#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FOXM1	2305	genome.wustl.edu	37	12	2981334	2981334	+	Silent	SNP	T	T	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr12:2981334T>G	ENST00000359843.3	-	3	650	c.582A>C	c.(580-582)ggA>ggC	p.G194G	FOXM1_ENST00000342628.2_Silent_p.G194G|FOXM1_ENST00000361953.3_Silent_p.G194G|FOXM1_ENST00000537018.1_5'UTR	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	194					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGGAGCCCAGTCCATCAGAAC	0.488																																																0			12											217.0	192.0	200.0					12																	2981334		2203	4300	6503	2851595	SO:0001819	synonymous_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.582A>C	12.37:g.2981334T>G			2851595	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.G194	ENST00000359843.3	37	c.582	CCDS8515.1	12																																																																																			-	NULL		0.488	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	protein_coding	OTTHUMT00000398272.1	T	NM_021953		2851595	-1	no_errors	NM_202002	genbank	human	validated	54_36p	silent	SNP	0.350	G
CCDC27	148870	genome.wustl.edu	37	1	3669295	3669295	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:3669295A>G	ENST00000294600.2	+	1	334	c.250A>G	c.(250-252)Aaa>Gaa	p.K84E		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	84										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CCCAGAATGGAAACCGCACCA	0.647																																																0			1											59.0	57.0	58.0					1																	3669295		2203	4300	6503	3659155	SO:0001583	missense	148870				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.250A>G	1.37:g.3669295A>G	ENSP00000294600:p.Lys84Glu		3659155	Q5TBV3|Q96M50	Missense_Mutation	SNP	NULL	p.K84E	ENST00000294600.2	37	c.250	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	A	9.721	1.159622	0.21454	.	.	ENSG00000162592	ENST00000294600	T	0.23950	1.88	3.85	3.85	0.44370	.	0.475733	0.17691	N	0.165264	T	0.26955	0.0660	L	0.32530	0.975	0.09310	N	1	P	0.50156	0.932	P	0.50352	0.638	T	0.05716	-1.0868	10	0.87932	D	0	-20.8109	9.3164	0.37937	1.0:0.0:0.0:0.0	.	84	Q2M243	CCD27_HUMAN	E	84	ENSP00000294600:K84E	ENSP00000294600:K84E	K	+	1	0	CCDC27	3659155	0.012000	0.17670	0.014000	0.15608	0.003000	0.03518	2.172000	0.42463	1.991000	0.58162	0.528000	0.53228	AAA	-	NULL		0.647	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	protein_coding	OTTHUMT00000009740.1	A	NM_152492		3659155	+1	no_errors	NM_152492	genbank	human	validated	54_36p	missense	SNP	0.015	G
ZNF594	84622	genome.wustl.edu	37	17	5085814	5085814	+	Missense_Mutation	SNP	T	T	C	rs201302960		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:5085814T>C	ENST00000399604.4	-	1	1878	c.1738A>G	c.(1738-1740)Agc>Ggc	p.S580G	ZNF594_ENST00000575779.1_Missense_Mutation_p.S580G			Q96JF6	ZN594_HUMAN	zinc finger protein 594	580					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						AGGTCTGAGCTGCCCTGGAAA	0.458																																																0			17											144.0	138.0	140.0					17																	5085814		2007	4207	6214	5026538	SO:0001583	missense	84622			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1738A>G	17.37:g.5085814T>C	ENSP00000382513:p.Ser580Gly		5026538	Q6RFS0	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.S580G	ENST00000399604.4	37	c.1738	CCDS42241.1	17	.	.	.	.	.	.	.	.	.	.	t	2.972	-0.212262	0.06140	.	.	ENSG00000180626	ENST00000399604;ENST00000389222	T	0.07688	3.17	1.04	1.04	0.20106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10035	0.0246	L	0.51422	1.61	0.09310	N	1	P	0.37731	0.607	B	0.43445	0.42	T	0.26573	-1.0099	9	0.49607	T	0.09	.	3.8407	0.08912	0.0:0.0:0.3924:0.6076	.	580	Q96JF6	ZN594_HUMAN	G	580;175	ENSP00000382513:S580G	ENSP00000373874:S175G	S	-	1	0	ZNF594	5026538	0.000000	0.05858	0.002000	0.10522	0.049000	0.14656	0.503000	0.22610	0.418000	0.25898	0.248000	0.18094	AGC	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.458	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	protein_coding	OTTHUMT00000438996.1	T	XM_290737		5026538	-1	no_errors	NM_032530	genbank	human	validated	54_36p	missense	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7578442	7578442	+	Missense_Mutation	SNP	T	T	C	rs148924904		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:7578442T>C	ENST00000269305.4	-	5	677	c.488A>G	c.(487-489)tAc>tGc	p.Y163C	TP53_ENST00000455263.2_Missense_Mutation_p.Y163C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.Y163C|TP53_ENST00000445888.2_Missense_Mutation_p.Y163C|TP53_ENST00000413465.2_Missense_Mutation_p.Y163C|TP53_ENST00000420246.2_Missense_Mutation_p.Y163C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	163	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y163C(134)|p.Y70C(12)|p.Y31C(12)|p.0?(8)|p.Y163S(7)|p.V157_C176del20(1)|p.Y31S(1)|p.Y163fs*1(1)|p.Y70S(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.I162_Y163delIY(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACTGCTTGTAGATGGCCAT	0.622		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	183	Substitution - Missense(167)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)	lung(49)|breast(34)|haematopoietic_and_lymphoid_tissue(14)|ovary(14)|urinary_tract(13)|large_intestine(10)|upper_aerodigestive_tract(9)|central_nervous_system(7)|oesophagus(7)|stomach(6)|biliary_tract(6)|bone(4)|pancreas(3)|soft_tissue(2)|liver(2)|endometrium(1)|salivary_gland(1)|prostate(1)	17	GRCh37	CM942135	TP53	M	rs148924904						53.0	54.0	53.0					17																	7578442		2203	4300	6503	7519167	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.488A>G	17.37:g.7578442T>C	ENSP00000269305:p.Tyr163Cys		7519167	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.Y163C	ENST00000269305.4	37	c.488	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.54	2.567047	0.45694	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.59	3.32	0.38043	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.062225	0.64402	D	0.000003	D	0.99746	0.9899	M	0.70595	2.14	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.996;0.999;0.983;0.999;1.0;0.999;0.994	D	0.98089	1.0408	10	0.87932	D	0	-16.6607	9.5833	0.39501	0.2797:0.0:0.0:0.7203	.	124;163;163;70;163;163;163	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	163;163;163;163;163;163;152;70;31;70;31;163	ENSP00000410739:Y163C;ENSP00000352610:Y163C;ENSP00000269305:Y163C;ENSP00000398846:Y163C;ENSP00000391127:Y163C;ENSP00000391478:Y163C;ENSP00000425104:Y31C;ENSP00000423862:Y70C;ENSP00000424104:Y163C	ENSP00000269305:Y163C	Y	-	2	0	TP53	7519167	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	5.141000	0.64814	0.446000	0.26666	0.533000	0.62120	TAC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.622	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7519167	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FASTKD3	79072	genome.wustl.edu	37	5	7866095	7866095	+	Splice_Site	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr5:7866095A>T	ENST00000264669.5	-	3	1576	c.1440T>A	c.(1438-1440)ggT>ggA	p.G480G	FASTKD3_ENST00000513658.1_5'UTR|MTRR_ENST00000502509.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	480					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GAGATTCTTTACCTGAAACAG	0.403																																																0			5											190.0	157.0	168.0					5																	7866095		2203	4300	6503	7919095	SO:0001630	splice_region_variant	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1439-1T>A	5.37:g.7866095A>T			7919095	Q9BVD3	Silent	SNP	HMMPfam_FAST_1,HMMPfam_FAST_2,HMMPfam_RAP	p.G480	ENST00000264669.5	37	c.1440	CCDS3873.1	5																																																																																			-	NULL		0.403	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	protein_coding	OTTHUMT00000253673.1	A	NM_024091	Silent	7919095	-1	no_errors	NM_024091	genbank	human	validated	54_36p	silent	SNP	0.161	T
LDLR	3949	genome.wustl.edu	37	19	11213434	11213434	+	Nonsense_Mutation	SNP	C	C	A	rs139400379		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr19:11213434C>A	ENST00000558518.1	+	3	472	c.285C>A	c.(283-285)tgC>tgA	p.C95*	LDLR_ENST00000455727.2_Nonsense_Mutation_p.C95*|LDLR_ENST00000545707.1_Nonsense_Mutation_p.C95*|LDLR_ENST00000535915.1_Intron|LDLR_ENST00000557933.1_Nonsense_Mutation_p.C95*|LDLR_ENST00000558013.1_Nonsense_Mutation_p.C95*	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	95	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.		C -> G (in FH; Spanish patient).		cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	AAGTGGACTGCGACAACGGCT	0.577																																					GBM(18;201 575 7820 21545)											1	Unknown(1)	lung(1)	19	GRCh37	CM983442	LDLR	M	rs139400379						147.0	123.0	131.0					19																	11213434		2203	4300	6503	11074434	SO:0001587	stop_gained	3949			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.285C>A	19.37:g.11213434C>A	ENSP00000454071:p.Cys95*		11074434	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Nonsense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b	p.C95*	ENST00000558518.1	37	c.285	CCDS12254.1	19	.	.	.	.	.	.	.	.	.	.	C	11.08	1.532358	0.27387	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000455727	.	.	.	5.65	-9.5	0.00584	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6284	0.84993	0.0:0.2341:0.0:0.7659	.	.	.	.	X	95	.	ENSP00000252444:C95X	C	+	3	2	LDLR	11074434	0.002000	0.14202	0.010000	0.14722	0.017000	0.09413	-1.457000	0.02374	-1.953000	0.01026	-1.130000	0.01982	TGC	-	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1		0.577	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	protein_coding	OTTHUMT00000415973.2	C			11074434	+1	no_errors	NM_000527	genbank	human	reviewed	54_36p	nonsense	SNP	0.921	A
ADTRP	84830	genome.wustl.edu	37	6	11723649	11723649	+	Silent	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr6:11723649G>A	ENST00000414691.3	-	5	1001	c.591C>T	c.(589-591)ttC>ttT	p.F197F	ADTRP_ENST00000229583.5_Silent_p.F215F|ADTRP_ENST00000379413.2_Silent_p.F197F|ADTRP_ENST00000514824.1_5'UTR	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGCTGAGAGAGAAGAAAGCTG	0.483																																																0			6											203.0	202.0	203.0					6																	11723649		2203	4300	6503	11831635	SO:0001819	synonymous_variant	84830			AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.591C>T	6.37:g.11723649G>A			11831635	B2R7T9|B4DV39|Q5THW1	Silent	SNP	HMMPfam_Far-17a_AIG1	p.F197	ENST00000414691.3	37	c.591	CCDS4521.1	6																																																																																			-	HMMPfam_Far-17a_AIG1		0.483	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf105	protein_coding	OTTHUMT00000039864.3	G	NM_032744		11831635	-1	no_errors	NM_032744	genbank	human	validated	54_36p	silent	SNP	0.985	A
DHTKD1	55526	genome.wustl.edu	37	10	12162877	12162877	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:12162877C>A	ENST00000263035.4	+	17	2812	c.2750C>A	c.(2749-2751)aCc>aAc	p.T917N		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	917					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			CTCGCCAAGACCTTCGCTTGA	0.507																																																0			10											93.0	84.0	87.0					10																	12162877		2203	4300	6503	12202883	SO:0001583	missense	55526			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2750C>A	10.37:g.12162877C>A	ENSP00000263035:p.Thr917Asn		12202883	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	superfamily_Thiamin diphosphate-binding fold (THDP-binding),HMMPfam_E1_dh,HMMPfam_Transket_pyr	p.T917N	ENST00000263035.4	37	c.2750	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	C	16.94	3.262045	0.59431	.	.	ENSG00000181192	ENST00000263035	T	0.05081	3.5	5.61	5.61	0.85477	.	0.096368	0.64402	D	0.000001	T	0.15609	0.0376	M	0.79258	2.445	0.58432	D	0.999999	P	0.45011	0.848	B	0.43103	0.408	T	0.00664	-1.1620	10	0.87932	D	0	-14.2665	19.2248	0.93814	0.0:1.0:0.0:0.0	.	917	Q96HY7	DHTK1_HUMAN	N	917	ENSP00000263035:T917N	ENSP00000263035:T917N	T	+	2	0	DHTKD1	12202883	1.000000	0.71417	1.000000	0.80357	0.241000	0.25554	6.713000	0.74686	2.614000	0.88457	0.655000	0.94253	ACC	-	NULL		0.507	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	protein_coding	OTTHUMT00000046777.1	C	NM_018706		12202883	+1	no_errors	NM_018706	genbank	human	validated	54_36p	missense	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13603402	13603402	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr4:13603402C>G	ENST00000040738.5	-	10	5257	c.5122G>C	c.(5122-5124)Gat>Cat	p.D1708H		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1708						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGGGAGCCATCCACCTCTTCA	0.423																																																0			4											181.0	188.0	186.0					4																	13603402		2203	4300	6503	13212500	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5122G>C	4.37:g.13603402C>G	ENSP00000040738:p.Asp1708His		13212500	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	superfamily_SSF81995,HMMPfam_AT_hook,HMMSmart_AT_hook	p.D1708H	ENST00000040738.5	37	c.5122	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628985	0.46944	.	.	ENSG00000038219	ENST00000040738	T	0.08984	3.03	4.59	3.74	0.42951	.	0.218722	0.31760	N	0.007107	T	0.12263	0.0298	L	0.34521	1.04	0.18873	N	0.999987	D	0.60160	0.987	P	0.54460	0.753	T	0.04165	-1.0972	10	0.66056	D	0.02	-0.5986	9.9769	0.41789	0.0:0.7826:0.1387:0.0788	.	1708	Q8NFC6	BOD1L_HUMAN	H	1708	ENSP00000040738:D1708H	ENSP00000040738:D1708H	D	-	1	0	BOD1L	13212500	.	.	0.063000	0.19743	0.785000	0.44390	.	.	1.029000	0.39812	0.555000	0.69702	GAT	-	superfamily_SSF81995		0.423	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L	protein_coding	OTTHUMT00000207321.1	C	NM_148894		13212500	-1	no_errors	NM_148894	genbank	human	validated	54_36p	missense	SNP	0.047	G
UNC13A	23025	genome.wustl.edu	37	19	17737486	17737486	+	Silent	SNP	G	G	A	rs113693450	byFrequency	TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr19:17737486G>A	ENST00000519716.2	-	34	4028	c.4029C>T	c.(4027-4029)gaC>gaT	p.D1343D	UNC13A_ENST00000551649.1_Silent_p.D1343D|UNC13A_ENST00000252773.7_Silent_p.D1343D|UNC13A_ENST00000552293.1_Silent_p.D1343D|UNC13A_ENST00000428389.2_Silent_p.D1431D|UNC13A_ENST00000550896.1_Silent_p.D1341D	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1343					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CATTGTCCGCGTCCTGGGCCA	0.622													g|||	85	0.0169728	0.0068	0.0274	5008	,	,		20526	0.001		0.0517	False		,,,				2504	0.0041															0			19								42,4274		0,42,2116	28.0	29.0	29.0		4029	-4.9	0.9	19	dbSNP_132	29	509,7995		16,477,3759	no	coding-synonymous	UNC13A	NM_001080421.2		16,519,5875	AA,AG,GG		5.9854,0.9731,4.298		1343/1704	17737486	551,12269	2158	4252	6410	17598486	SO:0001819	synonymous_variant	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4029C>T	19.37:g.17737486G>A			17598486	E5RHY9	Silent	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.D1431	ENST00000519716.2	37	c.4293	CCDS46013.2	19																																																																																			-	NULL		0.622	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	G	XM_038604		17598486	-1	no_errors	NM_001080421	genbank	human	provisional	54_36p	silent	SNP	0.969	A
Unknown	0	genome.wustl.edu	37	15	20457267	20457267	+	IGR	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:20457267C>G								RP11-173D3.1 (104061 upstream) : CHEK2P2 (30729 downstream)																							CTGATTTTCTCAAACACGCTT	0.493																																																0			15																																								18717281	SO:0001628	intergenic_variant	646090																															15.37:g.20457267C>G			18717281		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.493					LOC646090			C			18717281	-1	pseudogene	XR_017120	genbank	human	model	54_36p	rna	SNP	1.000	G
POTEB2	100287399	genome.wustl.edu	37	15	21059423	21059423	+	Silent	SNP	T	T	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:21059423T>C	ENST00000454856.4	-	6	1010	c.978A>G	c.(976-978)aaA>aaG	p.K326K	RNU6-749P_ENST00000459351.1_RNA	NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	326																	TTAGCATCTGTTTTTCTTTAT	0.284																																																0			15																																								19324011	SO:0001819	synonymous_variant	339010				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.978A>G	15.37:g.21059423T>C			19324011		Silent	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.K363	ENST00000454856.4	37	c.1089	CCDS59248.1	15																																																																																			-	superfamily_Ankyrin repeat,HMMSmart_SM00248		0.284	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	protein_coding	OTTHUMT00000471435.1	T			19324011	-1	no_errors	NM_207355	genbank	human	validated	54_36p	silent	SNP	0.001	C
SLIT2	9353	genome.wustl.edu	37	4	20620450	20620450	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr4:20620450G>T	ENST00000504154.1	+	37	4660	c.4408G>T	c.(4408-4410)Gct>Tct	p.A1470S	SLIT2_ENST00000503837.1_Missense_Mutation_p.A1466S|SLIT2_ENST00000503823.1_Missense_Mutation_p.A1462S|SLIT2_ENST00000273739.5_Missense_Mutation_p.A1483S	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1470	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039, ECO:0000305}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GGGCTATGCTGCTTGCCAAAC	0.483																																																0			4											109.0	98.0	102.0					4																	20620450		2203	4300	6503	20229548	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4408G>T	4.37:g.20620450G>T	ENSP00000422591:p.Ala1470Ser		20229548	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_LRRNT,HMMSmart_SM00013,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,HMMSmart_SM00365,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMSmart_SM00274,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00041,PatternScan_CTCK_1	p.A1470S	ENST00000504154.1	37	c.4408	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639210	0.29157	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.80304	-1.35;-1.36;-1.27;-1.32	6.07	5.22	0.72569	Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.65165	0.2665	N	0.13098	0.295	0.80722	D	1	B;B	0.31968	0.013;0.349	B;B	0.29862	0.036;0.108	T	0.63545	-0.6613	10	0.07990	T	0.79	.	16.8899	0.86084	0.0:0.0:0.8708:0.1292	.	1462;1470	O94813-3;O94813	.;SLIT2_HUMAN	S	1462;1470;1483;1466;1466	ENSP00000427548:A1462S;ENSP00000422591:A1470S;ENSP00000273739:A1483S;ENSP00000422261:A1466S	ENSP00000273739:A1483S	A	+	1	0	SLIT2	20229548	1.000000	0.71417	0.815000	0.32552	0.874000	0.50279	6.671000	0.74472	1.565000	0.49641	0.655000	0.94253	GCT	-	HMMSmart_SM00041		0.483	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	G			20229548	+1	no_errors	NM_004787	genbank	human	provisional	54_36p	missense	SNP	1.000	T
LRP10	26020	genome.wustl.edu	37	14	23344660	23344660	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr14:23344660G>T	ENST00000359591.4	+	5	1194	c.503G>T	c.(502-504)gGc>gTc	p.G168V	LRP10_ENST00000546834.1_Missense_Mutation_p.G168V	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	168	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TGTGGCGATGGCTCTGATGAA	0.587																																																0			14											142.0	113.0	123.0					14																	23344660		2203	4300	6503	22414500	SO:0001583	missense	26020			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.503G>T	14.37:g.23344660G>T	ENSP00000352601:p.Gly168Val		22414500	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042,HMMPfam_Ldl_recept_a,superfamily_LDL receptor-like module,HMMSmart_SM00192,HMMPfam_CUB,PatternScan_LDLRA_1	p.G168V	ENST00000359591.4	37	c.503	CCDS9578.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.54|13.54	2.267692|2.267692	0.40095|0.40095	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	D;D|.	0.96554|.	-4.05;-4.05|.	5.97|5.97	4.9|4.9	0.64082|0.64082	.|.	0.273316|.	0.40818|.	N|.	0.001011|.	T|T	0.79441|0.79441	0.4446|0.4446	M|M	0.88640|0.88640	2.97|2.97	0.80722|0.80722	D|D	1|1	B|.	0.30763|.	0.294|.	B|.	0.33890|.	0.172|.	T|T	0.82034|0.82034	-0.0657|-0.0657	10|5	0.66056|.	D|.	0.02|.	-23.7309|-23.7309	13.328|13.328	0.60471|0.60471	0.0883:0.0:0.9117:0.0|0.0883:0.0:0.9117:0.0	.|.	168|.	Q7Z4F1|.	LRP10_HUMAN|.	V|C	168|69	ENSP00000352601:G168V;ENSP00000447559:G168V|.	ENSP00000352601:G168V|.	G|W	+|+	2|3	0|0	LRP10|LRP10	22414500|22414500	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	1.883000|1.883000	0.39658|0.39658	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GGC|TGG	-	HMMPfam_Ldl_recept_a,superfamily_LDL receptor-like module,HMMSmart_SM00192		0.587	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP10	protein_coding	OTTHUMT00000071663.3	G			22414500	+1	no_errors	NM_014045	genbank	human	validated	54_36p	missense	SNP	0.910	T
LOXL2	4017	genome.wustl.edu	37	8	23174541	23174541	+	Silent	SNP	C	C	T	rs146017667	byFrequency	TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr8:23174541C>T	ENST00000389131.3	-	9	1926	c.1557G>A	c.(1555-1557)gcG>gcA	p.A519A		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	519	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GGCGGCAGTGCGCCAGGGACA	0.627																																																0			8						C		1,4405	2.1+/-5.4	0,1,2202	70.0	63.0	65.0		1557	-10.8	0.0	8	dbSNP_134	65	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	LOXL2	NM_002318.2		0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461		519/775	23174541	6,13000	2203	4300	6503	23230486	SO:0001819	synonymous_variant	4017			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1557G>A	8.37:g.23174541C>T			23230486	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	superfamily_Srcr_receptor,HMMSmart_SR,HMMPfam_SRCR,PatternScan_SRCR_1,HMMPfam_Lysyl_oxidase,PatternScan_LYSYL_OXIDASE	p.A519	ENST00000389131.3	37	c.1557	CCDS34864.1	8																																																																																			-	superfamily_Srcr_receptor,HMMSmart_SR,HMMPfam_SRCR		0.627	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	protein_coding	OTTHUMT00000375603.1	C			23230486	-1	no_errors	NM_002318	genbank	human	reviewed	54_36p	silent	SNP	0.316	T
LRRC16B	90668	genome.wustl.edu	37	14	24526195	24526195	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr14:24526195A>T	ENST00000342740.5	+	13	1178	c.1024A>T	c.(1024-1026)Agc>Tgc	p.S342C	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	342						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CCTGGACCTGAGCAAGAATCC	0.612																																																0			14											40.0	42.0	41.0					14																	24526195		2203	4300	6503	23596035	SO:0001583	missense	90668			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1024A>T	14.37:g.24526195A>T	ENSP00000340467:p.Ser342Cys		23596035	Q8TEF7|Q96HS9	Missense_Mutation	SNP	superfamily_RNI-like,HMMSmart_SM00368	p.S342C	ENST00000342740.5	37	c.1024	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708022	0.48412	.	.	ENSG00000186648	ENST00000342740	T	0.61158	0.13	5.25	5.25	0.73442	.	0.050378	0.85682	D	0.000000	T	0.71409	0.3336	H	0.94264	3.515	0.80722	D	1	D	0.55172	0.97	P	0.46543	0.52	T	0.80299	-0.1441	10	0.72032	D	0.01	-7.6032	11.4769	0.50304	1.0:0.0:0.0:0.0	.	342	Q8ND23	LR16B_HUMAN	C	342	ENSP00000340467:S342C	ENSP00000340467:S342C	S	+	1	0	LRRC16B	23596035	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.399000	0.52586	2.215000	0.71742	0.460000	0.39030	AGC	-	superfamily_RNI-like,HMMSmart_SM00368		0.612	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	protein_coding	OTTHUMT00000416527.1	A	NM_138360		23596035	+1	no_errors	NM_138360	genbank	human	validated	54_36p	missense	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26964958	26964958	+	Nonsense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:26964958G>T	ENST00000528896.2	-	14	1741	c.1667C>A	c.(1666-1668)tCa>tAa	p.S556*	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Nonsense_Mutation_p.S413*|KIAA0100_ENST00000389003.3_Nonsense_Mutation_p.S413*	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	556						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AGAGACAGCTGACTTCCCAGA	0.473																																																0			17											98.0	85.0	89.0					17																	26964958		2203	4300	6503	23989085	SO:0001587	stop_gained	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1667C>A	17.37:g.26964958G>T	ENSP00000436773:p.Ser556*		23989085	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Nonsense_Mutation	SNP	HMMPfam_Mqo,HMMPfam_Fmp27_GFWDK,HMMPfam_Apt1	p.S556*	ENST00000528896.2	37	c.1667	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.835645	0.98516	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	.	.	.	5.95	4.98	0.66077	.	1.025690	0.07669	N	0.935128	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0246	0.71659	0.0681:0.0:0.9319:0.0	.	.	.	.	X	556;556;556;413	.	ENSP00000005905:S556X	S	-	2	0	KIAA0100	23989085	0.992000	0.36948	0.867000	0.34043	0.948000	0.59901	3.427000	0.52785	1.517000	0.48917	0.563000	0.77884	TCA	-	NULL		0.473	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	protein_coding	OTTHUMT00000390571.3	G	NM_014680		23989085	-1	no_errors	NM_014680	genbank	human	validated	54_36p	nonsense	SNP	0.004	T
GPR113	165082	genome.wustl.edu	37	2	26534549	26534549	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:26534549C>T	ENST00000311519.1	-	11	2046	c.2047G>A	c.(2047-2049)Ggc>Agc	p.G683S	GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.G484S|GPR113_ENST00000421160.2_Missense_Mutation_p.G614S|GPR113_ENST00000541401.1_Missense_Mutation_p.G286S	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	683					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGACCAGGCCAGGAGTGGCA	0.532																																																0			2											53.0	53.0	53.0					2																	26534549		2203	4300	6503	26388053	SO:0001583	missense	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2047G>A	2.37:g.26534549C>T	ENSP00000307831:p.Gly683Ser		26388053	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.G484S	ENST00000311519.1	37	c.1450	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902871	0.52227	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.28069	1.67;1.63;1.69;1.63	5.84	4.96	0.65561	.	.	.	.	.	T	0.40171	0.1106	L	0.50333	1.59	0.30020	N	0.814453	P;P;P;P	0.46578	0.88;0.854;0.754;0.743	P;P;P;P	0.53809	0.735;0.54;0.669;0.591	T	0.14035	-1.0487	9	0.26408	T	0.33	-10.7596	11.9707	0.53062	0.0:0.9175:0.0:0.0825	.	614;484;683;286	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	S	286;484;614;683	ENSP00000445729:G286S;ENSP00000327396:G484S;ENSP00000388537:G614S;ENSP00000307831:G683S	ENSP00000307831:G683S	G	-	1	0	GPR113	26388053	0.006000	0.16342	0.224000	0.23877	0.901000	0.52897	1.904000	0.39868	2.758000	0.94735	0.655000	0.94253	GGC	-	NULL		0.532	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	protein_coding	OTTHUMT00000316892.1	C	NM_153835		26388053	-1	no_errors	NM_153835	genbank	human	validated	54_36p	missense	SNP	0.002	T
MAP3K6	9064	genome.wustl.edu	37	1	27684720	27684720	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:27684720G>C	ENST00000493901.1	-	22	3106	c.2867C>G	c.(2866-2868)cCc>cGc	p.P956R	MAP3K6_ENST00000357582.2_Missense_Mutation_p.P956R|MAP3K6_ENST00000374040.3_Missense_Mutation_p.P948R	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	956					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGGGGCTGGGTGGGTGCTG	0.617											OREG0013282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											78.0	87.0	84.0					1																	27684720		2203	4300	6503	27557307	SO:0001583	missense	9064			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2867C>G	1.37:g.27684720G>C	ENSP00000419591:p.Pro956Arg	796	27557307	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,superfamily_Protein kinase-like (PK-like),PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SAM/Pointed domain	p.P956R	ENST00000493901.1	37	c.2867	CCDS299.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.612|9.612	1.131559|1.131559	0.21041|0.21041	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000472410|ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	T|T;T;T	0.23348|0.23950	1.91|1.88;1.88;1.88	4.82|4.82	3.9|3.9	0.45041|0.45041	.|.	.|.	.|.	.|.	.|.	T|T	0.15782|0.15782	0.0380|0.0380	N|N	0.24115|0.24115	0.695|0.695	0.31420|0.31420	N|N	0.674364|0.674364	.|B;B	.|0.31859	.|0.343;0.232	.|B;B	.|0.33254	.|0.16;0.077	T|T	0.15954|0.15954	-1.0419|-1.0419	7|9	0.06625|0.13470	T|T	0.88|0.59	.|.	8.8902|8.8902	0.35429|0.35429	0.1012:0.0:0.8988:0.0|0.1012:0.0:0.8988:0.0	.|.	.|948;956	.|O95382-3;O95382	.|.;M3K6_HUMAN	A|R	680|948;956;679;956	ENSP00000418731:P680A|ENSP00000363152:P948R;ENSP00000419591:P956R;ENSP00000350195:P956R	ENSP00000418731:P680A|ENSP00000350195:P956R	P|P	-|-	1|2	0|0	MAP3K6|MAP3K6	27557307|27557307	0.988000|0.988000	0.35896|0.35896	0.958000|0.958000	0.39756|0.39756	0.881000|0.881000	0.50899|0.50899	0.739000|0.739000	0.26173|0.26173	1.271000|1.271000	0.44313|0.44313	0.650000|0.650000	0.86243|0.86243	CCA|CCC	-	NULL		0.617	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	protein_coding	OTTHUMT00000013469.2	G	NM_004672		27557307	-1	no_errors	NM_004672	genbank	human	reviewed	54_36p	missense	SNP	0.013	C
RP11-143J24.1	0	genome.wustl.edu	37	15	30336960	30336960	+	lincRNA	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:30336960G>T	ENST00000561392.1	-	0	138																											TGCATCTATGGCGAGGGCTAC	0.637																																																0			15																																								28124252			0																															15.37:g.30336960G>T			28124252		Missense_Mutation	SNP	HMMPfam_MARVEL	p.G71V	ENST00000561392.1	37	c.212		15																																																																																			-	HMMPfam_MARVEL		0.637	RP11-143J24.1-001	KNOWN	basic	lincRNA	LOC390557	lincRNA	OTTHUMT00000417288.1	G			28124252	+1	no_errors	XM_001726973	genbank	human	model	54_36p	missense	SNP	0.994	T
OR2J3	442186	genome.wustl.edu	37	6	29080427	29080427	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr6:29080427T>A	ENST00000377169.1	+	1	760	c.760T>A	c.(760-762)Ttt>Att	p.F254I		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TGTATCTCTCTTTTTCATTCC	0.458																																																0			6											113.0	114.0	114.0					6																	29080427		1253	2567	3820	29188406	SO:0001583	missense	442186				CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.760T>A	6.37:g.29080427T>A	ENSP00000366374:p.Phe254Ile		29188406	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.F254I	ENST00000377169.1	37	c.760	CCDS43433.1	6	.	.	.	.	.	.	.	.	.	.	T	14.29	2.490321	0.44249	.	.	ENSG00000204701	ENST00000377169	T	0.00289	8.28	2.46	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00468	0.0015	H	0.94345	3.525	0.40878	D	0.983971	D	0.89917	1.0	D	0.79108	0.992	T	0.53718	-0.8399	9	0.87932	D	0	.	10.2503	0.43364	0.0:0.0:0.0:1.0	.	254	O76001	OR2J3_HUMAN	I	254	ENSP00000366374:F254I	ENSP00000366374:F254I	F	+	1	0	OR2J3	29188406	0.548000	0.26473	0.983000	0.44433	0.212000	0.24457	5.678000	0.68153	1.121000	0.41925	0.358000	0.22013	TTT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.458	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J3	protein_coding	OTTHUMT00000076132.2	T			29188406	+1	no_errors	NM_001005216	genbank	human	validated	54_36p	missense	SNP	0.502	A
GDF5	8200	genome.wustl.edu	37	20	34022100	34022100	+	Silent	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr20:34022100C>T	ENST00000374372.1	-	4	1616	c.1113G>A	c.(1111-1113)gaG>gaA	p.E371E	GDF5OS_ENST00000374375.1_Silent_p.Y48Y|GDF5_ENST00000374369.3_Silent_p.E371E			P43026	GDF5_HUMAN	growth differentiation factor 5	371					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			TGAACAGGTACTCATACACGG	0.592																																																0			20											95.0	97.0	97.0					20																	34022100		2203	4300	6503	33485514	SO:0001819	synonymous_variant	8200			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1113G>A	20.37:g.34022100C>T			33485514	E1P5Q2|Q96SB1	Silent	SNP	HMMPfam_TGFb_propeptide,superfamily_SSF57501,HMMPfam_TGF_beta,HMMSmart_TGFB,PatternScan_TGF_BETA_1	p.E371	ENST00000374372.1	37	c.1113	CCDS13254.1	20																																																																																			-	NULL		0.592	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF5	protein_coding	OTTHUMT00000078875.2	C			33485514	-1	no_errors	NM_000557	genbank	human	reviewed	54_36p	silent	SNP	0.990	T
NRP1	8829	genome.wustl.edu	37	10	33483674	33483674	+	Intron	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:33483674G>C	ENST00000265371.4	-	14	2450				NRP1_ENST00000395995.1_Intron|NRP1_ENST00000374875.1_Intron|NRP1_ENST00000374867.2_Intron			O14786	NRP1_HUMAN	neuropilin 1						angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GAGGGTTATGGAGTGAGAGGT	0.383																																					Melanoma(104;886 1489 44640 45944 51153)											0			10											27.0	26.0	26.0					10																	33483674		876	1991	2867	33523680	SO:0001627	intron_variant	8829			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1925-2328C>G	10.37:g.33483674G>C			33523680	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Silent	SNP	NULL	p.L76	ENST00000265371.4	37	c.228	CCDS7177.1	10	.	.	.	.	.	.	.	.	.	.	G	3.108	-0.183310	0.06340	.	.	ENSG00000099250	ENST00000418675	.	.	.	4.66	0.482	0.16815	.	.	.	.	.	T	0.20740	0.0499	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22034	-1.0228	4	.	.	.	.	1.5514	0.02575	0.1897:0.1661:0.4731:0.1711	.	.	.	.	C	67	.	.	S	-	2	0	NRP1	33523680	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	0.103000	0.15292	-0.003000	0.14444	0.655000	0.94253	TCC	-	NULL		0.383	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	protein_coding	OTTHUMT00000051203.2	G			33523680	-1	no_errors	ENST00000374828	ensembl	human	known	54_36p	silent	SNP	0.001	C
ZBTB5	9925	genome.wustl.edu	37	9	37442075	37442075	+	Silent	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr9:37442075G>C	ENST00000307750.4	-	2	662	c.474C>G	c.(472-474)ctC>ctG	p.L158L		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		GGCTGGAATTGAGGGCTGAGC	0.607																																																0			9											52.0	53.0	53.0					9																	37442075		2203	4300	6503	37432075	SO:0001819	synonymous_variant	9925			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.474C>G	9.37:g.37442075G>C			37432075		Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.L158	ENST00000307750.4	37	c.474	CCDS6610.1	9																																																																																			-	NULL		0.607	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	protein_coding	OTTHUMT00000052462.1	G	NM_014872		37432075	-1	no_errors	NM_014872	genbank	human	validated	54_36p	silent	SNP	0.970	C
BRCA1	672	genome.wustl.edu	37	17	41245150	41245150	+	Nonsense_Mutation	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:41245150T>A	ENST00000357654.3	-	10	2516	c.2398A>T	c.(2398-2400)Aaa>Taa	p.K800*	BRCA1_ENST00000354071.3_Nonsense_Mutation_p.K800*|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Nonsense_Mutation_p.K753*|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000309486.4_Nonsense_Mutation_p.K504*|BRCA1_ENST00000471181.2_Nonsense_Mutation_p.K800*|BRCA1_ENST00000346315.3_Nonsense_Mutation_p.K800*|BRCA1_ENST00000491747.2_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	800					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTCACACATTTATTTGGTTCT	0.393			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			17											268.0	260.0	263.0					17																	41245150		2203	4300	6503	38498676	SO:0001587	stop_gained	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2398A>T	17.37:g.41245150T>A	ENSP00000350283:p.Lys800*		38498676	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_BRCT,HMMSmart_SM00292,superfamily_BRCT domain	p.K800*	ENST00000357654.3	37	c.2398	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	T	19.19	3.779737	0.70107	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	.	.	.	5.36	0.656	0.17844	.	1.180480	0.06175	N	0.678377	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	8.4604	0.32925	0.0:0.2487:0.3502:0.4011	.	.	.	.	X	800;800;800;800;504;800;753	.	ENSP00000310938:K504X	K	-	1	0	BRCA1	38498676	0.000000	0.05858	0.003000	0.11579	0.035000	0.12851	0.229000	0.17833	0.315000	0.23110	0.459000	0.35465	AAA	-	NULL		0.393	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	T	NM_007294		38498676	-1	no_errors	NM_007294	genbank	human	reviewed	54_36p	nonsense	SNP	0.001	A
SLFNL1	200172	genome.wustl.edu	37	1	41486079	41486079	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:41486079A>C	ENST00000359345.1	-	1	2830	c.254T>G	c.(253-255)gTg>gGg	p.V85G	SLFNL1_ENST00000397197.2_Missense_Mutation_p.V85G|SLFNL1_ENST00000439569.2_Missense_Mutation_p.V85G|SLFNL1_ENST00000372611.1_Missense_Mutation_p.V85G|SLFNL1_ENST00000372613.2_Missense_Mutation_p.V85G|SLFNL1_ENST00000302946.8_Missense_Mutation_p.V85G	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	85							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				CCGCCTCACCACTTCAATGTG	0.682																																																0			1											50.0	55.0	53.0					1																	41486079		2203	4299	6502	41258666	SO:0001583	missense	200172			BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.254T>G	1.37:g.41486079A>C	ENSP00000352299:p.Val85Gly		41258666	A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	HMMPfam_AAA_4	p.V85G	ENST00000359345.1	37	c.254	CCDS460.1	1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.210574	0.79240	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	5.8	5.8	0.92144	.	0.000000	0.53938	D	0.000047	T	0.71685	0.3369	L	0.59436	1.845	0.58432	D	0.999997	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	T	0.74469	-0.3655	10	0.87932	D	0	-30.3341	12.533	0.56126	1.0:0.0:0.0:0.0	.	85;85;85	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	G	85	ENSP00000304401:V85G;ENSP00000361696:V85G;ENSP00000361694:V85G;ENSP00000352299:V85G;ENSP00000398938:V85G;ENSP00000380381:V85G	ENSP00000304401:V85G	V	-	2	0	SLFNL1	41258666	1.000000	0.71417	0.988000	0.46212	0.880000	0.50808	4.953000	0.63624	2.211000	0.71520	0.459000	0.35465	GTG	-	NULL		0.682	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFNL1	protein_coding	OTTHUMT00000015650.1	A	NM_144990		41258666	-1	no_errors	NM_144990	genbank	human	provisional	54_36p	missense	SNP	0.986	C
OXER1	165140	genome.wustl.edu	37	2	42991162	42991162	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:42991162G>T	ENST00000378661.2	-	1	239	c.158C>A	c.(157-159)tCc>tAc	p.S53Y		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	53	Ser-rich.				G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						aacagaggaggagagagaggg	0.612																																																0			2											61.0	51.0	54.0					2																	42991162		2203	4300	6503	42844666	SO:0001583	missense	165140			AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.158C>A	2.37:g.42991162G>T	ENSP00000367930:p.Ser53Tyr		42844666	Q86WP7|Q8NGW4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S53Y	ENST00000378661.2	37	c.158	CCDS1810.1	2	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151588	0.38021	.	.	ENSG00000162881	ENST00000378661	T	0.61274	0.12	2.24	1.28	0.21552	.	.	.	.	.	T	0.30324	0.0761	N	0.08118	0	0.09310	N	1	P	0.34699	0.464	B	0.22152	0.038	T	0.12268	-1.0554	9	0.66056	D	0.02	.	7.0598	0.25119	0.0:0.2851:0.7148:0.0	.	53	Q8TDS5	OXER1_HUMAN	Y	53	ENSP00000367930:S53Y	ENSP00000367930:S53Y	S	-	2	0	OXER1	42844666	0.954000	0.32549	0.001000	0.08648	0.009000	0.06853	2.208000	0.42797	0.217000	0.20800	0.305000	0.20034	TCC	-	NULL		0.612	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXER1	protein_coding	OTTHUMT00000250514.1	G	NM_148962		42844666	-1	no_errors	NM_148962	genbank	human	validated	54_36p	missense	SNP	0.166	T
DYNC2LI1	51626	genome.wustl.edu	37	2	44023072	44023072	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:44023072T>A	ENST00000260605.8	+	7	651	c.551T>A	c.(550-552)aTt>aAt	p.I184N	DYNC2LI1_ENST00000443170.3_Missense_Mutation_p.I58N|DYNC2LI1_ENST00000605786.1_Missense_Mutation_p.I185N|DYNC2LI1_ENST00000489222.2_3'UTR	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	184					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGGTCATAATTGGAAGTAAA	0.358																																																0			2											130.0	128.0	129.0					2																	44023072		2203	4300	6503	43876576	SO:0001583	missense	51626				CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.551T>A	2.37:g.44023072T>A	ENSP00000260605:p.Ile184Asn		43876576	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I184N	ENST00000260605.8	37	c.551	CCDS1813.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.8|20.8	4.048247|4.048247	0.75846|0.75846	.|.	.|.	ENSG00000138036|ENSG00000138036	ENST00000260605;ENST00000443170|ENST00000378587	T;T|.	0.35236|.	1.32;1.32|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.199811|.	0.53938|.	D|.	0.000060|.	T|T	0.64853|0.64853	0.2636|0.2636	M|M	0.66939|0.66939	2.045|2.045	0.50813|0.50813	D|D	0.999899|0.999899	D;D;D|.	0.65815|.	0.995;0.992;0.987|.	D;P;D|.	0.67900|.	0.954;0.901;0.922|.	T|T	0.64905|0.64905	-0.6297|-0.6297	10|5	0.87932|.	D|.	0|.	-20.301|-20.301	9.7383|9.7383	0.40401|0.40401	0.0:0.0768:0.0:0.9232|0.0:0.0768:0.0:0.9232	.|.	185;184;184|.	Q8TCX1-2;Q8TCX1;Q8TCX1-3|.	.;DC2L1_HUMAN;.|.	N|M	184;58|168	ENSP00000260605:I184N;ENSP00000388941:I58N|.	ENSP00000260605:I184N|.	I|L	+|+	2|1	0|2	DYNC2LI1|DYNC2LI1	43876576|43876576	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.106000|5.106000	0.64597|0.64597	2.197000|2.197000	0.70478|0.70478	0.482000|0.482000	0.46254|0.46254	ATT|TTG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.358	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYNC2LI1	protein_coding	OTTHUMT00000250536.2	T	NM_016008		43876576	+1	no_errors	NM_016008	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZSWIM3	140831	genome.wustl.edu	37	20	44507167	44507167	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr20:44507167A>T	ENST00000255152.2	+	2	2179	c.1970A>T	c.(1969-1971)cAg>cTg	p.Q657L	ZSWIM1_ENST00000372520.1_5'Flank|ZSWIM1_ENST00000372523.1_5'Flank|ZSWIM3_ENST00000454862.2_Missense_Mutation_p.Q651L	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	657							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				GGCCCCTCCCAGCCATCTGAG	0.592																																																0			20											100.0	107.0	105.0					20																	44507167		2203	4300	6503	43940574	SO:0001583	missense	140831			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1970A>T	20.37:g.44507167A>T	ENSP00000255152:p.Gln657Leu		43940574	Q9BR13	Missense_Mutation	SNP	HMMPfam_MULE,HMMPfam_SWIM,HMMSmart_ZnF_PMZ	p.Q657L	ENST00000255152.2	37	c.1970	CCDS13381.1	20	.	.	.	.	.	.	.	.	.	.	A	9.721	1.159559	0.21454	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.24151	1.89;1.87	5.03	5.03	0.67393	.	0.096349	0.43110	D	0.000606	T	0.19967	0.0480	L	0.27053	0.805	0.30899	N	0.729431	B;B	0.33694	0.421;0.421	B;B	0.32864	0.154;0.107	T	0.17930	-1.0353	10	0.66056	D	0.02	-16.7698	13.8768	0.63657	1.0:0.0:0.0:0.0	.	651;657	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	L	657;651	ENSP00000255152:Q657L;ENSP00000406313:Q651L	ENSP00000255152:Q657L	Q	+	2	0	ZSWIM3	43940574	0.997000	0.39634	0.358000	0.25811	0.137000	0.21094	5.046000	0.64226	2.126000	0.65437	0.459000	0.35465	CAG	-	NULL		0.592	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM3	protein_coding	OTTHUMT00000079540.1	A	NM_080752		43940574	+1	no_errors	NM_080752	genbank	human	validated	54_36p	missense	SNP	0.269	T
LUC7L3	51747	genome.wustl.edu	37	17	48822088	48822088	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:48822088G>C	ENST00000505658.1	+	7	796	c.607G>C	c.(607-609)Gat>Cat	p.D203H	LUC7L3_ENST00000240304.1_Missense_Mutation_p.D203H|LUC7L3_ENST00000544170.1_Missense_Mutation_p.D127H|LUC7L3_ENST00000393227.2_Missense_Mutation_p.D203H			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	203					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						AATAGTAGGAGATGCCCAGTC	0.343																																																0			17											98.0	100.0	99.0					17																	48822088		2203	4300	6503	46177087	SO:0001583	missense	51747				CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.607G>C	17.37:g.48822088G>C	ENSP00000425092:p.Asp203His		46177087	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	HMMPfam_LUC7	p.D203H	ENST00000505658.1	37	c.607	CCDS11573.1	17	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501436	0.85176	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000542316;ENST00000544170	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.59	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.64560	0.2609	M	0.92970	3.365	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;P;D	0.97110	1.0;0.889;0.934	T	0.74951	-0.3489	10	0.87932	D	0	-16.093	14.583	0.68305	0.0701:0.0:0.9299:0.0	.	127;203;203	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	H	203;203;203;203;127	ENSP00000425092:D203H;ENSP00000376919:D203H;ENSP00000240304:D203H;ENSP00000444253:D127H	ENSP00000240304:D203H	D	+	1	0	LUC7L3	46177087	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.765000	0.98953	1.380000	0.46344	0.563000	0.77884	GAT	-	HMMPfam_LUC7		0.343	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROP	protein_coding	OTTHUMT00000368205.2	G	NM_016424		46177087	+1	no_errors	NM_006107	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MAST2	23139	genome.wustl.edu	37	1	46501659	46501659	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:46501659G>A	ENST00000361297.2	+	29	5601	c.5318G>A	c.(5317-5319)aGg>aAg	p.R1773K	MAST2_ENST00000372009.2_Missense_Mutation_p.R1583K	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CCCAGCCTCAGGAGGGGCCAA	0.557																																																0			1											82.0	85.0	84.0					1																	46501659		1932	4117	6049	46274246	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.5318G>A	1.37:g.46501659G>A	ENSP00000354671:p.Arg1773Lys		46274246		Missense_Mutation	SNP	HMMPfam_DUF1908,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMPfam_Pkinase_C,superfamily_PDZ domain-like,HMMSmart_SM00228,HMMPfam_PDZ	p.R1773K	ENST00000361297.2	37	c.5318	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.672563	0.00758	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.61510	0.12;0.1	5.38	-3.03	0.05429	.	1.252600	0.05565	N	0.570033	T	0.29158	0.0725	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.24764	-1.0151	10	0.02654	T	1	1.3783	2.8435	0.05536	0.1996:0.2365:0.4447:0.1192	.	1583;1773	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	K	1773;1583	ENSP00000354671:R1773K;ENSP00000361079:R1583K	ENSP00000354671:R1773K	R	+	2	0	MAST2	46274246	0.033000	0.19621	0.001000	0.08648	0.201000	0.24016	0.058000	0.14301	-0.111000	0.12001	0.655000	0.94253	AGG	-	NULL		0.557	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	protein_coding	OTTHUMT00000021977.1	G	NM_015112		46274246	+1	no_errors	NM_015112	genbank	human	validated	54_36p	missense	SNP	0.000	A
DMRTC2	63946	genome.wustl.edu	37	19	42354724	42354724	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr19:42354724C>A	ENST00000269945.3	+	8	998	c.947C>A	c.(946-948)cCc>cAc	p.P316H	DMRTC2_ENST00000596827.1_Missense_Mutation_p.P367H	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	316	Pro-rich.				male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						TCTGTGCCCCCCAACCCTGCC	0.602																																																0			19											48.0	46.0	47.0					19																	42354724		2203	4300	6503	47046564	SO:0001583	missense	63946			AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.947C>A	19.37:g.42354724C>A	ENSP00000269945:p.Pro316His		47046564	Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	superfamily_Cysteine-rich DNA binding domain (DM domain),HMMPfam_DM,HMMSmart_SM00301,PatternScan_DM_1	p.P316H	ENST00000269945.3	37	c.947	CCDS33034.1	19	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290735	0.40494	.	.	ENSG00000142025	ENST00000269945	T	0.37058	1.22	4.73	3.69	0.42338	.	0.808768	0.10432	N	0.675382	T	0.42720	0.1215	L	0.44542	1.39	0.21105	N	0.99978	D;D	0.63880	0.993;0.97	P;P	0.53185	0.72;0.541	T	0.22452	-1.0216	10	0.87932	D	0	-5.1606	9.5166	0.39109	0.0:0.8986:0.0:0.1014	.	367;316	B4DX56;Q8IXT2	.;DMRTD_HUMAN	H	316	ENSP00000269945:P316H	ENSP00000269945:P316H	P	+	2	0	DMRTC2	47046564	0.020000	0.18652	0.162000	0.22713	0.482000	0.33219	3.664000	0.54525	1.318000	0.45170	0.585000	0.79938	CCC	-	NULL		0.602	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC2	protein_coding	OTTHUMT00000463045.1	C	NM_001040283		47046564	+1	no_errors	NM_001040283	genbank	human	validated	54_36p	missense	SNP	0.971	A
PSG3	5671	genome.wustl.edu	37	19	43244487	43244487	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr19:43244487C>T	ENST00000327495.5	-	1	234	c.50G>A	c.(49-51)gGg>gAg	p.G17E	PSG3_ENST00000595140.1_Missense_Mutation_p.G17E|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	17					defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GAGCAGGAGCCCCTTCCAGGT	0.612																																																0			19											118.0	137.0	130.0					19																	43244487		1511	2707	4218	47936327	SO:0001583	missense	5671				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.50G>A	19.37:g.43244487C>T	ENSP00000332215:p.Gly17Glu		47936327	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2	p.G17E	ENST00000327495.5	37	c.50	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	N	9.138	1.013021	0.19277	.	.	ENSG00000221826	ENST00000327495	T	0.20738	2.05	1.21	0.0791	0.14414	.	.	.	.	.	T	0.29652	0.0740	L	0.61218	1.895	0.09310	N	1	D	0.56035	0.974	P	0.57911	0.829	T	0.14200	-1.0481	9	0.31617	T	0.26	.	3.6282	0.08121	0.0:0.7274:0.0:0.2726	.	17	Q16557	PSG3_HUMAN	E	17	ENSP00000332215:G17E	ENSP00000332215:G17E	G	-	2	0	PSG3	47936327	0.000000	0.05858	0.002000	0.10522	0.097000	0.18754	-0.157000	0.10085	0.096000	0.17463	0.121000	0.15741	GGG	-	HMMPfam_V-set		0.612	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	protein_coding	OTTHUMT00000321423.2	C	NM_021016		47936327	-1	no_errors	NM_021016	genbank	human	validated	54_36p	missense	SNP	0.025	T
FOXP3	50943	genome.wustl.edu	37	X	49110497	49110497	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chrX:49110497A>G	ENST00000376207.4	-	9	1035	c.848T>C	c.(847-849)gTa>gCa	p.V283A	FOXP3_ENST00000376199.2_Missense_Mutation_p.V248A|FOXP3_ENST00000376197.1_Missense_Mutation_p.V233A|FOXP3_ENST00000455775.2_Missense_Mutation_p.V256A|FOXP3_ENST00000557224.1_Missense_Mutation_p.V248A|FOXP3_ENST00000518685.1_Missense_Mutation_p.V248A	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	283					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					GCCAGCAGCTACGATGCAGCA	0.597																																					GBM(182;1432 2112 16160 23073 31774)											0			X											20.0	17.0	18.0					X																	49110497		2203	4297	6500	48997441	SO:0001583	missense	50943				CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.848T>C	X.37:g.49110497A>G	ENSP00000365380:p.Val283Ala		48997441	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Missense_Mutation	SNP	"PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.V283A	ENST00000376207.4	37	c.848	CCDS14323.1	X	.	.	.	.	.	.	.	.	.	.	A	13.84	2.357001	0.41801	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	D;D;D;D;D;D	0.97888	-3.64;-3.6;-4.59;-3.6;-4.55;-3.95	5.46	3.11	0.35812	.	0.694589	0.12751	N	0.442200	D	0.93635	0.7967	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.09022	0.0;0.0;0.002;0.0;0.0	B;B;B;B;B	0.12156	0.0;0.001;0.007;0.0;0.001	D	0.84926	0.0857	10	0.21014	T	0.42	.	4.5357	0.12028	0.6726:0.0:0.3274:0.0	.	256;306;248;283;248	B9UN80;B7ZLG1;Q9BZS1-3;Q9BZS1;Q9BZS1-2	.;.;.;FOXP3_HUMAN;.	A	283;248;248;248;233;256	ENSP00000365380:V283A;ENSP00000365372:V248A;ENSP00000451208:V248A;ENSP00000428952:V248A;ENSP00000365369:V233A;ENSP00000396415:V256A	ENSP00000365369:V233A	V	-	2	0	FOXP3	48997441	0.056000	0.20664	0.064000	0.19789	0.300000	0.27592	0.397000	0.20883	0.732000	0.32470	0.347000	0.21830	GTA	-	NULL		0.597	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXP3	protein_coding	OTTHUMT00000060814.1	A	NM_014009		48997441	-1	no_errors	NM_014009	genbank	human	reviewed	54_36p	missense	SNP	0.002	G
ATF7	11016	genome.wustl.edu	37	12	53925559	53925559	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr12:53925559T>G	ENST00000548446.2	-	9	1041	c.929A>C	c.(928-930)cAc>cCc	p.H310P	ATF7_ENST00000456903.4_Missense_Mutation_p.H299P|ATF7_ENST00000420353.2_Missense_Mutation_p.H299P|ATF7_ENST00000328463.7_Missense_Mutation_p.H310P|RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.H299P|ATF7_ENST00000415113.1_Missense_Mutation_p.H278P			P17544	ATF7_HUMAN	activating transcription factor 7	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GGCATCAGGGTGCTGGATGAG	0.507																																																0			12											56.0	63.0	61.0					12																	53925559		2017	4179	6196	52211826	SO:0001583	missense	11016			X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.929A>C	12.37:g.53925559T>G	ENSP00000449938:p.His310Pro		52211826	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,PatternScan_ATPASE_ALPHA_BETA,HMMPfam_bZIP_1,HMMSmart_BRLZ,PatternScan_BZIP_BASIC	p.H299P	ENST00000548446.2	37	c.896		12	.	.	.	.	.	.	.	.	.	.	T	14.69	2.611541	0.46631	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.50277	0.75;0.75;0.8;0.75;0.75	5.38	5.38	0.77491	.	0.049773	0.85682	D	0.000000	T	0.35422	0.0931	N	0.22421	0.69	0.58432	D	0.999991	B;B;B	0.33073	0.0;0.396;0.0	B;B;B	0.31614	0.0;0.133;0.0	T	0.25813	-1.0121	10	0.49607	T	0.09	-23.2099	14.684	0.69037	0.0:0.0:0.0:1.0	.	278;299;310	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	P	310;310;278;299;299	ENSP00000449938:H310P;ENSP00000329212:H310P;ENSP00000404880:H278P;ENSP00000399465:H299P;ENSP00000387406:H299P	ENSP00000329212:H310P	H	-	2	0	ATF7	52211826	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.839000	0.69395	2.189000	0.69895	0.402000	0.26972	CAC	-	NULL		0.507	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	ATF7	protein_coding	OTTHUMT00000406302.2	T	NM_001130059		52211826	-1	no_errors	NM_006856	genbank	human	validated	54_36p	missense	SNP	1.000	G
UNC13C	440279	genome.wustl.edu	37	15	54915995	54915995	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:54915995A>T	ENST00000260323.11	+	31	6202	c.6202A>T	c.(6202-6204)Att>Ttt	p.I2068F	UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000537900.1_Missense_Mutation_p.I2066F|UNC13C_ENST00000545554.1_Missense_Mutation_p.I2068F	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2068	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTTTTTAGTGATTGCTATTAA	0.353																																																0			15											59.0	55.0	57.0					15																	54915995		1828	4077	5905	52703287	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6202A>T	15.37:g.54915995A>T	ENSP00000260323:p.Ile2068Phe		52703287	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	superfamily_SSF57889,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.I2068F	ENST00000260323.11	37	c.6202	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	12.27	1.888316	0.33348	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.71461	-0.57;-0.57;-0.57	5.53	4.41	0.53225	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.368792	0.28057	N	0.016772	T	0.61689	0.2367	L	0.49350	1.555	0.41510	D	0.98833	B	0.27316	0.175	B	0.30029	0.11	T	0.64905	-0.6297	10	0.72032	D	0.01	.	5.056	0.14533	0.7573:0.0:0.2427:0.0	.	2068	Q8NB66	UN13C_HUMAN	F	2068;2068;2066	ENSP00000260323:I2068F;ENSP00000438156:I2068F;ENSP00000442569:I2066F	ENSP00000260323:I2068F	I	+	1	0	UNC13C	52703287	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	2.428000	0.44749	2.096000	0.63516	0.460000	0.39030	ATT	-	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2		0.353	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	A	NM_173166		52703287	+1	no_errors	NM_001080534	genbank	human	provisional	54_36p	missense	SNP	0.997	T
LRP8	7804	genome.wustl.edu	37	1	53716454	53716454	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:53716454C>G	ENST00000306052.6	-	17	2685	c.2584G>C	c.(2584-2586)Gac>Cac	p.D862H	LRP8_ENST00000347547.2_Missense_Mutation_p.D692H|LRP8_ENST00000371454.2_Missense_Mutation_p.D862H|LRP8_ENST00000465675.1_Missense_Mutation_p.D415H|LRP8_ENST00000354412.3_Missense_Mutation_p.D658H	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	862					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ACTGGGTTGTCAAAATTCATG	0.468																																																0			1											326.0	274.0	292.0					1																	53716454		2203	4300	6503	53489042	SO:0001583	missense	7804			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2584G>C	1.37:g.53716454C>G	ENSP00000303634:p.Asp862His		53489042	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00181,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b	p.D862H	ENST00000306052.6	37	c.2584	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.062222	0.93846	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.42	5.42	0.78866	.	.	.	.	.	T	0.66733	0.2819	M	0.85777	2.775	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.998;1.0;0.999	T	0.72286	-0.4338	9	0.87932	D	0	.	19.2098	0.93749	0.0:1.0:0.0:0.0	.	415;658;692;862;862;415	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	H	862;862;415;658;692	ENSP00000303634:D862H;ENSP00000360509:D862H;ENSP00000437009:D415H;ENSP00000346391:D658H;ENSP00000334522:D692H	ENSP00000303634:D862H	D	-	1	0	LRP8	53489042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.807000	0.86032	2.528000	0.85240	0.563000	0.77884	GAC	-	NULL		0.468	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	protein_coding	OTTHUMT00000024699.1	C	NM_004631		53489042	-1	no_errors	NM_004631	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OR4D1	26689	genome.wustl.edu	37	17	56233438	56233438	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:56233438C>G	ENST00000268912.5	+	1	945	c.924C>G	c.(922-924)tgC>tgG	p.C308W		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	308					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						TAGTAATTTGCAGGGAGTAAA	0.393																																																0			17											22.0	23.0	23.0					17																	56233438		2100	4186	6286	53588437	SO:0001583	missense	26689			X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.924C>G	17.37:g.56233438C>G	ENSP00000365451:p.Cys308Trp		53588437	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.C308W	ENST00000268912.5	37	c.924	CCDS42365.1	17	.	.	.	.	.	.	.	.	.	.	c	11.25	1.582762	0.28268	.	.	ENSG00000141194	ENST00000268912	T	0.37235	1.21	5.11	1.73	0.24493	.	0.634014	0.15681	N	0.249935	T	0.14227	0.0344	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.15435	-1.0437	10	0.38643	T	0.18	0.5848	0.2781	0.00241	0.2009:0.2888:0.1974:0.3128	.	308	Q15615	OR4D1_HUMAN	W	308	ENSP00000365451:C308W	ENSP00000365451:C308W	C	+	3	2	OR4D1	53588437	0.000000	0.05858	0.000000	0.03702	0.469000	0.32828	-1.935000	0.01550	0.195000	0.20347	0.543000	0.68304	TGC	-	superfamily_SSF81321		0.393	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D1	protein_coding	OTTHUMT00000443364.1	C			53588437	+1	no_errors	NM_012374	genbank	human	provisional	54_36p	missense	SNP	0.000	G
ZNF532	55205	genome.wustl.edu	37	18	56587591	56587591	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr18:56587591T>G	ENST00000336078.4	+	4	2848	c.2072T>G	c.(2071-2073)aTa>aGa	p.I691R	ZNF532_ENST00000591230.1_Missense_Mutation_p.I691R|ZNF532_ENST00000589288.1_Missense_Mutation_p.I691R|ZNF532_ENST00000591083.1_Missense_Mutation_p.I691R|ZNF532_ENST00000591808.1_Missense_Mutation_p.I691R	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	691					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GATCAAATGATAGTTTCTCCG	0.473																																																0			18											73.0	77.0	76.0					18																	56587591		2203	4300	6503	54738571	SO:0001583	missense	55205			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2072T>G	18.37:g.56587591T>G	ENSP00000338217:p.Ile691Arg		54738571	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.I691R	ENST00000336078.4	37	c.2072	CCDS11969.1	18	.	.	.	.	.	.	.	.	.	.	t	13.60	2.286288	0.40494	.	.	ENSG00000074657	ENST00000336078	T	0.32023	1.47	5.43	5.43	0.79202	.	0.085758	0.85682	D	0.000000	T	0.43787	0.1263	L	0.48642	1.525	0.80722	D	1	D	0.63046	0.992	P	0.60236	0.871	T	0.15037	-1.0451	10	0.25106	T	0.35	-15.9494	15.2409	0.73468	0.0:0.0:0.0:1.0	.	691	Q9HCE3	ZN532_HUMAN	R	691	ENSP00000338217:I691R	ENSP00000338217:I691R	I	+	2	0	ZNF532	54738571	1.000000	0.71417	0.944000	0.38274	0.954000	0.61252	4.108000	0.57817	2.080000	0.62538	0.445000	0.29226	ATA	-	NULL		0.473	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	protein_coding	OTTHUMT00000256130.1	T	NM_018181		54738571	+1	no_errors	NM_018181	genbank	human	validated	54_36p	missense	SNP	0.979	G
PCDH15	65217	genome.wustl.edu	37	10	55568458	55568458	+	Silent	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:55568458T>A	ENST00000395445.1	-	36	5746	c.5352A>T	c.(5350-5352)gcA>gcT	p.A1784A	PCDH15_ENST00000395446.1_Silent_p.A980A|PCDH15_ENST00000395442.1_Silent_p.A649A|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000395440.1_Silent_p.A718A	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTTTCAAAGTGCTGTGTTGT	0.483										HNSCC(58;0.16)																																						0			10											54.0	47.0	49.0					10																	55568458		1568	3582	5150	55238464	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5352A>T	10.37:g.55568458T>A			55238464	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_Cadherin,HMMPfam_Cadherin	p.A1784	ENST00000395445.1	37	c.5352		10																																																																																			-	NULL		0.483	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	protein_coding	OTTHUMT00000291335.1	T	NM_033056		55238464	-1	no_errors	ENST00000395445	ensembl	human	known	54_36p	silent	SNP	0.006	A
LRP1	4035	genome.wustl.edu	37	12	57578928	57578928	+	Nonsense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr12:57578928C>T	ENST00000243077.3	+	40	6869	c.6403C>T	c.(6403-6405)Cga>Tga	p.R2135*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2135					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGTGCCCCTGCGAACCGGCAT	0.612																																																0			12											76.0	75.0	75.0					12																	57578928		2203	4300	6503	55865195	SO:0001587	stop_gained	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.6403C>T	12.37:g.57578928C>T	ENSP00000243077:p.Arg2135*		55865195	Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_1	p.R2135*	ENST00000243077.3	37	c.6403	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	48	14.531223	0.99799	.	.	ENSG00000123384	ENST00000243077	.	.	.	5.31	0.989	0.19802	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	14.4716	0.67519	0.6827:0.3173:0.0:0.0	.	.	.	.	X	2135	.	ENSP00000243077:R2135X	R	+	1	2	LRP1	55865195	0.999000	0.42202	0.813000	0.32504	0.181000	0.23173	0.685000	0.25378	-0.101000	0.12219	0.491000	0.48974	CGA	-	superfamily_YWTD domain		0.612	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	C	NM_002332		55865195	+1	no_errors	NM_002332	genbank	human	validated	54_36p	nonsense	SNP	0.991	T
RPL12P38	645688	genome.wustl.edu	37	17	58512971	58512971	+	RNA	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:58512971C>T	ENST00000588627.1	-	0	386									ribosomal protein L12 pseudogene 38																		ACACAAATGACATATTTTCCA	0.512																																																0			17																																								55867753			645688					17q23.2	2013-01-23			ENSG00000213228	ENSG00000213228			36838	pseudogene	pseudogene						19123937	Standard	NG_010298		Approved				OTTHUMG00000157897		17.37:g.58512971C>T			55867753		RNA	SNP	-	NULL	ENST00000588627.1	37	NULL		17																																																																																			-	-		0.512	RPL12P38-002	KNOWN	basic	processed_transcript	LOC645688	pseudogene	OTTHUMT00000449464.1	C	NG_010298		55867753	-1	pseudogene	XR_017614	genbank	human	model	54_36p	rna	SNP	0.002	T
CDH7	1005	genome.wustl.edu	37	18	63511136	63511136	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr18:63511136C>T	ENST00000397968.2	+	7	1496	c.1070C>T	c.(1069-1071)cCg>cTg	p.P357L	CDH7_ENST00000536984.2_Missense_Mutation_p.P357L|CDH7_ENST00000323011.3_Missense_Mutation_p.P357L	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	357	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				AGCTTGGGTCCGTTCAGTGAC	0.478																																																0			18											148.0	129.0	136.0					18																	63511136		2203	4300	6503	61662116	SO:0001583	missense	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1070C>T	18.37:g.63511136C>T	ENSP00000381058:p.Pro357Leu		61662116	Q9H157	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.P357L	ENST00000397968.2	37	c.1070	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207273	0.58343	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.56941	0.43;0.43;0.43	4.67	4.67	0.58626	Cadherin (4);Cadherin-like (1);	0.063700	0.64402	D	0.000009	T	0.77545	0.4146	M	0.89095	3.005	0.80722	D	1	P;D	0.89917	0.487;1.0	B;D	0.91635	0.101;0.999	T	0.82313	-0.0519	10	0.66056	D	0.02	.	18.1055	0.89519	0.0:1.0:0.0:0.0	.	357;357	F5H5X9;Q9ULB5	.;CADH7_HUMAN	L	357	ENSP00000319166:P357L;ENSP00000443030:P357L;ENSP00000381058:P357L	ENSP00000319166:P357L	P	+	2	0	CDH7	61662116	1.000000	0.71417	0.952000	0.39060	0.073000	0.16967	7.275000	0.78548	2.554000	0.86153	0.655000	0.94253	CCG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.478	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	C	NM_033646		61662116	+1	no_errors	NM_004361	genbank	human	reviewed	54_36p	missense	SNP	0.981	T
SNX15	29907	genome.wustl.edu	37	11	64795066	64795066	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr11:64795066G>T	ENST00000377244.3	+	1	187	c.57G>T	c.(55-57)agG>agT	p.R19S	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.R19S	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	19	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CGGACCCCAGGACTCACCCCA	0.622											OREG0021069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(56;269 1304 3324 8253)											0			11											63.0	60.0	61.0					11																	64795066		2201	4297	6498	64551642	SO:0001583	missense	29907			AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.57G>T	11.37:g.64795066G>T	ENSP00000366452:p.Arg19Ser	1079	64551642	E5KQS6|Q9NRS5	Missense_Mutation	SNP	superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,HMMSmart_SM00745,HMMPfam_MIT	p.R19S	ENST00000377244.3	37	c.57	CCDS8089.1	11	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587147	0.66105	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.33	3.47	0.39725	Phox homologous domain (5);	0.125167	0.56097	D	0.000036	T	0.46718	0.1407	L	0.34521	1.04	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.979;1.0	D;P;D	0.87578	0.998;0.825;0.998	T	0.38757	-0.9646	10	0.42905	T	0.14	3.189	5.533	0.16995	0.1707:0.1645:0.6648:0.0	.	19;19;19	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	S	19	ENSP00000366452:R19S;ENSP00000437277:R19S;ENSP00000431690:R19S;ENSP00000316410:R19S	ENSP00000316410:R19S	R	+	3	2	SNX15	64551642	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.595000	0.24029	0.826000	0.34661	0.643000	0.83706	AGG	-	superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312		0.622	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX15	protein_coding	OTTHUMT00000091004.3	G			64551642	+1	no_errors	NM_013306	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
ZFYVE26	23503	genome.wustl.edu	37	14	68252891	68252891	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr14:68252891G>A	ENST00000347230.4	-	17	3217	c.3079C>T	c.(3079-3081)Ctt>Ttt	p.L1027F	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.L1027F	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1027					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ATTTGCTGAAGAACAACTGGA	0.403																																																0			14											103.0	100.0	101.0					14																	68252891		2203	4300	6503	67322644	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3079C>T	14.37:g.68252891G>A	ENSP00000251119:p.Leu1027Phe		67322644	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00064,HMMPfam_FYVE,superfamily_FYVE/PHD zinc finger	p.L1027F	ENST00000347230.4	37	c.3079	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966367	0.74131	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.50277	0.95;0.75	5.24	4.31	0.51392	.	0.073057	0.53938	D	0.000043	T	0.63768	0.2539	M	0.66939	2.045	0.47374	D	0.999404	D;D	0.63046	0.992;0.986	P;P	0.62298	0.9;0.797	T	0.68284	-0.5449	10	0.72032	D	0.01	-9.7448	15.1573	0.72752	0.0:0.0:0.8582:0.1418	.	1027;1027	G3V2D8;Q68DK2	.;ZFY26_HUMAN	F	1027;1006;1027	ENSP00000251119:L1027F;ENSP00000450603:L1027F	ENSP00000251119:L1027F	L	-	1	0	ZFYVE26	67322644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.003000	0.57061	2.424000	0.82194	0.655000	0.94253	CTT	-	NULL		0.403	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	protein_coding	OTTHUMT00000412736.2	G	NM_015346		67322644	-1	no_errors	NM_015346	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DNAJC12	56521	genome.wustl.edu	37	10	69583135	69583135	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:69583135C>G	ENST00000225171.2	-	2	246	c.94G>C	c.(94-96)Gca>Cca	p.A32P	RN7SL394P_ENST00000480997.2_RNA|DNAJC12_ENST00000483798.2_Missense_Mutation_p.A32P|DNAJC12_ENST00000339758.7_Missense_Mutation_p.A32P	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	32	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.									breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						TTAAATTCTGCCAGGATTTGT	0.413																																																0			10											104.0	107.0	106.0					10																	69583135		2203	4300	6503	69253141	SO:0001583	missense	56521			AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.94G>C	10.37:g.69583135C>G	ENSP00000225171:p.Ala32Pro		69253141	Q5JVQ1|Q9UKB2	Missense_Mutation	SNP	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ	p.A32P	ENST00000225171.2	37	c.94	CCDS7271.1	10	.	.	.	.	.	.	.	.	.	.	C	20.2	3.958368	0.74016	.	.	ENSG00000108176	ENST00000225171;ENST00000339758	T;T	0.31247	1.5;1.5	5.25	4.35	0.52113	Heat shock protein DnaJ, N-terminal (5);	0.251575	0.40818	N	0.001017	T	0.58466	0.2124	M	0.91196	3.185	0.58432	D	0.999997	P;D	0.58620	0.884;0.983	P;D	0.65233	0.749;0.933	T	0.64368	-0.6424	10	0.56958	D	0.05	-9.8744	9.6831	0.40082	0.0:0.9046:0.0:0.0954	.	32;32	Q9UKB3-2;Q9UKB3	.;DJC12_HUMAN	P	32	ENSP00000225171:A32P;ENSP00000343575:A32P	ENSP00000225171:A32P	A	-	1	0	DNAJC12	69253141	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.867000	0.27968	1.205000	0.43262	0.591000	0.81541	GCA	-	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ		0.413	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC12	protein_coding	OTTHUMT00000048291.1	C	NM_021800		69253141	-1	no_errors	NM_021800	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
SIRT1	23411	genome.wustl.edu	37	10	69647221	69647221	+	Silent	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:69647221C>T	ENST00000212015.6	+	2	530	c.477C>T	c.(475-477)tcC>tcT	p.S159S	SIRT1_ENST00000497639.1_3'UTR|SIRT1_ENST00000432464.1_5'UTR	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	159	Interaction with CCAR2.|Interaction with HIST1H1E.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						GTTTTCATTCCTGTGAAAGTG	0.423																																																0			10											155.0	145.0	149.0					10																	69647221		2203	4300	6503	69317227	SO:0001819	synonymous_variant	23411			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.477C>T	10.37:g.69647221C>T			69317227	Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Silent	SNP	superfamily_SSF52467,HMMPfam_SIR2	p.S159	ENST00000212015.6	37	c.477	CCDS7273.1	10																																																																																			-	NULL		0.423	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	protein_coding	OTTHUMT00000048296.1	C			69317227	+1	no_errors	NM_012238	genbank	human	validated	54_36p	silent	SNP	0.996	T
CLEC18B	497190	genome.wustl.edu	37	16	74452176	74452176	+	Silent	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr16:74452176G>A	ENST00000339953.5	-	3	358	c.237C>T	c.(235-237)gcC>gcT	p.A79A		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	79	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GAGCCAGTTGGGCCAGGCTGT	0.637																																																0			16											8.0	9.0	9.0					16																	74452176		1864	3953	5817	73009677	SO:0001819	synonymous_variant	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.237C>T	16.37:g.74452176G>A			73009677	B4DF90	Silent	SNP	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.A79	ENST00000339953.5	37	c.237	CCDS32484.1	16																																																																																			-	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP		0.637	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	protein_coding	OTTHUMT00000434697.1	G	NM_001011880		73009677	-1	no_errors	NM_001011880	genbank	human	validated	54_36p	silent	SNP	0.655	A
DNAH17	8632	genome.wustl.edu	37	17	76446421	76446421	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr17:76446421C>T	ENST00000585328.1	-	68	11064	c.10940G>A	c.(10939-10941)cGc>cAc	p.R3647H	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.R3638H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3638					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CGCAGCCGGGCGGTAGTTCTC	0.517																																																0			17											130.0	105.0	114.0					17																	76446421		2203	4300	6503	73958016	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10940G>A	17.37:g.76446421C>T	ENSP00000465516:p.Arg3647His		73958016	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin repeat,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,PatternScan_WD_REPEATS_1,HMMPfam_Dynein_heavy	p.R3647H	ENST00000585328.1	37	c.10940		17	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257399	0.59321	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.55052	0.54	4.76	3.78	0.43462	.	0.000000	0.56097	D	0.000026	T	0.82038	0.4950	H	0.98133	4.155	0.47153	D	0.999333	D	0.89917	1.0	D	0.83275	0.996	D	0.88422	0.3029	10	0.87932	D	0	.	14.3695	0.66830	0.1491:0.8509:0.0:0.0	.	3647	E7EUM8	.	H	3647;3638	ENSP00000374490:R3638H	ENSP00000300671:R3647H	R	-	2	0	DNAH17	73958016	1.000000	0.71417	0.795000	0.32087	0.046000	0.14306	5.881000	0.69706	0.986000	0.38683	0.555000	0.69702	CGC	-	NULL		0.517	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	C	NM_173628		73958016	-1	no_errors	ENST00000300671	ensembl	human	known	54_36p	missense	SNP	1.000	T
ANGEL1	23357	genome.wustl.edu	37	14	77256975	77256975	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr14:77256975A>G	ENST00000251089.2	-	9	1943	c.1831T>C	c.(1831-1833)Tgt>Cgt	p.C611R	ANGEL1_ENST00000557179.1_Missense_Mutation_p.C176R	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	611										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CCATTCTCACAGGACTCAGCT	0.527																																																0			14											128.0	109.0	115.0					14																	77256975		2203	4300	6503	76326728	SO:0001583	missense	23357			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1831T>C	14.37:g.77256975A>G	ENSP00000251089:p.Cys611Arg		76326728	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	HMMPfam_Exo_endo_phos,superfamily_Exo_endo_phos	p.C611R	ENST00000251089.2	37	c.1831	CCDS9852.1	14	.	.	.	.	.	.	.	.	.	.	A	1.884	-0.457099	0.04540	.	.	ENSG00000013523	ENST00000251089;ENST00000557179	T;T	0.79749	1.63;-1.3	5.76	5.76	0.90799	Endonuclease/exonuclease/phosphatase (2);	1.292320	0.04541	N	0.388193	T	0.61714	0.2369	N	0.03608	-0.345	0.25093	N	0.990847	B	0.02656	0.0	B	0.06405	0.002	T	0.54282	-0.8317	10	0.10377	T	0.69	-0.1375	8.2724	0.31853	0.7348:0.1352:0.0:0.1299	.	611	Q9UNK9	ANGE1_HUMAN	R	611;176	ENSP00000251089:C611R;ENSP00000451534:C176R	ENSP00000251089:C611R	C	-	1	0	ANGEL1	76326728	0.137000	0.22531	0.827000	0.32855	0.305000	0.27757	1.550000	0.36223	2.223000	0.72356	0.454000	0.30748	TGT	-	HMMPfam_Exo_endo_phos,superfamily_Exo_endo_phos		0.527	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	protein_coding	OTTHUMT00000413712.2	A	NM_015305		76326728	-1	no_errors	NM_015305	genbank	human	validated	54_36p	missense	SNP	0.587	G
ARNT2	9915	genome.wustl.edu	37	15	80767383	80767383	+	Silent	SNP	T	T	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:80767383T>C	ENST00000303329.4	+	5	606	c.441T>C	c.(439-441)gaT>gaC	p.D147D	ARNT2_ENST00000533983.1_Silent_p.D136D|ARNT2_ENST00000531595.3_3'UTR|ARNT2_ENST00000527771.1_Silent_p.D136D	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	147	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			AAGCAGCTGATGGATTTCTGT	0.463																																																0			15											273.0	273.0	273.0					15																	80767383		2203	4300	6503	78554438	SO:0001819	synonymous_variant	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.441T>C	15.37:g.80767383T>C			78554438	B4DIS7|O15024|Q8IYC2	Silent	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353,HMMSmart_SM00091,HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS_3,HMMSmart_SM00086	p.D147	ENST00000303329.4	37	c.441	CCDS32307.1	15																																																																																			-	superfamily_HLH helix-loop-helix DNA-binding domain,HMMSmart_SM00091,HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain)		0.463	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	protein_coding	OTTHUMT00000384389.2	T			78554438	+1	no_errors	NM_014862	genbank	human	reviewed	54_36p	silent	SNP	0.994	C
BNC1	646	genome.wustl.edu	37	15	83926639	83926639	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:83926639G>T	ENST00000345382.2	-	5	2625	c.2540C>A	c.(2539-2541)tCt>tAt	p.S847Y	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.S840Y	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	847					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CAAGGGGCCAGAGTTGTAGCT	0.542																																																0			15											120.0	98.0	105.0					15																	83926639		2203	4300	6503	81717643	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2540C>A	15.37:g.83926639G>T	ENSP00000307041:p.Ser847Tyr		81717643	Q15840	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.S847Y	ENST00000345382.2	37	c.2540	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.346373	0.01266	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.44881	0.91	5.94	4.0	0.46444	.	0.743058	0.13793	N	0.362388	T	0.21145	0.0509	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.05354	-1.0890	10	0.33940	T	0.23	-10.7682	10.2156	0.43166	0.0:0.117:0.6679:0.2151	.	840;847	F5GY04;Q01954	.;BNC1_HUMAN	Y	847;840	ENSP00000307041:S847Y	ENSP00000307041:S847Y	S	-	2	0	BNC1	81717643	0.119000	0.22226	0.032000	0.17829	0.072000	0.16883	1.392000	0.34486	2.816000	0.96949	0.563000	0.77884	TCT	-	NULL		0.542	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	protein_coding	OTTHUMT00000304006.1	G	NM_001717		81717643	-1	no_errors	NM_001717	genbank	human	reviewed	54_36p	missense	SNP	0.002	T
ALX1	8092	genome.wustl.edu	37	12	85677459	85677459	+	Silent	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr12:85677459G>A	ENST00000316824.3	+	2	491	c.336G>A	c.(334-336)gaG>gaA	p.E112E		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	112					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		GGATGCAAGAGAAGGGAGAGC	0.488																																																0			12											120.0	113.0	115.0					12																	85677459		2203	4300	6503	84201590	SO:0001819	synonymous_variant	8092			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.336G>A	12.37:g.85677459G>A			84201590	Q546C8|Q96FH4	Silent	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_OAR	p.E112	ENST00000316824.3	37	c.336	CCDS9028.1	12																																																																																			-	NULL		0.488	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX1	protein_coding	OTTHUMT00000406072.1	G	NM_006982		84201590	+1	no_errors	NM_006982	genbank	human	reviewed	54_36p	silent	SNP	0.950	A
PEX11A	8800	genome.wustl.edu	37	15	90229663	90229663	+	Splice_Site	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr15:90229663T>A	ENST00000300056.3	-	2	320	c.171A>T	c.(169-171)aaA>aaT	p.K57N	PEX11A_ENST00000561224.1_Splice_Site_p.K57N|PEX11A_ENST00000559170.1_Intron|PEX11A_ENST00000557982.1_Intron|PEX11A_ENST00000561257.1_Splice_Site_p.K57N	NM_001271573.1	NP_001258502.1	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha	57					brown fat cell differentiation (GO:0050873)|cellular lipid metabolic process (GO:0044255)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|lung(3)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			GGTACTTACATTTACGACCAG	0.433																																																0			15											146.0	128.0	134.0					15																	90229663		2200	4299	6499	88030667	SO:0001630	splice_region_variant	8800			AF093668	CCDS10354.1, CCDS61751.1	15q	2008-08-26	2008-08-26		ENSG00000166821	ENSG00000166821			8852	protein-coding gene	gene with protein product		603866	"""peroxisomal biogenesis factor 11A"""			9792670	Standard	NM_003847		Approved	PEX11-ALPHA, MGC119947, MGC138534	uc002boi.4	O75192	OTTHUMG00000149809	ENST00000300056.3:c.172+1A>T	15.37:g.90229663T>A			88030667	B4DV88	Missense_Mutation	SNP	HMMPfam_PEX11	p.K57N	ENST00000300056.3	37	c.171	CCDS10354.1	15	.	.	.	.	.	.	.	.	.	.	T	22.4	4.283365	0.80803	.	.	ENSG00000166821	ENST00000300056	T	0.61510	0.1	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.78704	0.4325	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81861	-0.0738	10	0.62326	D	0.03	-8.5082	15.3915	0.74747	0.0:0.0:0.0:1.0	.	57	O75192	PX11A_HUMAN	N	57	ENSP00000300056:K57N	ENSP00000300056:K57N	K	-	3	2	PEX11A	88030667	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.268000	0.43338	2.229000	0.72834	0.528000	0.53228	AAA	-	HMMPfam_PEX11		0.433	PEX11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11A	protein_coding	OTTHUMT00000313420.1	T	NM_003847	Missense_Mutation	88030667	-1	no_errors	NM_003847	genbank	human	provisional	54_36p	missense	SNP	1.000	A
WAPAL	23063	genome.wustl.edu	37	10	88277647	88277647	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:88277647C>G	ENST00000298767.5	-	2	652	c.180G>C	c.(178-180)aaG>aaC	p.K60N		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	60	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CTTTAGGTTTCTTCGGAATTT	0.403																																																0			10											79.0	78.0	78.0					10																	88277647		2203	4300	6503	88267627	SO:0001583	missense	23063			AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.180G>C	10.37:g.88277647C>G	ENSP00000298767:p.Lys60Asn		88267627	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_WAPL	p.K60N	ENST00000298767.5	37	c.180	CCDS7375.1	10	.	.	.	.	.	.	.	.	.	.	C	13.37	2.218001	0.39201	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.39406	1.08	5.56	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;1.0	D;D;D;D	0.91635	0.999;0.991;0.991;0.997	T	0.60520	-0.7247	10	0.72032	D	0.01	.	10.7602	0.46259	0.0:0.8404:0.0:0.1596	.	145;60;60;103	Q7Z5K2-3;B2RTX8;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	N	145;60;145	ENSP00000298767:K60N	ENSP00000298767:K60N	K	-	3	2	WAPAL	88267627	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.075000	0.30716	1.266000	0.44231	-0.355000	0.07637	AAG	-	NULL		0.403	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WAPAL	protein_coding	OTTHUMT00000049151.2	C	NM_015045		88267627	-1	no_errors	NM_015045	genbank	human	validated	54_36p	missense	SNP	1.000	G
HFM1	164045	genome.wustl.edu	37	1	91731665	91731665	+	Splice_Site	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:91731665C>T	ENST00000370425.3	-	36	3982		c.e36-1		HFM1_ENST00000462405.1_Intron|HFM1_ENST00000370424.3_Splice_Site|HFM1_ENST00000294696.5_Intron	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)						resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTTCCAAATCCTATGTGAAGA	0.373																																																0			1											132.0	117.0	122.0					1																	91731665		1840	4084	5924	91504253	SO:0001630	splice_region_variant	164045			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3884-1G>A	1.37:g.91731665C>T			91504253	B1B0B6|Q8N9Q0	Splice_Site	SNP	-	e35-1	ENST00000370425.3	37	c.3884-1	CCDS30769.2	1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778346	0.70107	.	.	ENSG00000162669	ENST00000370425;ENST00000370424;ENST00000430465	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5504	0.68061	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HFM1	91504253	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.140000	0.58031	2.581000	0.87130	0.655000	0.94253	.	-	-		0.373	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	protein_coding	OTTHUMT00000316716.2	C	NM_001017975	Intron	91504253	-1	no_errors	NM_001017975	genbank	human	validated	54_36p	splice_site	SNP	0.997	T
Unknown	0	genome.wustl.edu	37	X	92478436	92478436	+	IGR	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chrX:92478436C>T								PCDH11X (600207 upstream) : NAP1L3 (447492 downstream)																							AGAGAGGAGCCCAATAAGTAT	0.483																																																0			X																																								92365092	SO:0001628	intergenic_variant	401602																															X.37:g.92478436C>T			92365092		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.483					LOC401602			C			92365092	-1	pseudogene	XR_016272	genbank	human	model	54_36p	rna	SNP	1.000	T
DCT	1638	genome.wustl.edu	37	13	95121261	95121261	+	Missense_Mutation	SNP	C	C	A	rs144460082		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr13:95121261C>A	ENST00000377028.5	-	2	747	c.334G>T	c.(334-336)Ggc>Tgc	p.G112C	DCT_ENST00000446125.1_Missense_Mutation_p.G112C|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	112					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CCGGTCCAGCCAAACTTGCAG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		17967	0.0		0.001	False		,,,				2504	0.0															0			13						C	CYS/GLY,CYS/GLY	0,4406		0,0,2203	119.0	128.0	125.0		334,334	5.7	1.0	13	dbSNP_134	125	5,8595	5.0+/-18.6	0,5,4295	yes	missense,missense	DCT	NM_001129889.1,NM_001922.3	159,159	0,5,6498	AA,AC,CC		0.0581,0.0,0.0384	probably-damaging,probably-damaging	112/553,112/520	95121261	5,13001	2203	4300	6503	93919262	SO:0001583	missense	1638			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.334G>T	13.37:g.95121261C>A	ENSP00000366227:p.Gly112Cys		93919262	Q09GT4	Missense_Mutation	SNP	superfamily_Di-copper_centre,HMMPfam_Tyrosinase,PatternScan_TYROSINASE_1,PatternScan_TYROSINASE_2	p.G112C	ENST00000377028.5	37	c.334	CCDS9470.1	13	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	28.2	4.895898	0.91962	0.0	5.81E-4	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.92805	-3.11;-3.11	5.65	5.65	0.86999	Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.97536	0.9193	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.984	D	0.98276	1.0506	9	.	.	.	-25.1302	19.7272	0.96168	0.0:1.0:0.0:0.0	.	112;112	Q09GT4;P40126	.;TYRP2_HUMAN	C	112	ENSP00000366227:G112C;ENSP00000392762:G112C	.	G	-	1	0	DCT	93919262	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.459000	0.80802	2.646000	0.89796	0.655000	0.94253	GGC	-	superfamily_Di-copper_centre		0.483	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	protein_coding	OTTHUMT00000045461.3	C			93919262	-1	no_errors	NM_001922	genbank	human	validated	54_36p	missense	SNP	1.000	A
KDM4D	55693	genome.wustl.edu	37	11	94731666	94731666	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr11:94731666T>A	ENST00000335080.5	+	3	1962	c.1130T>A	c.(1129-1131)cTc>cAc	p.L377H	KDM4D_ENST00000536741.1_Missense_Mutation_p.L377H	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	377					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGAGACAACTCCCTTCCCAC	0.632																																																0			11											56.0	46.0	49.0					11																	94731666		2201	4298	6499	94371314	SO:0001583	missense	55693			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.1130T>A	11.37:g.94731666T>A	ENSP00000334181:p.Leu377His		94371314	B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	HMMPfam_JmjN,HMMSmart_JmjC,HMMPfam_JmjC	p.L377H	ENST00000335080.5	37	c.1130	CCDS8302.1	11	.	.	.	.	.	.	.	.	.	.	T	8.460	0.855095	0.17106	.	.	ENSG00000186280	ENST00000335080	T	0.31510	1.49	3.64	-5.2	0.02823	.	1.246770	0.06173	U	0.678134	T	0.14700	0.0355	L	0.29908	0.895	0.09310	N	1	B	0.18741	0.03	B	0.17098	0.017	T	0.28964	-1.0027	10	0.13108	T	0.6	-2.9886	0.3282	0.00314	0.2809:0.2676:0.1436:0.3079	.	377	Q6B0I6	KDM4D_HUMAN	H	377	ENSP00000334181:L377H	ENSP00000334181:L377H	L	+	2	0	KDM4D	94371314	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.411000	0.07142	-1.146000	0.02854	0.460000	0.39030	CTC	-	NULL		0.632	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD2D	protein_coding	OTTHUMT00000396558.2	T	NM_018039		94371314	+1	no_errors	NM_018039	genbank	human	validated	54_36p	missense	SNP	0.000	A
ANKRD20A8P	729171	genome.wustl.edu	37	2	95494796	95494796	+	RNA	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:95494796C>T	ENST00000432432.2	-	0	1148					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		GCTCCTTTCACAGCAGGATCT	0.343																																																0			2																																								94858523			729171					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95494796C>T			94858523	A6NC18	RNA	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			-	-		0.343	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20B	pseudogene	OTTHUMT00000451404.1	C			94858523	-1	pseudogene	NR_003366	genbank	human	validated	54_36p	rna	SNP	0.001	T
BDKRB1	623	genome.wustl.edu	37	14	96730551	96730551	+	Missense_Mutation	SNP	A	A	G	rs147649798		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr14:96730551A>G	ENST00000216629.6	+	3	1138	c.532A>G	c.(532-534)Atc>Gtc	p.I178V	RP11-404P21.3_ENST00000553638.1_RNA|BDKRB1_ENST00000553356.1_Missense_Mutation_p.I178V	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	178					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		GCTGCGATCCATCCAAGCCGT	0.607																																																0			14						A	VAL/ILE	0,4406		0,0,2203	68.0	65.0	66.0		532	-2.9	0.0	14	dbSNP_134	66	1,8599	1.2+/-3.3	0,1,4299	no	missense	BDKRB1	NM_000710.3	29	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	178/354	96730551	1,13005	2203	4300	6503	95800304	SO:0001583	missense	623			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.532A>G	14.37:g.96730551A>G	ENSP00000216629:p.Ile178Val		95800304	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.I178V	ENST00000216629.6	37	c.532	CCDS9943.1	14	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.216554	0.00286	0.0	1.16E-4	ENSG00000100739	ENST00000216629;ENST00000553356	T;T	0.71103	-0.54;-0.54	4.95	-2.92	0.05615	GPCR, rhodopsin-like superfamily (1);	0.359100	0.25060	N	0.033458	T	0.29355	0.0731	N	0.01352	-0.895	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.09377	0.004;0.001	T	0.39057	-0.9632	10	0.02654	T	1	-10.9442	7.1739	0.25734	0.2624:0.4662:0.2714:0.0	.	178;178	G3V4Y2;P46663	.;BKRB1_HUMAN	V	178	ENSP00000216629:I178V;ENSP00000452064:I178V	ENSP00000216629:I178V	I	+	1	0	BDKRB1	95800304	0.000000	0.05858	0.000000	0.03702	0.305000	0.27757	-0.143000	0.10296	-1.105000	0.03011	-1.498000	0.00962	ATC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.607	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB1	protein_coding	OTTHUMT00000413300.1	A			95800304	+1	no_errors	NM_000710	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
Unknown	0	genome.wustl.edu	37	10	97354829	97354829	+	IGR	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr10:97354829G>T								SORBS1 (33658 upstream) : ALDH18A1 (10866 downstream)																							CAACAGATCCGCCAAATCCAG	0.393																																																0			10																																								97344819	SO:0001628	intergenic_variant	643981																															10.37:g.97354829G>T			97344819		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.393					LOC643981			G			97344819	+1	pseudogene	XR_016514	genbank	human	model	54_36p	rna	SNP	1.000	T
POP1	10940	genome.wustl.edu	37	8	99142359	99142359	+	Missense_Mutation	SNP	A	A	G	rs370059328		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr8:99142359A>G	ENST00000401707.2	+	5	721	c.640A>G	c.(640-642)Atg>Gtg	p.M214V	POP1_ENST00000349693.3_Missense_Mutation_p.M214V	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	214					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GCGGTTTCATATGGTCAAGAA	0.517																																																0			8						A	VAL/MET,VAL/MET,VAL/MET	0,4406		0,0,2203	78.0	76.0	77.0		640,640,640	5.8	1.0	8		77	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	POP1	NM_001145860.1,NM_001145861.1,NM_015029.2	21,21,21	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	214/1025,214/1025,214/1025	99142359	1,13005	2203	4300	6503	99211535	SO:0001583	missense	10940			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.640A>G	8.37:g.99142359A>G	ENSP00000385787:p.Met214Val		99211535	A8K5W9|Q15037	Missense_Mutation	SNP	HMMPfam_POP1,HMMPfam_POPLD	p.M214V	ENST00000401707.2	37	c.640	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	A	20.8	4.054733	0.75960	0.0	1.16E-4	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.60299	0.2;0.2	5.81	5.81	0.92471	Ribonuclease P/MRP, subunit POP1 (1);	0.053946	0.64402	D	0.000002	T	0.78792	0.4339	M	0.87900	2.915	0.58432	D	0.999994	D	0.65815	0.995	D	0.76575	0.988	T	0.82043	-0.0653	9	.	.	.	-28.7216	14.4189	0.67171	1.0:0.0:0.0:0.0	.	214	Q99575	POP1_HUMAN	V	214	ENSP00000385787:M214V;ENSP00000339529:M214V	.	M	+	1	0	POP1	99211535	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.474000	0.81024	2.217000	0.71921	0.482000	0.46254	ATG	-	HMMPfam_POP1		0.517	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	protein_coding	OTTHUMT00000379470.1	A	NM_015029		99211535	+1	no_errors	NM_015029	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PCCA	5095	genome.wustl.edu	37	13	100803020	100803020	+	Intron	SNP	A	A	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr13:100803020A>C	ENST00000376285.1	+	5	338				PCCA_ENST00000376279.3_Intron|PCCA_ENST00000485946.1_Intron|PCCA_ENST00000376286.4_Intron	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide						biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TCAAAGCCCCACAGTGGCGTC	0.463																																																0			13																																								99601021	SO:0001627	intron_variant	728088			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.301-4213A>C	13.37:g.100803020A>C			99601021	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	RNA	SNP	-	NULL	ENST00000376285.1	37	NULL	CCDS9496.2	13																																																																																			-	-		0.463	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728088	protein_coding	OTTHUMT00000045627.2	A			99601021	-1	pseudogene	XR_015354	genbank	human	model	54_36p	rna	SNP	1.000	C
VPS13B	157680	genome.wustl.edu	37	8	100133434	100133434	+	Nonsense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr8:100133434C>T	ENST00000358544.2	+	8	1078	c.967C>T	c.(967-969)Caa>Taa	p.Q323*	CTD-2340D6.1_ENST00000523226.1_RNA|VPS13B_ENST00000441350.2_Nonsense_Mutation_p.Q323*|VPS13B_ENST00000357162.2_Nonsense_Mutation_p.Q323*|VPS13B_ENST00000355155.1_Nonsense_Mutation_p.Q323*|VPS13B_ENST00000395996.1_Nonsense_Mutation_p.Q323*	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	323					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AATAGATATGCAATATCCTGC	0.373																																					Colon(161;2205 2542 7338 31318)											0			8											67.0	64.0	65.0					8																	100133434		2203	4300	6503	100202610	SO:0001587	stop_gained	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.967C>T	8.37:g.100133434C>T	ENSP00000351346:p.Gln323*		100202610	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	PatternScan_ZINC_PROTEASE	p.Q323*	ENST00000358544.2	37	c.967	CCDS6280.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.515689|4.515689	0.85389|0.85389	.|.	.|.	ENSG00000132549|ENSG00000132549	ENST00000524330|ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.151019	.|0.44483	.|D	.|0.000445	T|.	0.74801|.	0.3764|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71477|.	-0.4581|.	3|.	.|0.34782	.|T	.|0.22	.|.	19.5169|19.5169	0.95169|0.95169	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	31|323	.|.	.|ENSP00000347281:Q323X	A|Q	+|+	2|1	0|0	VPS13B|VPS13B	100202610|100202610	0.989000|0.989000	0.36119|0.36119	0.995000|0.995000	0.50966|0.50966	0.795000|0.795000	0.44927|0.44927	3.508000|3.508000	0.53378|0.53378	2.615000|2.615000	0.88500|0.88500	0.655000|0.655000	0.94253|0.94253	GCA|CAA	-	NULL		0.373	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	protein_coding	OTTHUMT00000277138.1	C	NM_184042		100202610	+1	no_errors	NM_017890	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
CMSS1	84319	genome.wustl.edu	37	3	99886581	99886581	+	Splice_Site	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr3:99886581G>C	ENST00000421999.2	+	6	561		c.e6-1		CMSS1_ENST00000489081.1_Splice_Site	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)								poly(A) RNA binding (GO:0044822)										CTTTTTTCCAGTTTGTCCTAA	0.418																																																0			3											153.0	158.0	156.0					3																	99886581		2203	4300	6503	101369271	SO:0001630	splice_region_variant	84319				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.416-1G>C	3.37:g.99886581G>C			101369271	A8K5S7|B4DUM1|E9PHS3	Splice_Site	SNP	-	e6-1	ENST00000421999.2	37	c.416-1	CCDS2935.1	3	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306012	0.40795	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909;ENST00000497345	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2327	0.89939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C3orf26	101369271	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	8.201000	0.89735	2.642000	0.89623	0.655000	0.94253	.	-	-		0.418	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf26	protein_coding	OTTHUMT00000353060.1	G	NM_032359	Intron	101369271	+1	no_errors	NM_032359	genbank	human	predicted	54_36p	splice_site	SNP	1.000	C
RELN	5649	genome.wustl.edu	37	7	103557542	103557542	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr7:103557542C>T	ENST00000428762.1	-	2	476	c.317G>A	c.(316-318)gGt>gAt	p.G106D	RELN_ENST00000424685.2_Missense_Mutation_p.G106D|RELN_ENST00000343529.5_Missense_Mutation_p.G106D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	106	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGCACTGGAACCTCCAATGCT	0.388																																					NSCLC(146;835 1944 15585 22231 52158)											0			7											127.0	126.0	126.0					7																	103557542		2203	4300	6503	103344778	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.317G>A	7.37:g.103557542C>T	ENSP00000392423:p.Gly106Asp		103344778	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	HMMPfam_Reeler,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Sialidase	p.G106D	ENST00000428762.1	37	c.317	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439559	0.63067	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25414	1.8;1.8;1.8	5.48	5.48	0.80851	Reeler domain (2);	0.075935	0.53938	D	0.000047	T	0.34019	0.0883	N	0.08118	0	0.47441	D	0.999429	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.47114	-0.9142	10	0.66056	D	0.02	.	18.9525	0.92645	0.0:1.0:0.0:0.0	.	106;106	P78509-2;P78509	.;RELN_HUMAN	D	106	ENSP00000392423:G106D;ENSP00000345694:G106D;ENSP00000388446:G106D	ENSP00000345694:G106D	G	-	2	0	RELN	103344778	0.998000	0.40836	0.942000	0.38095	0.985000	0.73830	5.117000	0.64667	2.577000	0.86979	0.650000	0.86243	GGT	-	HMMPfam_Reeler		0.388	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	protein_coding	OTTHUMT00000348148.1	C	NM_005045		103344778	-1	no_errors	NM_005045	genbank	human	reviewed	54_36p	missense	SNP	0.988	T
SLC35F2	54733	genome.wustl.edu	37	11	107779149	107779149	+	Intron	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr11:107779149C>T	ENST00000429869.1	-	2	241				SLC35F2_ENST00000525071.1_Intron			Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		CGCGGCGATGCGCTACGTCGC	0.602																																																0			11																																								107284359	SO:0001627	intron_variant	643949				CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000429869.1:c.347+17G>A	11.37:g.107779149C>T			107284359	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	RNA	SNP	-	NULL	ENST00000429869.1	37	NULL	CCDS41709.1	11																																																																																			-	-		0.602	SLC35F2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643949	protein_coding		C	NM_017515		107284359	+1	pseudogene	XR_016405	genbank	human	model	54_36p	rna	SNP	1.000	T
DOCK4	9732	genome.wustl.edu	37	7	111398748	111398748	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr7:111398748G>T	ENST00000437633.1	-	40	4490	c.4234C>A	c.(4234-4236)Cac>Aac	p.H1412N	DOCK4_ENST00000494651.2_Missense_Mutation_p.H295N|DOCK4_ENST00000428084.1_Missense_Mutation_p.H1421N	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1412	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TTCCAGATGTGATTCACTTTA	0.423																																																0			7											129.0	119.0	122.0					7																	111398748		1875	4108	5983	111185984	SO:0001583	missense	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4234C>A	7.37:g.111398748G>T	ENSP00000404179:p.His1412Asn		111185984	O14584|O94824|Q8NB45	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2	p.H1412N	ENST00000437633.1	37	c.4234	CCDS47688.1	7	.	.	.	.	.	.	.	.	.	.	G	7.741	0.701374	0.15172	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	T;T;T	0.14144	2.53;2.53;2.53	5.01	5.01	0.66863	.	0.044381	0.85682	D	0.000000	T	0.04770	0.0129	N	0.00742	-1.23	0.53005	D	0.999963	B;B;B;B;B	0.16603	0.018;0.014;0.002;0.002;0.002	B;B;B;B;B	0.15052	0.012;0.007;0.006;0.006;0.004	T	0.44375	-0.9332	10	0.11182	T	0.66	.	18.8729	0.92324	0.0:0.0:1.0:0.0	.	319;295;1457;1412;1421	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2	.;.;.;DOCK4_HUMAN;.	N	1400;1421;295;1412;1409	ENSP00000410746:H1421N;ENSP00000440944:H295N;ENSP00000404179:H1412N	ENSP00000345432:H1409N	H	-	1	0	DOCK4	111185984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.406000	0.66357	2.763000	0.94921	0.650000	0.86243	CAC	-	NULL		0.423	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	protein_coding	OTTHUMT00000338369.4	G	NM_014705		111185984	-1	no_errors	NM_014705	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ANAPC1	64682	genome.wustl.edu	37	2	112566716	112566716	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:112566716C>A	ENST00000341068.3	-	29	4412	c.3640G>T	c.(3640-3642)Gct>Tct	p.A1214S		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1214					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						AGTTTTGCAGCAGAAACACCA	0.418																																																0			2											15.0	14.0	15.0					2																	112566716		1489	3139	4628	112283187	SO:0001583	missense	64682			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.3640G>T	2.37:g.112566716C>A	ENSP00000339109:p.Ala1214Ser		112283187	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	HMMPfam_PC_rep	p.A1214S	ENST00000341068.3	37	c.3640	CCDS2093.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.12|18.12	3.553622|3.553622	0.65425|0.65425	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	T|.	0.25250|.	1.81|.	4.83|4.83	4.83|4.83	0.62350|0.62350	.|.	0.000000|.	0.37715|.	U|.	0.001976|.	T|T	0.75236|0.75236	0.3822|0.3822	M|M	0.72576|0.72576	2.205|2.205	0.80722|0.80722	D|D	1|1	P|.	0.38473|.	0.633|.	B|.	0.29862|.	0.108|.	T|T	0.75233|0.75233	-0.3390|-0.3390	10|5	0.42905|.	T|.	0.14|.	-19.5691|-19.5691	18.0978|18.0978	0.89496|0.89496	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1214|.	Q9H1A4|.	APC1_HUMAN|.	S|F	1214|748	ENSP00000339109:A1214S|.	ENSP00000339109:A1214S|.	A|C	-|-	1|2	0|0	ANAPC1|ANAPC1	112283187|112283187	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.989000|5.989000	0.70587|0.70587	2.491000|2.491000	0.84063|0.84063	0.563000|0.563000	0.77884|0.77884	GCT|TGC	-	NULL		0.418	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	protein_coding	OTTHUMT00000254045.2	C	NM_022662		112283187	-1	no_errors	NM_022662	genbank	human	validated	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	2	113611201	113611201	+	IGR	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:113611201A>G								AC079753.1 (9213 upstream) : IL37 (59346 downstream)																							AATATCTGTTAGAACAGAAGA	0.408																																																0			2																																								113327672	SO:0001628	intergenic_variant	0																															2.37:g.113611201A>G			113327672		Silent	SNP	HMMPfam_BIR,HMMSmart_BIR,superfamily_SSF57924	p.L58		37	c.174		2																																																																																			-	HMMPfam_BIR,HMMSmart_BIR,superfamily_SSF57924	0	0.408					ENSG00000163098			A			113327672	+1	no_errors	ENST00000295249	ensembl	human	known	54_36p	silent	SNP	0.001	G
FOXP2	93986	genome.wustl.edu	37	7	114302148	114302148	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr7:114302148A>C	ENST00000393494.2	+	14	1955	c.1676A>C	c.(1675-1677)cAc>cCc	p.H559P	FOXP2_ENST00000350908.4_Missense_Mutation_p.H559P|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000408937.3_Missense_Mutation_p.H584P|FOXP2_ENST00000393491.3_Missense_Mutation_p.H374P|FOXP2_ENST00000393489.3_Missense_Mutation_p.H467P|FOXP2_ENST00000403559.4_Missense_Mutation_p.H576P|FOXP2_ENST00000393498.2_Missense_Mutation_p.H538P			O15409	FOXP2_HUMAN	forkhead box P2	559					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						CTTAGCCTGCACAAGTGTTTT	0.373																																																0			7											127.0	118.0	121.0					7																	114302148		2203	4300	6503	114089384	SO:0001583	missense	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1676A>C	7.37:g.114302148A>C	ENSP00000377132:p.His559Pro		114089384	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.H584P	ENST00000393494.2	37	c.1751	CCDS5760.1	7	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185743	0.57909	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.95342	-3.68;-3.68;-3.68;-3.68;-3.68;-3.68	5.65	5.65	0.86999	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	H	0.95504	3.68	0.80722	D	1	D;D;D;D;D	0.76494	0.991;0.991;0.999;0.991;0.988	D;D;D;D;D	0.87578	0.98;0.98;0.998;0.98;0.977	D	0.99457	1.0942	10	0.87932	D	0	.	16.1778	0.81874	1.0:0.0:0.0:0.0	.	558;576;374;559;584	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	P	559;584;576;559;536;467;374	ENSP00000377132:H559P;ENSP00000386200:H584P;ENSP00000385069:H576P;ENSP00000265436:H559P;ENSP00000377129:H467P;ENSP00000377130:H374P	ENSP00000265436:H559P	H	+	2	0	FOXP2	114089384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.279000	0.76181	0.533000	0.62120	CAC	-	HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head		0.373	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	protein_coding	OTTHUMT00000317366.1	A	NM_014491		114089384	+1	no_errors	NM_148898	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RFC5	5985	genome.wustl.edu	37	12	118469037	118469037	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr12:118469037T>A	ENST00000454402.2	+	11	1095	c.977T>A	c.(976-978)aTt>aAt	p.I326N	RFC5_ENST00000229043.3_Missense_Mutation_p.I241N|RFC5_ENST00000392542.2_Missense_Mutation_p.I305N|RFC5_ENST00000543153.1_3'UTR	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	326					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGCTCCCTCATTGCTGCATTT	0.493																																																0			12											190.0	162.0	172.0					12																	118469037		2203	4300	6503	116953420	SO:0001583	missense	5985				CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.977T>A	12.37:g.118469037T>A	ENSP00000408295:p.Ile326Asn		116953420	A8MZ62|B3KSX8	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,HMMPfam_Rep_fac_C,superfamily_Pol_clamp_load_C	p.I326N	ENST00000454402.2	37	c.977	CCDS9185.1	12	.	.	.	.	.	.	.	.	.	.	T	24.0	4.479175	0.84747	.	.	ENSG00000111445	ENST00000229043;ENST00000454402;ENST00000392542	T;T;T	0.50813	0.73;0.73;0.73	4.68	4.68	0.58851	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.059512	0.64402	D	0.000002	T	0.71117	0.3302	M	0.86651	2.83	0.58432	D	0.99999	D;D;D	0.71674	0.988;0.998;0.998	D;D;D	0.75020	0.966;0.985;0.975	T	0.77405	-0.2600	10	0.87932	D	0	-14.8599	13.5621	0.61795	0.0:0.0:0.0:1.0	.	305;337;326	A8MZ62;Q59GW7;P40937	.;.;RFC5_HUMAN	N	241;326;305	ENSP00000229043:I241N;ENSP00000408295:I326N;ENSP00000376325:I305N	ENSP00000229043:I241N	I	+	2	0	RFC5	116953420	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.858000	0.86971	2.085000	0.62840	0.528000	0.53228	ATT	-	HMMPfam_Rep_fac_C,superfamily_Pol_clamp_load_C		0.493	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC5	protein_coding	OTTHUMT00000344196.2	T	NM_007370		116953420	+1	no_errors	NM_007370	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
SCAI	286205	genome.wustl.edu	37	9	127734081	127734081	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr9:127734081T>C	ENST00000336505.6	-	16	1500	c.1442A>G	c.(1441-1443)aAt>aGt	p.N481S	SCAI_ENST00000373549.4_Missense_Mutation_p.N504S	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	481					negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						CATTAGAGGATTGTTCAAAAA	0.368																																																0			9											103.0	92.0	95.0					9																	127734081		1840	4091	5931	126773902	SO:0001583	missense	286205			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.1442A>G	9.37:g.127734081T>C	ENSP00000336756:p.Asn481Ser		126773902	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	NULL	p.N504S	ENST00000336505.6	37	c.1511	CCDS48017.1	9	.	.	.	.	.	.	.	.	.	.	T	3.290	-0.145218	0.06627	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.39229	1.09;1.09	5.1	5.1	0.69264	.	0.138673	0.64402	D	0.000004	T	0.16981	0.0408	N	0.01874	-0.695	0.44309	D	0.997188	B;B	0.16802	0.019;0.015	B;B	0.19946	0.026;0.027	T	0.17501	-1.0367	10	0.02654	T	1	-18.4788	14.3915	0.66983	0.0:0.0:0.0:1.0	.	481;504	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	S	481;504	ENSP00000336756:N481S;ENSP00000362650:N504S	ENSP00000336756:N481S	N	-	2	0	SCAI	126773902	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.225000	0.58600	2.057000	0.61298	0.533000	0.62120	AAT	-	NULL		0.368	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf126	protein_coding	OTTHUMT00000054055.3	T	NM_173690		126773902	-1	no_errors	NM_173690	genbank	human	validated	54_36p	missense	SNP	1.000	C
ACAD11	84129	genome.wustl.edu	37	3	132337565	132337565	+	Missense_Mutation	SNP	C	C	T	rs141257781	byFrequency	TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr3:132337565C>T	ENST00000264990.6	-	11	2298	c.1327G>A	c.(1327-1329)Gga>Aga	p.G443R	ACAD11_ENST00000355458.3_Missense_Mutation_p.G443R|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000481970.2_Missense_Mutation_p.G443R	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	443					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						TGGCTGAGTCCGCTGACAGCT	0.458													C|||	3	0.000599042	0.0008	0.0	5008	,	,		14717	0.0		0.0	False		,,,				2504	0.002															0			3						C	ARG/GLY	0,4406		0,0,2203	81.0	78.0	79.0		1327	4.7	0.9	3	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ACAD11	NM_032169.4	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		443/781	132337565	1,13005	2203	4300	6503	133820255	SO:0001583	missense	84129			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1327G>A	3.37:g.132337565C>T	ENSP00000264990:p.Gly443Arg		133820255	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_APH,PatternScan_PROTEIN_KINASE_TYR,superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_N,HMMPfam_Acyl-CoA_dh_M,HMMPfam_Acyl-CoA_dh_1,superfamily_Acyl-CoA dehydrogenase C-terminal domain-like	p.G443R	ENST00000264990.6	37	c.1327	CCDS3074.1	3	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.26	3.071718	0.55646	0.0	1.16E-4	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	D;D;T	0.99891	-7.56;-7.56;1.21	5.52	4.65	0.58169	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	.	.	.	.	D	0.99883	0.9944	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;0.998	P;D	0.74674	0.908;0.984	D	0.96671	0.9496	9	0.62326	D	0.03	.	10.5202	0.44914	0.0:0.8499:0.0:0.1501	.	443;443	D6RDI8;Q709F0	.;ACD11_HUMAN	R	443	ENSP00000347636:G443R;ENSP00000264990:G443R;ENSP00000420907:G443R	ENSP00000264990:G443R	G	-	1	0	ACAD11	133820255	0.999000	0.42202	0.948000	0.38648	0.255000	0.26057	4.621000	0.61233	1.474000	0.48178	-0.142000	0.14014	GGA	-	superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_N		0.458	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	protein_coding	OTTHUMT00000357279.2	C	NM_032169		133820255	-1	no_errors	NM_032169	genbank	human	validated	54_36p	missense	SNP	0.999	T
TG	7038	genome.wustl.edu	37	8	133883630	133883630	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr8:133883630A>T	ENST00000220616.4	+	4	352	c.312A>T	c.(310-312)ttA>ttT	p.L104F	TG_ENST00000377869.1_Missense_Mutation_p.L104F	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	104	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGCAGATCTTACTGAGTGGCT	0.512																																																0			8											190.0	166.0	174.0					8																	133883630		2203	4300	6503	133952812	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.312A>T	8.37:g.133883630A>T	ENSP00000220616:p.Leu104Phe		133952812	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.L104F	ENST00000220616.4	37	c.312	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	A	16.45	3.125653	0.56721	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.68479	-0.33;-0.33	5.58	0.762	0.18454	Thyroglobulin type-1 (3);	0.000000	0.49305	D	0.000160	T	0.74215	0.3687	L	0.60067	1.865	0.19945	N	0.999949	D	0.89917	1.0	D	0.97110	1.0	T	0.64935	-0.6290	10	0.87932	D	0	.	8.4592	0.32917	0.3777:0.0:0.6223:0.0	.	104	P01266	THYG_HUMAN	F	104	ENSP00000367100:L104F;ENSP00000220616:L104F	ENSP00000220616:L104F	L	+	3	2	TG	133952812	1.000000	0.71417	0.007000	0.13788	0.764000	0.43329	1.997000	0.40786	-0.133000	0.11537	-0.386000	0.06593	TTA	-	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1		0.512	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	A	NM_003235		133952812	+1	no_errors	NM_003235	genbank	human	validated	54_36p	missense	SNP	0.011	T
LCT	3938	genome.wustl.edu	37	2	136594437	136594437	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:136594437G>C	ENST00000264162.2	-	1	313	c.303C>G	c.(301-303)agC>agG	p.S101R		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	101	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GATTCTGGGTGCTTCCTGCTG	0.547																																																0			2											92.0	89.0	90.0					2																	136594437		2203	4300	6503	136310907	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.303C>G	2.37:g.136594437G>C	ENSP00000264162:p.Ser101Arg		136310907	Q4ZG58	Missense_Mutation	SNP	superfamily_Glyco_hydro_cat,HMMPfam_Glyco_hydro_1,PatternScan_GLYCOSYL_HYDROL_F1_2,PatternScan_GLYCOSYL_HYDROL_F1_1	p.S101R	ENST00000264162.2	37	c.303	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	g	0.555	-0.847946	0.02651	.	.	ENSG00000115850	ENST00000264162	T	0.31510	1.49	5.83	3.99	0.46301	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.941677	0.09128	N	0.844766	T	0.18299	0.0439	N	0.16368	0.405	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.32745	-0.9895	10	0.12766	T	0.61	-5.7079	8.4521	0.32877	0.1361:0.3191:0.5448:0.0	.	101	P09848	LPH_HUMAN	R	101	ENSP00000264162:S101R	ENSP00000264162:S101R	S	-	3	2	LCT	136310907	0.001000	0.12720	0.031000	0.17742	0.101000	0.19017	0.152000	0.16302	0.782000	0.33613	0.651000	0.88453	AGC	-	superfamily_Glyco_hydro_cat		0.547	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	G	NM_002299		136310907	-1	no_errors	NM_002299	genbank	human	reviewed	54_36p	missense	SNP	0.079	C
DGKI	9162	genome.wustl.edu	37	7	137075994	137075994	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr7:137075994C>A	ENST00000288490.5	-	34	3170	c.3170G>T	c.(3169-3171)gGc>gTc	p.G1057V	DGKI_ENST00000453654.2_Missense_Mutation_p.G726V|DGKI_ENST00000424189.2_Missense_Mutation_p.G1070V|DGKI_ENST00000446122.1_Missense_Mutation_p.G1039V|DGKI_ENST00000494390.1_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1057					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GTCCTCATGGCCAATGACCTT	0.522																																																0			7											139.0	123.0	129.0					7																	137075994		2203	4300	6503	136726534	SO:0001583	missense	9162			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3170G>T	7.37:g.137075994C>A	ENSP00000288490:p.Gly1057Val		136726534	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	PatternScan_ZF_DAG_PE_1,HMMSmart_C1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_DAGKc,HMMPfam_DAGK_acc,HMMSmart_DAGKa,superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK	p.G1057V	ENST00000288490.5	37	c.3170	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671906	0.29693	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.33865	1.95;1.39;1.58	5.92	4.01	0.46588	.	0.603917	0.17070	N	0.188181	T	0.22322	0.0538	N	0.08118	0	0.48288	D	0.999626	B;B	0.19445	0.002;0.036	B;B	0.20184	0.01;0.028	T	0.04153	-1.0973	10	0.30854	T	0.27	.	16.2436	0.82429	0.0:0.5864:0.4136:0.0	.	726;1057	E9PFX6;O75912	.;DGKI_HUMAN	V	726;974;1060;1057;1039	ENSP00000392161:G726V;ENSP00000288490:G1057V;ENSP00000399131:G1039V	ENSP00000288490:G1057V	G	-	2	0	DGKI	136726534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.246000	0.43142	1.502000	0.48669	0.650000	0.86243	GGC	-	NULL		0.522	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	C	NM_004717		136726534	-1	no_errors	NM_004717	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CLSTN2	64084	genome.wustl.edu	37	3	140123480	140123480	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr3:140123480C>T	ENST00000458420.3	+	4	699	c.509C>T	c.(508-510)aCg>aTg	p.T170M	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	170	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.T170M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GCTGTTGTGACGGAGGGCAAG	0.532										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)											1	Substitution - Missense(1)	large_intestine(1)	3											134.0	106.0	116.0					3																	140123480		2203	4300	6503	141606170	SO:0001583	missense	64084			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.509C>T	3.37:g.140123480C>T	ENSP00000402460:p.Thr170Met		141606170	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,superfamily_Concanavalin A-like lectins/glucanases	p.T170M	ENST00000458420.3	37	c.509	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698744	0.48307	.	.	ENSG00000158258	ENST00000458420	T	0.51071	0.72	5.66	5.66	0.87406	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.61788	0.2375	L	0.43923	1.385	0.45747	D	0.998642	D	0.89917	1.0	D	0.74023	0.982	T	0.59091	-0.7519	10	0.45353	T	0.12	-23.1038	17.2492	0.87037	0.0:1.0:0.0:0.0	.	170	Q9H4D0	CSTN2_HUMAN	M	170	ENSP00000402460:T170M	ENSP00000402460:T170M	T	+	2	0	CLSTN2	141606170	0.752000	0.28338	0.768000	0.31515	0.875000	0.50365	1.459000	0.35234	2.665000	0.90641	0.563000	0.77884	ACG	-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.532	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	protein_coding	OTTHUMT00000359393.3	C	NM_022131		141606170	+1	no_errors	NM_022131	genbank	human	validated	54_36p	missense	SNP	0.364	T
HIST2H2BB	338391	genome.wustl.edu	37	1	149375105	149375105	+	lincRNA	SNP	C	C	G	rs587678648		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:149375105C>G	ENST00000415338.1	-	0	1061				HIST2H2BB_ENST00000609585.1_RNA																							GCTTTACTATCGAAATGGCAA	0.468																																																0			1																																								147641729			0																															1.37:g.149375105C>G			147641729		Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2	p.R139G	ENST00000415338.1	37	c.415		1																																																																																			-	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig		0.468	RP5-998N21.4-001	KNOWN	basic	lincRNA	uc009wky.1	lincRNA	OTTHUMT00000098435.1	C			147641729	+1	no_errors	ENST00000369178	ensembl	human	known	54_36p	missense	SNP	0.015	G
TTC29	83894	genome.wustl.edu	37	4	147628654	147628654	+	Silent	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr4:147628654A>G	ENST00000325106.4	-	12	1606	c.1380T>C	c.(1378-1380)cgT>cgC	p.R460R	TTC29_ENST00000398886.4_Silent_p.R486R|TTC29_ENST00000513335.1_Silent_p.R486R	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	460										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GTTCTTCCAAACGTTCTGAGT	0.318																																																0			4											127.0	121.0	123.0					4																	147628654		1817	4074	5891	147848104	SO:0001819	synonymous_variant	83894			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1380T>C	4.37:g.147628654A>G			147848104	A4GU95|Q9BXB6	Silent	SNP	superfamily_TPR-like,HMMPfam_TPR_1,HMMSmart_SM00028	p.R460	ENST00000325106.4	37	c.1380	CCDS47141.1	4																																																																																			-	NULL		0.318	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	protein_coding		A	NM_031956		147848104	-1	no_errors	NM_031956	genbank	human	validated	54_36p	silent	SNP	0.000	G
TM4SF4	7104	genome.wustl.edu	37	3	149193613	149193613	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr3:149193613A>G	ENST00000305354.4	+	2	1082	c.178A>G	c.(178-180)Atc>Gtc	p.I60V		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	60					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CTGGTAGATGATCTTCCCTGC	0.572																																																0			3											47.0	49.0	48.0					3																	149193613		2027	4185	6212	150676303	SO:0001583	missense	7104				CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.178A>G	3.37:g.149193613A>G	ENSP00000305852:p.Ile60Val		150676303	B2RDA4	Missense_Mutation	SNP	HMMPfam_L6_membrane	p.I60V	ENST00000305354.4	37	c.178	CCDS46932.1	3	.	.	.	.	.	.	.	.	.	.	A	12.85	2.060147	0.36373	.	.	ENSG00000169903	ENST00000305354	T	0.33865	1.39	5.09	2.63	0.31362	.	0.142073	0.64402	N	0.000007	T	0.38506	0.1043	M	0.85710	2.77	0.53005	D	0.999968	B	0.30793	0.295	B	0.32677	0.15	T	0.09997	-1.0649	10	0.27785	T	0.31	.	6.254	0.20864	0.721:0.1353:0.1437:0.0	.	60	P48230	T4S4_HUMAN	V	60	ENSP00000305852:I60V	ENSP00000305852:I60V	I	+	1	0	TM4SF4	150676303	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	3.902000	0.56310	0.329000	0.23460	-0.290000	0.09829	ATC	-	HMMPfam_L6_membrane		0.572	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF4	protein_coding	OTTHUMT00000356528.1	A			150676303	+1	no_errors	NM_004617	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HTR5A	3361	genome.wustl.edu	37	7	154862937	154862937	+	Missense_Mutation	SNP	G	G	T	rs141719500		TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr7:154862937G>T	ENST00000287907.2	+	1	904	c.328G>T	c.(328-330)Ggt>Tgt	p.G110C	HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.P26H|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.P26H	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	110					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CTGGCAGCTAGGTCGGAGGCT	0.662																																																0			7											50.0	42.0	45.0					7																	154862937		2203	4300	6503	154493870	SO:0001583	missense	3361				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.328G>T	7.37:g.154862937G>T	ENSP00000287907:p.Gly110Cys		154493870	Q2M2D2	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G110C	ENST00000287907.2	37	c.328	CCDS5936.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.516282|4.516282	0.85495|0.85495	.|.	.|.	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.51325|.	0.71|.	4.52|4.52	4.52|4.52	0.55395|0.55395	GPCR, rhodopsin-like superfamily (1);|.	0.052450|.	0.85682|.	D|.	0.000000|.	D|D	0.90494|0.90494	0.7022|0.7022	H|H	0.98682|0.98682	4.3|4.3	0.80722|0.80722	D|D	1|1	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.97110	1.0|1.0	D|D	0.94453|0.94453	0.7669|0.7669	10|8	0.87932|0.87932	D|D	0|0	.|.	17.4477|17.4477	0.87583|0.87583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	110|26	P47898|B7Z8E6	5HT5A_HUMAN|.	C|H	110|26	ENSP00000287907:G110C|.	ENSP00000287907:G110C|ENSP00000379080:P26H	G|P	+|-	1|2	0|0	HTR5A|AC093726.4	154493870|154493870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.824000|0.824000	0.46624|0.46624	9.228000|9.228000	0.95250|0.95250	2.338000|2.338000	0.79540|0.79540	0.563000|0.563000	0.77884|0.77884	GGT|CCT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.662	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	protein_coding	OTTHUMT00000322240.1	G	NM_024012		154493870	+1	no_errors	NM_024012	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BCAN	63827	genome.wustl.edu	37	1	156626837	156626837	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:156626837G>C	ENST00000329117.5	+	10	2494	c.2158G>C	c.(2158-2160)Ggc>Cgc	p.G720R	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	720	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCGGATGTACGGCGCGCATCT	0.637																																																0			1											58.0	61.0	60.0					1																	156626837		2203	4300	6503	154893461	SO:0001583	missense	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2158G>C	1.37:g.156626837G>C	ENSP00000331210:p.Gly720Arg		154893461	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00406,PatternScan_IG_MHC,superfamily_C-type lectin-like,HMMSmart_SM00445,HMMPfam_Xlink,PatternScan_LINK_1,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.G720R	ENST00000329117.5	37	c.2158	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016364	0.93404	.	.	ENSG00000132692	ENST00000329117	T	0.26957	1.7	5.05	5.05	0.67936	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000017	T	0.50034	0.1592	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56667	-0.7941	10	0.72032	D	0.01	-24.9936	17.1361	0.86740	0.0:0.0:1.0:0.0	.	720	Q96GW7	PGCB_HUMAN	R	720	ENSP00000331210:G720R	ENSP00000331210:G720R	G	+	1	0	BCAN	154893461	1.000000	0.71417	0.970000	0.41538	0.998000	0.95712	5.457000	0.66672	2.641000	0.89580	0.561000	0.74099	GGC	-	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C		0.637	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	protein_coding	OTTHUMT00000081844.2	G	NM_021948		154893461	+1	no_errors	NM_021948	genbank	human	validated	54_36p	missense	SNP	0.986	C
INSRR	3645	genome.wustl.edu	37	1	156815576	156815576	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:156815576G>T	ENST00000368195.3	-	10	2405	c.2009C>A	c.(2008-2010)cCg>cAg	p.P670Q	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	670	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTCGAAGCGCGGATCGTTGTT	0.677																																																0			1											28.0	25.0	26.0					1																	156815576		2203	4298	6501	155082200	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2009C>A	1.37:g.156815576G>T	ENSP00000357178:p.Pro670Gln		155082200	O60724|Q5VZS3	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_Recep_L_domain,HMMPfam_Furin-like,superfamily_Grow_fac_recept,HMMSmart_FU,HMMSmart_FN3,superfamily_FN_III-like,HMMPfam_fn3,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.P670Q	ENST00000368195.3	37	c.2009	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867852	0.32977	.	.	ENSG00000027644	ENST00000368195	T	0.70045	-0.45	4.69	4.69	0.59074	Fibronectin, type III (3);	0.295187	0.24585	N	0.037267	T	0.33760	0.0874	.	.	.	0.29630	N	0.845556	B	0.09022	0.002	B	0.08055	0.003	T	0.03910	-1.0993	9	0.17369	T	0.5	.	15.4999	0.75691	0.0:0.0:1.0:0.0	.	670	P14616	INSRR_HUMAN	Q	670	ENSP00000357178:P670Q	ENSP00000357178:P670Q	P	-	2	0	INSRR	155082200	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	3.552000	0.53705	2.606000	0.88127	0.561000	0.74099	CCG	-	superfamily_FN_III-like,HMMSmart_FN3		0.677	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	protein_coding	OTTHUMT00000098929.1	G	NM_014215		155082200	-1	no_errors	NM_014215	genbank	human	validated	54_36p	missense	SNP	0.984	T
TENM2	57451	genome.wustl.edu	37	5	167674535	167674535	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr5:167674535T>G	ENST00000518659.1	+	27	6630	c.6591T>G	c.(6589-6591)aaT>aaG	p.N2197K	TENM2_ENST00000519204.1_Missense_Mutation_p.N2076K|TENM2_ENST00000520394.1_Missense_Mutation_p.N1958K|TENM2_ENST00000403607.2_Missense_Mutation_p.N2021K|TENM2_ENST00000545108.1_Missense_Mutation_p.N2196K	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2197					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCTATGCCAATACCACGAAGT	0.552																																																0			5											89.0	88.0	88.0					5																	167674535		2067	4205	6272	167607113	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6591T>G	5.37:g.167674535T>G	ENSP00000429430:p.Asn2197Lys		167607113	Q9ULU2	Missense_Mutation	SNP	HMMPfam_Ten_N,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Carboxypeptidase regulatory domain,superfamily_NHL repeat,HMMPfam_NHL,HMMPfam_RHS_repeat	p.N2196K	ENST00000518659.1	37	c.6588		5	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115545	0.56505	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90385	-2.2;-2.19;-2.31;-2.64;-2.66	5.59	2.25	0.28309	.	0.000000	0.85682	D	0.000000	D	0.93825	0.8025	M	0.90595	3.13	0.47994	D	0.999569	P;P;B	0.45594	0.862;0.783;0.449	P;B;B	0.51866	0.682;0.326;0.098	D	0.93805	0.7104	10	0.66056	D	0.02	.	11.879	0.52564	0.0:0.7742:0.0:0.2258	.	2196;2197;1958	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	K	2197;2196;2076;1958;2021	ENSP00000429430:N2197K;ENSP00000438635:N2196K;ENSP00000428964:N2076K;ENSP00000427874:N1958K;ENSP00000384905:N2021K	ENSP00000384905:N2021K	N	+	3	2	ODZ2	167607113	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.348000	0.52209	0.719000	0.32188	-0.337000	0.08149	AAT	-	NULL		0.552	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	T	NM_001122679		167607113	+1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1.000	G
C1orf112	55732	genome.wustl.edu	37	1	169811639	169811639	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:169811639G>A	ENST00000286031.6	+	18	2507	c.1807G>A	c.(1807-1809)Gaa>Aaa	p.E603K	C1orf112_ENST00000359326.4_Missense_Mutation_p.E603K|C1orf112_ENST00000498289.1_3'UTR	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	603										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGCAATTATCGAAGTTGTGAG	0.363																																																0			1											141.0	135.0	137.0					1																	169811639		2203	4300	6503	168078263	SO:0001583	missense	55732			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1807G>A	1.37:g.169811639G>A	ENSP00000286031:p.Glu603Lys		168078263	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	NULL	p.E603K	ENST00000286031.6	37	c.1807	CCDS1285.1	1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185148	0.38609	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.42131	0.98;0.98	5.18	4.26	0.50523	.	0.491266	0.24674	N	0.036540	T	0.18551	0.0445	L	0.50919	1.6	0.54753	D	0.999987	B;B	0.24651	0.108;0.108	B;B	0.15870	0.014;0.014	T	0.03148	-1.1067	10	0.18276	T	0.48	-7.2057	10.4753	0.44661	0.0906:0.0:0.9094:0.0	.	545;603	B4DGF2;Q9NSG2	.;CA112_HUMAN	K	603	ENSP00000352276:E603K;ENSP00000286031:E603K	ENSP00000286031:E603K	E	+	1	0	C1orf112	168078263	0.982000	0.34865	0.877000	0.34402	0.911000	0.54048	3.296000	0.51802	2.572000	0.86782	0.655000	0.94253	GAA	-	NULL		0.363	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf112	protein_coding	OTTHUMT00000087126.3	G	NM_018186		168078263	+1	no_errors	NM_018186	genbank	human	predicted	54_36p	missense	SNP	0.095	A
STK10	6793	genome.wustl.edu	37	5	171520948	171520948	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr5:171520948G>C	ENST00000176763.5	-	9	1365	c.1022C>G	c.(1021-1023)aCt>aGt	p.T341S	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	341					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGAGTTCTGAGTATGGTTCTC	0.493																																																0			5											28.0	29.0	28.0					5																	171520948		2047	4210	6257	171453553	SO:0001583	missense	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1022C>G	5.37:g.171520948G>C	ENSP00000176763:p.Thr341Ser		171453553	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.T341S	ENST00000176763.5	37	c.1022	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.854443	0.00558	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.51574	0.7	4.78	1.67	0.24075	Protein kinase-like domain (1);	0.818608	0.11186	N	0.590406	T	0.27241	0.0668	N	0.22421	0.69	0.29365	N	0.864387	B	0.02656	0.0	B	0.06405	0.002	T	0.30563	-0.9974	10	0.07325	T	0.83	.	6.9778	0.24686	0.0:0.1721:0.4738:0.3541	.	341	O94804	STK10_HUMAN	S	341	ENSP00000176763:T341S	ENSP00000176763:T341S	T	-	2	0	STK10	171453553	0.994000	0.37717	0.855000	0.33649	0.048000	0.14542	1.493000	0.35605	0.498000	0.27948	0.655000	0.94253	ACT	-	NULL		0.493	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	protein_coding	OTTHUMT00000372374.2	G	NM_005990		171453553	-1	no_errors	NM_005990	genbank	human	reviewed	54_36p	missense	SNP	0.970	C
COL23A1	91522	genome.wustl.edu	37	5	177674551	177674551	+	Silent	SNP	G	G	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr5:177674551G>A	ENST00000390654.3	-	22	1629	c.1272C>T	c.(1270-1272)ggC>ggT	p.G424G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	424	Collagen-like 4.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTCCCTGGAGGCCCTGCAGGA	0.637																																																0			5											43.0	51.0	48.0					5																	177674551		1976	4159	6135	177607157	SO:0001819	synonymous_variant	91522			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1272C>T	5.37:g.177674551G>A			177607157	Q8IVR4|Q9NT93	Silent	SNP	HMMPfam_Collagen	p.G424	ENST00000390654.3	37	c.1272	CCDS4436.1	5																																																																																			-	HMMPfam_Collagen		0.637	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	protein_coding	OTTHUMT00000253475.1	G	NM_173465		177607157	-1	no_errors	NM_173465	genbank	human	validated	54_36p	silent	SNP	1.000	A
PDE11A	50940	genome.wustl.edu	37	2	178862036	178862036	+	Intron	SNP	A	A	T			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:178862036A>T	ENST00000286063.6	-	2	1389				AC011998.1_ENST00000457053.1_RNA|PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	TATATTTCTCACTGGGAGGAT	0.458									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							0			2																																								178570282	SO:0001627	intron_variant	728664	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1071+16992T>A	2.37:g.178862036A>T			178570282	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	RNA	SNP	-	NULL	ENST00000286063.6	37	NULL	CCDS33334.1	2																																																																																			-	-		0.458	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728664	protein_coding	OTTHUMT00000334313.2	A			178570282	-1	pseudogene	XR_015711	genbank	human	model	54_36p	rna	SNP	1.000	T
MASP1	5648	genome.wustl.edu	37	3	186937894	186937894	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr3:186937894C>G	ENST00000337774.5	-	16	2454	c.2065G>C	c.(2065-2067)Gac>Cac	p.D689H		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	689	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGGATCCAGTCCTTGTTGTGG	0.567											OREG0015972	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			3											141.0	124.0	130.0					3																	186937894		2203	4300	6503	188420588	SO:0001583	missense	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.2065G>C	3.37:g.186937894C>G	ENSP00000336792:p.Asp689His	2011	188420588	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	HMMSmart_SM00042,HMMPfam_CUB,superfamily_Spermadhesin CUB domain,superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.D689H	ENST00000337774.5	37	c.2065	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102434	0.37145	.	.	ENSG00000127241	ENST00000337774	D	0.94613	-3.47	6.14	4.2	0.49525	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92805	0.7712	M	0.79475	2.455	0.38645	D	0.95169	P	0.37636	0.603	B	0.33196	0.159	D	0.91708	0.5379	9	0.66056	D	0.02	.	10.9213	0.47167	0.0:0.8376:0.0:0.1624	.	689	P48740	MASP1_HUMAN	H	689	ENSP00000336792:D689H	ENSP00000336792:D689H	D	-	1	0	MASP1	188420588	0.065000	0.20965	0.422000	0.26621	0.914000	0.54420	0.584000	0.23864	0.810000	0.34279	0.650000	0.86243	GAC	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.567	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	protein_coding	OTTHUMT00000344262.1	C	NM_001879		188420588	-1	no_errors	NM_001879	genbank	human	reviewed	54_36p	missense	SNP	0.044	G
CXCR2	3579	genome.wustl.edu	37	2	218999759	218999759	+	Missense_Mutation	SNP	G	G	A	rs149364972	byFrequency	TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:218999759G>A	ENST00000318507.2	+	3	662	c.235G>A	c.(235-237)Ggc>Agc	p.G79S		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	79					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						CAGCAGGGTCGGCCGCTCCGT	0.542													G|||	7	0.00139776	0.0045	0.0014	5008	,	,		20817	0.0		0.0	False		,,,				2504	0.0															0			2						G	SER/GLY,SER/GLY	26,4380	32.6+/-62.9	0,26,2177	136.0	130.0	132.0		235,235	-3.8	0.0	2	dbSNP_134	132	0,8600		0,0,4300	no	missense,missense	CXCR2	NM_001168298.1,NM_001557.3	56,56	0,26,6477	AA,AG,GG		0.0,0.5901,0.1999	benign,benign	79/361,79/361	218999759	26,12980	2203	4300	6503	218708004	SO:0001583	missense	3579			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.235G>A	2.37:g.218999759G>A	ENSP00000319635:p.Gly79Ser		218708004	Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G79S	ENST00000318507.2	37	c.235	CCDS2408.1	2	7	0.003205128205128205	6	0.012195121951219513	1	0.0027624309392265192	0	0.0	0	0.0	G	4.793	0.147493	0.09134	0.005901	0.0	ENSG00000180871	ENST00000453237;ENST00000415392;ENST00000318507;ENST00000454148;ENST00000428565	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.19	-3.78	0.04333	GPCR, rhodopsin-like superfamily (1);	0.539636	0.20217	N	0.096775	T	0.05364	0.0142	N	0.01640	-0.785	0.09310	N	1	B	0.18013	0.025	B	0.12156	0.007	T	0.29181	-1.0020	10	0.08179	T	0.78	.	3.0117	0.06046	0.385:0.1193:0.379:0.1167	.	79	P25025	CXCR2_HUMAN	S	79	ENSP00000413686:G79S;ENSP00000392348:G79S;ENSP00000319635:G79S;ENSP00000415148:G79S;ENSP00000392698:G79S	ENSP00000319635:G79S	G	+	1	0	CXCR2	218708004	0.000000	0.05858	0.017000	0.16124	0.532000	0.34746	-0.162000	0.10012	-0.427000	0.07350	-0.265000	0.10407	GGC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.542	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL8RB	protein_coding	OTTHUMT00000256772.2	G	NM_001557		218708004	+1	no_errors	NM_001557	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
ACTA1	58	genome.wustl.edu	37	1	229568609	229568609	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr1:229568609C>A	ENST00000366684.3	-	3	250	c.148G>T	c.(148-150)Ggt>Tgt	p.G50C	ACTA1_ENST00000366683.2_Missense_Mutation_p.G50C	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	50					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				TCTTTCTGACCCATACCGACC	0.622																																																0			1											53.0	55.0	54.0					1																	229568609		2203	4300	6503	227635232	SO:0001583	missense	58			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.148G>T	1.37:g.229568609C>A	ENSP00000355645:p.Gly50Cys		227635232	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268,PatternScan_ACTINS_1,PatternScan_ACTINS_ACT_LIKE,PatternScan_ACTINS_2	p.G50C	ENST00000366684.3	37	c.148	CCDS1578.1	1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820179	0.50633	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682;ENST00000342787	D;D	0.92805	-3.11;-3.11	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.96706	0.8925	H	0.94264	3.515	0.43540	D	0.995837	P	0.51057	0.941	P	0.59115	0.852	D	0.97869	1.0285	10	0.87932	D	0	.	16.5419	0.84395	0.0:1.0:0.0:0.0	.	50	P68133	ACTS_HUMAN	C	50	ENSP00000355645:G50C;ENSP00000355644:G50C	ENSP00000312351:G50C	G	-	1	0	ACTA1	227635232	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.651000	0.83577	2.431000	0.82371	0.655000	0.94253	GGT	-	superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268		0.622	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	protein_coding	OTTHUMT00000092781.1	C	NM_001100		227635232	-1	no_errors	NM_001100	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
UGT1A6	54578	genome.wustl.edu	37	2	234652221	234652221	+	Intron	SNP	G	G	C			TCGA-30-1857-01A-02W-0639-09	TCGA-30-1857-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cc2a574f-dc4d-42a8-9443-e9629c732e04	63bb87b6-b030-47ed-9e85-d7219ec8a137	g.chr2:234652221G>C	ENST00000305139.6	+	2	1000				UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A1_ENST00000609767.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000373424.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GGTTTCCCAAGAGGTCAAAGG	0.577																																																0			2											38.0	44.0	42.0					2																	234652221		1835	4077	5912	234316960	SO:0001627	intron_variant	414061			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23459G>C	2.37:g.234652221G>C			234316960	A6NKK6|B8K289|Q96TE7	Silent	SNP	superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ,PatternScan_DNAJ_1	p.L114	ENST00000305139.6	37	c.342	CCDS2507.1	2																																																																																			-	superfamily_DnaJ_N		0.577	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB3	protein_coding	OTTHUMT00000130988.1	G	NM_205862		234316960	-1	no_errors	NM_001001394	genbank	human	validated	54_36p	silent	SNP	1.000	C
