#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCF2	10061	broad.mit.edu	37	7	150912711	150912711	+	Nonsense_Mutation	SNP	G	G	C			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr7:150912711G>C	ENST00000287844.2	-	13	1618	c.1509C>G	c.(1507-1509)taC>taG	p.Y503*	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Nonsense_Mutation_p.Y503*	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	503	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.Y503*(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGTGAGACCGTATCGCCCAA	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	7											320.0	280.0	294.0					7																	150912711		2203	4300	6503	150543644	SO:0001587	stop_gained	10061			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1509C>G	7.37:g.150912711G>C	ENSP00000287844:p.Tyr503*		150543644	O60864|Q75MJ0|Q75MJ1|Q96TE8	Nonsense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.Y503*	ENST00000287844.2	37	c.1509	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088336	0.76756	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	.	.	.	5.76	-8.5	0.00927	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-20.8941	17.5001	0.87728	0.7003:0.0:0.2997:0.0	.	.	.	.	X	503	.	ENSP00000222388:Y503X	Y	-	3	2	ABCF2	150543644	0.001000	0.12720	0.675000	0.29917	0.486000	0.33341	-1.322000	0.02695	-1.767000	0.01300	-0.793000	0.03317	TAC	-	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran		0.517	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	protein_coding	OTTHUMT00000336086.1	G	NM_005692		150543644	-1	no_errors	NM_005692	genbank	human	reviewed	54_36p	nonsense	SNP	0.99	C
ALG10B	144245	broad.mit.edu	37	12	38710774	38710774	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr12:38710774T>A	ENST00000308742.4	+	1	395	c.79T>A	c.(79-81)Ttc>Atc	p.F27I	ALG10B_ENST00000551464.1_Missense_Mutation_p.F27I	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	27					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.F27I(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CTTCTCCGCCTTCAGCCGGGC	0.612											OREG0021733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											181.0	188.0	186.0					12																	38710774		2203	4300	6503	36997041	SO:0001583	missense	144245			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.79T>A	12.37:g.38710774T>A	ENSP00000310120:p.Phe27Ile	880	36997041	B2RPF4	Missense_Mutation	SNP	HMMPfam_DIE2_ALG10	p.F27I	ENST00000308742.4	37	c.79	CCDS31772.1	12	.	.	.	.	.	.	.	.	.	.	t	5.903	0.350718	0.11182	.	.	ENSG00000175548	ENST00000308742;ENST00000551464	T;T	0.39592	1.69;1.07	3.64	3.64	0.41730	.	0.214454	0.41500	D	0.000865	T	0.11410	0.0278	N	0.00335	-1.625	0.32608	N	0.524993	B	0.06786	0.001	B	0.01281	0.0	T	0.09773	-1.0659	10	0.23891	T	0.37	.	8.957	0.35823	0.0:0.0:0.0:1.0	.	27	Q5I7T1	AG10B_HUMAN	I	27	ENSP00000310120:F27I;ENSP00000448819:F27I	ENSP00000310120:F27I	F	+	1	0	ALG10B	36997041	0.591000	0.26824	1.000000	0.80357	0.999000	0.98932	0.614000	0.24314	1.872000	0.54250	0.533000	0.62120	TTC	-	NULL		0.612	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10B	protein_coding	OTTHUMT00000403349.1	T	NM_001013620		36997041	1	no_errors	NM_001013620	genbank	human	validated	54_36p	missense	SNP	1	A
ACACB	32	broad.mit.edu	37	12	109604778	109604778	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr12:109604778G>A	ENST00000338432.7	+	3	885	c.766G>A	c.(766-768)Ggg>Agg	p.G256R	ACACB_ENST00000377854.5_Missense_Mutation_p.G256R|ACACB_ENST00000377848.3_Missense_Mutation_p.G256R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	256					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.G256R(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	ACGCTTTGGGGGGGATCGGGT	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											76.0	71.0	73.0					12																	109604778		2203	4300	6503	108089161	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.766G>A	12.37:g.109604778G>A	ENSP00000341044:p.Gly256Arg		108089161	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	HMMPfam_CPSase_L_chain,superfamily_PreATP-grasp domain,superfamily_Glutathione synthetase ATP-binding domain-like,HMMPfam_CPSase_L_D2,PatternScan_CPSASE_1,PatternScan_CPSASE_2,superfamily_Rudiment single hybrid motif,HMMPfam_Biotin_carb_C,superfamily_Single hybrid motif,HMMPfam_Biotin_lipoyl,HMMPfam_ACC_central,superfamily_ClpP/crotonase,HMMPfam_Carboxyl_trans	p.G256R	ENST00000338432.7	37	c.766	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.417636	0.96092	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	T;T;T	0.74632	-0.86;-0.86;-0.86	5.55	5.55	0.83447	PreATP-grasp-like fold (1);	0.047809	0.85682	D	0.000000	D	0.90369	0.6986	H	0.94385	3.53	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.92699	0.6173	10	0.87932	D	0	.	19.1106	0.93315	0.0:0.0:1.0:0.0	.	256	O00763	ACACB_HUMAN	R	256	ENSP00000341044:G256R;ENSP00000367079:G256R;ENSP00000367085:G256R	ENSP00000341044:G256R	G	+	1	0	ACACB	108089161	1.000000	0.71417	0.837000	0.33122	0.958000	0.62258	9.767000	0.98960	2.596000	0.87737	0.591000	0.81541	GGG	-	NULL		0.612	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	protein_coding	OTTHUMT00000403077.1	G	NM_001093		108089161	1	no_errors	NM_001093	genbank	human	reviewed	54_36p	missense	SNP	1	A
ATAD2	29028	broad.mit.edu	37	8	124361587	124361587	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr8:124361587G>T	ENST00000287394.5	-	14	1851	c.1744C>A	c.(1744-1746)Cct>Act	p.P582T	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	582					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P582T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CGTAAAGCAGGATCTATAGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											143.0	130.0	134.0					8																	124361587		2203	4300	6503	124430768	SO:0001583	missense	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1744C>A	8.37:g.124361587G>T	ENSP00000287394:p.Pro582Thr		124430768	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	HMMPfam_Bromodomain,HMMSmart_SM00297,superfamily_Bromodomain,HMMSmart_SM00382,HMMPfam_AAA,PatternScan_AAA,HMMPfam_YL1,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P582T	ENST00000287394.5	37	c.1744	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	G	31	5.062214	0.93846	.	.	ENSG00000156802	ENST00000287394	D	0.95788	-3.81	5.7	5.7	0.88788	ATPase, AAA-type, conserved site (1);ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.051308	0.85682	D	0.000000	D	0.98021	0.9348	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98490	1.0609	10	0.87932	D	0	-18.0166	19.8338	0.96646	0.0:0.0:1.0:0.0	.	582	Q6PL18	ATAD2_HUMAN	T	582	ENSP00000287394:P582T	ENSP00000287394:P582T	P	-	1	0	ATAD2	124430768	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.692000	0.91855	0.591000	0.81541	CCT	-	HMMSmart_SM00382,HMMPfam_AAA,PatternScan_AAA,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.408	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	protein_coding	OTTHUMT00000381766.2	G	NM_014109		124430768	-1	no_errors	NM_014109	genbank	human	reviewed	54_36p	missense	SNP	1	T
CACNA1A	773	broad.mit.edu	37	19	13565965	13565965	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr19:13565965G>A	ENST00000360228.5	-	2	354	c.355C>T	c.(355-357)Cag>Tag	p.Q119*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.Q119*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	119					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.Q119*(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCAGATGCTGCTCCAGTGCG	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	19											194.0	193.0	194.0					19																	13565965		2044	4219	6263	13426965	SO:0001587	stop_gained	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.355C>T	19.37:g.13565965G>A	ENSP00000353362:p.Gln119*		13426965	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ,superfamily_Voltage-gated potassium channels	p.Q119*	ENST00000360228.5	37	c.355	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.822589	0.98510	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.4451	0.87575	0.0:0.0:1.0:0.0	.	.	.	.	X	119	.	ENSP00000317661:Q119X	Q	-	1	0	CACNA1A	13426965	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.695000	0.98691	2.489000	0.83994	0.655000	0.94253	CAG	-	superfamily_Voltage-gated potassium channels		0.433	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	G	NM_000068		13426965	-1	no_errors	ENST00000325084	ensembl	human	known	54_36p	nonsense	SNP	1	A
CDK5RAP1	51654	broad.mit.edu	37	20	31960505	31960505	+	Splice_Site	SNP	T	T	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr20:31960505T>A	ENST00000357886.4	-	11	1401		c.e11-2		CDK5RAP1_ENST00000477105.1_5'Flank|CDK5RAP1_ENST00000346416.2_Splice_Site|CDK5RAP1_ENST00000473997.1_Splice_Site|CDK5RAP1_ENST00000544843.1_Splice_Site|CDK5RAP1_ENST00000339269.5_Splice_Site			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1						brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.?(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CTTGAATATCTGCAATAAAGA	0.328																																																1	Unknown(1)	ovary(1)	20											99.0	95.0	97.0					20																	31960505		2203	4300	6503	31424166	SO:0001630	splice_region_variant	51654			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1248-2A>T	20.37:g.31960505T>A			31424166	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Splice_Site	SNP	-	e9-2	ENST00000357886.4	37	c.1206-2		20	.	.	.	.	.	.	.	.	.	.	T	17.22	3.333398	0.60853	.	.	ENSG00000101391	ENST00000427097;ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351;ENST00000544843	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3805	0.60764	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDK5RAP1	31424166	1.000000	0.71417	0.960000	0.40013	0.762000	0.43233	6.608000	0.74168	2.112000	0.64535	0.451000	0.29950	.	-	-		0.328	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	protein_coding	OTTHUMT00000078697.1	T	NM_016408	Intron	31424166	-1	no_errors	NM_016408	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
CSMD3	114788	broad.mit.edu	37	8	113403011	113403011	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sanger_PCR_WGA			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr8:113403011C>G	ENST00000297405.5	-	36	6060	c.5816G>C	c.(5815-5817)tGt>tCt	p.C1939S	CSMD3_ENST00000352409.3_Missense_Mutation_p.C1869S|CSMD3_ENST00000343508.3_Missense_Mutation_p.C1899S|CSMD3_ENST00000455883.2_Missense_Mutation_p.C1835S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1939	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C1939S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AATTCCACCACAGGGCACTGA	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											74.0	68.0	70.0					8																	113403011		2203	4300	6503	113472187	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5816G>C	8.37:g.113403011C>G	ENSP00000297405:p.Cys1939Ser		113472187	Q96PZ3	Missense_Mutation	SNP	HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,PatternScan_GLYCOSYL_HYDROL_F10,superfamily_Complement control module/SCR domain	p.C1939S	ENST00000297405.5	37	c.5816	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424488	0.43020	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	D;D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22;-4.22	5.24	4.35	0.52113	CUB (5);	0.000000	0.85682	D	0.000000	D	0.98953	0.9644	H	0.96748	3.875	0.53688	D	0.999977	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.942;0.999;0.999	D	0.99494	1.0951	10	0.41790	T	0.15	.	15.9478	0.79806	0.0:0.8648:0.1352:0.0	.	1835;1939;1899	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	1899;1939;1209;1835;1869	ENSP00000345799:C1899S;ENSP00000297405:C1939S;ENSP00000341558:C1209S;ENSP00000412263:C1835S;ENSP00000343124:C1869S	ENSP00000297405:C1939S	C	-	2	0	CSMD3	113472187	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	7.640000	0.83355	1.430000	0.47334	-0.499000	0.04595	TGT	-	HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain		0.393	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	C	NM_052900		113472187	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1	G
EPHB6	2051	broad.mit.edu	37	7	142561396	142561396	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr7:142561396G>T	ENST00000392957.2	+	6	895	c.108G>T	c.(106-108)ttG>ttT	p.L36F	EPHB6_ENST00000442129.1_Missense_Mutation_p.L36F|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	36	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.L21F(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CAGAGGTATTGCTGGACACCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											80.0	77.0	78.0					7																	142561396		2203	4300	6503	142271518	SO:0001583	missense	2051			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.108G>T	7.37:g.142561396G>T	ENSP00000376684:p.Leu36Phe		142271518	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,HMMPfam_Ephrin_lbd,HMMSmart_SM00615,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,PatternScan_EGF_2,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,HMMSmart_SM00454,HMMPfam_SAM_2,superfamily_SAM/Pointed domain	p.L21F	ENST00000392957.2	37	c.63	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	G	19.00	3.740981	0.69304	.	.	ENSG00000106123	ENST00000392957;ENST00000442129	T;T	0.20463	2.07;2.07	5.45	3.62	0.41486	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.35525	N	0.003143	T	0.42765	0.1217	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.26744	-1.0094	10	0.87932	D	0	.	8.532	0.33340	0.0745:0.0:0.6412:0.2843	.	36	O15197	EPHB6_HUMAN	F	36	ENSP00000376684:L36F;ENSP00000410789:L36F	ENSP00000376684:L36F	L	+	3	2	EPHB6	142271518	0.990000	0.36364	0.950000	0.38849	0.995000	0.86356	0.078000	0.14761	0.645000	0.30675	0.557000	0.71058	TTG	-	superfamily_Galactose-binding domain-like,HMMPfam_Ephrin_lbd,HMMSmart_SM00615		0.582	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	protein_coding	OTTHUMT00000341329.1	G			142271518	1	no_errors	NM_004445	genbank	human	reviewed	54_36p	missense	SNP	0.98	T
EYA1	2138	broad.mit.edu	37	8	72182016	72182016	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr8:72182016G>A	ENST00000340726.3	-	11	1648	c.1009C>T	c.(1009-1011)Cac>Tac	p.H337Y	EYA1_ENST00000419131.1_Missense_Mutation_p.H332Y|EYA1_ENST00000388743.2_Missense_Mutation_p.H336Y|EYA1_ENST00000303824.7_Missense_Mutation_p.H331Y|EYA1_ENST00000388742.4_Missense_Mutation_p.H337Y|EYA1_ENST00000388740.3_Missense_Mutation_p.H304Y|EYA1_ENST00000388741.2_Missense_Mutation_p.H303Y	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	337					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.H337Y(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			AGCAAGGAGTGGAAAACAATG	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											169.0	154.0	159.0					8																	72182016		2203	4300	6503	72344570	SO:0001583	missense	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1009C>T	8.37:g.72182016G>A	ENSP00000342626:p.His337Tyr		72344570	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	HMMPfam_Hydrolase	p.H337Y	ENST00000340726.3	37	c.1009	CCDS34906.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.253353	0.95336	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.86	5.86	0.93980	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.045600	0.85682	D	0.000000	D	0.91686	0.7372	M	0.79614	2.46	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.988;0.988;0.98;0.991	D;P;P;D;D	0.76575	0.988;0.87;0.87;0.956;0.92	D	0.91804	0.5454	10	0.87932	D	0	-19.0707	20.1802	0.98196	0.0:0.0:1.0:0.0	.	331;264;304;337;332	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	Y	337;337;305;304;331;303;336;332	ENSP00000373394:H337Y;ENSP00000342626:H337Y;ENSP00000373392:H304Y;ENSP00000303221:H331Y;ENSP00000373393:H303Y;ENSP00000373395:H336Y;ENSP00000410176:H332Y	ENSP00000303221:H331Y	H	-	1	0	EYA1	72344570	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.414000	0.97362	2.777000	0.95525	0.655000	0.94253	CAC	-	HMMPfam_Hydrolase		0.408	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	protein_coding	OTTHUMT00000313788.2	G	NM_000503, NM_172060		72344570	-1	no_errors	NM_000503	genbank	human	reviewed	54_36p	missense	SNP	1	A
ABHD17A	81926	broad.mit.edu	37	19	1877545	1877545	+	Silent	SNP	G	G	A	rs201913444	byFrequency	TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr19:1877545G>A	ENST00000292577.7	-	4	1102	c.669C>T	c.(667-669)ccC>ccT	p.P223P	ABHD17A_ENST00000590661.1_Missense_Mutation_p.P192L|CTB-31O20.2_ENST00000565797.1_lincRNA|ABHD17A_ENST00000250974.9_Silent_p.P274P|CTB-31O20.9_ENST00000592720.1_lincRNA	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	223						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.P274P(1)									TCTTGGTGTCGGGGAAGGCGA	0.736																																																1	Substitution - coding silent(1)	ovary(1)	19											17.0	20.0	19.0					19																	1877545		2169	4237	6406	1828545	SO:0001819	synonymous_variant	81926			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.669C>T	19.37:g.1877545G>A			1828545	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	PatternScan_TONB_DEPENDENT_REC_1,superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_2	p.P274	ENST00000292577.7	37	c.822	CCDS45902.1	19																																																																																			-	HMMPfam_Abhydrolase_2,superfamily_alpha/beta-Hydrolases		0.736	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM108A1	protein_coding	OTTHUMT00000415556.2	G	NM_031213		1828545	-1	no_errors	NM_031213	genbank	human	validated	54_36p	silent	SNP	1	A
FAM73A	374986	broad.mit.edu	37	1	78309037	78309037	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr1:78309037G>T	ENST00000370791.3	+	8	973	c.941G>T	c.(940-942)gGc>gTc	p.G314V	FAM73A_ENST00000443751.2_Missense_Mutation_p.G276V	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	314						integral component of membrane (GO:0016021)		p.G314V(1)		breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		GAAGACTTTGGCCTGCGAGAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											142.0	135.0	138.0					1																	78309037		2203	4300	6503	78081625	SO:0001583	missense	374986				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.941G>T	1.37:g.78309037G>T	ENSP00000359827:p.Gly314Val		78081625	Q6MZG0	Missense_Mutation	SNP	HMMPfam_DUF2217	p.G314V	ENST00000370791.3	37	c.941	CCDS681.1	1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.593546	0.28357	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.22336	1.96;1.96	5.98	5.01	0.66863	.	0.340327	0.36200	N	0.002737	T	0.12561	0.0305	L	0.52573	1.65	0.58432	D	0.999998	B;B;P;B	0.38827	0.161;0.193;0.649;0.193	B;B;B;B	0.39258	0.079;0.129;0.295;0.129	T	0.02464	-1.1155	10	0.29301	T	0.29	1.7477	14.3926	0.66989	0.0:0.0:0.8527:0.1473	.	276;314;314;314	F8W7S1;B7ZLZ8;Q8NAN2-2;Q8NAN2	.;.;.;FA73A_HUMAN	V	314;276	ENSP00000359827:G314V;ENSP00000393675:G276V	ENSP00000359827:G314V	G	+	2	0	FAM73A	78081625	1.000000	0.71417	0.995000	0.50966	0.760000	0.43138	2.855000	0.48333	2.838000	0.97847	0.655000	0.94253	GGC	-	HMMPfam_DUF2217		0.408	FAM73A-001	KNOWN	basic|CCDS	protein_coding	FAM73A	protein_coding	OTTHUMT00000026931.1	G	NM_198549		78081625	1	no_errors	NM_198549	genbank	human	predicted	54_36p	missense	SNP	0.97	T
FAT2	2196	broad.mit.edu	37	5	150891889	150891889	+	Silent	SNP	A	A	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr5:150891889A>G	ENST00000261800.5	-	20	11754	c.11742T>C	c.(11740-11742)gaT>gaC	p.D3914D	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3914	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D3914D(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCACGACAGCATCCAGGCAGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	5											79.0	76.0	77.0					5																	150891889		2203	4300	6503	150872082	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11742T>C	5.37:g.150891889A>G			150872082	O75091|Q9NSR7	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.D3914	ENST00000261800.5	37	c.11742	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	A	9.723	1.160120	0.21454	.	.	ENSG00000086570	ENST00000520200	.	.	.	5.16	1.51	0.23008	.	.	.	.	.	T	0.57330	0.2046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50792	-0.8786	4	.	.	.	.	9.0108	0.36139	0.6276:0.0:0.3724:0.0	.	.	.	.	R	687	.	.	C	-	1	0	FAT2	150872082	0.979000	0.34478	0.992000	0.48379	0.950000	0.60333	0.174000	0.16743	0.381000	0.24851	0.533000	0.62120	TGC	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2		0.602	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	A	NM_001447		150872082	-1	no_errors	NM_001447	genbank	human	reviewed	54_36p	silent	SNP	0.95	G
FPGS	2356	broad.mit.edu	37	9	130569338	130569338	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr9:130569338G>A	ENST00000373247.2	+	5	523	c.473G>A	c.(472-474)cGc>cAc	p.R158H	FPGS_ENST00000373245.1_Missense_Mutation_p.R158H|FPGS_ENST00000373225.3_Missense_Mutation_p.R108H|FPGS_ENST00000393706.2_Missense_Mutation_p.R158H|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	158					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)	p.R158H(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TACTTCTGGCGCCTCTACCAC	0.642																																																1	Substitution - Missense(1)	ovary(1)	9											79.0	75.0	76.0					9																	130569338		2203	4300	6503	129609159	SO:0001583	missense	2356				CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.473G>A	9.37:g.130569338G>A	ENSP00000362344:p.Arg158His		129609159	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	superfamily_MurD-like peptide ligases catalytic domain,PatternScan_FOLYLPOLYGLU_SYNT_1,PatternScan_FOLYLPOLYGLU_SYNT_2,HMMPfam_Mur_ligase_C,superfamily_MurD-like peptide ligases peptide-binding domain	p.R158H	ENST00000373247.2	37	c.473	CCDS35148.1	9	.	.	.	.	.	.	.	.	.	.	g	12.92	2.082301	0.36758	.	.	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228;ENST00000373225;ENST00000431857;ENST00000423577	T;T;T;T;T	0.32272	2.91;1.46;2.91;1.46;2.49	5.45	-2.91	0.05631	Mur ligase, central (2);	0.487574	0.24917	N	0.034571	T	0.18425	0.0442	L	0.44542	1.39	0.24754	N	0.992968	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.08006	-1.0743	10	0.42905	T	0.14	7.0E-4	3.7748	0.08656	0.5254:0.1043:0.2534:0.1169	.	158;158	Q05932-4;Q05932	.;FOLC_HUMAN	H	158;158;158;158;108;108;108	ENSP00000362344:R158H;ENSP00000362342:R158H;ENSP00000377309:R158H;ENSP00000362325:R158H;ENSP00000362322:R108H	ENSP00000362322:R108H	R	+	2	0	FPGS	129609159	0.991000	0.36638	0.867000	0.34043	0.595000	0.36748	1.127000	0.31357	-1.009000	0.03400	-0.405000	0.06341	CGC	-	superfamily_MurD-like peptide ligases catalytic domain		0.642	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	protein_coding	OTTHUMT00000054251.1	G			129609159	1	no_errors	NM_004957	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
GABPA	2551	broad.mit.edu	37	21	27121366	27121366	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr21:27121366T>C	ENST00000354828.3	+	4	769	c.242T>C	c.(241-243)tTa>tCa	p.L81S	GABPA_ENST00000487266.1_3'UTR|GABPA_ENST00000400075.3_Missense_Mutation_p.L81S	NM_001197297.1	NP_001184226.1	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa	81					cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.L81S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						GAACGAAGTTTATTTGACCAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	21											84.0	80.0	81.0					21																	27121366		2203	4296	6499	26043237	SO:0001583	missense	2551				CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000354828.3:c.242T>C	21.37:g.27121366T>C	ENSP00000346886:p.Leu81Ser		26043237	Q12939	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMPfam_SAM_PNT,HMMSmart_SM00251,superfamily_Winged helix DNA-binding domain,HMMPfam_Ets,HMMSmart_SM00413,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2	p.L81S	ENST00000354828.3	37	c.242	CCDS13575.1	21	.	.	.	.	.	.	.	.	.	.	T	21.0	4.085342	0.76642	.	.	ENSG00000154727	ENST00000354828;ENST00000400075	T;T	0.35605	1.3;1.3	4.73	4.73	0.59995	GA-binding protein alpha subunit, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.59715	0.2214	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63866	-0.6540	10	0.59425	D	0.04	.	14.3334	0.66572	0.0:0.0:0.0:1.0	.	81	Q06546	GABPA_HUMAN	S	81	ENSP00000346886:L81S;ENSP00000382948:L81S	ENSP00000346886:L81S	L	+	2	0	GABPA	26043237	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.120000	0.77153	2.107000	0.64212	0.445000	0.29226	TTA	-	NULL		0.323	GABPA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GABPA	protein_coding	OTTHUMT00000171365.1	T	NM_002040		26043237	1	no_errors	NM_002040	genbank	human	validated	54_36p	missense	SNP	1	C
GPRC6A	222545	broad.mit.edu	37	6	117127585	117127585	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr6:117127585T>C	ENST00000310357.3	-	3	1304	c.1283A>G	c.(1282-1284)gAt>gGt	p.D428G	GPRC6A_ENST00000368549.3_Missense_Mutation_p.D428G|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	428					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D428G(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TTGACACAGATCCCGAATGGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	6											110.0	95.0	100.0					6																	117127585		2203	4299	6502	117234278	SO:0001583	missense	222545			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1283A>G	6.37:g.117127585T>C	ENSP00000309493:p.Asp428Gly		117234278	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3	p.D428G	ENST00000310357.3	37	c.1283	CCDS5112.1	6	.	.	.	.	.	.	.	.	.	.	T	10.39	1.337121	0.24253	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.86297	-2.1;-2.1	5.48	5.48	0.80851	Extracellular ligand-binding receptor (1);	0.128312	0.36167	N	0.002755	T	0.74543	0.3730	L	0.45698	1.435	0.80722	D	1	B;B	0.15473	0.013;0.009	B;B	0.16289	0.011;0.015	T	0.73445	-0.3980	10	0.41790	T	0.15	.	10.3723	0.44062	0.0:0.0815:0.0:0.9185	.	428;428	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	G	428	ENSP00000309493:D428G;ENSP00000357537:D428G	ENSP00000309493:D428G	D	-	2	0	GPRC6A	117234278	0.977000	0.34250	0.997000	0.53966	0.610000	0.37248	1.866000	0.39489	2.307000	0.77673	0.528000	0.53228	GAT	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.468	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	protein_coding	OTTHUMT00000041966.2	T			117234278	-1	no_errors	NM_148963	genbank	human	validated	54_36p	missense	SNP	0.97	C
HSPA2	3306	broad.mit.edu	37	14	65008786	65008786	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr14:65008786G>A	ENST00000394709.1	+	2	1295	c.1219G>A	c.(1219-1221)Gag>Aag	p.E407K	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.E407K			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	407					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)	p.E407K(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GCTGGGCATCGAGACAGCTGG	0.607																																					Pancreas(136;1211 1835 24894 31984 38227)											1	Substitution - Missense(1)	ovary(1)	14											76.0	68.0	71.0					14																	65008786		2203	4300	6503	64078539	SO:0001583	missense	3306			L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1219G>A	14.37:g.65008786G>A	ENSP00000378199:p.Glu407Lys		64078539	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	superfamily_SSF53067,HMMPfam_HSP70,PatternScan_HSP70_1,PatternScan_HSP70_2,PatternScan_HSP70_3,superfamily_SSF100920,superfamily_SSF100934	p.E407K	ENST00000394709.1	37	c.1219	CCDS9766.1	14	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696546	0.68386	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01228	5.14;5.14	5.11	5.11	0.69529	.	0.000000	0.53938	U	0.000041	T	0.17450	0.0419	H	0.97291	3.975	0.53688	D	0.999978	D	0.89917	1.0	D	0.91635	0.999	T	0.31447	-0.9943	10	0.87932	D	0	-0.1546	18.6095	0.91279	0.0:0.0:1.0:0.0	.	407	P54652	HSP72_HUMAN	K	407;407;181	ENSP00000378199:E407K;ENSP00000247207:E407K	ENSP00000247207:E407K	E	+	1	0	HSPA2	64078539	1.000000	0.71417	0.998000	0.56505	0.476000	0.33039	9.865000	0.99609	2.395000	0.81488	0.558000	0.71614	GAG	-	HMMPfam_HSP70,superfamily_SSF100920		0.607	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	protein_coding	OTTHUMT00000280651.1	G			64078539	1	no_errors	NM_021979	genbank	human	validated	54_36p	missense	SNP	1	A
LYPD6B	130576	broad.mit.edu	37	2	150069509	150069509	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr2:150069509C>T	ENST00000409029.1	+	6	462	c.260C>T	c.(259-261)aCa>aTa	p.T87I	LYPD6B_ENST00000409876.1_Missense_Mutation_p.T87I|LYPD6B_ENST00000280115.7_Missense_Mutation_p.T111I|LYPD6B_ENST00000498249.1_3'UTR|LYPD6B_ENST00000409642.3_Missense_Mutation_p.T111I			Q8NI32	LPD6B_HUMAN	LY6/PLAUR domain containing 6B	87	UPAR/Ly6.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.T111I(1)		endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11						TGCCTAGATACACAGTACTGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	72.0	72.0					2																	150069509		1971	4164	6135	149777755	SO:0001583	missense	130576				CCDS46423.1	2q23.2	2012-07-20			ENSG00000150556	ENSG00000150556			27018	protein-coding gene	gene with protein product	"""cancer/testis antigen 116"""					18360792	Standard	NM_177964		Approved	CT116, LYPD7	uc002twv.1	Q8NI32	OTTHUMG00000153743	ENST00000409029.1:c.260C>T	2.37:g.150069509C>T	ENSP00000386650:p.Thr87Ile		149777755	D3DP90|Q53TK0|Q7Z747|Q8IXK7	Missense_Mutation	SNP	superfamily_SSF57302,HMMSmart_LU	p.T111I	ENST00000409029.1	37	c.332		2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415256	0.83449	.	.	ENSG00000150556	ENST00000409642;ENST00000409876;ENST00000409029;ENST00000280115	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.66	5.66	0.87406	Ly-6 antigen / uPA receptor -like (1);	0.125142	0.52532	D	0.000072	T	0.43077	0.1231	M	0.70275	2.135	0.48901	D	0.999725	D;D	0.63046	0.984;0.992	P;P	0.59703	0.77;0.862	T	0.13683	-1.0500	9	.	.	.	-15.9635	17.2354	0.86997	0.0:1.0:0.0:0.0	.	87;111	Q8NI32;Q8NI32-2	LPD6B_HUMAN;.	I	111;87;87;111	ENSP00000387077:T111I;ENSP00000386479:T87I;ENSP00000386650:T87I;ENSP00000280115:T111I	.	T	+	2	0	LYPD6B	149777755	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	6.117000	0.71577	2.674000	0.91012	0.655000	0.94253	ACA	-	superfamily_SSF57302,HMMSmart_LU		0.383	LYPD6B-003	KNOWN	alternative_5_UTR|basic	protein_coding	LYPD6B	protein_coding	OTTHUMT00000332299.2	C	NM_177964		149777755	1	no_errors	NM_177964	genbank	human	provisional	54_36p	missense	SNP	1	T
LZTS2	84445	broad.mit.edu	37	10	102763470	102763470	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr10:102763470T>A	ENST00000370220.1	+	2	3678	c.615T>A	c.(613-615)ttT>ttA	p.F205L	LZTS2_ENST00000370223.3_Missense_Mutation_p.F205L					leucine zipper, putative tumor suppressor 2									p.F68L(1)|p.F205L(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CCCTGGCATTTAGTGGCTGGG	0.637																																					Esophageal Squamous(8;38 437 13604 19902 37640)											2	Substitution - Missense(2)	ovary(2)	10											116.0	141.0	132.0					10																	102763470		2203	4299	6502	102753460	SO:0001583	missense	84445			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.615T>A	10.37:g.102763470T>A	ENSP00000359240:p.Phe205Leu		102753460		Missense_Mutation	SNP	HMMPfam_Fez1	p.F205L	ENST00000370220.1	37	c.615	CCDS7507.1	10	.	.	.	.	.	.	.	.	.	.	T	9.635	1.137520	0.21123	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.27256	1.68;1.68	5.12	2.2	0.27929	.	0.421096	0.24927	N	0.034491	T	0.05090	0.0136	N	0.00436	-1.5	0.22940	N	0.998533	B	0.02656	0.0	B	0.01281	0.0	T	0.36744	-0.9735	10	0.11485	T	0.65	-7.7833	4.2692	0.10778	0.1427:0.1235:0.6018:0.1319	.	205	Q9BRK4	LZTS2_HUMAN	L	205	ENSP00000359243:F205L;ENSP00000359240:F205L	ENSP00000314437:F205L	F	+	3	2	LZTS2	102753460	0.992000	0.36948	1.000000	0.80357	0.936000	0.57629	0.582000	0.23834	0.253000	0.21552	-1.222000	0.01597	TTT	-	NULL		0.637	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	protein_coding	OTTHUMT00000049872.1	T	XM_046743		102753460	1	no_errors	NM_032429	genbank	human	provisional	54_36p	missense	SNP	0.96	A
MED12L	116931	broad.mit.edu	37	3	150911297	150911297	+	Silent	SNP	A	A	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr3:150911297A>G	ENST00000474524.1	+	14	2027	c.1989A>G	c.(1987-1989)ggA>ggG	p.G663G	MED12L_ENST00000422248.2_Silent_p.G663G|MED12L_ENST00000273432.4_Silent_p.G523G|MED12L_ENST00000309237.4_Silent_p.G698G	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	663						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.G663G(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTATGCCTGGAGAATCCTGTG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	67.0	68.0					3																	150911297		2203	4300	6503	152393987	SO:0001819	synonymous_variant	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1989A>G	3.37:g.150911297A>G			152393987	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	HMMPfam_Med12	p.G663	ENST00000474524.1	37	c.1989	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	A	9.942	1.217802	0.22373	.	.	ENSG00000144893	ENST00000480026	.	.	.	5.37	4.2	0.49525	.	.	.	.	.	T	0.49372	0.1553	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43909	-0.9362	4	.	.	.	-5.9181	4.5225	0.11966	0.6342:0.1621:0.2037:0.0	.	.	.	.	G	13	.	.	R	+	1	2	MED12L	152393987	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.843000	0.27640	0.953000	0.37825	0.533000	0.62120	AGA	-	NULL		0.388	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	A	NM_053002		152393987	1	no_errors	NM_053002	genbank	human	validated	54_36p	silent	SNP	1	G
MON2	23041	broad.mit.edu	37	12	62972241	62972241	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr12:62972241C>A	ENST00000393632.2	+	31	4922	c.4531C>A	c.(4531-4533)Ctc>Atc	p.L1511I	MON2_ENST00000393630.3_Missense_Mutation_p.L1512I|MON2_ENST00000546600.1_Missense_Mutation_p.L1511I|MON2_ENST00000393629.2_Missense_Mutation_p.L1505I|MON2_ENST00000280379.6_Missense_Mutation_p.L1512I|MON2_ENST00000552738.1_Missense_Mutation_p.L1482I	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1511					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.L1511I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TCCAGATAATCTCTCTATTCA	0.274																																																1	Substitution - Missense(1)	ovary(1)	12											24.0	24.0	24.0					12																	62972241		2200	4280	6480	61258508	SO:0001583	missense	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4531C>A	12.37:g.62972241C>A	ENSP00000377252:p.Leu1511Ile		61258508	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_DUF1981	p.L1511I	ENST00000393632.2	37	c.4531	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635552	0.67130	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.58210	0.36;0.36;0.35;0.35;0.36;0.36	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	L	0.50333	1.59	0.80722	D	1	B;B;B;B;B	0.31290	0.213;0.208;0.208;0.276;0.318	B;B;B;B;B	0.36030	0.107;0.216;0.153;0.163;0.216	T	0.46205	-0.9208	9	.	.	.	-6.8704	19.7297	0.96177	0.0:1.0:0.0:0.0	.	1505;1482;1511;380;1511	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	I	1511;1512;1512;1511;1482;1505	ENSP00000377252:L1511I;ENSP00000377250:L1512I;ENSP00000280379:L1512I;ENSP00000447407:L1511I;ENSP00000449215:L1482I;ENSP00000377249:L1505I	.	L	+	1	0	MON2	61258508	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.687000	0.61708	2.658000	0.90341	0.650000	0.86243	CTC	-	superfamily_ARM-type_fold		0.274	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	protein_coding	OTTHUMT00000406767.3	C	NM_015026		61258508	1	no_errors	NM_015026	genbank	human	validated	54_36p	missense	SNP	1	A
MS4A8	83661	broad.mit.edu	37	11	60470943	60470943	+	Nonsense_Mutation	SNP	C	C	G	rs144254483		TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr11:60470943C>G	ENST00000300226.2	+	3	515	c.312C>G	c.(310-312)taC>taG	p.Y104*		NM_031457.1	NP_113645.1	Q9BY19	M4A8_HUMAN	membrane-spanning 4-domains, subfamily A, member 8	104						integral component of membrane (GO:0016021)		p.Y104*(1)									TTTCATTCTACGGAGGCTTTC	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	11											145.0	137.0	140.0					11																	60470943		2203	4300	6503	60227519	SO:0001587	stop_gained	83661			AF237905	CCDS7990.1	11q12	2013-03-01	2013-03-01	2013-03-01	ENSG00000166959	ENSG00000166959			13380	protein-coding gene	gene with protein product		606549	"""membrane-spanning 4-domains, subfamily A, member 8B"""	MS4A8B		11245982, 11401424	Standard	NM_031457		Approved	MS4A4, CD20L5	uc001npv.3	Q9BY19	OTTHUMG00000167686	ENST00000300226.2:c.312C>G	11.37:g.60470943C>G	ENSP00000300226:p.Tyr104*		60227519	Q8TCA5	Nonsense_Mutation	SNP	HMMPfam_CD20	p.Y104*	ENST00000300226.2	37	c.312	CCDS7990.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.178|4.178	0.031611|0.031611	0.08101|0.08101	.|.	.|.	ENSG00000166959|ENSG00000166959	ENST00000525458|ENST00000300226;ENST00000529752	.|.	.|.	.|.	3.62|3.62	-6.53|-6.53	0.01866|0.01866	.|.	.|1.355710	.|0.04604	.|N	.|0.399131	T|.	0.06005|.	0.0156|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.27468|.	-1.0073|.	3|.	.|0.02654	.|T	.|1	-1.3113|-1.3113	2.3175|2.3175	0.04202|0.04202	0.1341:0.2077:0.1332:0.5251|0.1341:0.2077:0.1332:0.5251	.|.	.|.	.|.	.|.	R|X	86|104	.|.	.|ENSP00000300226:Y104X	T|Y	+|+	2|3	0|2	MS4A8B|MS4A8B	60227519|60227519	0.000000|0.000000	0.05858|0.05858	0.626000|0.626000	0.29213|0.29213	0.263000|0.263000	0.26337|0.26337	-3.553000|-3.553000	0.00433|0.00433	-0.913000|-0.913000	0.03832|0.03832	0.491000|0.491000	0.48974|0.48974	ACG|TAC	-	HMMPfam_CD20		0.567	MS4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A8B	protein_coding	OTTHUMT00000395605.1	C			60227519	1	no_errors	NM_031457	genbank	human	reviewed	54_36p	nonsense	SNP	0.45	G
NF1	4763	broad.mit.edu	37	17	29654605	29654605	+	Nonsense_Mutation	SNP	C	C	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sanger_PCR_WGA			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr17:29654605C>A	ENST00000358273.4	+	38	5740	c.5357C>A	c.(5356-5358)tCg>tAg	p.S1786*	NF1_ENST00000356175.3_Nonsense_Mutation_p.S1765*|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1786	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.S1786L(2)|p.S1786*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATTATGCTTCGGAAATTGAA	0.458			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)|Substitution - Nonsense(1)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|ovary(1)	17	GRCh37	CS001442	NF1	S							88.0	86.0	86.0					17																	29654605		2203	4300	6503	26678731	SO:0001587	stop_gained	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5357C>A	17.37:g.29654605C>A	ENSP00000351015:p.Ser1786*		26678731	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	HMMSmart_SM00516,HMMPfam_RasGAP,HMMSmart_SM00323,PatternScan_RAS_GTPASE_ACTIV_1,superfamily_GTPase activation domain GAP	p.S1786*	ENST00000358273.4	37	c.5357	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	43	10.372301	0.99393	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5155	0.95162	0.0:1.0:0.0:0.0	.	.	.	.	X	1786;1765;1431	.	ENSP00000348498:S1765X	S	+	2	0	NF1	26678731	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.456000	0.80751	2.846000	0.97976	0.644000	0.83932	TCG	-	NULL		0.458	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	C	NM_000267		26678731	1	no_errors	NM_001042492	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
OVCH1	341350	broad.mit.edu	37	12	29630329	29630329	+	Silent	SNP	T	T	C	rs373966834		TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr12:29630329T>C	ENST00000318184.5	-	11	1190	c.1191A>G	c.(1189-1191)gaA>gaG	p.E397E	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	397	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.E397E(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TGCCACTGTCTTCTGTATCAG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	12											146.0	141.0	142.0					12																	29630329		1943	4152	6095	29521596	SO:0001819	synonymous_variant	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1191A>G	12.37:g.29630329T>C			29521596		Silent	SNP	HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,HMMPfam_Trypsin,HMMSmart_SM00020,superfamily_Trypsin-like serine proteases,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.E397	ENST00000318184.5	37	c.1191		12																																																																																			-	superfamily_Spermadhesin CUB domain		0.438	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	protein_coding	OTTHUMT00000395997.2	T	NM_183378		29521596	-1	no_errors	NM_183378	genbank	human	validated	54_36p	silent	SNP	0	C
NUAK1	9891	broad.mit.edu	37	12	106461475	106461475	+	Missense_Mutation	SNP	C	C	T	rs145399889		TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr12:106461475C>T	ENST00000261402.2	-	7	2470	c.1091G>A	c.(1090-1092)cGg>cAg	p.R364Q		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	364					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.R364Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						CGACCGCTGCCGCTCTAGCAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	12						T	GLN/ARG	0,4406		0,0,2203	86.0	84.0	85.0		1091	4.8	1.0	12	dbSNP_134	85	3,8597	3.0+/-9.4	0,3,4297	yes	missense	NUAK1	NM_014840.2	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign	364/662	106461475	3,13003	2203	4300	6503	104985605	SO:0001583	missense	9891			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1091G>A	12.37:g.106461475C>T	ENSP00000261402:p.Arg364Gln		104985605	A7MD39|Q96KA8	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R364Q	ENST00000261402.2	37	c.1091	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	c	15.74	2.922628	0.52653	0.0	3.49E-4	ENSG00000074590	ENST00000261402;ENST00000553094	T;T	0.74421	-0.84;1.28	5.67	4.79	0.61399	Protein kinase-like domain (1);	0.108410	0.39687	N	0.001295	T	0.63838	0.2545	L	0.43152	1.355	0.39998	D	0.975131	P	0.36990	0.577	B	0.31614	0.133	T	0.67074	-0.5762	10	0.56958	D	0.05	.	10.9839	0.47510	0.0:0.8579:0.0:0.1421	.	364	O60285	NUAK1_HUMAN	Q	364;79	ENSP00000261402:R364Q;ENSP00000446873:R79Q	ENSP00000261402:R364Q	R	-	2	0	NUAK1	104985605	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	2.542000	0.45744	1.411000	0.46957	-0.215000	0.12644	CGG	-	NULL		0.547	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	protein_coding	OTTHUMT00000405767.2	C	NM_014840		104985605	-1	no_errors	NM_014840	genbank	human	validated	54_36p	missense	SNP	1	T
PCDHA5	56143	broad.mit.edu	37	5	140202018	140202018	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr5:140202018G>A	ENST00000529859.1	+	1	658	c.658G>A	c.(658-660)Gaa>Aaa	p.E220K	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.E220K|PCDHA5_ENST00000378126.3_Missense_Mutation_p.E220K|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E220K(3)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAAAACCCGAACTAACAGG	0.358																																																3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	5											98.0	104.0	102.0					5																	140202018		2203	4300	6503	140182202	SO:0001583	missense	56143			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.658G>A	5.37:g.140202018G>A	ENSP00000436557:p.Glu220Lys		140182202	O75284|Q8N4R3	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.E220K	ENST00000529859.1	37	c.658	CCDS54917.1	5	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413802	0.42817	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.51325	0.71;0.71;0.71	4.02	4.02	0.46733	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.51941	0.1704	M	0.64567	1.98	0.09310	N	1	P;P;P	0.44627	0.827;0.839;0.839	P;B;B	0.48704	0.587;0.241;0.175	T	0.47394	-0.9121	9	0.66056	D	0.02	.	7.8112	0.29232	0.0898:0.164:0.7462:0.0	.	220;220;220	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	K	220	ENSP00000433416:E220K;ENSP00000436557:E220K;ENSP00000367366:E220K	ENSP00000367366:E220K	E	+	1	0	PCDHA5	140182202	0.000000	0.05858	1.000000	0.80357	0.960000	0.62799	0.341000	0.19909	1.946000	0.56461	0.591000	0.81541	GAA	-	superfamily_Cadherin-like,HMMSmart_SM00112,HMMPfam_Cadherin		0.358	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	protein_coding	OTTHUMT00000372883.2	G	NM_018908		140182202	1	no_errors	NM_018908	genbank	human	reviewed	54_36p	missense	SNP	0.54	A
PCDHGB1	56104	broad.mit.edu	37	5	140731005	140731005	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr5:140731005C>A	ENST00000523390.1	+	1	1178	c.1178C>A	c.(1177-1179)aCc>aAc	p.T393N	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	393	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T393N(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAGAATCCACCTCGAAGAAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											57.0	58.0	58.0					5																	140731005		1931	4138	6069	140711189	SO:0001583	missense	56104			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1178C>A	5.37:g.140731005C>A	ENSP00000429273:p.Thr393Asn		140711189	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.T393N	ENST00000523390.1	37	c.1178	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	12.00	1.807780	0.31961	.	.	ENSG00000254221	ENST00000523390	T	0.20200	2.09	5.49	4.6	0.57074	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.25158	0.0611	L	0.45137	1.4	0.18873	N	0.999989	B;B	0.31383	0.321;0.257	B;B	0.36030	0.138;0.216	T	0.20240	-1.0281	9	0.72032	D	0.01	.	15.4794	0.75514	0.1399:0.8601:0.0:0.0	.	393;393	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	N	393	ENSP00000429273:T393N	ENSP00000429273:T393N	T	+	2	0	PCDHGB1	140711189	0.000000	0.05858	0.474000	0.27266	0.760000	0.43138	1.175000	0.31944	1.403000	0.46800	0.563000	0.77884	ACC	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.458	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	protein_coding	OTTHUMT00000374740.1	C	NM_018922		140711189	1	no_errors	NM_018922	genbank	human	reviewed	54_36p	missense	SNP	0.05	A
PLEKHG1	57480	broad.mit.edu	37	6	151055188	151055188	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr6:151055188C>A	ENST00000358517.2	+	2	582	c.371C>A	c.(370-372)aCc>aAc	p.T124N	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.T124N			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	124	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T124N(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ATTCTGGAAACCGAAAGGACT	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											77.0	85.0	83.0					6																	151055188		2203	4300	6503	151096881	SO:0001583	missense	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.371C>A	6.37:g.151055188C>A	ENSP00000351318:p.Thr124Asn		151096881	Q5T1F2	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.T124N	ENST00000358517.2	37	c.371	CCDS34552.1	6	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712554	0.89112	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.77620	-1.11;-1.11	5.66	4.8	0.61643	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.88800	0.6535	M	0.92833	3.35	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.91839	0.5482	9	.	.	.	.	14.8863	0.70572	0.0:0.931:0.0:0.069	.	124;124	Q5JYA6;Q9ULL1	.;PKHG1_HUMAN	N	124	ENSP00000356297:T124N;ENSP00000351318:T124N	.	T	+	2	0	PLEKHG1	151096881	1.000000	0.71417	0.891000	0.34965	0.985000	0.73830	7.173000	0.77612	1.535000	0.49220	0.655000	0.94253	ACC	-	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325		0.458	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	protein_coding	OTTHUMT00000042691.1	C			151096881	1	no_errors	NM_001029884	genbank	human	provisional	54_36p	missense	SNP	1	A
PRKD1	5587	broad.mit.edu	37	14	30100191	30100191	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr14:30100191C>T	ENST00000331968.5	-	10	1658	c.1429G>A	c.(1429-1431)Gta>Ata	p.V477I	PRKD1_ENST00000415220.2_Missense_Mutation_p.V485I	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	477	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.V477I(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GAAGTTTTTACTGGTTCCAGA	0.328																																																1	Substitution - Missense(1)	ovary(1)	14											75.0	78.0	77.0					14																	30100191		2203	4300	6503	29169942	SO:0001583	missense	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1429G>A	14.37:g.30100191C>T	ENSP00000333568:p.Val477Ile		29169942	A6NL64|B2RAF6	Missense_Mutation	SNP	superfamily_SSF57889,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.V477I	ENST00000331968.5	37	c.1429	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541764	0.45280	.	.	ENSG00000184304	ENST00000331968;ENST00000415220;ENST00000546371	T;T;T	0.22945	1.93;1.93;1.93	5.32	4.44	0.53790	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.16342	0.0393	N	0.12182	0.205	0.21762	N	0.999556	B	0.17038	0.02	B	0.16722	0.016	T	0.16958	-1.0385	10	0.44086	T	0.13	-1.5023	14.2479	0.65999	0.0:0.9278:0.0:0.0722	.	477	Q15139	KPCD1_HUMAN	I	477;485;58	ENSP00000333568:V477I;ENSP00000390535:V485I;ENSP00000447333:V58I	ENSP00000333568:V477I	V	-	1	0	PRKD1	29169942	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	3.697000	0.54764	1.383000	0.46405	0.655000	0.94253	GTA	-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.328	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	protein_coding	OTTHUMT00000276611.2	C	NM_002742		29169942	-1	no_errors	NM_002742	genbank	human	validated	54_36p	missense	SNP	1	T
SALL4	57167	broad.mit.edu	37	20	50408255	50408255	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr20:50408255G>C	ENST00000217086.4	-	2	878	c.767C>G	c.(766-768)aCt>aGt	p.T256S	SALL4_ENST00000395997.3_Missense_Mutation_p.T256S|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	256					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T256S(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGTCTTCAGAGTGTCGGCCCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											33.0	32.0	32.0					20																	50408255		2203	4300	6503	49841662	SO:0001583	missense	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.767C>G	20.37:g.50408255G>C	ENSP00000217086:p.Thr256Ser		49841662	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.T256S	ENST00000217086.4	37	c.767	CCDS13438.1	20	.	.	.	.	.	.	.	.	.	.	G	4.556	0.103164	0.08731	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.68181	-0.31;-0.31	5.29	4.33	0.51752	.	0.834516	0.10311	N	0.690007	T	0.62648	0.2445	L	0.44542	1.39	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.001	T	0.53308	-0.8457	10	0.45353	T	0.12	-15.0846	15.6479	0.77068	0.0:0.1379:0.8621:0.0	.	256;256	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	S	256	ENSP00000217086:T256S;ENSP00000379319:T256S	ENSP00000217086:T256S	T	-	2	0	SALL4	49841662	0.999000	0.42202	0.116000	0.21606	0.029000	0.11900	9.272000	0.95707	1.213000	0.43380	-0.165000	0.13383	ACT	-	NULL		0.602	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	protein_coding	OTTHUMT00000079738.3	G			49841662	-1	no_errors	NM_020436	genbank	human	reviewed	54_36p	missense	SNP	0.98	C
SDK1	221935	broad.mit.edu	37	7	4089017	4089017	+	Silent	SNP	C	C	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr7:4089017C>T	ENST00000404826.2	+	18	2779	c.2640C>T	c.(2638-2640)gcC>gcT	p.A880A	SDK1_ENST00000389531.3_Silent_p.A880A	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	880	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A880A(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGACGGAAGCCGTGAACTCCA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	7											89.0	76.0	80.0					7																	4089017		2203	4300	6503	4055543	SO:0001819	synonymous_variant	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2640C>T	7.37:g.4089017C>T			4055543	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMPfam_I-set,HMMPfam_ig,superfamily_Immunoglobulin	p.A880	ENST00000404826.2	37	c.2640	CCDS34590.1	7																																																																																			-	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III		0.592	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744		4055543	1	no_errors	NM_152744	genbank	human	validated	54_36p	silent	SNP	0.68	T
TAOK1	57551	broad.mit.edu	37	17	27869612	27869612	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr17:27869612C>T	ENST00000261716.3	+	20	3097	c.2578C>T	c.(2578-2580)Cgc>Tgc	p.R860C	TAOK1_ENST00000536202.1_Missense_Mutation_p.R712C	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	860				R -> C (in Ref. 1; AAG38502). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.R860C(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			GCAGAATGAGCGCACAGAACG	0.378																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	112.0	114.0					17																	27869612		2203	4300	6503	24893738	SO:0001583	missense	57551			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.2578C>T	17.37:g.27869612C>T	ENSP00000261716:p.Arg860Cys		24893738	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R860C	ENST00000261716.3	37	c.2578	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755700	0.69648	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.68624	-0.34;-0.34	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.84674	0.5524	M	0.87180	2.865	0.48395	D	0.999649	D;B	0.89917	1.0;0.196	D;B	0.71414	0.973;0.04	D	0.86921	0.2067	10	0.87932	D	0	.	19.5531	0.95330	0.0:1.0:0.0:0.0	.	712;860	B7ZLV6;Q7L7X3	.;TAOK1_HUMAN	C	860;712	ENSP00000261716:R860C;ENSP00000438819:R712C	ENSP00000261716:R860C	R	+	1	0	TAOK1	24893738	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.772000	0.85439	2.623000	0.88846	0.561000	0.74099	CGC	-	superfamily_Protein kinase-like (PK-like)		0.378	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	protein_coding	OTTHUMT00000447790.1	C	NM_020791		24893738	1	no_errors	NM_020791	genbank	human	validated	54_36p	missense	SNP	1	T
TCHHL1	126637	broad.mit.edu	37	1	152059451	152059451	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr1:152059451T>G	ENST00000368806.1	-	3	771	c.707A>C	c.(706-708)gAt>gCt	p.D236A		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	236							calcium ion binding (GO:0005509)	p.D236A(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GGCTGGTTCATCTCCTTCCTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											150.0	135.0	140.0					1																	152059451		2203	4300	6503	150326075	SO:0001583	missense	126637				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.707A>C	1.37:g.152059451T>G	ENSP00000357796:p.Asp236Ala		150326075	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	PatternScan_S100_CABP,superfamily_SSF47473,HMMPfam_S_100	p.D236A	ENST00000368806.1	37	c.707	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	11.76	1.735520	0.30774	.	.	ENSG00000182898	ENST00000368806	T	0.26518	1.73	5.1	-4.14	0.03892	.	1.066260	0.07419	N	0.893608	T	0.05777	0.0151	L	0.57536	1.79	0.09310	N	1	P	0.35575	0.51	B	0.26094	0.066	T	0.30357	-0.9981	10	0.16896	T	0.51	0.2487	5.3807	0.16189	0.0:0.3383:0.2813:0.3804	.	236	Q5QJ38	TCHL1_HUMAN	A	236	ENSP00000357796:D236A	ENSP00000357796:D236A	D	-	2	0	TCHHL1	150326075	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.600000	0.05693	-0.340000	0.08388	-0.377000	0.06932	GAT	-	NULL		0.463	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	protein_coding	OTTHUMT00000036638.2	T	XM_060104		150326075	-1	no_errors	NM_001008536	genbank	human	provisional	54_36p	missense	SNP	0	G
TMEM63C	57156	broad.mit.edu	37	14	77715782	77715782	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr14:77715782C>G	ENST00000298351.4	+	21	2163	c.2019C>G	c.(2017-2019)ttC>ttG	p.F673L		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	673					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)	p.F673L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		GGATGCTGTTCTTCTCCATCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	118.0	118.0					14																	77715782		2123	4222	6345	76785535	SO:0001583	missense	57156				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.2019C>G	14.37:g.77715782C>G	ENSP00000298351:p.Phe673Leu		76785535	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	HMMPfam_DUF221	p.F673L	ENST00000298351.4	37	c.2019	CCDS45141.1	14	.	.	.	.	.	.	.	.	.	.	C	33	5.203308	0.95033	.	.	ENSG00000165548	ENST00000298351;ENST00000536110	T	0.24538	1.85	5.4	5.4	0.78164	Domain of unknown function DUF221 (1);	0.000000	0.85682	D	0.000000	T	0.44286	0.1286	M	0.67700	2.07	0.80722	D	1	P	0.50272	0.933	P	0.62014	0.897	T	0.32877	-0.9890	10	0.02654	T	1	-33.4729	19.1798	0.93619	0.0:1.0:0.0:0.0	.	673	Q9P1W3	TM63C_HUMAN	L	673;243	ENSP00000298351:F673L	ENSP00000298351:F673L	F	+	3	2	TMEM63C	76785535	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	3.749000	0.55150	2.537000	0.85549	0.561000	0.74099	TTC	-	HMMPfam_DUF221		0.567	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	protein_coding	OTTHUMT00000414193.1	C			76785535	1	no_errors	NM_020431	genbank	human	validated	54_36p	missense	SNP	1	G
TP53	7157	broad.mit.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	C	T			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sanger_PCR_WGA			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr17:7578176C>T	ENST00000269305.4	-	6	862		c.e6+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(56)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAACCAGACCTCAGGCGGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Unknown(56)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	ovary(12)|upper_aerodigestive_tract(10)|lung(8)|biliary_tract(5)|endometrium(5)|large_intestine(4)|oesophagus(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|cervix(1)|soft_tissue(1)|skin(1)|pancreas(1)	17	GRCh37	CS071266	TP53	S							80.0	75.0	77.0					17																	7578176		2203	4300	6503	7518901	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>A	17.37:g.7578176C>T			7518901	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5+1	ENST00000269305.4	37	c.672+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024476	0.75390	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.205	0.59790	0.1605:0.8394:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518901	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.775000	0.85489	1.321000	0.45227	0.563000	0.77884	.	-	-		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7518901	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
TOP2A	7153	broad.mit.edu	37	17	38546267	38546267	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sanger_PCR_WGA			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr17:38546267C>A	ENST00000423485.1	-	34	4575	c.4417G>T	c.(4417-4419)Gat>Tat	p.D1473Y	Y_RNA_ENST00000410949.1_RNA	NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1473					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)	p.D1473Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GAGTCAGAATCATCAGAAGTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	17											70.0	66.0	67.0					17																	38546267		1906	4123	6029	35799793	SO:0001583	missense	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.4417G>T	17.37:g.38546267C>A	ENSP00000411532:p.Asp1473Tyr		35799793	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase,HMMPfam_HATPase_c,HMMSmart_SM00433,superfamily_Ribosomal protein S5 domain 2-like,HMMPfam_DNA_gyraseB,superfamily_Type II DNA topoisomerase,PatternScan_TOPOISOMERASE_II,HMMSmart_SM00434,HMMPfam_DNA_topoisoIV,HMMPfam_DTHCT	p.D1473Y	ENST00000423485.1	37	c.4417	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812792	0.70912	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.51071	0.72	5.67	4.69	0.59074	DTHCT (1);	0.411135	0.30620	N	0.009225	T	0.52500	0.1738	L	0.55481	1.735	0.40566	D	0.981252	P	0.42203	0.773	P	0.48524	0.58	T	0.58451	-0.7634	10	0.87932	D	0	.	12.0361	0.53425	0.0:0.9179:0.0:0.0821	.	1473	P11388	TOP2A_HUMAN	Y	1473;1553;1496;1510	ENSP00000411532:D1473Y	ENSP00000269577:D1553Y	D	-	1	0	TOP2A	35799793	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.671000	0.46842	1.497000	0.48584	0.591000	0.81541	GAT	-	HMMPfam_DTHCT		0.428	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	protein_coding	OTTHUMT00000338035.1	C			35799793	-1	no_errors	NM_001067	genbank	human	reviewed	54_36p	missense	SNP	1	A
TPP2	7174	broad.mit.edu	37	13	103330652	103330652	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr13:103330652T>G	ENST00000376065.4	+	29	3772	c.3736T>G	c.(3736-3738)Tat>Gat	p.Y1246D	RP11-29B2.5_ENST00000602560.1_lincRNA|TPP2_ENST00000376052.3_Missense_Mutation_p.Y1259D|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1246					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.Y1246D(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCTCCCGATTATTGCGTATT	0.308																																																1	Substitution - Missense(1)	ovary(1)	13											96.0	94.0	95.0					13																	103330652		2203	4300	6503	102128653	SO:0001583	missense	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3736T>G	13.37:g.103330652T>G	ENSP00000365233:p.Tyr1246Asp		102128653	Q5VZU8	Missense_Mutation	SNP	PatternScan_SUBTILASE_ASP,superfamily_Pept_S8_S53,HMMPfam_Peptidase_S8,PatternScan_SUBTILASE_HIS,PatternScan_SUBTILASE_SER	p.Y1246D	ENST00000376065.4	37	c.3736	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	T	17.33	3.363355	0.61513	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.77	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.61961	0.2389	L	0.43923	1.385	0.58432	D	0.999997	D	0.64830	0.994	P	0.55161	0.77	T	0.64643	-0.6359	9	0.72032	D	0.01	.	12.5465	0.56203	0.1249:0.0:0.0:0.8751	.	1246	P29144	TPP2_HUMAN	D	1246;1259	.	ENSP00000365220:Y1259D	Y	+	1	0	TPP2	102128653	1.000000	0.71417	0.981000	0.43875	0.908000	0.53690	7.438000	0.80431	1.093000	0.41377	0.533000	0.62120	TAT	-	NULL		0.308	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	protein_coding	OTTHUMT00000045683.2	T			102128653	1	no_errors	NM_003291	genbank	human	reviewed	54_36p	missense	SNP	1	G
UBR5	51366	broad.mit.edu	37	8	103354762	103354762	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr8:103354762T>C	ENST00000520539.1	-	9	1643	c.1037A>G	c.(1036-1038)aAg>aGg	p.K346R	UBR5_ENST00000220959.4_Missense_Mutation_p.K346R|UBR5_ENST00000521922.1_Missense_Mutation_p.K340R	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	346					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.K346R(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGGTGTATTCTTCTTATCCAA	0.418																																					Ovarian(131;96 1741 5634 7352 27489)											1	Substitution - Missense(1)	ovary(1)	8											191.0	178.0	183.0					8																	103354762		2203	4300	6503	103423938	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1037A>G	8.37:g.103354762T>C	ENSP00000429084:p.Lys346Arg		103423938	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	HMMPfam_HECT,HMMSmart_HECTc,superfamily_HECT,HMMPfam_PABP,HMMSmart_PolyA,superfamily_PABP_HYD,HMMPfam_zf-UBR,HMMSmart_ZnF_UBR1	p.K346R	ENST00000520539.1	37	c.1037	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002336	0.74932	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.48201	0.84;0.84;0.82	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.58090	0.2098	L	0.42744	1.35	0.53688	D	0.999979	P;P	0.52842	0.956;0.956	P;P	0.62184	0.899;0.899	T	0.54938	-0.8218	10	0.34782	T	0.22	.	15.4455	0.75225	0.0:0.0:0.0:1.0	.	340;346	E7EMW7;O95071	.;UBR5_HUMAN	R	346;346;340	ENSP00000429084:K346R;ENSP00000220959:K346R;ENSP00000427819:K340R	ENSP00000220959:K346R	K	-	2	0	UBR5	103423938	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.997000	0.88414	2.110000	0.64415	0.533000	0.62120	AAG	-	NULL		0.418	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	protein_coding	OTTHUMT00000380075.2	T	NM_015902		103423938	-1	no_errors	NM_015902	genbank	human	reviewed	54_36p	missense	SNP	1	C
USP25	29761	broad.mit.edu	37	21	17199305	17199305	+	Silent	SNP	A	A	G			TCGA-30-1862-01A-02W-0699-08	TCGA-30-1862-10A-01W-0699-08	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	---			Illumina GAIIx	f2dfa869-39e1-4e54-8adf-c2b5428753bb	02e93152-8b3e-45a1-b1a7-ae8ab12d105d	g.chr21:17199305A>G	ENST00000285679.6	+	14	1845	c.1476A>G	c.(1474-1476)gaA>gaG	p.E492E	USP25_ENST00000400183.2_Silent_p.E492E|USP25_ENST00000285681.2_Silent_p.E492E|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	492	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.E492E(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GCACAACAGAACAACAGGGAG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	21											115.0	106.0	109.0					21																	17199305		2203	4300	6503	16121176	SO:0001819	synonymous_variant	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1476A>G	21.37:g.17199305A>G			16121176	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	superfamily_UBA-like,HMMPfam_UIM,HMMSmart_SM00726,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.E492	ENST00000285679.6	37	c.1476	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	A	9.753	1.168086	0.21621	.	.	ENSG00000155313	ENST00000453553	.	.	.	4.5	-1.72	0.08107	.	.	.	.	.	T	0.51398	0.1672	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44421	-0.9329	4	.	.	.	.	7.0616	0.25129	0.3612:0.1535:0.4853:0.0	.	.	.	.	S	21	.	.	N	+	2	0	USP25	16121176	0.964000	0.33143	0.945000	0.38365	0.940000	0.58332	0.071000	0.14594	-0.190000	0.10465	0.455000	0.32223	AAC	-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.413	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	protein_coding	OTTHUMT00000157964.1	A			16121176	1	no_errors	NM_013396	genbank	human	validated	54_36p	silent	SNP	1	G
