNP	0.012	G
INTS6P1	285634	genome.wustl.edu	37	5	39721068	39721068	+	IGR	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr5:39721068C>T								CTD-2078B5.2 (196258 upstream) : LINC00603 (331324 downstream)																							ACTTTCTGCACCAAGGACTCC	0.468																																																0			5																																								39756825	SO:0001628	intergenic_variant	285634																															5.37:g.39721068C>T			39756825		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.468					LOC285634			C			39756825	-1	pseudogene	XR_017261	genbank	human	model	54_36p	rna	SNP	1.000	T
DMKN	93099	genome.wustl.edu	37	19	36002404	36002404	+	Missense_Mutation	SNP	C	C	T	rs56743379|rs138902616		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:36002404C>T	ENST00000339686.3	-	5	1003	c.827G>A	c.(826-828)aGc>aAc	p.S276N	DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S276N|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.S276N|DMKN_ENST00000447113.2_Missense_Mutation_p.S276N|DMKN_ENST00000424570.2_Missense_Mutation_p.S276N|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.S276N|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000467637.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	276	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gccactgctgctgccactgct	0.647																																																1	Deletion - In frame(1)	ovary(1)	19											28.0	21.0	23.0					19																	36002404		2176	4255	6431	40694244	SO:0001583	missense	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.827G>A	19.37:g.36002404C>T	ENSP00000342012:p.Ser276Asn		40694244	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	NULL	p.S276N	ENST00000339686.3	37	c.827	CCDS12463.1	19	.	.	.	.	.	.	.	.	.	.	C	7.414	0.635437	0.14322	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	3.2	-1.74	0.08056	.	0.904855	0.09337	N	0.815985	T	0.30696	0.0773	L	0.48642	1.525	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.08055	0.001;0.001;0.001;0.001;0.003	T	0.32241	-0.9914	10	0.16896	T	0.51	5.0393	8.4003	0.32581	0.0:0.7659:0.0:0.2341	.	276;276;276;276;276	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	N	276	ENSP00000342012:S276N;ENSP00000394908:S276N;ENSP00000415277:S276N;ENSP00000414743:S276N;ENSP00000388404:S276N;ENSP00000409513:S276N	ENSP00000342012:S276N	S	-	2	0	DMKN	40694244	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.213000	0.09305	-0.013000	0.14199	-1.984000	0.00453	AGC	-	NULL		0.647	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	protein_coding	OTTHUMT00000109461.2	C	NM_033317		40694244	-1	no_errors	NM_033317	genbank	human	reviewed	54_36p	missense	SNP	0.007	T
LRFN3	79414	genome.wustl.edu	37	19	36435579	36435579	+	Silent	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:36435579C>T	ENST00000588831.1	+	4	2599	c.1545C>T	c.(1543-1545)tgC>tgT	p.C515C	AF038458.3_ENST00000592518.1_lincRNA|LRFN3_ENST00000246529.3_Silent_p.C515C			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	515	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTGTGGGCTGCGCCCGCTTCT	0.711																																																0			19											12.0	13.0	13.0					19																	36435579		2193	4279	6472	41127419	SO:0001819	synonymous_variant	79414			BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.1545C>T	19.37:g.36435579C>T			41127419	Q6UY10	Silent	SNP	HMMSmart_LRRNT,superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1,HMMSmart_LRRCT,superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,superfamily_FN_III-like,HMMPfam_fn3,HMMSmart_FN3	p.C515	ENST00000588831.1	37	c.1545	CCDS12483.1	19																																																																																			-	NULL		0.711	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN3	protein_coding	OTTHUMT00000457403.2	C	NM_024509		41127419	+1	no_errors	NM_024509	genbank	human	provisional	54_36p	silent	SNP	0.300	T
TCEB3B	51224	genome.wustl.edu	37	18	44560009	44560009	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr18:44560009C>T	ENST00000332567.4	-	1	1979	c.1627G>A	c.(1627-1629)Gcc>Acc	p.A543T	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	543	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TCGCTGAGGGCGTCCGGATTG	0.607																																																0			18											59.0	60.0	60.0					18																	44560009		2203	4300	6503	42814007	SO:0001583	missense	51224			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1627G>A	18.37:g.44560009C>T	ENSP00000331302:p.Ala543Thr		42814007	Q9P2V9	Missense_Mutation	SNP	HMMPfam_TFIIS,HMMSmart_TFS2N,HMMPfam_Elongin_A	p.A543T	ENST00000332567.4	37	c.1627	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	C	4.916	0.170279	0.09339	.	.	ENSG00000206181	ENST00000332567	T	0.07021	3.23	1.26	-2.52	0.06346	.	1.329700	0.05240	N	0.512073	T	0.05364	0.0142	L	0.31752	0.955	0.09310	N	1	B	0.17667	0.023	B	0.14578	0.011	T	0.40346	-0.9568	10	0.33141	T	0.24	-1.3321	0.0906	0.00039	0.319:0.2492:0.1905:0.2414	.	543	Q8IYF1	ELOA2_HUMAN	T	543	ENSP00000331302:A543T	ENSP00000331302:A543T	A	-	1	0	TCEB3B	42814007	0.015000	0.18098	0.000000	0.03702	0.000000	0.00434	0.145000	0.16157	-1.107000	0.03004	-2.442000	0.00211	GCC	-	NULL		0.607	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	protein_coding	OTTHUMT00000255900.1	C	NM_016427		42814007	-1	no_errors	NM_016427	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
ZKSCAN7	55888	genome.wustl.edu	37	3	44619502	44619502	+	Intron	SNP	A	A	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr3:44619502A>C	ENST00000419137.1	+	3	316				ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000431636.1_Intron																							GATGTTTCTGAGTTGCCAGGT	0.473																																																0			3																																								44594506	SO:0001627	intron_variant	729143																														ENST00000419137.1:c.316+9577A>C	3.37:g.44619502A>C			44594506		RNA	SNP	-	NULL	ENST00000419137.1	37	NULL		3																																																																																			-	-		0.473	RP11-944L7.5-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	protein_coding	LOC729143	protein_coding	OTTHUMT00000343829.1	A			44594506	-1	pseudogene	XR_015907	genbank	human	model	54_36p	rna	SNP	0.102	C
OR4X1	390113	genome.wustl.edu	37	11	48285770	48285770	+	Missense_Mutation	SNP	C	C	T	rs79872488	byFrequency	TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr11:48285770C>T	ENST00000320048.1	+	1	358	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						GGCCTATGACCGCTATGTGGC	0.547													C|||	19	0.00379393	0.0	0.0086	5008	,	,		21393	0.0		0.0129	False		,,,				2504	0.0															0			11						C	CYS/ARG	10,4392	17.9+/-39.9	1,8,2192	81.0	75.0	77.0		358	1.4	1.0	11	dbSNP_131	77	73,8523	43.6+/-101.6	0,73,4225	yes	missense	OR4X1	NM_001004726.1	180	1,81,6417	TT,TC,CC		0.8492,0.2272,0.6386	probably-damaging	120/306	48285770	83,12915	2201	4298	6499	48242346	SO:0001583	missense	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.358C>T	11.37:g.48285770C>T	ENSP00000321506:p.Arg120Cys		48242346	Q6IF74	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R120C	ENST00000320048.1	37	c.358	CCDS31487.1	11	13	0.005952380952380952	0	0.0	3	0.008287292817679558	0	0.0	10	0.013192612137203167	C	10.10	1.256815	0.22965	0.002272	0.008492	ENSG00000176567	ENST00000320048	T	0.77358	-1.09	4.26	1.37	0.22104	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.81833	0.4906	M	0.86740	2.835	0.34850	D	0.741566	D	0.89917	1.0	D	0.72338	0.977	T	0.82930	-0.0213	9	0.72032	D	0.01	.	3.8036	0.08768	0.1681:0.558:0.0:0.274	.	120	Q8NH49	OR4X1_HUMAN	C	120	ENSP00000321506:R120C	ENSP00000321506:R120C	R	+	1	0	OR4X1	48242346	1.000000	0.71417	0.999000	0.59377	0.007000	0.05969	2.354000	0.44098	0.196000	0.20367	-1.989000	0.00450	CGC	-	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.547	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X1	protein_coding	OTTHUMT00000383373.1	C	NM_001004726		48242346	+1	no_errors	NM_001004726	genbank	human	provisional	54_36p	missense	SNP	1.000	T
AQP2	359	genome.wustl.edu	37	12	50344620	50344620	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr12:50344620G>T	ENST00000199280.3	+	1	92	c.7G>T	c.(7-9)Gag>Tag	p.E3*	RP11-469H8.6_ENST00000550530.1_RNA|RP11-469H8.6_ENST00000552379.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	3					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						CAGCATGTGGGAGCTCCGCTC	0.627																																																0			12											63.0	55.0	58.0					12																	50344620		2203	4300	6503	48630887	SO:0001587	stop_gained	359				CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.7G>T	12.37:g.50344620G>T	ENSP00000199280:p.Glu3*		48630887	Q9UD68	Nonsense_Mutation	SNP	superfamily_MIP,HMMPfam_MIP,PatternScan_MIP	p.E3*	ENST00000199280.3	37	c.7	CCDS8792.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.914556	0.97099	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	.	.	.	4.37	4.37	0.52481	.	0.285491	0.25078	N	0.033305	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.5723	14.8137	0.70013	0.0:0.0:1.0:0.0	.	.	.	.	X	3	.	ENSP00000199280:E3X	E	+	1	0	AQP2	48630887	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.641000	0.98458	2.432000	0.82394	0.655000	0.94253	GAG	-	superfamily_MIP,HMMPfam_MIP		0.627	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP2	protein_coding	OTTHUMT00000405540.1	G	NM_000486		48630887	+1	no_errors	NM_000486	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
TFAP2D	83741	genome.wustl.edu	37	6	50740417	50740417	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr6:50740417C>G	ENST00000008391.3	+	8	1427	c.1199C>G	c.(1198-1200)aCa>aGa	p.T400R		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.T400K(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACTTTCCAAACAGTTCTCAGT	0.458																																																1	Substitution - Missense(1)	lung(1)	6											66.0	64.0	65.0					6																	50740417		2203	4300	6503	50848376	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1199C>G	6.37:g.50740417C>G	ENSP00000008391:p.Thr400Arg		50848376		Missense_Mutation	SNP	HMMPfam_TF_AP-2	p.T400R	ENST00000008391.3	37	c.1199	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371674	0.61624	.	.	ENSG00000008197	ENST00000008391	D	0.96774	-4.12	5.46	5.46	0.80206	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89825	0.6827	N	0.08118	0	0.80722	D	1	B	0.30146	0.27	B	0.34346	0.18	D	0.89379	0.3680	10	0.87932	D	0	-21.0128	19.3034	0.94151	0.0:1.0:0.0:0.0	.	400	Q7Z6R9	AP2D_HUMAN	R	400	ENSP00000008391:T400R	ENSP00000008391:T400R	T	+	2	0	TFAP2D	50848376	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.577000	0.86979	0.467000	0.42956	ACA	-	HMMPfam_TF_AP-2		0.458	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	protein_coding	OTTHUMT00000040881.1	C	NM_172238		50848376	+1	no_errors	NM_172238	genbank	human	validated	54_36p	missense	SNP	1.000	G
KRT86	3892	genome.wustl.edu	37	12	52695731	52695731	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr12:52695731G>C	ENST00000423955.2	+	3	209	c.31G>C	c.(31-33)Gcc>Ccc	p.A11P	KRT86_ENST00000293525.5_Missense_Mutation_p.A11P|KRT86_ENST00000544024.1_Missense_Mutation_p.A11P			O43790	KRT86_HUMAN	keratin 86	11	Head.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGTGGCCGCGCCTTCAGCTG	0.667																																																0			12											49.0	56.0	53.0					12																	52695731		2166	4279	6445	50981998	SO:0001583	missense	3892			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.31G>C	12.37:g.52695731G>C	ENSP00000444533:p.Ala11Pro		50981998	P78387	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.A11P	ENST00000423955.2	37	c.31	CCDS41785.1	12	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273967	0.40194	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	D;D;D	0.81659	-1.52;-1.52;-1.52	5.01	4.11	0.48088	.	1.824800	0.03602	U	0.233611	T	0.77356	0.4118	L	0.38175	1.15	0.29644	N	0.844475	P	0.35363	0.497	B	0.36808	0.233	T	0.66432	-0.5925	10	0.54805	T	0.06	.	10.7888	0.46422	0.0889:0.0:0.9111:0.0	.	11	O43790	KRT86_HUMAN	P	11	ENSP00000443169:A11P;ENSP00000444533:A11P;ENSP00000293525:A11P	ENSP00000293525:A11P	A	+	1	0	AC021066.1;KRT86	50981998	0.013000	0.17824	0.809000	0.32408	0.774000	0.43823	0.375000	0.20518	1.101000	0.41535	0.643000	0.83706	GCC	-	NULL		0.667	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT86	protein_coding	OTTHUMT00000404911.1	G	NM_002284		50981998	+1	no_errors	NM_002284	genbank	human	reviewed	54_36p	missense	SNP	0.862	C
PHBP21	390730	genome.wustl.edu	37	16	52969023	52969023	+	IGR	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr16:52969023G>A								RP11-297L17.4 (305753 upstream) : RP11-467J12.2 (7669 downstream)																							CTTCTGGCCTGTCACTAGCCA	0.507																																																0			16																																								51526524	SO:0001628	intergenic_variant	390730																															16.37:g.52969023G>A			51526524		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.507					LOC390730			G			51526524	+1	pseudogene	XR_016422	genbank	human	model	54_36p	rna	SNP	0.801	A
CSTF2T	23283	genome.wustl.edu	37	10	53458636	53458636	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr10:53458636G>C	ENST00000331173.4	-	1	719	c.674C>G	c.(673-675)cCt>cGt	p.P225R	PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373985.1_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	225					mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		CAGAACATTAGGTCCTGGGCA	0.557																																																0			10											39.0	41.0	40.0					10																	53458636		2203	4300	6503	53128642	SO:0001583	missense	23283			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.674C>G	10.37:g.53458636G>C	ENSP00000332444:p.Pro225Arg		53128642	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.P225R	ENST00000331173.4	37	c.674	CCDS7245.1	10	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360157	0.61403	.	.	ENSG00000177613	ENST00000331173	T	0.28069	1.63	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	L	0.53249	1.67	0.80722	D	1	D	0.58620	0.983	P	0.54924	0.764	T	0.29701	-1.0003	10	0.49607	T	0.09	-1.9305	15.2882	0.73846	0.0:0.0:1.0:0.0	.	225	Q9H0L4	CSTFT_HUMAN	R	225	ENSP00000332444:P225R	ENSP00000332444:P225R	P	-	2	0	CSTF2T	53128642	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.786000	0.69006	2.551000	0.86045	0.655000	0.94253	CCT	-	NULL		0.557	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2T	protein_coding	OTTHUMT00000048097.1	G	NM_015235		53128642	-1	no_errors	NM_015235	genbank	human	validated	54_36p	missense	SNP	0.991	C
VEZF1	7716	genome.wustl.edu	37	17	56060253	56060253	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr17:56060253A>G	ENST00000581208.1	-	2	575	c.535T>C	c.(535-537)Tgt>Cgt	p.C179R	VEZF1_ENST00000584396.1_Missense_Mutation_p.C170R	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	179					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GCCTTCCCACACATCTCACAA	0.498																																																0			17											83.0	65.0	71.0					17																	56060253		2203	4300	6503	53415252	SO:0001583	missense	7716			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.535T>C	17.37:g.56060253A>G	ENSP00000462337:p.Cys179Arg		53415252		Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.C179R	ENST00000581208.1	37	c.535	CCDS32687.1	17	.	.	.	.	.	.	.	.	.	.	A	18.31	3.596117	0.66332	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.48	5.48	0.80851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.70967	-0.4728	9	0.87932	D	0	-2.826	15.5805	0.76432	1.0:0.0:0.0:0.0	.	179	Q14119	VEZF1_HUMAN	R	179	.	ENSP00000258963:C179R	C	-	1	0	VEZF1	53415252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.331000	0.96430	2.094000	0.63399	0.523000	0.50628	TGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.498	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	protein_coding	OTTHUMT00000443321.1	A			53415252	-1	no_errors	NM_007146	genbank	human	validated	54_36p	missense	SNP	1.000	G
PDGFRA	5156	genome.wustl.edu	37	4	55155051	55155051	+	Silent	SNP	C	C	T	rs368291181		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:55155051C>T	ENST00000257290.5	+	20	3091	c.2760C>T	c.(2758-2760)caC>caT	p.H920H	FIP1L1_ENST00000507166.1_Silent_p.H680H	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	920	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	AGCCTGACCACGCTACCAGTG	0.577			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	0			4						C		0,4406		0,0,2203	87.0	80.0	82.0		2760	-12.1	0.2	4		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PDGFRA	NM_006206.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		920/1090	55155051	1,13005	2203	4300	6503	54849808	SO:0001819	synonymous_variant	5156	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2760C>T	4.37:g.55155051C>T			54849808	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,PatternScan_PROTEIN_KINASE_ATP,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR	p.H920	ENST00000257290.5	37	c.2760	CCDS3495.1	4																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase_Tyr,HMMSmart_SM00219		0.577	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	protein_coding	OTTHUMT00000250598.2	C	NM_006206		54849808	+1	no_errors	NM_006206	genbank	human	reviewed	54_36p	silent	SNP	0.908	T
TSKS	60385	genome.wustl.edu	37	19	50265390	50265390	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr19:50265390C>T	ENST00000246801.3	-	2	352	c.270G>A	c.(268-270)atG>atA	p.M90I	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	90					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CAGTGGGCTCCATGGCGGCCA	0.647																																																0			19											92.0	72.0	79.0					19																	50265390		2203	4300	6503	54957202	SO:0001583	missense	60385			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.270G>A	19.37:g.50265390C>T	ENSP00000246801:p.Met90Ile		54957202	Q8WXJ0	Missense_Mutation	SNP	NULL	p.M90I	ENST00000246801.3	37	c.270	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	9.023	0.985456	0.18889	.	.	ENSG00000126467	ENST00000246801	T	0.29142	1.58	4.69	3.66	0.41972	.	0.953557	0.08655	N	0.913362	T	0.21674	0.0522	N	0.24115	0.695	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.07195	-1.0785	10	0.48119	T	0.1	-8.0779	6.9749	0.24669	0.0:0.7978:0.0:0.2022	.	90	Q9UJT2	TSKS_HUMAN	I	90	ENSP00000246801:M90I	ENSP00000246801:M90I	M	-	3	0	TSKS	54957202	0.990000	0.36364	0.995000	0.50966	0.878000	0.50629	2.232000	0.43018	1.209000	0.43321	0.462000	0.41574	ATG	-	NULL		0.647	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	protein_coding	OTTHUMT00000465795.1	C	NM_021733		54957202	-1	no_errors	NM_021733	genbank	human	reviewed	54_36p	missense	SNP	0.871	T
CGNL1	84952	genome.wustl.edu	37	15	57734647	57734647	+	Missense_Mutation	SNP	G	G	A	rs373744980		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr15:57734647G>A	ENST00000281282.5	+	4	1852	c.1774G>A	c.(1774-1776)Gca>Aca	p.A592T		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	592						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AAAGTCTCGAGCAGCTGGGAG	0.398																																																0			15						G	THR/ALA	1,4383	2.1+/-5.4	0,1,2191	75.0	73.0	74.0		1774	5.5	1.0	15		74	0,8584		0,0,4292	no	missense	CGNL1	NM_032866.3	58	0,1,6483	AA,AG,GG		0.0,0.0228,0.0077	benign	592/1303	57734647	1,12967	2192	4292	6484	55521939	SO:0001583	missense	84952			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1774G>A	15.37:g.57734647G>A	ENSP00000281282:p.Ala592Thr		55521939	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	HMMPfam_Myosin_tail_1	p.A592T	ENST00000281282.5	37	c.1774	CCDS10161.1	15	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042439	0.75732	2.28E-4	0.0	ENSG00000128849	ENST00000281282	T	0.47177	0.85	5.46	5.46	0.80206	.	0.000000	0.53938	D	0.000048	T	0.52092	0.1713	M	0.65498	2.005	0.58432	D	0.999999	B	0.26120	0.142	B	0.31442	0.13	T	0.47548	-0.9109	10	0.29301	T	0.29	-8.2359	19.3079	0.94171	0.0:0.0:1.0:0.0	.	592	Q0VF96	CGNL1_HUMAN	T	592	ENSP00000281282:A592T	ENSP00000281282:A592T	A	+	1	0	CGNL1	55521939	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.109000	0.94291	2.555000	0.86185	0.557000	0.71058	GCA	-	NULL		0.398	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGNL1	protein_coding	OTTHUMT00000255482.2	G	NM_032866		55521939	+1	no_errors	NM_032866	genbank	human	validated	54_36p	missense	SNP	1.000	A
OR8H1	219469	genome.wustl.edu	37	11	56058495	56058495	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr11:56058495G>A	ENST00000313022.2	-	1	71	c.44C>T	c.(43-45)aCg>aTg	p.T15M		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T15M(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					TGACAGTCCCGTAAGGATGAA	0.383																																																1	Substitution - Missense(1)	large_intestine(1)	11											106.0	102.0	104.0					11																	56058495		2201	4296	6497	55815071	SO:0001583	missense	219469			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.44C>T	11.37:g.56058495G>A	ENSP00000323595:p.Thr15Met		55815071	B2RNI7|Q6IFC5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T15M	ENST00000313022.2	37	c.44	CCDS31526.1	11	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.305499	0.01353	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00421	7.46	3.77	-0.664	0.11406	.	0.935374	0.09043	N	0.856952	T	0.00144	0.0004	N	0.01431	-0.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22906	-1.0203	10	0.33141	T	0.24	.	1.6337	0.02737	0.5533:0.1417:0.1679:0.137	.	15	Q8NGG4	OR8H1_HUMAN	M	15;11	ENSP00000323595:T15M	ENSP00000323595:T15M	T	-	2	0	OR8H1	55815071	0.000000	0.05858	0.018000	0.16275	0.001000	0.01503	-0.185000	0.09684	-0.168000	0.10853	-0.455000	0.05494	ACG	-	superfamily_Family A G protein-coupled receptor-like		0.383	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	protein_coding	OTTHUMT00000370019.1	G	NM_001005199		55815071	-1	no_errors	NM_001005199	genbank	human	provisional	54_36p	missense	SNP	0.444	A
TBC1D3P2	440452	genome.wustl.edu	37	17	60344557	60344557	+	RNA	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr17:60344557C>A	ENST00000581291.1	-	0	947									TBC1 domain family, member 3 pseudogene 2											breast(2)|kidney(1)|lung(2)	5						CTACCAGATACACGTCCCAGA	0.602																																																0			17																																								57699339			0					17q23.2	2009-05-14				ENSG00000188755			27783	pseudogene	pseudogene							Standard	NR_027486		Approved		uc002izq.2				17.37:g.60344557C>A			57699339		Silent	SNP	superfamily_RabGAP_TBC,HMMPfam_TBC,HMMSmart_TBC	p.V288	ENST00000581291.1	37	c.864		17																																																																																			-	HMMPfam_TBC,HMMSmart_TBC		0.602	TBC1D3P2-002	KNOWN	basic	processed_transcript	TBC1D3P2	pseudogene	OTTHUMT00000445021.1	C	NR_027486		57699339	-1	no_errors	ENST00000339120	ensembl	human	known	54_36p	silent	SNP	1.000	A
RPS15AP34	390735	genome.wustl.edu	37	16	63384918	63384918	+	IGR	SNP	A	A	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr16:63384918A>C								RP11-96H17.1 (221360 upstream) : RP11-2K6.2 (17829 downstream)																							TTGCCAGTGTAGCCATGCTTC	0.468																																																0			16																																								61942419	SO:0001628	intergenic_variant	390735																															16.37:g.63384918A>C			61942419		Missense_Mutation	SNP	superfamily_Ribosomal protein S8,HMMPfam_Ribosomal_S8	p.Y46D		37	c.136		16																																																																																			-	superfamily_Ribosomal protein S8,HMMPfam_Ribosomal_S8	0	0.468					LOC390735			A			61942419	-1	pseudogene	XM_001129659	genbank	human	model	54_36p	missense	SNP	1.000	C
RHOBTB1	9886	genome.wustl.edu	37	10	62634789	62634789	+	Missense_Mutation	SNP	C	C	T	rs201889243		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr10:62634789C>T	ENST00000337910.5	-	9	2075	c.1738G>A	c.(1738-1740)Gtt>Att	p.V580I	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.V580I|RHOBTB1_ENST00000490827.1_5'UTR	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	580					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AACTCCTGAACGGCATGCTGT	0.542																																																0			10						C	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	83.0	80.0	81.0		1738,1738	5.7	0.4	10		81	0,8600		0,0,4300	no	missense,missense	RHOBTB1	NM_001242359.1,NM_014836.4	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	580/697,580/697	62634789	1,13005	2203	4300	6503	62304795	SO:0001583	missense	9886			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1738G>A	10.37:g.62634789C>T	ENSP00000338671:p.Val580Ile		62304795		Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_RHO,HMMPfam_Ras,superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB	p.V580I	ENST00000337910.5	37	c.1738	CCDS7261.1	10	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	14.41	2.527634	0.44969	2.27E-4	0.0	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.66815	-0.23;-0.23	5.66	5.66	0.87406	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (1);	0.000000	0.64402	D	0.000004	T	0.64713	0.2623	L	0.34521	1.04	0.80722	D	1	D	0.56287	0.975	P	0.50970	0.655	T	0.58086	-0.7698	10	0.08381	T	0.77	.	19.7525	0.96273	0.0:1.0:0.0:0.0	.	580	O94844	RHBT1_HUMAN	I	580	ENSP00000350595:V580I;ENSP00000338671:V580I	ENSP00000338671:V580I	V	-	1	0	RHOBTB1	62304795	1.000000	0.71417	0.427000	0.26684	0.116000	0.19942	7.425000	0.80255	2.666000	0.90696	0.563000	0.77884	GTT	-	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB		0.542	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	protein_coding	OTTHUMT00000048220.1	C			62304795	-1	no_errors	NM_014836	genbank	human	reviewed	54_36p	missense	SNP	0.949	T
CMTR2	55783	genome.wustl.edu	37	16	71319816	71319816	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr16:71319816T>G	ENST00000338099.5	-	3	344	c.8A>C	c.(7-9)aAg>aCg	p.K3T	CMTR2_ENST00000434935.2_Missense_Mutation_p.K3T			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	3					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										CTTTCTGCACTTACTCATTTT	0.353																																																0			16											37.0	37.0	37.0					16																	71319816		2194	4287	6481	69877317	SO:0001583	missense	55783			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.8A>C	16.37:g.71319816T>G	ENSP00000337512:p.Lys3Thr		69877317	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_FtsJ	p.K3T	ENST00000338099.5	37	c.8	CCDS10898.1	16	.	.	.	.	.	.	.	.	.	.	T	15.50	2.852188	0.51270	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.15952	2.38;2.38	5.69	5.69	0.88448	.	0.402722	0.27586	N	0.018715	T	0.12390	0.0301	N	0.22421	0.69	0.33616	D	0.604207	B	0.25719	0.132	B	0.20577	0.03	T	0.12708	-1.0537	10	0.39692	T	0.17	-19.9932	12.3458	0.55119	0.0:0.0:0.1403:0.8596	.	3	Q8IYT2	FTSJ1_HUMAN	T	3	ENSP00000337512:K3T;ENSP00000411148:K3T	ENSP00000337512:K3T	K	-	2	0	FTSJD1	69877317	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.916000	0.39986	2.165000	0.68154	0.528000	0.53228	AAG	-	NULL		0.353	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD1	protein_coding	OTTHUMT00000268984.2	T	NM_018348		69877317	-1	no_errors	NM_001099642	genbank	human	validated	54_36p	missense	SNP	0.996	G
NPFFR2	10886	genome.wustl.edu	37	4	72994449	72994449	+	Silent	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:72994449C>A	ENST00000308744.6	+	2	545	c.447C>A	c.(445-447)atC>atA	p.I149I	NPFFR2_ENST00000395999.1_Silent_p.I50I|NPFFR2_ENST00000358749.3_Silent_p.I47I|NPFFR2_ENST00000344413.5_Intron	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	149					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TGGCAGCAATCTTCATTATTT	0.368																																																0			4											212.0	185.0	194.0					4																	72994449		2203	4300	6503	73213313	SO:0001819	synonymous_variant	10886			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.447C>A	4.37:g.72994449C>A			73213313	Q96RV1|Q9NR49	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I149	ENST00000308744.6	37	c.447	CCDS3551.1	4																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.368	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	protein_coding	OTTHUMT00000252170.2	C	NM_004885		73213313	+1	no_errors	NM_004885	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
ALMS1	7840	genome.wustl.edu	37	2	73680447	73680447	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:73680447C>G	ENST00000264448.6	+	8	6901	c.6790C>G	c.(6790-6792)Ctt>Gtt	p.L2264V	ALMS1_ENST00000377715.1_Missense_Mutation_p.L2264V|ALMS1_ENST00000409009.1_Missense_Mutation_p.L2222V	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2264					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AATTCGGACACTTTTGATGGA	0.368																																																0			2											62.0	61.0	62.0					2																	73680447		1847	4090	5937	73533955	SO:0001583	missense	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6790C>G	2.37:g.73680447C>G	ENSP00000264448:p.Leu2264Val		73533955	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.L2264V	ENST00000264448.6	37	c.6790	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742370	0.69418	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.29917	2.49;2.49;1.55	5.82	5.82	0.92795	.	0.155438	0.30649	N	0.009179	T	0.48978	0.1530	L	0.48642	1.525	0.37443	D	0.914502	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71870	0.975;0.975;0.975	T	0.53265	-0.8463	10	0.87932	D	0	.	15.5992	0.76611	0.0:1.0:0.0:0.0	.	2264;2222;2264	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	V	2222;2264;2264	ENSP00000386627:L2222V;ENSP00000264448:L2264V;ENSP00000366944:L2264V	ENSP00000264448:L2264V	L	+	1	0	ALMS1	73533955	0.996000	0.38824	0.910000	0.35882	0.985000	0.73830	4.401000	0.59716	2.752000	0.94435	0.655000	0.94253	CTT	-	NULL		0.368	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	C	NM_015120		73533955	+1	no_errors	NM_015120	genbank	human	reviewed	54_36p	missense	SNP	0.939	G
Unknown	0	genome.wustl.edu	37	7	74323164	74323164	+	IGR	SNP	G	G	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:74323164G>T								Y_RNA (11127 upstream) : GATSL1 (55918 downstream)																							TTTGTTTGGGGGCCTCATCGT	0.542																																																0			7																																								73961100	SO:0001628	intergenic_variant	0																															7.37:g.74323164G>T			73961100		Silent	SNP	NULL	p.A177		37	c.531		7																																																																																			-	NULL	0	0.542					LOC100132585			G			73961100	-1	no_errors	XM_001722111	genbank	human	model	54_36p	silent	SNP	0.358	T
ADAMTS18	170692	genome.wustl.edu	37	16	77355019	77355019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr16:77355019G>T	ENST00000282849.5	-	15	2662	c.2244C>A	c.(2242-2244)tgC>tgA	p.C748*		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	748	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TATAAAACTTGCAAGTTGAAT	0.383																																																0			16											123.0	122.0	122.0					16																	77355019		2198	4300	6498	75912520	SO:0001587	stop_gained	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2244C>A	16.37:g.77355019G>T	ENSP00000282849:p.Cys748*		75912520	Q6P4R5|Q6ZWJ9	Nonsense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_PLAC"	p.C748*	ENST00000282849.5	37	c.2244	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	G	46	12.494029	0.99672	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.67	5.67	0.87782	.	0.202633	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1672	0.54138	0.0775:0.0:0.9225:0.0	.	.	.	.	X	748	.	ENSP00000282849:C748X	C	-	3	2	ADAMTS18	75912520	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.373000	0.97168	2.692000	0.91855	0.650000	0.86243	TGC	-	NULL		0.383	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	G			75912520	-1	no_errors	NM_199355	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
ZMIZ1	57178	genome.wustl.edu	37	10	81053247	81053247	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr10:81053247C>T	ENST00000334512.5	+	12	1639	c.1067C>T	c.(1066-1068)aCg>aTg	p.T356M	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	356	Pro-rich.				artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GCTGGCATGACGCCCTCGGGG	0.701																																																0			10											31.0	41.0	38.0					10																	81053247		2195	4284	6479	80723253	SO:0001583	missense	57178			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.1067C>T	10.37:g.81053247C>T	ENSP00000334474:p.Thr356Met		80723253	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	superfamily_RING/U-box,HMMPfam_zf-MIZ	p.T356M	ENST00000334512.5	37	c.1067	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929569	0.73327	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.31247	1.5	4.91	4.91	0.64330	.	0.000000	0.39544	U	0.001336	T	0.32041	0.0816	N	0.14661	0.345	0.80722	D	1	D;D	0.64830	0.994;0.965	P;P	0.54499	0.754;0.513	T	0.11817	-1.0572	10	0.34782	T	0.22	-9.9472	18.0871	0.89461	0.0:1.0:0.0:0.0	.	272;356	Q9H7J0;Q9ULJ6	.;ZMIZ1_HUMAN	M	356;286;263	ENSP00000334474:T356M	ENSP00000334474:T356M	T	+	2	0	ZMIZ1	80723253	1.000000	0.71417	0.991000	0.47740	0.857000	0.48899	4.729000	0.62008	2.273000	0.75805	0.313000	0.20887	ACG	-	NULL		0.701	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	protein_coding	OTTHUMT00000048944.2	C	NM_020338		80723253	+1	no_errors	NM_020338	genbank	human	validated	54_36p	missense	SNP	1.000	T
ATP2C2	9914	genome.wustl.edu	37	16	84494381	84494381	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr16:84494381G>A	ENST00000262429.4	+	24	2544	c.2455G>A	c.(2455-2457)Ggg>Agg	p.G819R	ATP2C2_ENST00000420010.2_3'UTR|RP11-517C16.2_ENST00000565700.1_RNA|ATP2C2_ENST00000416219.2_Missense_Mutation_p.G848R	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	819					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CATCATCAGCGGGACCCTCTT	0.627																																																0			16											90.0	98.0	96.0					16																	84494381		2098	4207	6305	83051882	SO:0001583	missense	9914			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.2455G>A	16.37:g.84494381G>A	ENSP00000262429:p.Gly819Arg		83051882	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Cation_ATPase_N,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.G819R	ENST00000262429.4	37	c.2455	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866347	0.71949	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.95949	-3.86;-3.86	5.41	5.41	0.78517	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.070917	0.64402	D	0.000017	D	0.98563	0.9520	H	0.96518	3.835	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99097	1.0842	10	0.56958	D	0.05	.	18.5395	0.91022	0.0:0.0:1.0:0.0	.	848;668;668;836;819	E7ES94;B3KR57;F8WAA5;O75185-2;O75185	.;.;.;.;AT2C2_HUMAN	R	848;819;668	ENSP00000397925:G848R;ENSP00000262429:G819R	ENSP00000262429:G819R	G	+	1	0	ATP2C2	83051882	1.000000	0.71417	0.984000	0.44739	0.108000	0.19459	9.328000	0.96403	2.684000	0.91462	0.655000	0.94253	GGG	-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Cation_ATPase_C		0.627	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	protein_coding	OTTHUMT00000433404.1	G	NM_014861		83051882	+1	no_errors	NM_014861	genbank	human	validated	54_36p	missense	SNP	1.000	A
HNRNPD	3184	genome.wustl.edu	37	4	83278046	83278046	+	Silent	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:83278046A>G	ENST00000313899.7	-	6	1033	c.756T>C	c.(754-756)tgT>tgC	p.C252C	HNRNPD_ENST00000353341.4_Silent_p.C252C|HNRNPD_ENST00000352301.4_Silent_p.C233C|HNRNPD_ENST00000508119.1_5'UTR|HNRNPD_ENST00000541060.1_Silent_p.C98C|HNRNPD_ENST00000543098.1_Silent_p.C200C	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	252	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						CTTTTATTTCACACTAAAAGA	0.358																																																0			4											161.0	174.0	170.0					4																	83278046		2203	4300	6503	83497070	SO:0001819	synonymous_variant	3184			AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.756T>C	4.37:g.83278046A>G			83497070	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Silent	SNP	HMMPfam_CBFNT,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.C252	ENST00000313899.7	37	c.756	CCDS3592.1	4	.	.	.	.	.	.	.	.	.	.	A	12.33	1.906761	0.33628	.	.	ENSG00000138668	ENST00000514671	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.327	0.74172	1.0:0.0:0.0:0.0	.	.	.	.	R	156	.	.	X	-	1	0	HNRNPD	83497070	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.985000	0.70556	2.016000	0.59253	0.533000	0.62120	TGA	-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1		0.358	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPD	protein_coding	OTTHUMT00000252630.2	A	NM_031370		83497070	-1	no_errors	NM_031370	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
ATP2B1	490	genome.wustl.edu	37	12	89984844	89984844	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr12:89984844T>C	ENST00000428670.3	-	21	4036	c.3580A>G	c.(3580-3582)Att>Gtt	p.I1194V	ATP2B1_ENST00000393164.2_Missense_Mutation_p.I937V|ATP2B1_ENST00000261173.2_Missense_Mutation_p.I1194V|ATP2B1_ENST00000359142.3_3'UTR|RP11-981P6.1_ENST00000552778.1_RNA|AC068641.1_ENST00000585304.1_RNA|ATP2B1_ENST00000348959.3_Missense_Mutation_p.I1158V			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1232					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						GTAAGGTGAATTCCACTGTCA	0.423																																																0			12											237.0	210.0	219.0					12																	89984844		2203	4299	6502	88508975	SO:0001583	missense	490			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.3580A>G	12.37:g.89984844T>C	ENSP00000392043:p.Ile1194Val		88508975	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_SSF81665,HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,HMMPfam_Cation_ATPase_C	p.I1194V	ENST00000428670.3	37	c.3580	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	T	7.747	0.702523	0.15172	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000428670;ENST00000393164	D;D;D;D	0.94092	-3.2;-3.19;-3.2;-3.35	5.53	5.53	0.82687	.	0.298435	0.37304	N	0.002146	D	0.88149	0.6359	N	0.19112	0.55	0.44595	D	0.997566	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	D	0.83966	0.0324	10	0.45353	T	0.12	-30.4525	15.6593	0.77169	0.0:0.0:0.0:1.0	.	1194;1158	P20020-3;P20020-6	.;.	V	1194;1158;1194;937	ENSP00000261173:I1194V;ENSP00000343599:I1158V;ENSP00000392043:I1194V;ENSP00000376869:I937V	ENSP00000261173:I1194V	I	-	1	0	ATP2B1	88508975	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.970000	0.56824	2.095000	0.63458	0.482000	0.46254	ATT	-	NULL		0.423	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	protein_coding	OTTHUMT00000406653.1	T	NM_001682		88508975	-1	no_errors	NM_001682	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CRTC3	64784	genome.wustl.edu	37	15	91172654	91172654	+	Missense_Mutation	SNP	C	C	T	rs563914760		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr15:91172654C>T	ENST00000268184.6	+	11	1160	c.1156C>T	c.(1156-1158)Cgg>Tgg	p.R386W	CRTC3_ENST00000420329.2_Missense_Mutation_p.R386W|RP11-387D10.2_ENST00000559531.1_RNA			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	386					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			GTCTCGGCGTCGGCAGCCTCC	0.582			T	MAML2	salivary gland mucoepidermoid																																		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0			15											186.0	190.0	188.0					15																	91172654		2198	4298	6496	88973658	SO:0001583	missense	64784				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1156C>T	15.37:g.91172654C>T	ENSP00000268184:p.Arg386Trp		88973658	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	NULL	p.R386W	ENST00000268184.6	37	c.1156	CCDS32331.1	15	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942410	0.34283	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.19532	2.14;2.14	5.18	-1.91	0.07641	.	0.159393	0.52532	D	0.000069	T	0.41351	0.1155	M	0.66939	2.045	0.38474	D	0.947534	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.42464	-0.9450	10	0.72032	D	0.01	-22.3577	15.7604	0.78076	0.3248:0.6752:0.0:0.0	.	386;386	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	W	350;386;386	ENSP00000268184:R386W;ENSP00000416573:R386W	ENSP00000268184:R386W	R	+	1	2	CRTC3	88973658	0.044000	0.20184	0.056000	0.19401	0.007000	0.05969	0.134000	0.15932	-0.514000	0.06488	-0.274000	0.10170	CGG	-	NULL		0.582	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CRTC3	protein_coding	OTTHUMT00000417716.2	C	NM_022769		88973658	+1	no_errors	NM_022769	genbank	human	validated	54_36p	missense	SNP	0.251	T
LONRF2	164832	genome.wustl.edu	37	2	100916305	100916305	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:100916305C>A	ENST00000393437.3	-	5	1780	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	LONRF2_ENST00000409647.1_Nonsense_Mutation_p.E138*	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	381							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						TTATCCTCTTCAAAGTGTAGA	0.413																																																0			2											71.0	68.0	69.0					2																	100916305		2203	4300	6503	100282737	SO:0001587	stop_gained	164832			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1141G>T	2.37:g.100916305C>A	ENSP00000377086:p.Glu381*		100282737	B9A006|Q6ZSR4	Nonsense_Mutation	SNP	superfamily_TPR-like,superfamily_RING/U-box,HMMSmart_SM00184,HMMSmart_SM00028,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_LON,HMMSmart_SM00464	p.E381*	ENST00000393437.3	37	c.1141	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	43	10.507902	0.99418	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	.	.	.	4.17	2.34	0.29019	.	0.724109	0.13409	N	0.390022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-10.8787	9.7487	0.40462	0.0:0.868:0.0:0.132	.	.	.	.	X	381;138	.	ENSP00000377086:E381X	E	-	1	0	LONRF2	100282737	0.988000	0.35896	0.035000	0.18076	0.709000	0.40893	1.323000	0.33701	0.335000	0.23614	0.555000	0.69702	GAA	-	superfamily_TPR-like		0.413	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	protein_coding	OTTHUMT00000253161.2	C	NM_198461		100282737	-1	no_errors	NM_198461	genbank	human	validated	54_36p	nonsense	SNP	0.961	A
SH3RF3	344558	genome.wustl.edu	37	2	109964296	109964296	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:109964296A>G	ENST00000309415.6	+	2	740	c.740A>G	c.(739-741)tAt>tGt	p.Y247C		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	247	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CCAGCCAGCTATATCCAGTGC	0.567																																																0			2											49.0	57.0	54.0					2																	109964296		2130	4235	6365	109330728	SO:0001583	missense	344558			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.740A>G	2.37:g.109964296A>G	ENSP00000309186:p.Tyr247Cys		109330728	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.Y247C	ENST00000309415.6	37	c.740		2	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168195	0.21621	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.61980	0.06;0.06	4.97	0.883	0.19177	Src homology-3 domain (3);	.	.	.	.	T	0.50000	0.1590	.	.	.	0.42866	D	0.994127	B	0.17667	0.023	B	0.23419	0.046	T	0.46105	-0.9215	8	0.87932	D	0	.	5.6604	0.17667	0.665:0.0:0.0734:0.2616	.	247	Q8TEJ3	SH3R3_HUMAN	C	247	ENSP00000414997:Y247C;ENSP00000309186:Y247C	ENSP00000309186:Y247C	Y	+	2	0	SH3RF3	109330728	0.755000	0.28372	0.839000	0.33178	0.428000	0.31595	1.582000	0.36568	0.221000	0.20879	0.397000	0.26171	TAT	-	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326		0.567	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	SH3RF3	protein_coding		A	NM_001099289		109330728	+1	no_stop_codon	NM_001099289	genbank	human	provisional	54_36p	missense	SNP	0.459	G
SYPL2	284612	genome.wustl.edu	37	1	110018217	110018217	+	Silent	SNP	C	C	T	rs368388571		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:110018217C>T	ENST00000369872.3	+	3	360	c.144C>T	c.(142-144)ttC>ttT	p.F48F	SYPL2_ENST00000475497.1_3'UTR|SYPL2_ENST00000401021.3_Silent_p.F48F	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	48	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		TTGCTATTTTCGCCTTCGGGT	0.547																																																0			1						C		1,3877		0,1,1938	59.0	62.0	61.0		144	4.0	1.0	1		61	0,8272		0,0,4136	no	coding-synonymous	SYPL2	NM_001040709.1		0,1,6074	TT,TC,CC		0.0,0.0258,0.0082		48/273	110018217	1,12149	1939	4136	6075	109819740	SO:0001819	synonymous_variant	284612			AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.144C>T	1.37:g.110018217C>T			109819740	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Silent	SNP	HMMPfam_MARVEL	p.F48	ENST00000369872.3	37	c.144	CCDS41365.1	1																																																																																			-	HMMPfam_MARVEL		0.547	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYPL2	protein_coding	OTTHUMT00000030191.1	C	NM_001006603		109819740	+1	no_errors	NM_001040709	genbank	human	validated	54_36p	silent	SNP	1.000	T
SYPL2	284612	genome.wustl.edu	37	1	110019488	110019488	+	Silent	SNP	C	C	T	rs371487864		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:110019488C>T	ENST00000369872.3	+	4	561	c.345C>T	c.(343-345)gcC>gcT	p.A115A	SYPL2_ENST00000401021.3_Silent_p.A115A	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	115	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		CTGCACCCGCCGAGTTCTTCG	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19656	0.0		0.0	False		,,,				2504	0.0															0			1						C		2,3994		0,2,1996	91.0	96.0	94.0		345	-10.9	0.0	1		94	0,8346		0,0,4173	no	coding-synonymous	SYPL2	NM_001040709.1		0,2,6169	TT,TC,CC		0.0,0.0501,0.0162		115/273	110019488	2,12340	1998	4173	6171	109821011	SO:0001819	synonymous_variant	284612			AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.345C>T	1.37:g.110019488C>T			109821011	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Silent	SNP	HMMPfam_MARVEL	p.A115	ENST00000369872.3	37	c.345	CCDS41365.1	1																																																																																			-	HMMPfam_MARVEL		0.537	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYPL2	protein_coding	OTTHUMT00000030191.1	C	NM_001006603		109821011	+1	no_errors	NM_001040709	genbank	human	validated	54_36p	silent	SNP	0.205	T
ALPK1	80216	genome.wustl.edu	37	4	113351618	113351618	+	Silent	SNP	G	G	A	rs199945458		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:113351618G>A	ENST00000458497.1	+	11	1194	c.915G>A	c.(913-915)acG>acA	p.T305T	ALPK1_ENST00000504176.2_Silent_p.T227T|ALPK1_ENST00000177648.9_Silent_p.T305T	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	305							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T305T(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TCCGTGGCACGTGTTTATTGT	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		21045	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	endometrium(1)	4											66.0	68.0	67.0					4																	113351618		2203	4300	6503	113571067	SO:0001819	synonymous_variant	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.915G>A	4.37:g.113351618G>A			113571067	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00811,HMMPfam_Alpha_kinase	p.T305	ENST00000458497.1	37	c.915	CCDS3697.1	4																																																																																			-	NULL		0.398	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	protein_coding	OTTHUMT00000256421.2	G	NM_025144		113571067	+1	no_errors	NM_001102406	genbank	human	validated	54_36p	silent	SNP	0.881	A
POT1	25913	genome.wustl.edu	37	7	124532428	124532428	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:124532428C>T	ENST00000357628.3	-	6	614	c.16G>A	c.(16-18)Gca>Aca	p.A6T	POT1_ENST00000393329.1_5'UTR	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	6					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TAATTTGTTGCTGGAACCTAA	0.323																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)											0			7											85.0	93.0	91.0					7																	124532428		2203	4300	6503	124319664	SO:0001583	missense	25913			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.16G>A	7.37:g.124532428C>T	ENSP00000350249:p.Ala6Thr		124319664	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	superfamily_Nucleic acid-binding proteins,HMMPfam_Telo_bind	p.A6T	ENST00000357628.3	37	c.16	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	C	8.731	0.916655	0.17907	.	.	ENSG00000128513	ENST00000357628;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391;ENST00000446993	T	0.48836	0.8	5.7	0.589	0.17452	Nucleic acid-binding, OB-fold (1);	0.878626	0.10012	N	0.727026	T	0.22126	0.0533	N	0.11560	0.145	0.22096	N	0.999364	B	0.02656	0.0	B	0.04013	0.001	T	0.24584	-1.0156	10	0.13108	T	0.6	-9.1514	3.9913	0.09538	0.2538:0.4498:0.0:0.2964	.	6	Q9NUX5	POTE1_HUMAN	T	6;6;6;6;5;6	ENSP00000350249:A6T	ENSP00000265391:A5T	A	-	1	0	POT1	124319664	0.027000	0.19231	0.961000	0.40146	0.917000	0.54804	-0.402000	0.07223	0.045000	0.15804	-0.252000	0.11476	GCA	-	NULL		0.323	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	protein_coding	OTTHUMT00000347861.1	C			124319664	-1	no_errors	NM_015450	genbank	human	reviewed	54_36p	missense	SNP	0.006	T
GRM8	2918	genome.wustl.edu	37	7	126173080	126173080	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:126173080T>G	ENST00000339582.2	-	9	3164	c.2356A>C	c.(2356-2358)Acc>Ccc	p.T786P	GRM8_ENST00000480995.1_5'Flank|GRM8_ENST00000444921.2_Missense_Mutation_p.T786P|GRM8_ENST00000358373.3_Missense_Mutation_p.T786P			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	786					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.T786A(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTATACATGGTAAATCCAATA	0.408										HNSCC(24;0.065)																																						1	Substitution - Missense(1)	endometrium(1)	7											140.0	122.0	128.0					7																	126173080		2203	4300	6503	125960316	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2356A>C	7.37:g.126173080T>G	ENSP00000344173:p.Thr786Pro		125960316	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.T786P	ENST00000339582.2	37	c.2356	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914572	0.72983	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.89746	-2.56;-2.56;-2.56	5.62	5.62	0.85841	GPCR, family 3, conserved site (1);GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95357	0.8493	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.986	D	0.96171	0.9123	10	0.87932	D	0	.	15.0201	0.71624	0.0:0.0:0.0:1.0	.	786;786	O00222-2;O00222	.;GRM8_HUMAN	P	786	ENSP00000344173:T786P;ENSP00000409790:T786P;ENSP00000351142:T786P	ENSP00000344173:T786P	T	-	1	0	GRM8	125960316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.150000	0.67090	0.533000	0.62120	ACC	-	HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3		0.408	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	protein_coding	OTTHUMT00000059209.4	T			125960316	-1	no_errors	NM_000845	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
JAKMIP3	282973	genome.wustl.edu	37	10	133930919	133930919	+	Silent	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr10:133930919C>A	ENST00000298622.4	+	2	612	c.474C>A	c.(472-474)atC>atA	p.I158I		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	158						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGCAGGAGATCTCCGAGCTCA	0.617																																																0			10											76.0	91.0	86.0					10																	133930919		2171	4260	6431	133780909	SO:0001819	synonymous_variant	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.474C>A	10.37:g.133930919C>A			133780909	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	NULL	p.I158	ENST00000298622.4	37	c.474	CCDS44494.1	10																																																																																			-	NULL		0.617	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	protein_coding	OTTHUMT00000051049.3	C	NM_194303		133780909	+1	no_errors	NM_001105521	genbank	human	provisional	54_36p	silent	SNP	0.868	A
TG	7038	genome.wustl.edu	37	8	134024174	134024174	+	Silent	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr8:134024174C>T	ENST00000220616.4	+	36	6331	c.6291C>T	c.(6289-6291)gcC>gcT	p.A2097A	TG_ENST00000519543.1_Silent_p.A230A|TG_ENST00000542445.1_Silent_p.A467A|TG_ENST00000522523.1_3'UTR|TG_ENST00000377869.1_Silent_p.A2040A	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2097					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGTCCCTGGCCCTCTCTTCAG	0.522																																																0			8											339.0	300.0	313.0					8																	134024174		2203	4300	6503	134093356	SO:0001819	synonymous_variant	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6291C>T	8.37:g.134024174C>T			134093356	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.A2097	ENST00000220616.4	37	c.6291	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	0.202	-1.043668	0.01997	.	.	ENSG00000042832	ENST00000519178	.	.	.	5.58	1.77	0.24775	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.22730	-1.0208	4	.	.	.	.	4.5714	0.12212	0.1525:0.5995:0.0:0.248	.	.	.	.	S	553	.	.	P	+	1	0	TG	134093356	0.001000	0.12720	0.136000	0.22124	0.016000	0.09150	0.186000	0.16978	0.046000	0.15833	0.563000	0.77884	CCT	-	NULL		0.522	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	C	NM_003235		134093356	+1	no_errors	NM_003235	genbank	human	validated	54_36p	silent	SNP	0.181	T
PKD2L2	27039	genome.wustl.edu	37	5	137226195	137226195	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr5:137226195C>A	ENST00000508883.1	+	2	83	c.57C>A	c.(55-57)taC>taA	p.Y19*	PKD2L2_ENST00000290431.5_Nonsense_Mutation_p.Y19*|RP11-381K20.2_ENST00000514616.1_RNA|RP11-381K20.2_ENST00000508281.2_RNA|PKD2L2_ENST00000350250.4_Intron|PKD2L2_ENST00000502810.1_Nonsense_Mutation_p.Y19*|PKD2L2_ENST00000508638.1_Nonsense_Mutation_p.Y19*			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	19					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGTTGCATTACAGAAAGGAAG	0.294																																																0			5											94.0	94.0	94.0					5																	137226195		1803	4069	5872	137254094	SO:0001587	stop_gained	27039			AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.57C>A	5.37:g.137226195C>A	ENSP00000424725:p.Tyr19*		137254094	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Nonsense_Mutation	SNP	HMMPfam_PKD_channel	p.Y19*	ENST00000508883.1	37	c.57		5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069900	0.76301	.	.	ENSG00000078795	ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	.	.	.	5.8	4.75	0.60458	.	0.113920	0.39615	N	0.001320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3673	14.6851	0.69044	0.0:0.9163:0.0:0.0837	.	.	.	.	X	19	.	ENSP00000290431:Y19X	Y	+	3	2	PKD2L2	137254094	1.000000	0.71417	0.987000	0.45799	0.823000	0.46562	2.208000	0.42797	2.747000	0.94245	0.460000	0.39030	TAC	-	NULL		0.294	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	protein_coding	OTTHUMT00000372521.1	C	NM_014386		137254094	+1	no_errors	NM_014386	genbank	human	validated	54_36p	nonsense	SNP	0.018	A
NOBOX	135935	genome.wustl.edu	37	7	144096938	144096938	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:144096938G>A	ENST00000467773.1	-	6	1065	c.1066C>T	c.(1066-1068)Cgg>Tgg	p.R356W	NOBOX_ENST00000223140.5_Missense_Mutation_p.R239W|NOBOX_ENST00000483238.1_Missense_Mutation_p.R324W	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	356					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CACTTGGCCCGGCGATTCTGG	0.537																																																0			7											74.0	78.0	76.0					7																	144096938		1954	4148	6102	143727871	SO:0001583	missense	135935					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1066C>T	7.37:g.144096938G>A	ENSP00000419457:p.Arg356Trp		143727871	A6NCD3|A8MZN5	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox	p.R356W	ENST00000467773.1	37	c.1066		7	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750459	0.69533	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.99311	-5.51;-5.73;-5.51	5.55	-2.34	0.06704	Homeodomain-related (1);Homeobox (2);	0.324668	0.29987	N	0.010695	D	0.99196	0.9721	M	0.86864	2.845	0.30934	N	0.726558	D	0.89917	1.0	D	0.97110	1.0	D	0.98771	1.0728	10	0.87932	D	0	-35.0972	9.9442	0.41598	0.0752:0.0:0.3185:0.6062	.	356	O60393	NOBOX_HUMAN	W	324;356;239;113	ENSP00000419565:R324W;ENSP00000419457:R356W;ENSP00000223140:R239W	ENSP00000223140:R239W	R	-	1	2	NOBOX	143727871	0.836000	0.29430	0.949000	0.38748	0.994000	0.84299	-0.133000	0.10451	-0.261000	0.09405	0.650000	0.86243	CGG	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.537	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	G	XM_001134420		143727871	-1	no_errors	NM_001080413	genbank	human	provisional	54_36p	missense	SNP	0.688	A
CYP11B2	1585	genome.wustl.edu	37	8	143999035	143999035	+	Silent	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr8:143999035C>T	ENST00000323110.2	-	1	224	c.222G>A	c.(220-222)gaG>gaA	p.E74E		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	74					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TGGGCCCCAGCTCCTGGAAGG	0.642									Familial Hyperaldosteronism type I																																							0			8											74.0	69.0	71.0					8																	143999035		2203	4300	6503	143996037	SO:0001819	synonymous_variant	1585	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.222G>A	8.37:g.143999035C>T			143996037	B0ZBE4|Q16726	Silent	SNP	HMMPfam_p450,superfamily_Cytochrome P450,PatternScan_CYTOCHROME_P450	p.E74	ENST00000323110.2	37	c.222	CCDS6393.1	8																																																																																			-	HMMPfam_p450,superfamily_Cytochrome P450		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	protein_coding	OTTHUMT00000359904.1	C			143996037	-1	no_errors	NM_000498	genbank	human	reviewed	54_36p	silent	SNP	0.940	T
ABCF2	10061	genome.wustl.edu	37	7	150911146	150911146	+	Silent	SNP	G	G	A	rs142050158		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:150911146G>A	ENST00000287844.2	-	15	1975	c.1866C>T	c.(1864-1866)aaC>aaT	p.N622N	ABCF2_ENST00000222388.2_Silent_p.N622N	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	622					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGCTCACACGTTGTGGGTCC	0.587																																																0			7											81.0	68.0	73.0					7																	150911146		2203	4300	6503	150542079	SO:0001819	synonymous_variant	10061			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1866C>T	7.37:g.150911146G>A			150542079	O60864|Q75MJ0|Q75MJ1|Q96TE8	Silent	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.N622	ENST00000287844.2	37	c.1866	CCDS5923.1	7																																																																																			-	NULL		0.587	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	protein_coding	OTTHUMT00000336086.1	G	NM_005692		150542079	-1	no_errors	NM_005692	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
LRBA	987	genome.wustl.edu	37	4	151509212	151509212	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:151509212T>G	ENST00000357115.3	-	41	6594	c.6351A>C	c.(6349-6351)aaA>aaC	p.K2117N	LRBA_ENST00000507224.1_Missense_Mutation_p.K2106N|LRBA_ENST00000510413.1_Missense_Mutation_p.K2106N|LRBA_ENST00000535741.1_Missense_Mutation_p.K2106N	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2117						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGGGGTCGATTTTTTTGAAGT	0.458																																																0			4											149.0	163.0	158.0					4																	151509212		2203	4299	6502	151728662	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6351A>C	4.37:g.151509212T>G	ENSP00000349629:p.Lys2117Asn		151728662	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_DUF1088,superfamily_PH domain-like,superfamily_BEACH domain,HMMPfam_Beach,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.K2117N	ENST00000357115.3	37	c.6351	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.62|10.62	1.401185|1.401185	0.25291|0.25291	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|T	0.58210|0.49432	0.79;0.93;0.79;0.35|0.78	6.03|6.03	2.06|2.06	0.26882|0.26882	PH-BEACH domain (1);|.	0.372505|0.372505	0.31188|0.31188	N|N	0.008090|0.008090	T|T	0.45677|0.45677	0.1354|0.1354	L|L	0.46670|0.46670	1.46|1.46	0.54753|0.54753	D|D	0.999986|0.999986	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.33599|0.33599	-0.9862|-0.9862	10|8	0.39692|0.51188	T|T	0.17|0.08	.|.	6.6653|6.6653	0.23037|0.23037	0.2391:0.0647:0.0:0.6963|0.2391:0.0647:0.0:0.6963	.|.	2117;2106|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	N|T	2106;2106;2117;2106|759	ENSP00000446299:K2106N;ENSP00000421552:K2106N;ENSP00000349629:K2117N;ENSP00000422180:K2106N|ENSP00000426669:K759T	ENSP00000349629:K2117N|ENSP00000426669:K759T	K|K	-|-	3|2	2|0	LRBA|LRBA	151728662|151728662	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.988000|0.988000	0.29616|0.29616	0.502000|0.502000	0.28037|0.28037	0.533000|0.533000	0.62120|0.62120	AAA|AAA	-	superfamily_PH domain-like		0.458	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	T			151728662	-1	no_errors	NM_006726	genbank	human	validated	54_36p	missense	SNP	1.000	G
ARHGEF26	26084	genome.wustl.edu	37	3	153840466	153840466	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr3:153840466G>A	ENST00000356448.4	+	2	969	c.685G>A	c.(685-687)Gag>Aag	p.E229K	ARHGEF26-AS1_ENST00000480639.1_RNA|ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.E229K|ARHGEF26-AS1_ENST00000491862.1_RNA|ARHGEF26-AS1_ENST00000479270.1_RNA|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.E229K	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	229					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						CGAGCTCCTCGAGAATCCTTC	0.547																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)											0			3											16.0	18.0	18.0					3																	153840466		1850	4085	5935	155323156	SO:0001583	missense	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.685G>A	3.37:g.153840466G>A	ENSP00000348828:p.Glu229Lys		155323156	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_1	p.E229K	ENST00000356448.4	37	c.685	CCDS46938.1	3	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961593	0.53400	.	.	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.58506	0.33;0.33;2.11	4.65	4.65	0.58169	.	0.300418	0.31134	N	0.008193	T	0.39462	0.1079	L	0.27053	0.805	0.09310	N	0.999992	P;P	0.43352	0.688;0.804	B;B	0.25291	0.059;0.059	T	0.46952	-0.9154	10	0.59425	D	0.04	-18.6125	16.2969	0.82781	0.0:0.0:1.0:0.0	.	229;229	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	K	229	ENSP00000348828:E229K;ENSP00000423418:E229K;ENSP00000423295:E229K	ENSP00000348828:E229K	E	+	1	0	ARHGEF26	155323156	0.984000	0.35163	0.053000	0.19242	0.269000	0.26545	3.893000	0.56243	2.105000	0.64084	0.655000	0.94253	GAG	-	NULL		0.547	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	uc003ezv.1	protein_coding	OTTHUMT00000353287.3	G	NM_015595		155323156	+1	no_errors	ENST00000356448	ensembl	human	known	54_36p	missense	SNP	0.033	A
ARHGEF26	26084	genome.wustl.edu	37	3	153958177	153958177	+	Silent	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr3:153958177C>T	ENST00000356448.4	+	12	2393	c.2109C>T	c.(2107-2109)gtC>gtT	p.V703V	ARHGEF26_ENST00000465093.1_Silent_p.V703V|ARHGEF26_ENST00000483068.1_3'UTR|ARHGEF26_ENST00000465817.1_Intron	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	703	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						GTTACAACGTCAATGATTATT	0.388																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)											0			3											84.0	79.0	81.0					3																	153958177		1875	4117	5992	155440867	SO:0001819	synonymous_variant	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.2109C>T	3.37:g.153958177C>T			155440867	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Silent	SNP	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH3-domain,HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like	p.V703	ENST00000356448.4	37	c.2109	CCDS46938.1	3																																																																																			-	HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like		0.388	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	uc003ezv.1	protein_coding	OTTHUMT00000353287.3	C	NM_015595		155440867	+1	no_errors	ENST00000356448	ensembl	human	known	54_36p	silent	SNP	1.000	T
DDR2	4921	genome.wustl.edu	37	1	162745441	162745441	+	Splice_Site	SNP	G	G	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:162745441G>C	ENST00000367922.3	+	16	2294		c.e16-1		RN7SL861P_ENST00000473793.2_RNA|DDR2_ENST00000367921.3_Splice_Site	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2						biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATCCTCCCAAGGAATGATTTT	0.423																																					NSCLC(161;314 2006 8283 19651 23192)											0			1											87.0	86.0	86.0					1																	162745441		2203	4300	6503	161012065	SO:0001630	splice_region_variant	4921			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1857-1G>C	1.37:g.162745441G>C			161012065	Q7Z730	Splice_Site	SNP	-	e13-1	ENST00000367922.3	37	c.1857-1	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573941	0.86542	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.467	0.87635	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DDR2	161012065	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.671000	0.98627	2.507000	0.84556	0.591000	0.81541	.	-	-		0.423	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	protein_coding	OTTHUMT00000083213.2	G	NM_006182	Intron	161012065	+1	no_errors	NM_001014796	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
KCNH7	90134	genome.wustl.edu	37	2	163236362	163236362	+	Splice_Site	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:163236362C>T	ENST00000332142.5	-	14	3231		c.e14+1			NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7						circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ACTGCTTATACCTGTTAAGTT	0.468																																					GBM(196;1492 2208 17507 24132 45496)											0			2											145.0	138.0	140.0					2																	163236362		2203	4300	6503	162944608	SO:0001630	splice_region_variant	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.3131+1G>A	2.37:g.163236362C>T			162944608	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Splice_Site	SNP	-	e14+1	ENST00000332142.5	37	c.3131+1	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876535	0.91664	.	.	ENSG00000184611	ENST00000332142	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNH7	162944608	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.638000	0.74309	2.835000	0.97688	0.591000	0.81541	.	-	-		0.468	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	C	NM_033272	Intron	162944608	-1	no_errors	NM_033272	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
LMX1A	4009	genome.wustl.edu	37	1	165182958	165182958	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:165182958G>A	ENST00000342310.3	-	5	971	c.589C>T	c.(589-591)Cgt>Tgt	p.R197C	RP11-38C18.2_ENST00000457106.1_RNA|RP11-38C18.3_ENST00000441773.1_RNA|LMX1A_ENST00000294816.2_Missense_Mutation_p.R197C|LMX1A_ENST00000489443.2_5'Flank|LMX1A_ENST00000367893.4_Missense_Mutation_p.R197C	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	197					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					GTTCTCGGACGTTTGGGGCGC	0.517																																																0			1											244.0	219.0	228.0					1																	165182958		2203	4300	6503	163449582	SO:0001583	missense	4009			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.589C>T	1.37:g.165182958G>A	ENSP00000340226:p.Arg197Cys		163449582	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.R197C	ENST00000342310.3	37	c.589	CCDS1247.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138201	0.77775	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	D;D;D	0.97161	-4.27;-4.27;-4.27	5.64	4.67	0.58626	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99004	0.9660	H	0.98199	4.17	0.80722	D	1.000000	D	0.89917	1.0	D	0.87578	0.998	D	0.99069	1.0833	9	0.87932	D	0	.	12.9675	0.58492	0.0:0.0:0.7187:0.2813	.	197	Q8TE12	LMX1A_HUMAN	C	197	ENSP00000340226:R197C;ENSP00000294816:R197C;ENSP00000356868:R197C	ENSP00000294816:R197C	R	-	1	0	LMX1A	163449582	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.806000	0.38892	2.637000	0.89404	0.650000	0.86243	CGT	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.517	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMX1A	protein_coding	OTTHUMT00000083668.2	G	NM_177398		163449582	-1	no_errors	NM_177398	genbank	human	provisional	54_36p	missense	SNP	1.000	A
TRIM60	166655	genome.wustl.edu	37	4	165962417	165962417	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr4:165962417C>T	ENST00000512596.1	+	3	1409	c.1193C>T	c.(1192-1194)gCg>gTg	p.A398V	TRIM60_ENST00000508504.1_Missense_Mutation_p.A398V|TRIM60_ENST00000341062.5_Missense_Mutation_p.A398V	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	398	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		GGTTATGTTGCGTCAGGTCCT	0.443																																																0			4											120.0	123.0	122.0					4																	165962417		2203	4300	6503	166181867	SO:0001583	missense	166655			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1193C>T	4.37:g.165962417C>T	ENSP00000421142:p.Ala398Val		166181867	Q8NA35	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_BBOX,HMMSmart_PRY,HMMPfam_SPRY	p.A398V	ENST00000512596.1	37	c.1193	CCDS3808.1	4	.	.	.	.	.	.	.	.	.	.	C	7.933	0.741104	0.15642	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.61158	0.13;0.13;0.13	2.69	-4.63	0.03359	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.350227	0.17940	N	0.156862	T	0.37598	0.1009	N	0.25286	0.73	0.09310	N	1	B	0.22480	0.07	B	0.29077	0.098	T	0.17349	-1.0372	10	0.28530	T	0.3	.	10.3675	0.44033	0.0:0.2347:0.0:0.7653	.	398	Q495X7	TRI60_HUMAN	V	398	ENSP00000421142:A398V;ENSP00000426496:A398V;ENSP00000343765:A398V	ENSP00000343765:A398V	A	+	2	0	TRIM60	166181867	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.516000	0.02250	-1.545000	0.01719	-0.812000	0.03155	GCG	-	HMMPfam_SPRY		0.443	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	protein_coding	OTTHUMT00000364325.1	C	NM_152620		166181867	+1	no_errors	NM_152620	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171560762	171560762	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:171560762C>T	ENST00000338920.4	+	34	8467	c.8230C>T	c.(8230-8232)Cgg>Tgg	p.R2744W	PRRC2C_ENST00000367742.3_Missense_Mutation_p.R2746W|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R2825W|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R2679W	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2823					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GTCCACGCAACGGTTCTTCTC	0.448																																																0			1											82.0	79.0	80.0					1																	171560762		1929	4142	6071	169827385	SO:0001583	missense	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.8230C>T	1.37:g.171560762C>T	ENSP00000343629:p.Arg2744Trp		169827385	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	HMMPfam_BAT2_N	p.R2745W	ENST00000338920.4	37	c.8233	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371119	0.42003	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.02916	4.22;4.12;4.11;4.11	5.93	5.93	0.95920	.	.	.	.	.	T	0.05914	0.0154	L	0.36672	1.1	0.38880	D	0.956887	D;D	0.89917	1.0;1.0	D;D	0.76071	0.948;0.987	T	0.35201	-0.9798	9	0.66056	D	0.02	.	15.9834	0.80130	0.1426:0.8574:0.0:0.0	.	2679;2744	B7WNZ6;Q9Y520-4	.;.	W	2825;2777;2679;2746;2744;2580	ENSP00000375928:R2825W;ENSP00000410219:R2679W;ENSP00000356716:R2746W;ENSP00000343629:R2744W	ENSP00000343629:R2744W	R	+	1	2	PRRC2C	169827385	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	3.407000	0.52644	2.814000	0.96858	0.591000	0.81541	CGG	-	NULL		0.448	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	BAT2D1	protein_coding	OTTHUMT00000314826.4	C	NM_015172		169827385	+1	no_errors	ENST00000392080	ensembl	human	known	54_36p	missense	SNP	1.000	T
GORASP2	26003	genome.wustl.edu	37	2	171822378	171822378	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:171822378C>G	ENST00000234160.4	+	10	1912	c.1097C>G	c.(1096-1098)cCg>cGg	p.P366R	GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Missense_Mutation_p.P378R	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	366	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						GAGTTCCTCCCGTCATTCCCC	0.592																																																0			2											162.0	124.0	137.0					2																	171822378		2203	4300	6503	171530624	SO:0001583	missense	26003				CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.1097C>G	2.37:g.171822378C>G	ENSP00000234160:p.Pro366Arg		171530624	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_GRASP55_65	p.P366R	ENST00000234160.4	37	c.1097	CCDS33325.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103124	0.76983	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.54279	0.62;0.58	5.85	5.85	0.93711	.	0.105384	0.64402	D	0.000003	T	0.62612	0.2442	M	0.69823	2.125	0.51767	D	0.999939	P;P;P	0.52061	0.915;0.95;0.808	B;P;B	0.47346	0.42;0.544;0.42	T	0.64676	-0.6351	10	0.51188	T	0.08	-4.811	20.1649	0.98147	0.0:1.0:0.0:0.0	.	322;378;366	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	R	366;378	ENSP00000234160:P366R;ENSP00000410208:P378R	ENSP00000234160:P366R	P	+	2	0	GORASP2	171530624	0.998000	0.40836	1.000000	0.80357	0.941000	0.58515	5.114000	0.64648	2.753000	0.94483	0.655000	0.94253	CCG	-	HMMPfam_GRASP55_65		0.592	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP2	protein_coding	OTTHUMT00000333719.2	C			171530624	+1	no_errors	NM_015530	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KLHL6	89857	genome.wustl.edu	37	3	183273208	183273208	+	Silent	SNP	C	C	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr3:183273208C>T	ENST00000341319.3	-	1	269	c.234G>A	c.(232-234)gtG>gtA	p.V78V		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	78	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CCTGAATGTCCACACACAAGA	0.502																																																0			3											126.0	116.0	119.0					3																	183273208		2203	4300	6503	184755902	SO:0001819	synonymous_variant	89857			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.234G>A	3.37:g.183273208C>T			184755902	B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,HMMPfam_BACK,superfamily_Gal_oxid_central,HMMPfam_Kelch_1,HMMSmart_Kelch	p.V78	ENST00000341319.3	37	c.234	CCDS3245.2	3																																																																																			-	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB		0.502	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	protein_coding	OTTHUMT00000309024.1	C	NM_130446		184755902	-1	no_errors	NM_130446	genbank	human	validated	54_36p	silent	SNP	1.000	T
MFSD6	54842	genome.wustl.edu	37	2	191301994	191301994	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:191301994G>C	ENST00000392328.1	+	3	1563	c.1239G>C	c.(1237-1239)agG>agC	p.R413S	MFSD6_ENST00000281416.7_Missense_Mutation_p.R413S	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	413					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						AGGTGGAAAGGAACAACTCTA	0.512																																																0			2											97.0	87.0	91.0					2																	191301994		2203	4300	6503	191010239	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1239G>C	2.37:g.191301994G>C	ENSP00000376141:p.Arg413Ser		191010239	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.R413S	ENST00000392328.1	37	c.1239	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	G	3.098	-0.185318	0.06340	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.30182	1.54;1.54	5.64	0.542	0.17174	Major facilitator superfamily domain, general substrate transporter (1);	0.391477	0.29972	N	0.010729	T	0.12902	0.0313	N	0.12182	0.205	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.16571	-1.0398	10	0.10902	T	0.67	-14.2002	7.7463	0.28871	0.5896:0.0:0.4104:0.0	.	413	Q6ZSS7	MFSD6_HUMAN	S	413	ENSP00000376141:R413S;ENSP00000281416:R413S	ENSP00000281416:R413S	R	+	3	2	MFSD6	191010239	0.995000	0.38212	0.995000	0.50966	0.797000	0.45037	1.066000	0.30604	0.182000	0.20032	-0.145000	0.13849	AGG	-	superfamily_MFS_gen_substrate_transporter		0.512	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	protein_coding	OTTHUMT00000255931.1	G			191010239	+1	no_errors	NM_017694	genbank	human	validated	54_36p	missense	SNP	0.028	C
MUC20	200958	genome.wustl.edu	37	3	195453421	195453421	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr3:195453421G>T	ENST00000447234.2	+	2	2073	c.1947G>T	c.(1945-1947)agG>agT	p.R649S	MUC20_ENST00000445522.2_Missense_Mutation_p.R614S|MUC20_ENST00000320736.6_Missense_Mutation_p.R478S|MUC20_ENST00000436408.1_Missense_Mutation_p.R649S	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	649	Involved in oligomerization.|Thr-rich.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CCCGGACGAGGCCGACCACAG	0.607																																																0			3											95.0	101.0	99.0					3																	195453421		2084	4207	6291	196939092	SO:0001583	missense	200958			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1947G>T	3.37:g.195453421G>T	ENSP00000414350:p.Arg649Ser		196939092	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.R478S	ENST00000447234.2	37	c.1434		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.233|9.233	1.036278|1.036278	0.19669|0.19669	.|.	.|.	ENSG00000176945|ENSG00000176945	ENST00000423938|ENST00000381954;ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	.|T;T;T;T	.|0.17854	.|2.69;2.76;2.85;2.25	4.8|4.8	1.74|1.74	0.24563|0.24563	.|.	.|0.470054	.|0.18482	.|N	.|0.139885	T|T	0.08714|0.08714	0.0216|0.0216	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|P	.|0.37101	.|0.582	.|B	.|0.31686	.|0.134	T|T	0.25710|0.25710	-1.0124|-1.0124	5|10	.|0.30078	.|T	.|0.28	-0.1444|-0.1444	7.1248|7.1248	0.25465|0.25465	0.0:0.1699:0.4797:0.3503|0.0:0.1699:0.4797:0.3503	.|.	.|478	.|E9PH32	.|.	S|S	61|460;649;478;649;614	.|ENSP00000414350:R649S;ENSP00000325431:R478S;ENSP00000396774:R649S;ENSP00000405629:R614S	.|ENSP00000325431:R478S	A|R	+|+	1|3	0|2	MUC20|MUC20	196939092|196939092	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	-0.352000|-0.352000	0.07701|0.07701	0.691000|0.691000	0.31592|0.31592	0.655000|0.655000	0.94253|0.94253	GCC|AGG	-	NULL		0.607	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	protein_coding	OTTHUMT00000341835.1	G	NM_152673		196939092	+1	no_errors	NM_152673	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
Unknown	0	genome.wustl.edu	37	1	234895130	234895130	+	IGR	SNP	T	T	C	rs114657346	byFrequency	TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:234895130T>C								RP4-781K5.8 (27740 upstream) : RNY4P16 (78589 downstream)																							TTGCGCGCCATACTGGGCAGG	0.498													T|||	145	0.0289537	0.0	0.0692	5008	,	,		20542	0.0		0.0606	False		,,,				2504	0.0368															0			1																																								232961753	SO:0001628	intergenic_variant	0																															1.37:g.234895130T>C			232961753		Missense_Mutation	SNP	NULL	p.Y157C		37	c.470		1																																																																																			-	NULL	0	0.498					LOC100130249			T			232961753	-1	no_errors	XM_001722882	genbank	human	model	54_36p	missense	SNP	0.001	C
NLRP3	114548	genome.wustl.edu	37	1	247587589	247587589	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr1:247587589G>A	ENST00000336119.3	+	3	1590	c.844G>A	c.(844-846)Gac>Aac	p.D282N	NLRP3_ENST00000348069.2_Missense_Mutation_p.D282N|NLRP3_ENST00000391827.2_Missense_Mutation_p.D282N|NLRP3_ENST00000366496.2_Missense_Mutation_p.D282N|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391828.3_Missense_Mutation_p.D282N|NLRP3_ENST00000366497.2_Missense_Mutation_p.D282N	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	282	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTGCTGCCCCGACCCAAACCC	0.537																																																0			1											66.0	68.0	67.0					1																	247587589		2203	4300	6503	245654212	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.844G>A	1.37:g.247587589G>A	ENSP00000337383:p.Asp282Asn		245654212	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_NACHT,superfamily_SSF52047,HMMSmart_LRR_RI,HMMPfam_LRR_1	p.D282N	ENST00000336119.3	37	c.844	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383515	0.25031	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	4.04	4.04	0.47022	NACHT nucleoside triphosphatase (1);	0.235140	0.30428	N	0.009647	D	0.82976	0.5154	L	0.58669	1.825	0.44117	D	0.996897	D;B;D;P;P	0.69078	0.97;0.168;0.997;0.769;0.659	P;B;D;B;B	0.63793	0.708;0.009;0.918;0.434;0.426	T	0.82884	-0.0236	10	0.49607	T	0.09	.	11.9927	0.53184	0.0:0.0:1.0:0.0	.	282;282;282;282;282	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	282	ENSP00000375704:D282N;ENSP00000355453:D282N;ENSP00000337383:D282N;ENSP00000294752:D282N;ENSP00000355452:D282N;ENSP00000375703:D282N	ENSP00000337383:D282N	D	+	1	0	NLRP3	245654212	0.123000	0.22298	0.507000	0.27676	0.040000	0.13550	1.551000	0.36233	2.543000	0.85770	0.563000	0.77884	GAC	-	HMMPfam_NACHT		0.537	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	protein_coding	OTTHUMT00000097740.1	G	NM_004895		245654212	+1	no_errors	NM_001079821	genbank	human	reviewed	54_36p	missense	SNP	0.024	A
FASTKD3	79072	genome.wustl.edu	37	5	7867620	7867623	+	Frame_Shift_Del	DEL	GAGG	GAGG	-			TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	GAGG	GAGG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr5:7867620_7867623delGAGG	ENST00000264669.5	-	2	710_713	c.574_577delCCTC	c.(574-579)cctcaafs	p.PQ192fs	MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000440940.2_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000502509.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	192					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AGGCTACTTTGAGGATCCACATGC	0.441																																																0			5																																								7920623	SO:0001589	frameshift_variant	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.574_577delCCTC	5.37:g.7867620_7867623delGAGG	ENSP00000264669:p.Pro192fs		7920620	Q9BVD3	Frame_Shift_Del	DEL	HMMPfam_FAST_1,HMMPfam_FAST_2,HMMPfam_RAP	p.P192fs	ENST00000264669.5	37	c.577_574	CCDS3873.1	5																																																																																			(deletion:cds_exon[7919759,7921196])	NULL		0.441	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	protein_coding	OTTHUMT00000253673.1	GAGG	NM_024091		7920623	-1	no_errors	NM_024091	genbank	human	validated	54_36p	frame_shift_del	DEL	0.770:0.781:0.982:0.982	-
EHF	26298	genome.wustl.edu	37	11	34668214	34668222	+	In_Frame_Del	DEL	AGCATCTGA	AGCATCTGA	-	rs144427844		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	AGCATCTGA	AGCATCTGA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr11:34668214_34668222delAGCATCTGA	ENST00000533754.1	+	3	543_551	c.326_334delAGCATCTGA	c.(325-336)cagcatctgaag>cag	p.HLK110del	EHF_ENST00000530286.1_In_Frame_Del_p.HLK110del|EHF_ENST00000450654.2_In_Frame_Del_p.HLK110del|EHF_ENST00000257831.3_In_Frame_Del_p.HLK110del|EHF_ENST00000531728.1_In_Frame_Del_p.HLK110del|EHF_ENST00000527935.1_In_Frame_Del_p.HLK110del|EHF_ENST00000531794.1_In_Frame_Del_p.HLK132del					ets homologous factor										NFIA/EHF(2)	autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|lung(8)|upper_aerodigestive_tract(1)	17		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			AGCAACTTGCAGCATCTGAAGTGGAACGG	0.555																																																0			11																																								34624798	SO:0001651	inframe_deletion	26298			AF170583	CCDS7894.1, CCDS55752.1, CCDS55753.1	11p12	2008-07-18				ENSG00000135373			3246	protein-coding gene	gene with protein product	"""epithelium-specific ets factor 3"", ""ESE3 transcription factor"""	605439				10527851	Standard	NM_012153		Approved	ESE3, ESEJ	uc021qfu.1	Q9NZC4		ENST00000533754.1:c.326_334delAGCATCTGA	11.37:g.34668214_34668222delAGCATCTGA	ENSP00000435837:p.His110_Lys112del		34624790		In_Frame_Del	DEL	"superfamily_SAM/Pointed domain,HMMPfam_SAM_PNT,HMMSmart_SM00251,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Ets,HMMSmart_SM00413"	p.HLK110in_frame_del	ENST00000533754.1	37	c.326_334	CCDS7894.1	11																																																																																			(deletion:cds_exon[34624562,34624807])	superfamily_SAM/Pointed domain,HMMPfam_SAM_PNT,HMMSmart_SM00251		0.555	EHF-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EHF	protein_coding	OTTHUMT00000389855.1	AGCATCTGA	NM_012153		34624798	+1	no_errors	NM_012153	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:0.999:1.000:1.000:1.000:1.000:1.000:0.991:1.000	-
TMEM213	155006	genome.wustl.edu	37	7	138486136	138486136	+	Frame_Shift_Del	DEL	G	G	-	rs201901802		TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr7:138486136delG	ENST00000442682.2	+	2	300	c.147delG	c.(145-147)cagfs	p.Q49fs	TMEM213_ENST00000397602.3_Frame_Shift_Del_p.Q48fs|TMEM213_ENST00000413208.1_Frame_Shift_Del_p.Q49fs|TMEM213_ENST00000422794.2_Frame_Shift_Del_p.Q99fs|TMEM213_ENST00000458494.1_Intron	NM_001085429.1	NP_001078898.1	A2RRL7	TM213_HUMAN	transmembrane protein 213	49						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(1)	6						CCCTGGAGCAGTGCCTCAGTA	0.567																																																0			7											38.0	44.0	42.0					7																	138486136		1975	4137	6112	138136676	SO:0001589	frameshift_variant	155006				CCDS47722.1	7q34	2008-08-08			ENSG00000214128	ENSG00000214128			27220	protein-coding gene	gene with protein product							Standard	NM_001085429		Approved		uc010lna.3	A2RRL7	OTTHUMG00000157182	ENST00000442682.2:c.147delG	7.37:g.138486136delG	ENSP00000390407:p.Gln49fs		138136676	A4D1R3|C9JH49|C9JX41|C9K0P0	Frame_Shift_Del	DEL	NULL	p.Q49fs	ENST00000442682.2	37	c.147	CCDS47722.1	7																																																																																			(deletion:cds_exon[138136612,138136683])	NULL		0.567	TMEM213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM213	protein_coding	OTTHUMT00000347800.2	G	NM_001085429		138136676	+1	no_errors	NM_001085429	genbank	human	validated	54_36p	frame_shift_del	DEL	0.993	-
TM4SF20	79853	genome.wustl.edu	37	2	228235654	228235655	+	Frame_Shift_Del	DEL	CT	CT	-	rs144716300	byFrequency	TCGA-29-1695-01A-01W-0633-09	TCGA-29-1695-10A-01W-0633-09	CT	CT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	bbf1daec-d2ee-4279-932a-024e03ac9273	03e23f9c-96bb-44a0-9f3f-db563f94848b	g.chr2:228235654_228235655delCT	ENST00000304568.3	-	2	262_263	c.225_226delAG	c.(223-228)agagcgfs	p.RA75fs		NM_024795.3	NP_079071.2	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(2)	10		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TTGCAGCACGCTCTTTTTCTTG	0.421																																																0			2																																								227943899	SO:0001589	frameshift_variant	79853			AK026453	CCDS2466.1	2q36.3	2008-02-05			ENSG00000168955	ENSG00000168955			26230	protein-coding gene	gene with protein product		615404				12975309	Standard	NM_024795		Approved	FLJ22800, TCCE518	uc002vpb.2	Q53R12	OTTHUMG00000133187	ENST00000304568.3:c.225_226delAG	2.37:g.228235656_228235657delCT	ENSP00000303028:p.Arg75fs		227943898	B2RP42|Q5U609|Q6UWS1|Q9H5X9	Frame_Shift_Del	DEL	HMMPfam_L6_membrane	p.R75fs	ENST00000304568.3	37	c.226_225	CCDS2466.1	2																																																																																			(deletion:cds_exon[227943875,227943940])	HMMPfam_L6_membrane		0.421	TM4SF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF20	protein_coding	OTTHUMT00000256896.2	CT	NM_024795		227943899	-1	no_errors	NM_024795	genbank	human	validated	54_36p	frame_shift_del	DEL	0.182:0.379	-
