#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SIRT3	23410	genome.wustl.edu	37	11	236209	236209	+	Silent	SNP	A	A	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:236209A>T	ENST00000382743.4	-	1	222	c.120T>A	c.(118-120)ctT>ctA	p.L40L	PSMD13_ENST00000352303.5_5'Flank|PSMD13_ENST00000532097.1_5'Flank|SIRT3_ENST00000524564.1_Silent_p.L40L|SIRT3_ENST00000529382.1_Intron|SIRT3_ENST00000525319.1_Silent_p.L40L|PSMD13_ENST00000431206.2_5'Flank|SIRT3_ENST00000532956.1_Silent_p.L40L|SIRT3_ENST00000528702.1_Intron	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	40					aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		CCCTGCCGCCAAGCACCAGCC	0.751																																																0			11											7.0	10.0	9.0					11																	236209		2085	4097	6182	226209	SO:0001819	synonymous_variant	23410			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.120T>A	11.37:g.236209A>T			226209	B7Z5U6|Q9Y6E8	Silent	SNP	superfamily_SSF52467,HMMPfam_SIR2	p.L40	ENST00000382743.4	37	c.120	CCDS7691.1	11																																																																																			-	NULL		0.751	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	protein_coding	OTTHUMT00000239288.3	A			226209	-1	no_errors	NM_012239	genbank	human	validated	54_36p	silent	SNP	0.002	T
PIGG	54872	genome.wustl.edu	37	4	527631	527631	+	Missense_Mutation	SNP	G	G	A	rs140960241		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr4:527631G>A	ENST00000453061.2	+	12	2702	c.2596G>A	c.(2596-2598)Gtg>Atg	p.V866M	PIGG_ENST00000310340.5_Missense_Mutation_p.V858M|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000504346.1_Missense_Mutation_p.V777M|PIGG_ENST00000383028.4_Missense_Mutation_p.V733M	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	866					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CATTGCCACCGTGGACATCTC	0.582																																																0			4											139.0	108.0	119.0					4																	527631		2203	4300	6503	517631	SO:0001583	missense	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.2596G>A	4.37:g.527631G>A	ENSP00000415203:p.Val866Met		517631	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	superfamily_Alkaline_phosphatase_core	p.V858M	ENST00000453061.2	37	c.2572	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555157	0.65425	.	.	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000453065	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.78	3.84	0.44239	.	0.212761	0.39274	N	0.001406	T	0.53546	0.1803	M	0.77103	2.36	0.80722	D	1	D;P;P	0.64830	0.994;0.76;0.846	P;B;B	0.55965	0.788;0.148;0.285	T	0.56637	-0.7946	10	0.56958	D	0.05	-16.3221	6.6078	0.22735	0.1114:0.0:0.7112:0.1774	.	733;866;858	Q5H8A4-3;Q5H8A4;Q5H8A4-2	.;PIGG_HUMAN;.	M	858;866;777;733;22	ENSP00000311750:V858M;ENSP00000415203:V866M;ENSP00000424800:V777M;ENSP00000372494:V733M	ENSP00000311750:V858M	V	+	1	0	PIGG	517631	1.000000	0.71417	0.943000	0.38184	0.938000	0.57974	4.136000	0.58004	1.455000	0.47813	0.655000	0.94253	GTG	-	NULL		0.582	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	protein_coding	OTTHUMT00000357494.1	G	NM_017733		517631	+1	no_errors	NM_017733	genbank	human	validated	54_36p	missense	SNP	0.925	A
LRRC56	115399	genome.wustl.edu	37	11	552165	552165	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:552165G>A	ENST00000270115.7	+	12	1614	c.1114G>A	c.(1114-1116)Gac>Aac	p.D372N		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	372								p.D372Y(1)		kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCAGAGCCTGACCCTGCAGA	0.662																																																1	Substitution - Missense(1)	lung(1)	11											39.0	44.0	42.0					11																	552165		2200	4299	6499	542165	SO:0001583	missense	115399				CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1114G>A	11.37:g.552165G>A	ENSP00000270115:p.Asp372Asn		542165	Q8N3Q4	Missense_Mutation	SNP	superfamily_SSF52075,HMMPfam_LRR_1,HMMSmart_LRRcap	p.D372N	ENST00000270115.7	37	c.1114	CCDS7700.1	11	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028838	0.75504	.	.	ENSG00000161328	ENST00000270115	T	0.12569	2.67	4.38	2.5	0.30297	.	1.058730	0.07412	N	0.892577	T	0.10508	0.0257	L	0.29908	0.895	0.09310	N	1	B	0.21821	0.061	B	0.15870	0.014	T	0.34403	-0.9830	10	0.39692	T	0.17	-0.6605	6.0944	0.20013	0.3172:0.0:0.6828:0.0	.	372	Q8IYG6	LRC56_HUMAN	N	372	ENSP00000270115:D372N	ENSP00000270115:D372N	D	+	1	0	LRRC56	542165	0.044000	0.20184	0.006000	0.13384	0.666000	0.39218	2.308000	0.43690	0.601000	0.29879	0.561000	0.74099	GAC	-	NULL		0.662	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC56	protein_coding	OTTHUMT00000254969.1	G	NM_198075		542165	+1	no_errors	NM_198075	genbank	human	validated	54_36p	missense	SNP	0.003	A
AZU1	566	genome.wustl.edu	37	19	830900	830900	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:830900G>C	ENST00000233997.2	+	4	574	c.553G>C	c.(553-555)Gtg>Ctg	p.V185L		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	185	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCAACAACGTGTGCACCGG	0.667																																																0			19											36.0	35.0	35.0					19																	830900		2203	4299	6502	781900	SO:0001583	missense	566			X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.553G>C	19.37:g.830900G>C	ENSP00000233997:p.Val185Leu		781900	P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,superfamily_Pept_Ser_Cys	p.V185L	ENST00000233997.2	37	c.553	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	G	7.857	0.725235	0.15439	.	.	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.87571	-2.27	1.51	-3.03	0.05429	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.63295	0.2499	N	0.01874	-0.695	0.09310	N	1	P	0.40180	0.705	B	0.37780	0.258	T	0.60525	-0.7246	9	0.10902	T	0.67	.	9.1169	0.36764	0.0:0.6274:0.3726:0.0	.	185	P20160	CAP7_HUMAN	L	199;185	ENSP00000233997:V185L	ENSP00000233997:V185L	V	+	1	0	AZU1	781900	0.037000	0.19845	0.000000	0.03702	0.007000	0.05969	-0.202000	0.09451	-0.815000	0.04346	-0.270000	0.10280	GTG	-	HMMSmart_Tryp_SPc,HMMPfam_Trypsin,superfamily_Pept_Ser_Cys		0.667	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	protein_coding	OTTHUMT00000457472.2	G	NM_001700		781900	+1	no_errors	NM_001700	genbank	human	reviewed	54_36p	missense	SNP	0.029	C
C19orf24	55009	genome.wustl.edu	37	19	1278880	1278880	+	3'UTR	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:1278880G>C	ENST00000409293.4	+	0	1026				C19orf24_ENST00000469144.1_Missense_Mutation_p.C24S	NM_017914.3	NP_060384.3	Q9BVV8	CS024_HUMAN	chromosome 19 open reading frame 24							cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)							Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATTCCCCTGCTGGCCCCGG	0.682																																																0			19											51.0	51.0	51.0					19																	1278880		2202	4298	6500	1229880	SO:0001624	3_prime_UTR_variant	55009			BC000890	CCDS12060.2	19p13.3	2012-10-24			ENSG00000228300	ENSG00000228300			26073	protein-coding gene	gene with protein product						16847563	Standard	NM_017914		Approved	FLJ20640	uc002lrw.4	Q9BVV8	OTTHUMG00000153928	ENST00000409293.4:c.*104G>C	19.37:g.1278880G>C			1229880	Q9NWS2	Missense_Mutation	SNP	NULL	p.C24S	ENST00000409293.4	37	c.71	CCDS12060.2	19	.	.	.	.	.	.	.	.	.	.	G	5.426	0.263734	0.10294	.	.	ENSG00000226593	ENST00000416408	.	.	.	2.2	1.14	0.20703	.	.	.	.	.	T	0.25005	0.0607	.	.	.	.	.	.	B	0.32010	0.351	B	0.20384	0.029	T	0.30446	-0.9978	6	0.87932	D	0	.	3.8684	0.09025	0.2208:0.0:0.7792:0.0	.	24	D6W5Y7	.	S	24	.	ENSP00000407816:C24S	C	+	2	0	AC004258.1	1229880	0.051000	0.20477	0.036000	0.18154	0.024000	0.10985	1.515000	0.35845	1.190000	0.43042	0.462000	0.41574	TGC	-	NULL		0.682	C19orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf24	protein_coding	OTTHUMT00000333049.2	G	NM_017914		1229880	+1	no_errors	NM_017914	genbank	human	validated	54_36p	missense	SNP	0.005	C
CNTN6	27255	genome.wustl.edu	37	3	1339577	1339577	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr3:1339577G>A	ENST00000446702.2	+	7	1290	c.663G>A	c.(661-663)gtG>gtA	p.V221V	CNTN6_ENST00000539053.1_Silent_p.V149V|CNTN6_ENST00000350110.2_Silent_p.V221V			Q9UQ52	CNTN6_HUMAN	contactin 6	221					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TAACAGGTGTGATGGGGGAAT	0.353																																																0			3											116.0	123.0	121.0					3																	1339577		2203	4300	6503	1314577	SO:0001819	synonymous_variant	27255			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.663G>A	3.37:g.1339577G>A			1314577	Q2KHM2	Silent	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.V221	ENST00000446702.2	37	c.663	CCDS2557.1	3																																																																																			-	NULL		0.353	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	protein_coding	OTTHUMT00000239235.2	G	NM_014461		1314577	+1	no_errors	NM_014461	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
PXDN	7837	genome.wustl.edu	37	2	1652438	1652438	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:1652438G>A	ENST00000252804.4	-	17	3164	c.3114C>T	c.(3112-3114)atC>atT	p.I1038I		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1038					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCTCCCCCAGGATCTTCGGGA	0.617																																																0			2											33.0	38.0	37.0					2																	1652438		2189	4272	6461	1631445	SO:0001819	synonymous_variant	7837			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3114C>T	2.37:g.1652438G>A			1631445	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1	p.I1038	ENST00000252804.4	37	c.3114	CCDS46221.1	2																																																																																			-	superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase		0.617	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	protein_coding	OTTHUMT00000322505.1	G	XM_056455		1631445	-1	no_errors	NM_012293	genbank	human	validated	54_36p	silent	SNP	0.981	A
ITFG2	55846	genome.wustl.edu	37	12	2930926	2930926	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr12:2930926C>G	ENST00000228799.2	+	9	1055	c.916C>G	c.(916-918)Cag>Gag	p.Q306E	ITFG2_ENST00000542548.1_Missense_Mutation_p.Q194E|ITFG2_ENST00000419778.2_Missense_Mutation_p.Q129E	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	306					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GGTGGATCACCAGCTCTTTGC	0.537																																																0			12											138.0	129.0	132.0					12																	2930926		2203	4300	6503	2801187	SO:0001583	missense	55846			AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.916C>G	12.37:g.2930926C>G	ENSP00000228799:p.Gln306Glu		2801187	A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMPfam_FG-GAP	p.Q306E	ENST00000228799.2	37	c.916	CCDS8513.1	12	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250358	0.59212	.	.	ENSG00000111203	ENST00000228799;ENST00000419778;ENST00000542548	T;T;T	0.70282	-0.47;2.33;2.33	5.21	5.21	0.72293	.	0.054843	0.85682	D	0.000000	T	0.72534	0.3472	M	0.74647	2.275	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.71104	-0.4689	10	0.59425	D	0.04	-6.9827	17.8095	0.88611	0.0:1.0:0.0:0.0	.	306	Q969R8	ITFG2_HUMAN	E	306;129;194	ENSP00000228799:Q306E;ENSP00000401103:Q129E;ENSP00000437870:Q194E	ENSP00000228799:Q306E	Q	+	1	0	ITFG2	2801187	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.760000	0.85248	2.439000	0.82584	0.449000	0.29647	CAG	-	NULL		0.537	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG2	protein_coding	OTTHUMT00000253091.1	C	NM_018463		2801187	+1	no_errors	NM_018463	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TUBB2BP1	100132153	genome.wustl.edu	37	6	3177715	3177715	+	IGR	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:3177715T>A								TUBB2A (19955 upstream) : RP1-40E16.9 (5262 downstream)																							AGGGTGCCCATCCCGGACCCC	0.617																																																0			6																																								3122714	SO:0001628	intergenic_variant	0																															6.37:g.3177715T>A			3122714		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.617					LOC100132153			T			3122714	-1	pseudogene	XR_036965	genbank	human	model	54_36p	rna	SNP	1.000	A
ITGAE	3682	genome.wustl.edu	37	17	3662784	3662784	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:3662784G>T	ENST00000263087.4	-	8	876	c.778C>A	c.(778-780)Cag>Aag	p.Q260K		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	260	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ATCACATCCTGGCTGTCCCGA	0.572																																					NSCLC(182;635 2928 8995 38788)											0			17											147.0	117.0	127.0					17																	3662784		2203	4300	6503	3609533	SO:0001583	missense	3682			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.778C>A	17.37:g.3662784G>T	ENSP00000263087:p.Gln260Lys		3609533	Q17RS6|Q9NZU9	Missense_Mutation	SNP	superfamily_SSF69318,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMSmart_Int_alpha,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.Q260K	ENST00000263087.4	37	c.778	CCDS32531.1	17	.	.	.	.	.	.	.	.	.	.	G	8.279	0.815050	0.16607	.	.	ENSG00000083457	ENST00000263087	D	0.82893	-1.66	5.47	1.72	0.24424	von Willebrand factor, type A (3);	.	.	.	.	T	0.68091	0.2963	N	0.20685	0.6	0.23435	N	0.997688	P	0.34462	0.454	B	0.38156	0.266	T	0.56135	-0.8029	9	0.05436	T	0.98	.	9.1348	0.36868	0.0:0.2535:0.5641:0.1824	.	260	P38570	ITAE_HUMAN	K	260	ENSP00000263087:Q260K	ENSP00000263087:Q260K	Q	-	1	0	ITGAE	3609533	0.929000	0.31497	0.998000	0.56505	0.970000	0.65996	0.513000	0.22770	0.715000	0.32103	0.609000	0.83330	CAG	-	superfamily_SSF69318,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA		0.572	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ITGAE	protein_coding	OTTHUMT00000438169.1	G	NM_002208		3609533	-1	no_errors	NM_002208	genbank	human	reviewed	54_36p	missense	SNP	0.883	T
ZMYND15	84225	genome.wustl.edu	37	17	4645731	4645731	+	Silent	SNP	A	A	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:4645731A>T	ENST00000433935.1	+	5	1146	c.1089A>T	c.(1087-1089)gcA>gcT	p.A363A	ZMYND15_ENST00000592813.1_Silent_p.A363A|CXCL16_ENST00000574412.1_5'Flank|CXCL16_ENST00000293778.6_5'Flank|ZMYND15_ENST00000573751.2_Silent_p.A363A|ZMYND15_ENST00000269289.6_Silent_p.A363A	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	363					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CAAGGCTTGCAGCCTTCATGG	0.562																																																0			17											103.0	97.0	99.0					17																	4645731		2203	4300	6503	4592480	SO:0001819	synonymous_variant	84225			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.1089A>T	17.37:g.4645731A>T			4592480	B4DXY5|I3L296	Silent	SNP	PatternScan_ZF_MYND_1,HMMPfam_zf-MYND	p.A363	ENST00000433935.1	37	c.1089	CCDS45584.1	17																																																																																			-	NULL		0.562	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND15	protein_coding	OTTHUMT00000439580.1	A	NM_032265		4592480	+1	no_errors	NM_032265	genbank	human	provisional	54_36p	silent	SNP	0.996	T
TP53	7157	genome.wustl.edu	37	17	7576855	7576855	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:7576855G>A	ENST00000269305.4	-	9	1180	c.991C>T	c.(991-993)Cag>Tag	p.Q331*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q331*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	331	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		Q -> H (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q331*(23)|p.0?(8)|p.Q331fs*6(2)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTAGTACCTGAAGGGTGAAA	0.448		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Substitution - Nonsense(23)|Whole gene deletion(8)|Insertion - Frameshift(2)|Unknown(1)	lung(6)|large_intestine(4)|urinary_tract(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|skin(2)|ovary(2)|stomach(1)|breast(1)|oesophagus(1)	17											115.0	108.0	110.0					17																	7576855		2203	4300	6503	7517580	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.991C>T	17.37:g.7576855G>A	ENSP00000269305:p.Gln331*		7517580	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.Q331*	ENST00000269305.4	37	c.991	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117678	0.77323	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.95	2.88	0.33553	.	0.253251	0.40469	N	0.001098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-17.7352	9.751	0.40475	0.0:0.0:0.4869:0.5131	.	.	.	.	X	331;331;331;331;331;320;199	.	ENSP00000269305:Q331X	Q	-	1	0	TP53	7517580	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.858000	0.39408	0.557000	0.29117	-0.314000	0.08810	CAG	-	HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain		0.448	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517580	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.990	A
PPFIBP2	8495	genome.wustl.edu	37	11	7661068	7661068	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:7661068C>T	ENST00000299492.4	+	15	1730	c.1342C>T	c.(1342-1344)Cct>Tct	p.P448S	PPFIBP2_ENST00000528883.1_Missense_Mutation_p.P336S|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.P305S|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Missense_Mutation_p.P290S	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	448					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CATCTGCCAGCCTGACGCCAC	0.572																																																0			11											81.0	82.0	82.0					11																	7661068		2201	4296	6497	7617644	SO:0001583	missense	8495			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1342C>T	11.37:g.7661068C>T	ENSP00000299492:p.Pro448Ser		7617644	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	HMMPfam_Integrase_DNA,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1,HMMPfam_SAM_2	p.P448S	ENST00000299492.4	37	c.1342	CCDS31419.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.49|11.49	1.655033|1.655033	0.29425|0.29425	.|.	.|.	ENSG00000166387|ENSG00000166387	ENST00000534409|ENST00000299492;ENST00000533792;ENST00000537467;ENST00000541115;ENST00000528883;ENST00000530181;ENST00000530081	.|T;T;T;T	.|0.29397	.|2.0;1.58;1.99;1.57	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.887919	.|0.09875	.|N	.|0.744382	T|T	0.26702|0.26702	0.0653|0.0653	L|L	0.43152|0.43152	1.355|1.355	0.31229|0.31229	N|N	0.69652|0.69652	.|B;B;B;B;B;B	.|0.19331	.|0.027;0.001;0.035;0.001;0.001;0.019	.|B;B;B;B;B;B	.|0.16289	.|0.007;0.001;0.015;0.001;0.002;0.007	T|T	0.18524|0.18524	-1.0334|-1.0334	5|10	.|0.06891	.|T	.|0.86	-0.4494|-0.4494	14.7129|14.7129	0.69247|0.69247	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|336;336;371;290;305;448	.|E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.|.;.;.;.;.;LIPB2_HUMAN	V|S	127|448;290;290;371;336;305;92	.|ENSP00000299492:P448S;ENSP00000436498:P290S;ENSP00000435469:P336S;ENSP00000437321:P305S	.|ENSP00000299492:P448S	A|P	+|+	2|1	0|0	PPFIBP2|PPFIBP2	7617644|7617644	0.000000|0.000000	0.05858|0.05858	0.840000|0.840000	0.33206|0.33206	0.055000|0.055000	0.15305|0.15305	0.470000|0.470000	0.22084|0.22084	2.743000|2.743000	0.94032|0.94032	0.650000|0.650000	0.86243|0.86243	GCC|CCT	-	NULL		0.572	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	protein_coding	OTTHUMT00000385345.2	C	NM_003621		7617644	+1	no_errors	NM_003621	genbank	human	validated	54_36p	missense	SNP	0.384	T
ADCY2	108	genome.wustl.edu	37	5	7826926	7826926	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr5:7826926C>T	ENST00000338316.4	+	25	3307	c.3218C>T	c.(3217-3219)aCg>aTg	p.T1073M	ADCY2_ENST00000537121.1_Missense_Mutation_p.T893M	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1073					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GACCTGAAGACGTACTTTGTA	0.488																																																0			5											121.0	101.0	108.0					5																	7826926		2203	4300	6503	7879926	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3218C>T	5.37:g.7826926C>T	ENSP00000342952:p.Thr1073Met		7879926	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1,HMMPfam_DUF1053	p.T1073M	ENST00000338316.4	37	c.3218	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955553	0.92726	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	D;D	0.82803	-1.65;-1.65	5.76	5.76	0.90799	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.000000	0.85682	D	0.000000	D	0.92987	0.7768	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93562	0.6896	10	0.87932	D	0	.	19.9504	0.97197	0.0:1.0:0.0:0.0	.	893;1073	B7Z2C1;Q08462	.;ADCY2_HUMAN	M	1073;185;906;893	ENSP00000342952:T1073M;ENSP00000444803:T893M	ENSP00000342952:T1073M	T	+	2	0	ADCY2	7879926	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.584000	0.82572	2.720000	0.93068	0.591000	0.81541	ACG	-	HMMPfam_Guanylate_cyc,superfamily_A/G_cyclase		0.488	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	C	NM_020546		7879926	+1	no_errors	NM_020546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ALOX15B	247	genome.wustl.edu	37	17	7951805	7951805	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:7951805C>T	ENST00000380183.4	+	14	2092	c.1953C>T	c.(1951-1953)atC>atT	p.I651I	ALOX15B_ENST00000380173.2_Silent_p.I622I|ALOX15B_ENST00000572022.1_Silent_p.I639I|ALOX15B_ENST00000573359.1_Silent_p.I577I	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	651	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CGAGGGGCATCCAGGAGCGGA	0.647																																																0			17											80.0	84.0	83.0					17																	7951805		2203	4300	6503	7892530	SO:0001819	synonymous_variant	247			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1953C>T	17.37:g.7951805C>T			7892530	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Silent	SNP	HMMPfam_PLAT,HMMSmart_SM00308,superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),superfamily_Lipoxigenase,HMMPfam_Lipoxygenase,PatternScan_LIPOXYGENASE_1,PatternScan_LIPOXYGENASE_2,PatternScan_IG_MHC	p.I651	ENST00000380183.4	37	c.1953	CCDS11128.1	17																																																																																			-	superfamily_Lipoxigenase,HMMPfam_Lipoxygenase		0.647	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	protein_coding	OTTHUMT00000226985.2	C			7892530	+1	no_errors	NM_001141	genbank	human	reviewed	54_36p	silent	SNP	0.710	T
OR1M1	125963	genome.wustl.edu	37	19	9204363	9204363	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:9204363T>C	ENST00000429566.3	+	1	509	c.443T>C	c.(442-444)cTc>cCc	p.L148P		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GTCGGCGCCCTCTGGGCGTTT	0.587																																																0			19											110.0	90.0	97.0					19																	9204363		2203	4300	6503	9065363	SO:0001583	missense	125963				CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.443T>C	19.37:g.9204363T>C	ENSP00000401966:p.Leu148Pro		9065363	B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L148P	ENST00000429566.3	37	c.443	CCDS32896.1	19	.	.	.	.	.	.	.	.	.	.	c	5.642	0.303189	0.10678	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.38240	1.15	3.9	0.555	0.17247	GPCR, rhodopsin-like superfamily (1);	0.627745	0.15102	N	0.280470	T	0.13543	0.0328	N	0.02973	-0.45	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16958	-1.0385	10	0.51188	T	0.08	.	4.6256	0.12476	0.1438:0.5034:0.0:0.3528	.	148	Q8NGA1	OR1M1_HUMAN	P	151;148	ENSP00000401966:L148P	ENSP00000303195:L151P	L	+	2	0	OR1M1	9065363	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.257000	0.01180	-0.117000	0.11872	-0.779000	0.03376	CTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.587	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1M1	protein_coding	OTTHUMT00000448993.1	T			9065363	+1	no_errors	NM_001004456	genbank	human	provisional	54_36p	missense	SNP	0.001	C
C16orf72	29035	genome.wustl.edu	37	16	9186006	9186006	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:9186006C>G	ENST00000327827.7	+	1	502	c.105C>G	c.(103-105)gaC>gaG	p.D35E		NM_014117.2	NP_054836.2	Q14CZ0	CP072_HUMAN	chromosome 16 open reading frame 72	35										endometrium(4)|large_intestine(2)|lung(2)	8						CCGAACAGGACGAGCAGCTGC	0.706																																																0			16											9.0	14.0	13.0					16																	9186006		2077	4076	6153	9093507	SO:0001583	missense	29035			AK123266	CCDS10538.1	16p13.2	2012-11-19			ENSG00000182831	ENSG00000182831			30103	protein-coding gene	gene with protein product						8889548	Standard	NM_014117		Approved	FLJ41272, PRO0149	uc002czm.3	Q14CZ0	OTTHUMG00000178147	ENST00000327827.7:c.105C>G	16.37:g.9186006C>G	ENSP00000331720:p.Asp35Glu		9093507		Missense_Mutation	SNP	NULL	p.D35E	ENST00000327827.7	37	c.105	CCDS10538.1	16	.	.	.	.	.	.	.	.	.	.	C	2.021	-0.424793	0.04734	.	.	ENSG00000182831	ENST00000327827	T	0.40225	1.04	3.19	0.595	0.17490	.	0.406006	0.26983	N	0.021512	T	0.05731	0.0150	N	0.00092	-2.175	0.29882	N	0.825917	B	0.02656	0.0	B	0.01281	0.0	T	0.35624	-0.9781	10	0.02654	T	1	-0.019	1.896	0.03257	0.1506:0.3418:0.3656:0.142	.	35	Q14CZ0	CP072_HUMAN	E	35	ENSP00000331720:D35E	ENSP00000331720:D35E	D	+	3	2	C16orf72	9093507	1.000000	0.71417	0.997000	0.53966	0.600000	0.36913	0.824000	0.27379	0.423000	0.26033	0.467000	0.42956	GAC	-	NULL		0.706	C16orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf72	protein_coding	OTTHUMT00000440760.2	C	NM_014117		9093507	+1	no_errors	NM_014117	genbank	human	validated	54_36p	missense	SNP	0.999	G
TCEB1P3	644540	genome.wustl.edu	37	10	10216519	10216519	+	IGR	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr10:10216519C>T								RP5-933E2.1 (111054 upstream) : Y_RNA (58054 downstream)																							ATGTGAGCTTCCTAGATTGTG	0.338																																																0			10																																								10256525	SO:0001628	intergenic_variant	644540																															10.37:g.10216519C>T			10256525		Silent	SNP	HMMSmart_SM00512,HMMPfam_Skp1_POZ,superfamily_POZ domain	p.F109		37	c.327		10																																																																																			-	HMMSmart_SM00512,superfamily_POZ domain	0	0.338					TCEB1P3			C			10256525	+1	pseudogene	XM_927664	genbank	human	model	54_36p	silent	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10416193	10416193	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:10416193C>A	ENST00000226207.5	-	10	989	c.895G>T	c.(895-897)Gat>Tat	p.D299Y	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	299	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CCAATTAGATCTGGCTTCTTG	0.363																																																0			17											85.0	85.0	85.0					17																	10416193		2203	4300	6503	10356918	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.895G>T	17.37:g.10416193C>A	ENSP00000226207:p.Asp299Tyr		10356918	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.D299Y	ENST00000226207.5	37	c.895	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119521	0.77323	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	D	0.87491	-2.26	5.87	5.87	0.94306	Myosin head, motor domain (2);	0.166983	0.27906	U	0.017368	D	0.90459	0.7012	M	0.64170	1.965	0.58432	D	0.999999	B	0.29432	0.244	B	0.42522	0.39	D	0.88337	0.2972	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	299	P12882	MYH1_HUMAN	Y	299	ENSP00000226207:D299Y	ENSP00000226207:D299Y	D	-	1	0	MYH1	10356918	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.787000	0.85759	2.941000	0.99782	0.655000	0.94253	GAT	-	superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head		0.363	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	C	NM_005963		10356918	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ELOVL2	54898	genome.wustl.edu	37	6	10995339	10995339	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:10995339G>A	ENST00000354666.3	-	5	489	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	136					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			GTTTTTTTCCGCAAAACGAAG	0.383																																																0			6											119.0	114.0	116.0					6																	10995339		2203	4300	6503	11103325	SO:0001583	missense	54898			AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.406C>T	6.37:g.10995339G>A	ENSP00000346693:p.Arg136Trp		11103325	Q6P9E1|Q86W94	Missense_Mutation	SNP	HMMPfam_ELO,PatternScan_ELO	p.R136W	ENST00000354666.3	37	c.406	CCDS4518.1	6	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831299	0.71258	.	.	ENSG00000197977	ENST00000354666	T	0.28255	1.62	5.75	4.81	0.61882	.	0.000000	0.64402	D	0.000001	T	0.71609	0.3360	H	0.99425	4.56	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.84664	0.0708	10	0.87932	D	0	-1.5591	17.6712	0.88218	0.0:0.0:0.8422:0.1578	.	136	Q9NXB9	ELOV2_HUMAN	W	136	ENSP00000346693:R136W	ENSP00000346693:R136W	R	-	1	2	ELOVL2	11103325	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.713000	0.47194	2.716000	0.92895	0.655000	0.94253	CGG	-	HMMPfam_ELO		0.383	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL2	protein_coding	OTTHUMT00000039849.1	G			11103325	-1	no_errors	NM_017770	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF823	55552	genome.wustl.edu	37	19	11833723	11833723	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:11833723A>G	ENST00000341191.6	-	4	779	c.626T>C	c.(625-627)tTg>tCg	p.L209S	ZNF823_ENST00000545749.1_Missense_Mutation_p.L27S	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						TCTTTCGTGCAAATGAAATAA	0.423										HNSCC(68;0.2)																																						0			19											98.0	104.0	102.0					19																	11833723		2199	4299	6498	11694723	SO:0001583	missense	55552			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.626T>C	19.37:g.11833723A>G	ENSP00000340683:p.Leu209Ser		11694723	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.L209S	ENST00000341191.6	37	c.626	CCDS45981.1	19	.	.	.	.	.	.	.	.	.	.	a	5.890	0.348395	0.11126	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	T;T;T	0.07021	3.23;3.23;3.23	0.632	-1.25	0.09405	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04003	0.0112	N	0.05383	-0.06	0.09310	N	1	P	0.40731	0.728	P	0.46144	0.505	T	0.21109	-1.0255	9	0.09338	T	0.73	.	1.3743	0.02217	0.4031:0.0:0.2643:0.3326	.	209	P16415	ZN823_HUMAN	S	27;209;165	ENSP00000440162:L27S;ENSP00000340683:L209S;ENSP00000410654:L165S	ENSP00000340683:L209S	L	-	2	0	ZNF823	11694723	0.000000	0.05858	0.012000	0.15200	0.780000	0.44128	-6.937000	0.00049	-0.457000	0.07033	0.248000	0.18094	TTG	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.423	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF823	protein_coding	OTTHUMT00000344516.2	A	NM_001080493		11694723	-1	no_errors	NM_001080493	genbank	human	validated	54_36p	missense	SNP	0.000	G
CYP4F24P	388514	genome.wustl.edu	37	19	15887301	15887301	+	IGR	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:15887301A>G								LLNLR-249E10.1 (5663 upstream) : OR10H5 (17459 downstream)																							CCCTGGGGATAGGTGGCTGAC	0.512																																																0			19																																								15748301	SO:0001628	intergenic_variant	388514																															19.37:g.15887301A>G			15748301		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.512					LOC388514			A			15748301	-1	no_errors	XR_017598	genbank	human	model	54_36p	rna	SNP	0.005	G
OR10H4	126541	genome.wustl.edu	37	19	16060236	16060236	+	Missense_Mutation	SNP	G	G	T	rs144850333	byFrequency	TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:16060236G>T	ENST00000322107.1	+	1	419	c.419G>T	c.(418-420)cGt>cTt	p.R140L		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						ATGAGCCCCCGTGACTGTGCC	0.532																																																0			19											190.0	162.0	172.0					19																	16060236		2203	4300	6503	15921236	SO:0001583	missense	126541			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.419G>T	19.37:g.16060236G>T	ENSP00000318834:p.Arg140Leu		15921236	Q6IFJ2|Q96R57	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.R140L	ENST00000322107.1	37	c.419	CCDS32941.1	19	.	.	.	.	.	.	.	.	.	.	g	7.532	0.658893	0.14645	.	.	ENSG00000176231	ENST00000322107	T	0.41758	0.99	1.53	-1.58	0.08479	GPCR, rhodopsin-like superfamily (1);	1.255120	0.05976	U	0.643223	T	0.40862	0.1134	M	0.75777	2.31	0.09310	N	1	B	0.17465	0.022	B	0.20767	0.031	T	0.45804	-0.9236	10	0.54805	T	0.06	.	4.2623	0.10747	0.1814:0.2355:0.5831:0.0	.	140	Q8NGA5	O10H4_HUMAN	L	140	ENSP00000318834:R140L	ENSP00000318834:R140L	R	+	2	0	OR10H4	15921236	0.000000	0.05858	0.011000	0.14972	0.085000	0.17905	-1.620000	0.02046	0.004000	0.14682	-0.370000	0.07254	CGT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.532	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H4	protein_coding	OTTHUMT00000460311.1	G			15921236	+1	no_errors	NM_001004465	genbank	human	validated	54_36p	missense	SNP	0.000	T
MYLIP	29116	genome.wustl.edu	37	6	16145472	16145472	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:16145472G>T	ENST00000356840.3	+	6	1370	c.1172G>T	c.(1171-1173)tGc>tTc	p.C391F	MYLIP_ENST00000349606.4_Missense_Mutation_p.C210F	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	391					cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			ATGGTGTGCTGCGAGGAGGAG	0.612																																																0			6											103.0	90.0	94.0					6																	16145472		2203	4300	6503	16253451	SO:0001583	missense	29116			AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.1172G>T	6.37:g.16145472G>T	ENSP00000349298:p.Cys391Phe		16253451	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Missense_Mutation	SNP	superfamily_Ubiquitin-like,HMMSmart_SM00295,HMMPfam_FERM_N,superfamily_Second domain of FERM,HMMPfam_FERM_M,superfamily_PH domain-like,superfamily_RING/U-box,HMMPfam_zf-C3HC4	p.C391F	ENST00000356840.3	37	c.1172	CCDS4536.1	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444806	0.83993	.	.	ENSG00000007944	ENST00000356840;ENST00000349606	T;T	0.77229	-1.08;-1.08	5.63	5.63	0.86233	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	T	0.73753	0.3627	N	0.04746	-0.17	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.80582	-0.1318	10	0.56958	D	0.05	.	20.0572	0.97657	0.0:0.0:1.0:0.0	.	391	Q8WY64	MYLIP_HUMAN	F	391;210	ENSP00000349298:C391F;ENSP00000008686:C210F	ENSP00000008686:C210F	C	+	2	0	MYLIP	16253451	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	9.748000	0.98867	2.826000	0.97356	0.655000	0.94253	TGC	-	superfamily_RING/U-box,HMMPfam_zf-C3HC4		0.612	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLIP	protein_coding	OTTHUMT00000043864.1	G	NM_013262		16253451	+1	no_errors	NM_013262	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CROCC	9696	genome.wustl.edu	37	1	17263285	17263285	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:17263285G>T	ENST00000375541.5	+	9	1179	c.1110G>T	c.(1108-1110)caG>caT	p.Q370H	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGGAGGAGCAGCTGCGGGACA	0.677																																																0			1											34.0	31.0	32.0					1																	17263285		2201	4298	6499	17135872	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1110G>T	1.37:g.17263285G>T	ENSP00000364691:p.Gln370His		17135872		Missense_Mutation	SNP	superfamily_Prefoldin	p.Q370H	ENST00000375541.5	37	c.1110	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831829	0.50845	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.14022	2.54	4.1	4.1	0.47936	.	.	.	.	.	T	0.17066	0.0410	M	0.64404	1.975	0.50467	D	0.999874	B;B;B	0.30914	0.231;0.144;0.3	B;B;B	0.34452	0.183;0.068;0.084	T	0.02477	-1.1153	9	0.39692	T	0.17	.	11.4942	0.50398	0.0:0.0:0.82:0.18	.	233;233;370	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	H	370;251	ENSP00000364691:Q370H	ENSP00000364691:Q370H	Q	+	3	2	CROCC	17135872	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.124000	0.57924	2.292000	0.77174	0.462000	0.41574	CAG	-	NULL		0.677	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	G	NM_014675		17135872	+1	no_errors	NM_014675	genbank	human	validated	54_36p	missense	SNP	1.000	T
SLC25A1	6576	genome.wustl.edu	37	22	19166130	19166130	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr22:19166130C>T	ENST00000215882.5	-	1	213	c.57G>A	c.(55-57)aaG>aaA	p.K19K	CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000461267.1_5'Flank|SLC25A1_ENST00000451283.1_5'Flank	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	19					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		TCAGCTTGGCCTTCCCGGAcg	0.811																																																0			22											2.0	3.0	3.0					22																	19166130		1219	2387	3606	17546130	SO:0001819	synonymous_variant	6576			U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.57G>A	22.37:g.19166130C>T			17546130	A8K8E8|Q9BSK6	Silent	SNP	superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.K19	ENST00000215882.5	37	c.57	CCDS13758.1	22																																																																																			-	NULL		0.811	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A1	protein_coding	OTTHUMT00000316441.1	C	NM_005984		17546130	-1	no_errors	NM_005984	genbank	human	validated	54_36p	silent	SNP	0.397	T
Unknown	0	genome.wustl.edu	37	14	19491788	19491788	+	IGR	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:19491788A>G								RP11-536C10.16 (77890 upstream) : MED15P1 (8057 downstream)																							CACACCGGGTATCTGCTTCCT	0.507																																																0			14																																								18561788	SO:0001628	intergenic_variant	642458																															14.37:g.19491788A>G			18561788		RNA	SNP	-	NULL		37	NULL		14																																																																																			-	-	0	0.507					LOC642458			A			18561788	-1	pseudogene	XR_016116	genbank	human	model	54_36p	rna	SNP	1.000	G
HAPLN4	404037	genome.wustl.edu	37	19	19371670	19371670	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:19371670T>A	ENST00000291481.7	-	3	499	c.436A>T	c.(436-438)Acc>Tcc	p.T146S	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	146	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	AGCTCATTGGTGACTTCGCAC	0.637																																																0			19											91.0	78.0	82.0					19																	19371670		2203	4300	6503	19232670	SO:0001583	missense	404037			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.436A>T	19.37:g.19371670T>A	ENSP00000291481:p.Thr146Ser		19232670	A5PKW5|Q96PW2	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like,PatternScan_LINK_1	p.T146S	ENST00000291481.7	37	c.436	CCDS12398.1	19	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273781	0.80580	.	.	ENSG00000187664	ENST00000291481	T	0.26957	1.7	4.66	4.66	0.58398	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.24699	0.0599	N	0.25380	0.74	0.42377	D	0.992475	B	0.32968	0.392	B	0.42062	0.374	T	0.11717	-1.0576	10	0.56958	D	0.05	-40.0531	12.0713	0.53618	0.0:0.0:0.0:1.0	.	146	Q86UW8	HPLN4_HUMAN	S	146	ENSP00000291481:T146S	ENSP00000291481:T146S	T	-	1	0	HAPLN4	19232670	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.430000	0.80321	1.960000	0.56953	0.459000	0.35465	ACC	-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408		0.637	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	protein_coding	OTTHUMT00000460117.2	T	NM_023002		19232670	-1	no_errors	NM_023002	genbank	human	validated	54_36p	missense	SNP	1.000	A
ID4	3400	genome.wustl.edu	37	6	19838210	19838210	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:19838210G>A	ENST00000378700.3	+	1	594	c.225G>A	c.(223-225)ctG>ctA	p.L75L	RP1-167F1.2_ENST00000432171.2_RNA	NM_001546.3	NP_001537.1	P47928	ID4_HUMAN	inhibitor of DNA binding 4, dominant negative helix-loop-helix protein	75	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex neuron differentiation (GO:0021895)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|hippocampus development (GO:0021766)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast proliferation (GO:0007405)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			lung(1)	1	Ovarian(93;0.0355)|Breast(50;0.0654)|all_epithelial(95;0.12)		OV - Ovarian serous cystadenocarcinoma(7;0.00659)|all cancers(50;0.0327)|Epithelial(50;0.0621)			ATAGCCGCCTGCGGAGGCTGG	0.672																																					Esophageal Squamous(13;105 518 19978 28644 46870)											0			6											34.0	34.0	34.0					6																	19838210		2202	4299	6501	19946189	SO:0001819	synonymous_variant	3400			U16153	CCDS4544.1	6p22.3	2013-05-21			ENSG00000172201	ENSG00000172201		"""Basic helix-loop-helix proteins"""	5363	protein-coding gene	gene with protein product		600581				7665172	Standard	NM_001546		Approved	bHLHb27	uc003ncw.4	P47928	OTTHUMG00000014333	ENST00000378700.3:c.225G>A	6.37:g.19838210G>A			19946189	Q13005	Silent	SNP	HMMPfam_HLH,HMMSmart_HLH,superfamily_HLH_basic	p.L75	ENST00000378700.3	37	c.225	CCDS4544.1	6																																																																																			-	HMMPfam_HLH,HMMSmart_HLH,superfamily_HLH_basic		0.672	ID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID4	protein_coding	OTTHUMT00000039979.1	G	NM_001546		19946189	+1	no_errors	NM_001546	genbank	human	provisional	54_36p	silent	SNP	1.000	A
WDR35	57539	genome.wustl.edu	37	2	20138094	20138094	+	Silent	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:20138094T>A	ENST00000345530.3	-	19	2143	c.2028A>T	c.(2026-2028)gcA>gcT	p.A676A	WDR35_ENST00000281405.4_Silent_p.A665A|WDR35_ENST00000416055.2_Silent_p.A241A	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	676					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCAATCAGTGCTCGGCTAT	0.383																																																0			2											106.0	108.0	107.0					2																	20138094		2203	4300	6503	20001575	SO:0001819	synonymous_variant	57539			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.2028A>T	2.37:g.20138094T>A			20001575	B3KVI5|Q4ZG01|Q8NE11	Silent	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40	p.A676	ENST00000345530.3	37	c.2028	CCDS33152.1	2																																																																																			-	NULL		0.383	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	protein_coding	OTTHUMT00000207472.2	T	NM_020779		20001575	-1	no_errors	NM_001006657	genbank	human	reviewed	54_36p	silent	SNP	0.151	A
E2F3	1871	genome.wustl.edu	37	6	20490464	20490464	+	Missense_Mutation	SNP	G	G	T	rs151305307	byFrequency	TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:20490464G>T	ENST00000346618.3	+	7	1267	c.1201G>T	c.(1201-1203)Gcc>Tcc	p.A401S	E2F3_ENST00000535432.1_Missense_Mutation_p.A270S	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	401	Transactivation. {ECO:0000255}.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			TTCTCCTCTGGCCTCCCCAGC	0.463																																																0			6						G	SER/ALA	1,4405	2.1+/-5.4	0,1,2202	66.0	65.0	65.0		1201	4.6	1.0	6	dbSNP_134	65	24,8576	17.3+/-56.4	0,24,4276	yes	missense	E2F3	NM_001949.4	99	0,25,6478	TT,TG,GG		0.2791,0.0227,0.1922	benign	401/466	20490464	25,12981	2203	4300	6503	20598443	SO:0001583	missense	1871			Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.1201G>T	6.37:g.20490464G>T	ENSP00000262904:p.Ala401Ser		20598443	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	superfamily_SSF46785,HMMPfam_E2F_TDP	p.A401S	ENST00000346618.3	37	c.1201	CCDS4545.1	6	.	.	.	.	.	.	.	.	.	.	G	6.715	0.500703	0.12822	2.27E-4	0.002791	ENSG00000112242	ENST00000346618;ENST00000535432	T;T	0.05996	3.36;3.36	5.49	4.63	0.57726	.	0.222920	0.47852	D	0.000212	T	0.01558	0.0050	N	0.25647	0.755	0.38202	D	0.940218	B	0.17038	0.02	B	0.19148	0.024	T	0.37526	-0.9702	10	0.09590	T	0.72	.	10.922	0.47169	0.1445:0.0:0.8555:0.0	.	401	O00716	E2F3_HUMAN	S	401;270	ENSP00000262904:A401S;ENSP00000443418:A270S	ENSP00000262904:A401S	A	+	1	0	E2F3	20598443	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.805000	0.27112	1.461000	0.47929	-0.291000	0.09656	GCC	-	NULL		0.463	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	E2F3	protein_coding	OTTHUMT00000043828.1	G			20598443	+1	no_errors	NM_001949	genbank	human	reviewed	54_36p	missense	SNP	0.956	T
ACSM3	6296	genome.wustl.edu	37	16	20803396	20803396	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:20803396A>G	ENST00000289416.5	+	11	1874	c.1399A>G	c.(1399-1401)Aaa>Gaa	p.K467E	ERI2_ENST00000300005.3_Intron|ACSM3_ENST00000450120.2_Missense_Mutation_p.K459E|ACSM3_ENST00000567387.1_3'UTR	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	467					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						ATATATGGATAAAGATGGGTA	0.363																																																0			16											204.0	197.0	199.0					16																	20803396		2201	4300	6501	20710897	SO:0001583	missense	6296			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.1399A>G	16.37:g.20803396A>G	ENSP00000289416:p.Lys467Glu		20710897	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.K467E	ENST00000289416.5	37	c.1399	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	A	1.774	-0.483661	0.04383	.	.	ENSG00000005187	ENST00000289416;ENST00000450120	T;T	0.40476	1.03;1.03	5.59	2.49	0.30216	AMP-dependent synthetase/ligase (1);	0.315937	0.33364	N	0.004995	T	0.09992	0.0245	N	0.00301	-1.68	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.37033	-0.9723	10	0.02654	T	1	-22.1988	10.5073	0.44841	0.2194:0.0:0.7806:0.0	.	459;467	E7ETR5;Q53FZ2	.;ACSM3_HUMAN	E	467;459	ENSP00000289416:K467E;ENSP00000395297:K459E	ENSP00000289416:K467E	K	+	1	0	ACSM3	20710897	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	2.190000	0.42630	0.272000	0.22027	-1.179000	0.01719	AAA	-	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding		0.363	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	protein_coding	OTTHUMT00000254414.2	A	NM_005622		20710897	+1	no_errors	NM_005622	genbank	human	validated	54_36p	missense	SNP	1.000	G
APOB	338	genome.wustl.edu	37	2	21233200	21233200	+	Silent	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:21233200T>C	ENST00000233242.1	-	26	6667	c.6540A>G	c.(6538-6540)caA>caG	p.Q2180Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2180					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTGATCAAATTGTATCATAT	0.234																																																0			2											39.0	40.0	39.0					2																	21233200		2193	4293	6486	21086705	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6540A>G	2.37:g.21233200T>C			21086705	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.Q2180	ENST00000233242.1	37	c.6540	CCDS1703.1	2																																																																																			-	NULL		0.234	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	T			21086705	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
EFS	10278	genome.wustl.edu	37	14	23829010	23829010	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:23829010G>A	ENST00000216733.3	-	4	1284	c.677C>T	c.(676-678)gCg>gTg	p.A226V	EFS_ENST00000351354.3_Missense_Mutation_p.A133V|EFS_ENST00000429593.2_Intron|RP11-124D2.3_ENST00000554010.1_RNA	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	226	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		TAAGGCTGACGCTCGTTTCAG	0.627																																																0			14											47.0	56.0	53.0					14																	23829010		2203	4290	6493	22898850	SO:0001583	missense	10278			AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.677C>T	14.37:g.23829010G>A	ENSP00000216733:p.Ala226Val		22898850	B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.A226V	ENST00000216733.3	37	c.677	CCDS9595.1	14	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095333	0.36952	.	.	ENSG00000100842	ENST00000216733;ENST00000351354	T;T	0.58940	0.3;0.94	4.88	4.88	0.63580	.	0.923163	0.09277	N	0.824255	T	0.68485	0.3006	L	0.46741	1.465	0.80722	D	1	D;P	0.89917	1.0;0.66	D;B	0.85130	0.997;0.095	T	0.55842	-0.8077	10	0.25751	T	0.34	-8.942	10.5283	0.44963	0.0898:0.0:0.9102:0.0	.	133;226	O43281-2;O43281	.;EFS_HUMAN	V	226;133	ENSP00000216733:A226V;ENSP00000340607:A133V	ENSP00000216733:A226V	A	-	2	0	EFS	22898850	1.000000	0.71417	0.864000	0.33941	0.013000	0.08279	4.268000	0.58883	2.547000	0.85894	0.563000	0.77884	GCG	-	NULL		0.627	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFS	protein_coding	OTTHUMT00000071770.2	G			22898850	-1	no_errors	NM_005864	genbank	human	reviewed	54_36p	missense	SNP	0.686	A
GGA2	23062	genome.wustl.edu	37	16	23499997	23499997	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:23499997T>A	ENST00000309859.4	-	6	591	c.509A>T	c.(508-510)gAt>gTt	p.D170V	GGA2_ENST00000567468.1_Missense_Mutation_p.D170V	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	170					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TAAGATTTTATCCACTGGTAG	0.408																																																0			16											164.0	161.0	162.0					16																	23499997		2197	4300	6497	23407498	SO:0001583	missense	23062			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.509A>T	16.37:g.23499997T>A	ENSP00000311962:p.Asp170Val		23407498	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	HMMPfam_VHS,superfamily_ENTH_VHS,HMMSmart_VHS,superfamily_SSF89009,HMMPfam_GAT,superfamily_Clath_adapt,HMMPfam_Alpha_adaptinC2,HMMSmart_Alpha_adaptinC2	p.D170V	ENST00000309859.4	37	c.509	CCDS10611.1	16	.	.	.	.	.	.	.	.	.	.	T	16.07	3.017719	0.54576	.	.	ENSG00000103365	ENST00000309859	T	0.18502	2.21	5.11	5.11	0.69529	.	0.370566	0.29638	N	0.011584	T	0.13372	0.0324	L	0.29908	0.895	0.51767	D	0.999934	B	0.30914	0.3	B	0.27715	0.082	T	0.06991	-1.0796	10	0.40728	T	0.16	-23.4361	13.1649	0.59565	0.0:0.0:0.0:1.0	.	170	Q9UJY4	GGA2_HUMAN	V	170	ENSP00000311962:D170V	ENSP00000311962:D170V	D	-	2	0	GGA2	23407498	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.217000	0.77982	2.054000	0.61138	0.523000	0.50628	GAT	-	NULL		0.408	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA2	protein_coding	OTTHUMT00000214019.1	T			23407498	-1	no_errors	NM_015044	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CTSG	1511	genome.wustl.edu	37	14	25044514	25044514	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:25044514C>A	ENST00000216336.2	-	2	196	c.160G>T	c.(160-162)Gtg>Ttg	p.V54L		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	54	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TCTTCTCGCACCAGGAACCCT	0.602																																																0			14											113.0	105.0	108.0					14																	25044514		2203	4300	6503	24114354	SO:0001583	missense	1511			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.160G>T	14.37:g.25044514C>A	ENSP00000216336:p.Val54Leu		24114354	Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.V54L	ENST00000216336.2	37	c.160	CCDS9631.1	14	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166377	0.78339	.	.	ENSG00000100448	ENST00000216336	D	0.92595	-3.07	5.38	5.38	0.77491	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.34507	N	0.003903	D	0.90099	0.6907	N	0.05199	-0.095	0.44728	D	0.997725	B	0.32893	0.389	P	0.52309	0.695	D	0.90569	0.4521	10	0.66056	D	0.02	.	15.0163	0.71588	0.0:1.0:0.0:0.0	.	54	P08311	CATG_HUMAN	L	54	ENSP00000216336:V54L	ENSP00000216336:V54L	V	-	1	0	CTSG	24114354	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	1.549000	0.36212	2.687000	0.91594	0.655000	0.94253	GTG	-	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin		0.602	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	protein_coding	OTTHUMT00000276536.2	C	NM_001911		24114354	-1	no_errors	NM_001911	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CACNG3	10368	genome.wustl.edu	37	16	24372921	24372921	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:24372921T>A	ENST00000005284.3	+	4	1887	c.685T>A	c.(685-687)Tat>Aat	p.Y229N		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	229					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ACCCTACAGGTATCGATTCCG	0.537																																																0			16											86.0	84.0	85.0					16																	24372921		2197	4300	6497	24280422	SO:0001583	missense	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.685T>A	16.37:g.24372921T>A	ENSP00000005284:p.Tyr229Asn		24280422		Missense_Mutation	SNP	HMMPfam_PMP22_Claudin	p.Y229N	ENST00000005284.3	37	c.685	CCDS10620.1	16	.	.	.	.	.	.	.	.	.	.	T	9.829	1.187953	0.21954	.	.	ENSG00000006116	ENST00000005284	T	0.61274	0.12	4.96	4.96	0.65561	.	0.062950	0.64402	D	0.000004	T	0.57051	0.2027	M	0.73217	2.22	0.53005	D	0.999965	B	0.21225	0.053	B	0.25291	0.059	T	0.54476	-0.8288	10	0.21540	T	0.41	-13.0359	14.3332	0.66572	0.0:0.0:0.0:1.0	.	229	O60359	CCG3_HUMAN	N	229	ENSP00000005284:Y229N	ENSP00000005284:Y229N	Y	+	1	0	CACNG3	24280422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.783000	0.62403	1.846000	0.53633	0.533000	0.62120	TAT	-	NULL		0.537	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG3	protein_coding	OTTHUMT00000254548.1	T	NM_006539		24280422	+1	no_errors	NM_006539	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARHGAP17	55114	genome.wustl.edu	37	16	24950756	24950756	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:24950756G>T	ENST00000289968.6	-	17	1722	c.1653C>A	c.(1651-1653)agC>agA	p.S551R	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Intron	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	551	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCCCAGAGCTGCTTTCAGCCC	0.677																																																0			16											17.0	23.0	21.0					16																	24950756		2194	4296	6490	24858257	SO:0001583	missense	55114			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1653C>A	16.37:g.24950756G>T	ENSP00000289968:p.Ser551Arg		24858257	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	HMMPfam_BAR,HMMSmart_SM00721,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,PatternScan_AA_TRNA_LIGASE_I	p.S551R	ENST00000289968.6	37	c.1653	CCDS32409.1	16	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669923	0.47677	.	.	ENSG00000140750	ENST00000289968;ENST00000455311	T	0.20881	2.04	5.32	5.32	0.75619	.	0.120593	0.37906	N	0.001892	T	0.24661	0.0598	L	0.44542	1.39	0.80722	D	1	P;P	0.48016	0.454;0.904	B;P	0.48227	0.115;0.571	T	0.00770	-1.1573	10	0.19590	T	0.45	.	14.3713	0.66840	0.0:0.0:1.0:0.0	.	551;84	Q68EM7;Q68EM7-7	RHG17_HUMAN;.	R	551	ENSP00000289968:S551R	ENSP00000289968:S551R	S	-	3	2	ARHGAP17	24858257	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	1.057000	0.30492	2.767000	0.95098	0.655000	0.94253	AGC	-	NULL		0.677	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP17	protein_coding	OTTHUMT00000436548.3	G	NM_018054		24858257	-1	no_errors	NM_001006634	genbank	human	validated	54_36p	missense	SNP	1.000	T
TAOK1	57551	genome.wustl.edu	37	17	27849422	27849422	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:27849422T>C	ENST00000261716.3	+	17	2552	c.2033T>C	c.(2032-2034)aTc>aCc	p.I678T	TAOK1_ENST00000536202.1_Intron	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	678					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TGTGAGTTGATCAGATTACAG	0.448																																																0			17											115.0	104.0	107.0					17																	27849422		2203	4300	6503	24873548	SO:0001583	missense	57551			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.2033T>C	17.37:g.27849422T>C	ENSP00000261716:p.Ile678Thr		24873548	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.I678T	ENST00000261716.3	37	c.2033	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	T	15.47	2.844419	0.51164	.	.	ENSG00000160551	ENST00000261716	T	0.55760	0.5	5.86	5.86	0.93980	Protein kinase-like domain (1);	0.047303	0.85682	D	0.000000	T	0.47764	0.1463	L	0.46670	1.46	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.35101	-0.9802	10	0.27785	T	0.31	.	16.2561	0.82517	0.0:0.0:0.0:1.0	.	678	Q7L7X3	TAOK1_HUMAN	T	678	ENSP00000261716:I678T	ENSP00000261716:I678T	I	+	2	0	TAOK1	24873548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.035000	0.88872	2.243000	0.73865	0.472000	0.43445	ATC	-	superfamily_Protein kinase-like (PK-like)		0.448	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	protein_coding	OTTHUMT00000447790.1	T	NM_020791		24873548	+1	no_errors	NM_020791	genbank	human	validated	54_36p	missense	SNP	1.000	C
DOCK5	80005	genome.wustl.edu	37	8	25261089	25261089	+	Nonsense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:25261089G>T	ENST00000276440.7	+	48	4986	c.4942G>T	c.(4942-4944)Gag>Tag	p.E1648*		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1648					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CAACTTGACGGAGAGGAAGCA	0.542																																					Pancreas(145;34 1887 3271 10937 30165)											0			8											263.0	238.0	247.0					8																	25261089		2203	4300	6503	25317006	SO:0001587	stop_gained	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.4942G>T	8.37:g.25261089G>T	ENSP00000276440:p.Glu1648*		25317006	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Nonsense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.E1648*	ENST00000276440.7	37	c.4942	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.530684	0.99196	.	.	ENSG00000147459	ENST00000276440	.	.	.	5.81	5.81	0.92471	.	0.366827	0.30556	N	0.009372	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	20.0782	0.97758	0.0:0.0:1.0:0.0	.	.	.	.	X	1648	.	ENSP00000276440:E1648X	E	+	1	0	DOCK5	25317006	1.000000	0.71417	0.893000	0.35052	0.075000	0.17131	7.341000	0.79300	2.746000	0.94184	0.655000	0.94253	GAG	-	NULL		0.542	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	protein_coding	OTTHUMT00000254955.2	G	NM_024940		25317006	+1	no_errors	NM_024940	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29670026	29670026	+	Splice_Site	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:29670026G>T	ENST00000358273.4	+	48	7445		c.e48-1		NF1_ENST00000444181.2_Splice_Site|NF1_ENST00000356175.3_Splice_Site|NF1_ENST00000417592.2_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATCTTTAATAGAGTCCAGAGG	0.363			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	17											86.0	89.0	88.0					17																	29670026		2203	4300	6503	26694152	SO:0001630	splice_region_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7063-1G>T	17.37:g.29670026G>T			26694152	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	-	e48-1	ENST00000358273.4	37	c.7063-1	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425009	0.83667	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181;ENST00000417592	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.476	0.94989	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26694152	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.022000	0.93678	2.616000	0.88540	0.563000	0.77884	.	-	-		0.363	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	G	NM_000267	Intron	26694152	+1	no_errors	NM_001042492	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
HOXA13	3209	genome.wustl.edu	37	7	27238031	27238031	+	Missense_Mutation	SNP	G	G	T	rs146259736		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:27238031G>T	ENST00000222753.4	-	2	981	c.953C>A	c.(952-954)tCc>tAc	p.S318Y	HOTTIP_ENST00000521028.2_RNA|HOXA13_ENST00000518136.3_5'Flank|HOTTIP_ENST00000605136.1_RNA|HOTTIP_ENST00000421733.1_RNA|HOTTIP_ENST00000472494.1_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	318					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						CCTCCTATAGGAGCTGGCATC	0.507			T	NUP98	AML						OREG0003748	type=REGULATORY REGION|Gene=HOXA13|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											Dom	yes		7	7p15-p14.2	3209	homeo box A13		L	0			7											89.0	91.0	90.0					7																	27238031		2203	4300	6503	27204556	SO:0001583	missense	3209				CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.953C>A	7.37:g.27238031G>T	ENSP00000222753:p.Ser318Tyr	792	27204556	A4D188|O43371	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.S318Y	ENST00000222753.4	37	c.953	CCDS5412.1	7	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446822	0.84101	.	.	ENSG00000106031	ENST00000222753	T	0.57436	0.4	5.71	5.71	0.89125	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.73628	0.3611	M	0.81802	2.56	0.50313	D	0.999868	D	0.53885	0.963	P	0.61328	0.887	T	0.75645	-0.3246	10	0.62326	D	0.03	.	19.4604	0.94915	0.0:0.0:1.0:0.0	.	318	P31271	HXA13_HUMAN	Y	318	ENSP00000222753:S318Y	ENSP00000222753:S318Y	S	-	2	0	HOXA13	27204556	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.621000	0.83083	2.697000	0.92050	0.563000	0.77884	TCC	-	superfamily_Homeodomain-like		0.507	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA13	protein_coding	OTTHUMT00000358752.3	G			27204556	-1	no_errors	NM_000522	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EQTN	54586	genome.wustl.edu	37	9	27284732	27284732	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:27284732C>T	ENST00000380032.3	-	8	957	c.874G>A	c.(874-876)Gtt>Att	p.V292I	LINC00032_ENST00000425633.1_lincRNA|EQTN_ENST00000537675.1_Missense_Mutation_p.V263I	NM_020641.2	NP_065692.2	Q9NQ60	EQTN_HUMAN	equatorin, sperm acrosome associated	292					acrosomal vesicle exocytosis (GO:0060478)|endocytosis (GO:0006897)|fusion of sperm to egg plasma membrane (GO:0007342)	early endosome (GO:0005769)|inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|outer acrosomal membrane (GO:0002081)|plasma membrane (GO:0005886)											CACCGGGTAACCGACTCATCG	0.348																																																0			9											109.0	101.0	104.0					9																	27284732		2203	4300	6503	27274732	SO:0001583	missense	54586			AJ278482	CCDS35001.1, CCDS55300.1	9p21	2012-09-20	2012-09-20	2012-09-20	ENSG00000120160	ENSG00000120160			1359	protein-coding gene	gene with protein product	"""Acr formation associated factor"", ""Acrosome formation associated factor"", ""sperm acrosome associated 8"""		"""chromosome 9 open reading frame 11"", ""equatorin"""	C9orf11			Standard	NM_020641		Approved	AFAF, SPACA8, equatorin	uc003zql.3	Q9NQ60	OTTHUMG00000021033	ENST00000380032.3:c.874G>A	9.37:g.27284732C>T	ENSP00000369371:p.Val292Ile		27274732	B2RPB3|B7ZMK1|Q5TCU1|Q96L22	Missense_Mutation	SNP	NULL	p.V292I	ENST00000380032.3	37	c.874	CCDS35001.1	9	.	.	.	.	.	.	.	.	.	.	.	0.028	-1.352403	0.01256	.	.	ENSG00000120160	ENST00000537675;ENST00000380032	T;T	0.32753	1.44;1.84	3.96	-7.91	0.01165	.	2.987710	0.01303	N	0.010367	T	0.12902	0.0313	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.002;0.003	T	0.16897	-1.0387	10	0.87932	D	0	.	1.3397	0.02152	0.3956:0.1017:0.1381:0.3646	.	263;292	B7ZMK1;Q9NQ60	.;AFAF_HUMAN	I	263;292	ENSP00000441630:V263I;ENSP00000369371:V292I	ENSP00000369371:V292I	V	-	1	0	C9orf11	27274732	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.427000	0.01026	-2.415000	0.00568	-0.411000	0.06167	GTT	-	NULL		0.348	EQTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf11	protein_coding	OTTHUMT00000055499.1	C	NM_020641		27274732	-1	no_errors	NM_020641	genbank	human	provisional	54_36p	missense	SNP	0.002	T
EIF2B4	8890	genome.wustl.edu	37	2	27587370	27587370	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:27587370T>G	ENST00000347454.4	-	13	1640	c.1469A>C	c.(1468-1470)gAt>gCt	p.D490A	EIF2B4_ENST00000493344.2_Missense_Mutation_p.D511A|EIF2B4_ENST00000451130.2_Missense_Mutation_p.D510A|EIF2B4_ENST00000445933.2_Missense_Mutation_p.D489A|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	490					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGAGTCACATCATAGACTAG	0.522																																																0			2											146.0	125.0	132.0					2																	27587370		2203	4300	6503	27440874	SO:0001583	missense	8890			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.1469A>C	2.37:g.27587370T>G	ENSP00000233552:p.Asp490Ala		27440874	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	superfamily_NagB/RpiA/CoA transferase-like,HMMPfam_IF-2B	p.D510A	ENST00000347454.4	37	c.1529	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259058	0.80246	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.99150	-5.49;-5.49;-5.49;-5.49	5.64	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.99447	0.9804	H	0.95950	3.745	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.98674	1.0689	10	0.87932	D	0	-17.5689	10.3899	0.44162	0.0:0.0776:0.0:0.9224	.	487;489;490;510	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	A	490;487;489;510;511	ENSP00000233552:D490A;ENSP00000394397:D489A;ENSP00000394869:D510A;ENSP00000429323:D511A	ENSP00000233552:D490A	D	-	2	0	EIF2B4	27440874	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	7.956000	0.87863	0.963000	0.38082	0.533000	0.62120	GAT	-	superfamily_NagB/RpiA/CoA transferase-like,HMMPfam_IF-2B		0.522	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	protein_coding	OTTHUMT00000324448.1	T			27440874	-1	no_errors	NM_172195	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HIST1H2BO	8348	genome.wustl.edu	37	6	27861369	27861369	+	Nonsense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:27861369C>G	ENST00000303806.4	+	1	167	c.129C>G	c.(127-129)taC>taG	p.Y43*	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	43					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTACGTGTACAAGGTGCTGA	0.547																																																0			6											158.0	144.0	149.0					6																	27861369		2203	4300	6503	27969348	SO:0001587	stop_gained	8348			X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.129C>G	6.37:g.27861369C>G	ENSP00000303408:p.Tyr43*		27969348	Q3KPI7|Q8TCV6	Nonsense_Mutation	SNP	superfamily_Histone-fold,HMMSmart_H2B,HMMPfam_Histone,PatternScan_HISTONE_H2B	p.Y43*	ENST00000303806.4	37	c.129	CCDS4640.1	6	.	.	.	.	.	.	.	.	.	.	C	16.32	3.091109	0.55968	.	.	ENSG00000196331	ENST00000303806	.	.	.	3.55	2.68	0.31781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6676	0.45739	0.0:0.9011:0.0:0.0989	.	.	.	.	X	43	.	ENSP00000303408:Y43X	Y	+	3	2	HIST1H2BO	27969348	1.000000	0.71417	1.000000	0.80357	0.403000	0.30841	3.610000	0.54125	1.066000	0.40716	-0.291000	0.09656	TAC	-	superfamily_Histone-fold,HMMSmart_H2B,HMMPfam_Histone		0.547	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BO	protein_coding	OTTHUMT00000040161.1	C	NM_003527		27969348	+1	no_errors	NM_003527	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	G
MYLK2	85366	genome.wustl.edu	37	20	30419940	30419940	+	Splice_Site	SNP	G	G	A	rs188633312		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr20:30419940G>A	ENST00000375994.2	+	11	1983		c.e11+1		MYLK2_ENST00000468730.1_Splice_Site|MYLK2_ENST00000375985.4_Splice_Site			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2						cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GCGCTGGAAGGTACCGCTGGA	0.577																																																0			20											28.0	26.0	27.0					20																	30419940		2203	4300	6503	29883601	SO:0001630	splice_region_variant	85366			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1710+1G>A	20.37:g.30419940G>A			29883601	Q569L1|Q96I84	Splice_Site	SNP	-	e11+1	ENST00000375994.2	37	c.1710+1	CCDS13191.1	20	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783361	0.70222	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3805	0.87403	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYLK2	29883601	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	9.409000	0.97331	2.595000	0.87683	0.655000	0.94253	.	-	-		0.577	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	protein_coding	OTTHUMT00000078583.2	G	NM_033118	Intron	29883601	+1	no_errors	NM_033118	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
TM9SF4	9777	genome.wustl.edu	37	20	30753155	30753155	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr20:30753155G>C	ENST00000398022.2	+	18	2072	c.1837G>C	c.(1837-1839)Gtc>Ctc	p.V613L	TM9SF4_ENST00000217315.5_Missense_Mutation_p.V596L	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	613						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGCCCTCATGGTCTTGTCCTT	0.527																																																0			20											276.0	193.0	221.0					20																	30753155		2203	4300	6503	30216816	SO:0001583	missense	9777			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.1837G>C	20.37:g.30753155G>C	ENSP00000381104:p.Val613Leu		30216816	B0QYT7|Q9NUA3	Missense_Mutation	SNP	HMMPfam_EMP70	p.V596L	ENST00000398022.2	37	c.1786	CCDS13196.2	20	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192595	0.78902	.	.	ENSG00000101337	ENST00000398022;ENST00000217315	T;T	0.45668	1.48;0.89	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.45677	0.1354	M	0.73753	2.245	0.80722	D	1	B;P	0.44260	0.209;0.83	B;B	0.37943	0.15;0.261	T	0.55490	-0.8133	10	0.48119	T	0.1	-24.758	18.0523	0.89353	0.0:0.0:1.0:0.0	.	520;613	B4DH88;Q92544	.;TM9S4_HUMAN	L	613;596	ENSP00000381104:V613L;ENSP00000217315:V596L	ENSP00000217315:V596L	V	+	1	0	TM9SF4	30216816	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.823000	0.86660	2.485000	0.83878	0.561000	0.74099	GTC	-	NULL		0.527	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF4	protein_coding	OTTHUMT00000323568.1	G	NM_014742		30216816	+1	no_errors	NM_014742	genbank	human	validated	54_36p	missense	SNP	1.000	C
DHX16	8449	genome.wustl.edu	37	6	30638975	30638975	+	Missense_Mutation	SNP	C	C	A	rs138934886		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:30638975C>A	ENST00000376442.3	-	2	479	c.284G>T	c.(283-285)cGa>cTa	p.R95L		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	95					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CCTATAAGATCGGTTCTTCTC	0.542																																																0			6											207.0	250.0	235.0					6																	30638975		1509	2708	4217	30746954	SO:0001583	missense	8449			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.284G>T	6.37:g.30638975C>A	ENSP00000365625:p.Arg95Leu		30746954	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.R95L	ENST00000376442.3	37	c.284	CCDS4685.1	6	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277989	0.59758	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.22134	1.97;1.97	5.27	3.46	0.39613	.	0.136030	0.47455	N	0.000232	T	0.05686	0.0149	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.08973	-1.0696	10	0.62326	D	0.03	.	8.8394	0.35133	0.1515:0.7682:0.0:0.0803	.	35;95	B4DZ28;O60231	.;DHX16_HUMAN	L	95;35	ENSP00000365625:R95L;ENSP00000399101:R35L	ENSP00000365625:R95L	R	-	2	0	DHX16	30746954	0.992000	0.36948	0.942000	0.38095	0.971000	0.66376	2.789000	0.47813	1.203000	0.43233	0.557000	0.71058	CGA	-	NULL		0.542	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX16	protein_coding	OTTHUMT00000076076.2	C	NM_003587		30746954	-1	no_errors	NM_003587	genbank	human	reviewed	54_36p	missense	SNP	0.926	A
SLFN13	146857	genome.wustl.edu	37	17	33768204	33768204	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:33768204G>C	ENST00000285013.6	-	6	2379	c.2104C>G	c.(2104-2106)Ctg>Gtg	p.L702V	SLFN13_ENST00000360502.2_Missense_Mutation_p.L384V|SLFN13_ENST00000533791.1_Missense_Mutation_p.L702V|SLFN13_ENST00000534689.1_Missense_Mutation_p.L384V|SLFN13_ENST00000542635.1_Missense_Mutation_p.L702V|SLFN13_ENST00000526861.1_Missense_Mutation_p.L702V	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	702						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AAGTAGTCCAGAAAGATCCAG	0.488																																																0			17											128.0	135.0	133.0					17																	33768204		2203	4300	6503	30792317	SO:0001583	missense	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2104C>G	17.37:g.33768204G>C	ENSP00000285013:p.Leu702Val		30792317	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	HMMPfam_AAA_4,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L702V	ENST00000285013.6	37	c.2104	CCDS32620.1	17	.	.	.	.	.	.	.	.	.	.	g	15.27	2.783017	0.49891	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53	3.41	2.32	0.28847	Domain of unknown function DUF2075 (1);	0.000000	0.37669	N	0.001983	D	0.87958	0.6309	M	0.85542	2.76	0.27088	N	0.962916	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.987	T	0.77749	-0.2471	10	0.72032	D	0.01	.	7.2588	0.26191	0.0:0.0:0.7363:0.2637	.	384;702	Q68D06-2;Q68D06	.;SLN13_HUMAN	V	702;384;702;702;384	ENSP00000285013:L702V;ENSP00000353692:L384V;ENSP00000434439:L702V;ENSP00000444016:L702V;ENSP00000435442:L384V	ENSP00000285013:L702V	L	-	1	2	SLFN13	30792317	0.905000	0.30787	1.000000	0.80357	0.851000	0.48451	0.117000	0.15583	1.895000	0.54865	0.407000	0.27541	CTG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.488	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN13	protein_coding	OTTHUMT00000381883.1	G	NM_144682		30792317	-1	no_errors	NM_144682	genbank	human	validated	54_36p	missense	SNP	1.000	C
SETD1A	9739	genome.wustl.edu	37	16	30990567	30990567	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:30990567C>G	ENST00000262519.8	+	14	4146	c.3460C>G	c.(3460-3462)Ccc>Gcc	p.P1154A		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1154	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TCCCTCTTCTCCCATCCCCCT	0.711																																																0			16											12.0	14.0	13.0					16																	30990567		2156	4222	6378	30898068	SO:0001583	missense	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3460C>G	16.37:g.30990567C>G	ENSP00000262519:p.Pro1154Ala		30898068	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SSF82199,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET	p.P1154A	ENST00000262519.8	37	c.3460	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	C	9.813	1.183602	0.21870	.	.	ENSG00000099381	ENST00000262519	D	0.94576	-3.46	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.94098	0.8108	M	0.61703	1.905	0.41375	D	0.98751	D	0.58620	0.983	P	0.51016	0.656	D	0.93764	0.7069	10	0.56958	D	0.05	.	9.4776	0.38880	0.0:0.9032:0.0:0.0968	.	1154	O15047	SET1A_HUMAN	A	1154	ENSP00000262519:P1154A	ENSP00000262519:P1154A	P	+	1	0	SETD1A	30898068	1.000000	0.71417	0.991000	0.47740	0.349000	0.29174	5.028000	0.64115	2.328000	0.79073	0.557000	0.71058	CCC	-	NULL		0.711	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	C	NM_014712		30898068	+1	no_errors	NM_014712	genbank	human	provisional	54_36p	missense	SNP	0.917	G
MATN1	4146	genome.wustl.edu	37	1	31187155	31187155	+	Nonsense_Mutation	SNP	G	G	T	rs149688576	byFrequency	TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:31187155G>T	ENST00000373765.4	-	7	1415	c.1380C>A	c.(1378-1380)tgC>tgA	p.C460*	MATN1_ENST00000477320.1_5'Flank	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	460					extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGGGACTCGCAGGCACACG	0.627																																																0			1											35.0	35.0	35.0					1																	31187155		2203	4300	6503	30959742	SO:0001587	stop_gained	4146			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.1380C>A	1.37:g.31187155G>T	ENSP00000362870:p.Cys460*		30959742	B2R7E3|Q5TBB9	Nonsense_Mutation	SNP	PatternScan_EGF_1,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Matrilin_ccoil	p.C460*	ENST00000373765.4	37	c.1380	CCDS336.1	1	.	.	.	.	.	.	.	.	.	.	g	16.20	3.056126	0.55325	.	.	ENSG00000162510	ENST00000373765	.	.	.	4.99	-9.98	0.00438	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1963	21.1591	0.99947	0.7662:0.0:0.2338:0.0	.	.	.	.	X	460	.	ENSP00000362870:C460X	C	-	3	2	MATN1	30959742	0.011000	0.17503	0.095000	0.20976	0.459000	0.32528	-0.669000	0.05262	-3.337000	0.00184	-2.408000	0.00222	TGC	-	HMMPfam_Matrilin_ccoil		0.627	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	protein_coding	OTTHUMT00000010458.1	G	NM_002379		30959742	-1	no_errors	NM_002379	genbank	human	reviewed	54_36p	nonsense	SNP	0.994	T
FAM47B	170062	genome.wustl.edu	37	X	34962025	34962025	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chrX:34962025C>T	ENST00000329357.5	+	1	1113	c.1077C>T	c.(1075-1077)gaC>gaT	p.D359D		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	359								p.D359D(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGCTGGAAGACGCACGGGCTC	0.537																																																1	Substitution - coding silent(1)	large_intestine(1)	X											44.0	42.0	43.0					X																	34962025		2202	4300	6502	34871946	SO:0001819	synonymous_variant	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1077C>T	X.37:g.34962025C>T			34871946	Q5JQN5|Q6PIG3	Silent	SNP	NULL	p.D359	ENST00000329357.5	37	c.1077	CCDS14236.1	X																																																																																			-	NULL		0.537	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	protein_coding	OTTHUMT00000056211.1	C	NM_152631		34871946	+1	no_errors	NM_152631	genbank	human	predicted	54_36p	silent	SNP	0.079	T
TMPRSS6	164656	genome.wustl.edu	37	22	37499388	37499388	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr22:37499388G>A	ENST00000346753.3	-	2	213	c.97C>T	c.(97-99)Ccg>Tcg	p.P33S	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.P24S|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.P24S|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.P33S|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.P24S	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	33					angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						ATCCCCTCCGGCTCCGCTTCC	0.667																																																0			22											88.0	94.0	92.0					22																	37499388		2203	4300	6503	35829334	SO:0001583	missense	164656			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.97C>T	22.37:g.37499388G>A	ENSP00000334962:p.Pro33Ser		35829334	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	superfamily_SEA domain,superfamily_Spermadhesin CUB domain,superfamily_LDL receptor-like module,HMMSmart_SM00192,HMMPfam_Ldl_recept_a,PatternScan_LDLRA_1,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.P33S	ENST00000346753.3	37	c.97	CCDS13941.1	22	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166171	0.38217	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782;ENST00000423761	D;D;D;D;T;D	0.91577	-2.86;-2.87;-2.86;-2.86;-0.94;-2.35	4.03	4.03	0.46877	.	0.338840	0.21513	N	0.073342	D	0.91831	0.7415	L	0.36672	1.1	0.32480	N	0.541569	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.992	D	0.91885	0.5519	10	0.45353	T	0.12	.	12.0441	0.53469	0.0:0.0:1.0:0.0	.	33;24;33	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	S	24;33;24;24;33;24	ENSP00000371211:P24S;ENSP00000334962:P33S;ENSP00000385453:P24S;ENSP00000384964:P24S;ENSP00000397691:P33S;ENSP00000400317:P24S	ENSP00000334962:P33S	P	-	1	0	TMPRSS6	35829334	1.000000	0.71417	0.980000	0.43619	0.127000	0.20565	2.747000	0.47475	1.970000	0.57323	0.498000	0.49722	CCG	-	NULL		0.667	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	protein_coding	OTTHUMT00000318822.1	G	NM_153609		35829334	-1	no_errors	NM_153609	genbank	human	reviewed	54_36p	missense	SNP	0.875	A
ADRB3	155	genome.wustl.edu	37	8	37822813	37822813	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:37822813G>A	ENST00000345060.3	-	1	1670	c.1175C>T	c.(1174-1176)gCg>gTg	p.A392V	ADRB3_ENST00000520341.1_5'UTR	NM_000025.2	NP_000016.1	P13945	ADRB3_HUMAN	adrenoceptor beta 3	392					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|aging (GO:0007568)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|diet induced thermogenesis (GO:0002024)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|generation of precursor metabolites and energy (GO:0006091)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of MAPK cascade (GO:0043410)|response to antibiotic (GO:0046677)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta-adrenergic receptor activity (GO:0004939)|beta3-adrenergic receptor activity (GO:0015052)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)	9	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)		Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Bethanidine(DB00217)|Bopindolol(DB08807)|Bupranolol(DB08808)|Clenbuterol(DB01407)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Isoprenaline(DB01064)|Mephentermine(DB01365)|Mirabegron(DB08893)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Propranolol(DB00571)|Trimipramine(DB00726)	CCTGGGCTGCGCTGGGCTGCT	0.731																																																0			8											5.0	5.0	5.0					8																	37822813		2093	4128	6221	37941970	SO:0001583	missense	155			AY487247	CCDS6099.1	8p12	2012-08-08	2012-05-09			ENSG00000188778		"""GPCR / Class A : Adrenoceptors : beta"""	288	protein-coding gene	gene with protein product		109691	"""adrenergic, beta-3-, receptor"""			7898940, 15123695	Standard	NM_000025		Approved		uc003xkr.2	P13945		ENST00000345060.3:c.1175C>T	8.37:g.37822813G>A	ENSP00000343782:p.Ala392Val		37941970	Q4JFT4	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A392V	ENST00000345060.3	37	c.1175	CCDS6099.1	8	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129582	0.37630	.	.	ENSG00000188778	ENST00000345060	T	0.56103	0.48	3.96	2.08	0.27032	.	74.219000	0.00166	N	0.000000	T	0.29652	0.0740	N	0.14661	0.345	0.09310	N	1	P	0.45078	0.85	B	0.33521	0.165	T	0.27331	-1.0077	10	0.16420	T	0.52	.	3.9621	0.09415	0.2153:0.0:0.5952:0.1894	.	392	P13945	ADRB3_HUMAN	V	392	ENSP00000343782:A392V	ENSP00000343782:A392V	A	-	2	0	ADRB3	37941970	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.177000	0.09796	0.317000	0.23160	-0.500000	0.04577	GCG	-	NULL		0.731	ADRB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRB3	protein_coding	OTTHUMT00000376826.1	G	NM_000025		37941970	-1	no_errors	NM_000025	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
BRCA1	672	genome.wustl.edu	37	17	41203135	41203135	+	Splice_Site	SNP	C	C	A	rs80358099|rs273901760		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:41203135C>A	ENST00000357654.3	-	20	5396		c.e20-1		BRCA1_ENST00000586385.1_Splice_Site|BRCA1_ENST00000351666.3_Splice_Site|BRCA1_ENST00000468300.1_Splice_Site|BRCA1_ENST00000493795.1_Splice_Site|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Splice_Site|BRCA1_ENST00000352993.3_Splice_Site|BRCA1_ENST00000471181.2_Splice_Site|BRCA1_ENST00000491747.2_Splice_Site|BRCA1_ENST00000346315.3_Splice_Site|BRCA1_ENST00000354071.3_Splice_Site|BRCA1_ENST00000591534.1_Splice_Site	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset						androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCCTGAAGATCTGGAAGAAGA	0.453			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Unknown(1)	ovary(1)	17	GRCh37	CS021726|CS971624|CS973718	BRCA1	S	rs80358099						63.0	62.0	63.0					17																	41203135		2203	4300	6503	38456661	SO:0001630	splice_region_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5278-1G>T	17.37:g.41203135C>A			38456661	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Splice_Site	SNP	-	e19-1	ENST00000357654.3	37	c.5278-1	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	19.46	3.830931	0.71258	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1279	0.65233	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRCA1	38456661	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.743000	0.47442	2.793000	0.96121	0.561000	0.74099	.	-	-		0.453	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	C	NM_007294	Intron	38456661	-1	no_errors	NM_007294	genbank	human	reviewed	54_36p	splice_site	SNP	0.999	A
KLB	152831	genome.wustl.edu	37	4	39448094	39448094	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr4:39448094A>C	ENST00000257408.4	+	4	1845	c.1748A>C	c.(1747-1749)aAa>aCa	p.K583T		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	583	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GTAAACATCAAAAAACAACTT	0.522																																																0			4											105.0	108.0	107.0					4																	39448094		2203	4300	6503	39124489	SO:0001583	missense	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1748A>C	4.37:g.39448094A>C	ENSP00000257408:p.Lys583Thr		39124489	Q2M3K8	Missense_Mutation	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1,PatternScan_GLYCOSYL_HYDROL_F1_2,HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat	p.K583T	ENST00000257408.4	37	c.1748	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820463	0.50633	.	.	ENSG00000134962	ENST00000257408	T	0.35789	1.29	5.68	5.68	0.88126	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.293423	0.40302	N	0.001137	T	0.52948	0.1766	M	0.88450	2.955	0.38481	D	0.947729	D;D	0.53312	0.959;0.959	P;P	0.50537	0.643;0.643	T	0.63919	-0.6528	10	0.46703	T	0.11	-23.4642	10.2921	0.43603	0.9262:0.0:0.0738:0.0	.	574;583	B7ZL50;Q86Z14	.;KLOTB_HUMAN	T	583	ENSP00000257408:K583T	ENSP00000257408:K583T	K	+	2	0	KLB	39124489	0.994000	0.37717	0.996000	0.52242	0.666000	0.39218	2.377000	0.44300	2.166000	0.68216	0.397000	0.26171	AAA	-	superfamily_Glyco_hydro_cat		0.522	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	protein_coding	OTTHUMT00000250429.1	A	NM_175737		39124489	+1	no_errors	NM_175737	genbank	human	validated	54_36p	missense	SNP	0.768	C
TOB2	10766	genome.wustl.edu	37	22	41832754	41832754	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr22:41832754C>T	ENST00000327492.3	-	2	1302	c.596G>A	c.(595-597)aGt>aAt	p.S199N		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	199					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						ACCCCCACCACTTGCTGCCCC	0.642																																																0			22											18.0	18.0	18.0					22																	41832754		2199	4299	6498	40162700	SO:0001583	missense	10766			D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.596G>A	22.37:g.41832754C>T	ENSP00000331305:p.Ser199Asn		40162700	Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Missense_Mutation	SNP	HMMSmart_btg1,HMMPfam_BTG,PatternScan_BTG_1,PatternScan_BTG_2,HMMPfam_PAM2	p.S199N	ENST00000327492.3	37	c.596	CCDS14015.1	22	.	.	.	.	.	.	.	.	.	.	C	0.135	-1.108483	0.01813	.	.	ENSG00000183864	ENST00000327492	T	0.39787	1.06	4.89	1.55	0.23275	.	0.799333	0.12106	N	0.499068	T	0.18841	0.0452	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30707	-0.9969	10	0.02654	T	1	.	5.5456	0.17061	0.0:0.6521:0.1639:0.184	.	199	Q14106	TOB2_HUMAN	N	199	ENSP00000331305:S199N	ENSP00000331305:S199N	S	-	2	0	TOB2	40162700	0.608000	0.26966	0.000000	0.03702	0.629000	0.37895	0.000000	0.12993	0.303000	0.22785	-0.136000	0.14681	AGT	-	NULL		0.642	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOB2	protein_coding	OTTHUMT00000320699.1	C	NM_016272		40162700	-1	no_errors	NM_016272	genbank	human	validated	54_36p	missense	SNP	0.000	T
CARD6	84674	genome.wustl.edu	37	5	40841613	40841613	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr5:40841613G>C	ENST00000254691.5	+	1	328	c.129G>C	c.(127-129)gaG>gaC	p.E43D	CARD6_ENST00000381677.3_Missense_Mutation_p.E43D	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	43	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CTGAGGAAGAGTATGAGACTC	0.398																																																0			5											101.0	102.0	101.0					5																	40841613		2203	4300	6503	40877370	SO:0001583	missense	84674			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.129G>C	5.37:g.40841613G>C	ENSP00000254691:p.Glu43Asp		40877370	Q52LR2	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_CARD	p.E43D	ENST00000254691.5	37	c.129	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508290	0.64410	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.21361	2.01;2.01	4.88	2.16	0.27623	DEATH-like (2);Caspase Recruitment (3);	0.238980	0.29638	N	0.011598	T	0.38348	0.1037	M	0.68952	2.095	0.27852	N	0.940696	D	0.59767	0.986	D	0.77004	0.989	T	0.14144	-1.0483	10	0.87932	D	0	-19.7577	6.7671	0.23573	0.2908:0.0:0.7092:0.0	.	43	Q9BX69	CARD6_HUMAN	D	43	ENSP00000254691:E43D;ENSP00000371093:E43D	ENSP00000254691:E43D	E	+	3	2	CARD6	40877370	0.868000	0.29978	0.869000	0.34112	0.874000	0.50279	-0.334000	0.07883	0.276000	0.22118	-0.253000	0.11424	GAG	-	superfamily_DEATH_like,HMMPfam_CARD		0.398	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	protein_coding	OTTHUMT00000211584.3	G			40877370	+1	no_errors	NM_032587	genbank	human	reviewed	54_36p	missense	SNP	0.988	C
MED20	9477	genome.wustl.edu	37	6	41877141	41877141	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:41877141T>G	ENST00000265350.4	-	3	369	c.289A>C	c.(289-291)Aag>Cag	p.K97Q	MED20_ENST00000409312.1_Missense_Mutation_p.K97Q|MED20_ENST00000467535.1_5'UTR|MED20_ENST00000409060.1_Missense_Mutation_p.K97Q	NM_004275.3	NP_004266.2	Q9H944	MED20_HUMAN	mediator complex subunit 20	97					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)|RNA polymerase II transcription cofactor activity (GO:0001104)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)|pancreas(1)	5	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000367)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCCTTGAGCTTCACCATAAGC	0.517																																																0			6											98.0	85.0	90.0					6																	41877141		2203	4300	6503	41985119	SO:0001583	missense	9477			AF097725	CCDS4862.1	6p21.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000124641	ENSG00000124641			16840	protein-coding gene	gene with protein product		612915	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"""	TRFP		9933582, 15175163	Standard	NM_004275		Approved	DKFZp586D2223, PRO0213	uc011dui.3	Q9H944	OTTHUMG00000014689	ENST00000265350.4:c.289A>C	6.37:g.41877141T>G	ENSP00000265350:p.Lys97Gln		41985119	B4DE08|O95821|Q5T8J4|Q9Y429	Missense_Mutation	SNP	HMMPfam_TATA_RF	p.K97Q	ENST00000265350.4	37	c.289	CCDS4862.1	6	.	.	.	.	.	.	.	.	.	.	T	28.1	4.894753	0.91962	.	.	ENSG00000124641	ENST00000265350;ENST00000409312;ENST00000394251;ENST00000409060	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.77398	0.4124	M	0.86178	2.8	0.80722	D	1	D;D	0.71674	0.998;0.96	D;P	0.69824	0.966;0.742	T	0.81735	-0.0797	9	0.72032	D	0.01	-20.0291	16.0098	0.80391	0.0:0.0:0.0:1.0	.	97;97	B4DE08;Q9H944	.;MED20_HUMAN	Q	97;97;89;97	.	ENSP00000265350:K97Q	K	-	1	0	MED20	41985119	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.848000	0.69458	2.254000	0.74563	0.533000	0.62120	AAG	-	HMMPfam_TATA_RF		0.517	MED20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED20	protein_coding	OTTHUMT00000040539.1	T	NM_004275		41985119	-1	no_errors	NM_004275	genbank	human	validated	54_36p	missense	SNP	1.000	G
PRDM15	63977	genome.wustl.edu	37	21	43221550	43221550	+	Silent	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr21:43221550C>A	ENST00000269844.3	-	31	4484	c.4374G>T	c.(4372-4374)ggG>ggT	p.G1458G	PRDM15_ENST00000422911.1_Silent_p.G1149G|PRDM15_ENST00000447207.2_Silent_p.G1092G|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000538201.1_Silent_p.G1112G|PRDM15_ENST00000398548.1_Silent_p.G1129G	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TAAGCTGGCTCCCCAGGGGCG	0.662																																																0			21											81.0	72.0	75.0					21																	43221550		2203	4300	6503	42094619	SO:0001819	synonymous_variant	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4374G>T	21.37:g.43221550C>A			42094619	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	HMMSmart_SET,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.G1458	ENST00000269844.3	37	c.4374	CCDS13676.1	21																																																																																			-	NULL		0.662	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	protein_coding		C	NM_022115		42094619	-1	no_errors	NM_022115	genbank	human	validated	54_36p	silent	SNP	0.988	A
AP3M2	10947	genome.wustl.edu	37	8	42026496	42026496	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:42026496C>G	ENST00000518421.1	+	10	1465	c.1174C>G	c.(1174-1176)Ctg>Gtg	p.L392V	AP3M2_ENST00000174653.3_Missense_Mutation_p.L392V|AP3M2_ENST00000396926.3_Missense_Mutation_p.L392V|AP3M2_ENST00000520685.1_3'UTR	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	392	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			GGTGAATCGTCTGGATATGTA	0.423																																																0			8											107.0	108.0	108.0					8																	42026496		2203	4300	6503	42145653	SO:0001583	missense	10947			D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.1174C>G	8.37:g.42026496C>G	ENSP00000428787:p.Leu392Val		42145653	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	superfamily_SNARE-like,HMMPfam_Clat_adaptor_s,PatternScan_CLAT_ADAPTOR_M_1,HMMPfam_Adap_comp_sub,superfamily_Second domain of Mu2 adaptin subunit (ap50) of ap2 adaptor,PatternScan_CLAT_ADAPTOR_M_2	p.L392V	ENST00000518421.1	37	c.1174	CCDS6125.1	8	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812069	0.70797	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000521280	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.72	5.72	0.89469	Clathrin adaptor, mu subunit, C-terminal (3);	0.069957	0.64402	N	0.000017	T	0.43411	0.1246	M	0.75884	2.315	0.80722	D	1	D	0.55172	0.97	P	0.59012	0.85	T	0.32348	-0.9910	10	0.72032	D	0.01	-15.1399	15.0609	0.71951	0.0:0.9302:0.0:0.0698	.	392	P53677	AP3M2_HUMAN	V	392;392;392;277	ENSP00000428787:L392V;ENSP00000174653:L392V;ENSP00000380132:L392V;ENSP00000430616:L277V	ENSP00000174653:L392V	L	+	1	2	AP3M2	42145653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.075000	0.50073	2.689000	0.91719	0.591000	0.81541	CTG	-	HMMPfam_Adap_comp_sub,superfamily_Second domain of Mu2 adaptin subunit (ap50) of ap2 adaptor		0.423	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP3M2	protein_coding	OTTHUMT00000376996.1	C			42145653	+1	no_errors	NM_006803	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
TTLL6	284076	genome.wustl.edu	37	17	46863617	46863617	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:46863617G>A	ENST00000393382.3	-	12	1811	c.1670C>T	c.(1669-1671)tCg>tTg	p.S557L	TTLL6_ENST00000433608.2_Missense_Mutation_p.S250L	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CTCGCCTGCCGATTCCCCCTG	0.522																																																0			17											343.0	335.0	338.0					17																	46863617		2203	4300	6503	44218616	SO:0001583	missense	284076			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1670C>T	17.37:g.46863617G>A	ENSP00000377043:p.Ser557Leu		44218616		Missense_Mutation	SNP	HMMPfam_TTL	p.S235L	ENST00000393382.3	37	c.704	CCDS45724.1	17	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824470	0.50739	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	5.63	4.65	0.58169	.	125.583000	0.00166	N	0.000000	T	0.38772	0.1053	M	0.61703	1.905	0.25610	N	0.986505	B;B;P	0.51653	0.003;0.008;0.947	B;B;B	0.38225	0.001;0.008;0.268	T	0.39333	-0.9619	9	0.38643	T	0.18	.	9.7826	0.40658	0.0921:0.0:0.9079:0.0	.	509;310;250	Q8N841;D3DTW0;G5E937	TTLL6_HUMAN;.;.	L	557;250;235;509	.	ENSP00000302547:S250L	S	-	2	0	TTLL6	44218616	0.839000	0.29477	0.644000	0.29465	0.024000	0.10985	2.372000	0.44257	2.802000	0.96397	0.561000	0.74099	TCG	-	NULL		0.522	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	protein_coding	OTTHUMT00000346939.3	G	NM_173623		44218616	-1	no_errors	NM_173623	genbank	human	validated	54_36p	missense	SNP	0.680	A
OR13A1	79290	genome.wustl.edu	37	10	45799431	45799431	+	Missense_Mutation	SNP	G	G	A	rs201230704		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr10:45799431G>A	ENST00000553795.1	-	4	748	c.440C>T	c.(439-441)cCg>cTg	p.P147L	OR13A1_ENST00000374401.2_Missense_Mutation_p.P147L|OR13A1_ENST00000536058.1_Missense_Mutation_p.P147L	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						GTAATGCAGCGGGTGGCAGAT	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		19298	0.001		0.0	False		,,,				2504	0.0															0			10											32.0	27.0	29.0					10																	45799431		2203	4300	6503	45119437	SO:0001583	missense	79290			AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.440C>T	10.37:g.45799431G>A	ENSP00000451950:p.Pro147Leu		45119437	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P147L	ENST00000553795.1	37	c.440	CCDS31188.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	12.27	1.888834	0.33348	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.01902	4.57;4.57;4.57	5.63	3.78	0.43462	GPCR, rhodopsin-like superfamily (1);	0.146445	0.31859	N	0.006944	T	0.07098	0.0180	M	0.93594	3.435	0.52501	D	0.999952	B	0.32101	0.356	B	0.33121	0.158	T	0.00657	-1.1623	10	0.72032	D	0.01	-47.7444	8.8766	0.35350	0.0784:0.0:0.7722:0.1494	.	147	Q8NGR1	O13A1_HUMAN	L	147	ENSP00000451950:P147L;ENSP00000438657:P147L;ENSP00000363522:P147L	ENSP00000311379:P147L	P	-	2	0	OR13A1	45119437	1.000000	0.71417	0.479000	0.27329	0.146000	0.21551	6.327000	0.72910	0.733000	0.32492	-0.141000	0.14075	CCG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.632	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR13A1	protein_coding	OTTHUMT00000047779.2	G	NM_001004297		45119437	-1	no_errors	NM_001004297	genbank	human	validated	54_36p	missense	SNP	0.991	A
ENPP5	59084	genome.wustl.edu	37	6	46133125	46133125	+	Splice_Site	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr6:46133125C>A	ENST00000371383.2	-	4	1265	c.1005G>T	c.(1003-1005)ctG>ctT	p.L335L	ENPP5_ENST00000230565.3_Splice_Site_p.L335L|ENPP5_ENST00000492313.1_5'UTR					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						CATACTCACACAGAAAGTCAT	0.328																																																0			6											183.0	159.0	167.0					6																	46133125		2203	4300	6503	46241084	SO:0001630	splice_region_variant	59084			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1006+1G>T	6.37:g.46133125C>A			46241084		Silent	SNP	superfamily_Alkaline phosphatase-like,HMMPfam_Phosphodiest	p.L335	ENST00000371383.2	37	c.1005	CCDS4915.1	6																																																																																			-	superfamily_Alkaline phosphatase-like,HMMPfam_Phosphodiest		0.328	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	protein_coding	OTTHUMT00000040779.2	C		Silent	46241084	-1	no_errors	NM_021572	genbank	human	validated	54_36p	silent	SNP	0.999	A
ELK1	2002	genome.wustl.edu	37	X	47497528	47497528	+	Silent	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chrX:47497528C>A	ENST00000247161.3	-	4	807	c.708G>T	c.(706-708)gtG>gtT	p.V236V	ELK1_ENST00000376983.3_Silent_p.V236V|ELK1_ENST00000592066.1_Silent_p.V182V|ELK1_ENST00000343894.4_Intron	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	236					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						AACCCGGCTCCACATTAAGCT	0.572																																																0			X											10.0	11.0	11.0					X																	47497528		2174	4198	6372	47382472	SO:0001819	synonymous_variant	2002			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.708G>T	X.37:g.47497528C>A			47382472	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Silent	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Ets,HMMSmart_SM00413,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2"	p.V236	ENST00000247161.3	37	c.708	CCDS14283.1	X																																																																																			-	NULL		0.572	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	protein_coding	OTTHUMT00000056436.1	C	NM_005229		47382472	-1	no_errors	NM_005229	genbank	human	reviewed	54_36p	silent	SNP	0.864	A
STON1	11037	genome.wustl.edu	37	2	48808115	48808115	+	Missense_Mutation	SNP	G	G	A	rs147769896		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:48808115G>A	ENST00000406226.1	+	3	538	c.343G>A	c.(343-345)Gca>Aca	p.A115T	STON1_ENST00000404752.1_Missense_Mutation_p.A115T|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.A115T|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.A115T|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.A115T|STON1_ENST00000309835.3_Missense_Mutation_p.A115T|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.A115T|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.A115T	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	115					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CAGCCCACTCGCAATATCAGG	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		21656	0.0		0.001	False		,,,				2504	0.0															0			2											109.0	105.0	106.0					2																	48808115		2203	4300	6503	48661619	SO:0001583	missense	286749			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.343G>A	2.37:g.48808115G>A	ENSP00000384615:p.Ala115Thr		48661619	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	superfamily_AP50,HMMPfam_Adap_comp_sub,superfamily_TFIIA_helical,HMMPfam_TFIIA,superfamily_TFIIA_betabarrel	p.A115T	ENST00000406226.1	37	c.343	CCDS1841.1	2	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	0.011	-1.720889	0.00700	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96;2.96;3.13	5.24	-7.58	0.01313	.	0.751444	0.12809	N	0.437329	T	0.01765	0.0056	N	0.00483	-1.445	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.39522	-0.9610	10	0.02654	T	1	.	9.3313	0.38023	0.3073:0.4944:0.1983:0.0	.	115;115;115	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	T	115	ENSP00000385273:A115T;ENSP00000384615:A115T;ENSP00000310969:A115T;ENSP00000385499:A115T;ENSP00000385701:A115T;ENSP00000378236:A115T;ENSP00000311493:A115T;ENSP00000378234:A115T	ENSP00000310969:A115T	A	+	1	0	STON1-GTF2A1L;STON1	48661619	0.000000	0.05858	0.000000	0.03702	0.458000	0.32498	0.070000	0.14573	-1.050000	0.03230	-0.238000	0.12139	GCA	-	NULL		0.473	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	protein_coding	OTTHUMT00000323848.2	G	NM_006873		48661619	+1	no_errors	NM_172311	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
MEIS3	56917	genome.wustl.edu	37	19	47912361	47912361	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:47912361G>C	ENST00000558555.1	-	8	1040	c.853C>G	c.(853-855)Ctc>Gtc	p.L285V	MEIS3_ENST00000559524.1_Missense_Mutation_p.L285V|MEIS3_ENST00000561096.1_Missense_Mutation_p.L373V|MEIS3_ENST00000441740.2_Missense_Mutation_p.L268V|MEIS3_ENST00000331559.5_Missense_Mutation_p.L268V|MEIS3_ENST00000561293.1_Missense_Mutation_p.L285V|MEIS3_ENST00000560253.1_5'UTR			Q99687	MEIS3_HUMAN	Meis homeobox 3	285					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CTCACCGAGAGGTGCTGGAAC	0.592																																																0			19											108.0	93.0	98.0					19																	47912361		2203	4300	6503	52604173	SO:0001583	missense	56917			BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.853C>G	19.37:g.47912361G>C	ENSP00000454073:p.Leu285Val		52604173	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like,PatternScan_LIPOCALIN	p.L285V	ENST00000558555.1	37	c.853		19	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406316	0.83230	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	D	0.94576	-3.46	3.86	3.86	0.44501	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000007	D	0.95648	0.8585	L	0.48642	1.525	0.80722	D	1	D;D;P;D;D	0.89917	0.999;1.0;0.822;0.998;0.997	D;D;P;D;D	0.91635	0.998;0.999;0.75;0.99;0.997	D	0.95704	0.8752	10	0.72032	D	0.01	-0.0655	14.1014	0.65059	0.0:0.0:1.0:0.0	.	177;285;268;285;160	Q8TCW1;Q99687;Q99687-3;Q99687-2;Q59FK5	.;MEIS3_HUMAN;.;.;.	V	285;268	ENSP00000388667:L268V	ENSP00000333552:L285V	L	-	1	0	MEIS3	52604173	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.051000	0.93849	2.432000	0.82394	0.655000	0.94253	CTC	-	NULL		0.592	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	MEIS3	protein_coding	OTTHUMT00000417642.1	G	XM_085929		52604173	-1	no_errors	NM_020160	genbank	human	validated	54_36p	missense	SNP	1.000	C
PMEL	6490	genome.wustl.edu	37	12	56355206	56355206	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr12:56355206G>C	ENST00000548747.1	-	3	891	c.229C>G	c.(229-231)Ctg>Gtg	p.L77V	PMEL_ENST00000550447.1_Missense_Mutation_p.L40V|PMEL_ENST00000548493.1_Missense_Mutation_p.L77V|PMEL_ENST00000360714.4_Missense_Mutation_p.L77V|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000552882.1_Missense_Mutation_p.L77V|PMEL_ENST00000449260.2_Missense_Mutation_p.L77V|PMEL_ENST00000536427.1_Missense_Mutation_p.L77V|PMEL_ENST00000550464.1_Intron			P40967	PMEL_HUMAN	premelanosome protein	77					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCACCAATCAGTGTAGGCCCA	0.498																																																0			12											169.0	149.0	155.0					12																	56355206		2203	4300	6503	54641473	SO:0001583	missense	6490			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.229C>G	12.37:g.56355206G>C	ENSP00000448828:p.Leu77Val		54641473	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	superfamily_PKD domain,HMMPfam_PKD,HMMSmart_SM00089	p.L77V	ENST00000548747.1	37	c.229	CCDS8897.1	12	.	.	.	.	.	.	.	.	.	.	g	14.88	2.666097	0.47677	.	.	ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000550447;ENST00000548803;ENST00000547137;ENST00000549418;ENST00000549233	T;T;T;T;T;T;T;T	0.58358	2.05;1.99;1.99;1.99;2.06;1.71;0.34;1.15	5.15	4.24	0.50183	.	0.000000	0.39985	N	0.001209	T	0.69566	0.3125	M	0.81112	2.525	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.83275	0.996;0.991	T	0.72340	-0.4323	10	0.87932	D	0	-11.0054	7.9927	0.30250	0.0852:0.0:0.7529:0.1618	.	77;77	P40967-2;P40967	.;PMEL_HUMAN	V	77;77;77;77;77;77;40;77;77;77;80	ENSP00000402758:L77V;ENSP00000449690:L77V;ENSP00000448828:L77V;ENSP00000447374:L77V;ENSP00000353940:L77V;ENSP00000438695:L77V;ENSP00000447732:L77V;ENSP00000448849:L77V	ENSP00000353940:L77V	L	-	1	2	PMEL	54641473	0.994000	0.37717	0.969000	0.41365	0.978000	0.69477	2.172000	0.42463	2.560000	0.86352	0.643000	0.83706	CTG	-	NULL		0.498	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SILV	protein_coding	OTTHUMT00000409626.1	G	NM_006928		54641473	-1	no_errors	NM_006928	genbank	human	validated	54_36p	missense	SNP	0.870	C
STAT2	6773	genome.wustl.edu	37	12	56742953	56742953	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr12:56742953G>T	ENST00000314128.4	-	16	1457	c.1434C>A	c.(1432-1434)aaC>aaA	p.N478K	STAT2_ENST00000418572.2_Intron|STAT2_ENST00000556539.1_5'UTR|STAT2_ENST00000557235.1_Missense_Mutation_p.N474K			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	478					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						CTACCTGAAGGTTTGGGCTGA	0.562																																																0			12											96.0	96.0	96.0					12																	56742953		2203	4300	6503	55029220	SO:0001583	missense	6773			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1434C>A	12.37:g.56742953G>T	ENSP00000315768:p.Asn478Lys		55029220	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	superfamily_Transcription factor STAT-4 N-domain,HMMPfam_STAT_int,superfamily_STAT,HMMPfam_STAT_alpha,HMMPfam_STAT_bind,superfamily_p53-like transcription factors,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2	p.N478K	ENST00000314128.4	37	c.1434	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	G	9.723	1.160183	0.21454	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000553337	D;D	0.86627	-2.15;-2.15	5.29	-2.06	0.07298	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.457877	0.24003	N	0.042450	T	0.71091	0.3299	N	0.19112	0.55	0.80722	D	1	B;B	0.18166	0.026;0.021	B;B	0.23018	0.043;0.038	T	0.51810	-0.8658	10	0.40728	T	0.16	-1.9605	2.9621	0.05896	0.2962:0.1146:0.4729:0.1163	.	474;478	G3V2M6;P52630	.;STAT2_HUMAN	K	478;474;280	ENSP00000315768:N478K;ENSP00000450751:N474K	ENSP00000315768:N478K	N	-	3	2	STAT2	55029220	0.534000	0.26362	0.941000	0.38009	0.133000	0.20885	0.193000	0.17116	-0.043000	0.13513	-0.251000	0.11542	AAC	-	HMMPfam_STAT_bind,superfamily_p53-like transcription factors		0.562	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	G	NM_005419		55029220	-1	no_errors	NM_005419	genbank	human	reviewed	54_36p	missense	SNP	0.794	T
LIPC	3990	genome.wustl.edu	37	15	58837994	58837994	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr15:58837994T>A	ENST00000356113.6	+	7	1243	c.628T>A	c.(628-630)Tct>Act	p.S210T	LIPC_ENST00000299022.5_Missense_Mutation_p.S210T|LIPC_ENST00000433326.2_Missense_Mutation_p.S149T|LIPC_ENST00000414170.3_Missense_Mutation_p.S210T			P11150	LIPC_HUMAN	lipase, hepatic	210					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		CAATCGTCTTTCTCCAGATGA	0.547																																																0			15											98.0	93.0	94.0					15																	58837994		2192	4292	6484	56625286	SO:0001583	missense	3990				CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.628T>A	15.37:g.58837994T>A	ENSP00000348425:p.Ser210Thr		56625286	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_Lipase,PatternScan_LIPASE_SER,superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),HMMPfam_PLAT,HMMSmart_SM00308	p.S210T	ENST00000356113.6	37	c.628	CCDS10166.1	15	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216758	0.79352	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85	5.44	5.44	0.79542	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94282	0.8163	M	0.69185	2.1	0.80722	D	1	P;D	0.59357	0.939;0.985	P;D	0.66979	0.522;0.948	D	0.94882	0.8040	10	0.87932	D	0	.	15.4981	0.75673	0.0:0.0:0.0:1.0	.	149;210	E7EUK6;P11150	.;LIPC_HUMAN	T	210;210;210;149	ENSP00000348425:S210T;ENSP00000395569:S210T;ENSP00000299022:S210T;ENSP00000395002:S149T	ENSP00000299022:S210T	S	+	1	0	LIPC	56625286	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	8.020000	0.88740	2.060000	0.61445	0.460000	0.39030	TCT	-	superfamily_alpha/beta-Hydrolases,HMMPfam_Lipase		0.547	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIPC	protein_coding	OTTHUMT00000416209.1	T			56625286	+1	no_errors	NM_000236	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF766	90321	genome.wustl.edu	37	19	52793720	52793720	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:52793720G>T	ENST00000439461.1	+	4	719	c.676G>T	c.(676-678)Gac>Tac	p.D226Y	ZNF766_ENST00000593612.1_Missense_Mutation_p.D241Y|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Missense_Mutation_p.D241Y	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AACCGTCAGGGACAAGTCAGG	0.438																																																0			19											63.0	64.0	64.0					19																	52793720		2134	4275	6409	57485532	SO:0001583	missense	90321			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.676G>T	19.37:g.52793720G>T	ENSP00000409652:p.Asp226Tyr		57485532	B2RNE0|Q7Z326	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.D226Y	ENST00000439461.1	37	c.676	CCDS46163.1	19	.	.	.	.	.	.	.	.	.	.	G	4.235	0.042541	0.08196	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	T;T	0.06449	3.3;3.3	2.38	-4.76	0.03229	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01730	0.0055	N	0.04043	-0.29	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.002;0.001	T	0.41484	-0.9506	9	0.02654	T	1	.	1.2957	0.02069	0.1256:0.2505:0.2532:0.3707	.	241;226	G3XAE0;Q5HY98	.;ZN766_HUMAN	Y	226;241	ENSP00000409652:D226Y;ENSP00000352005:D241Y	ENSP00000352005:D241Y	D	+	1	0	ZNF766	57485532	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.090000	0.00014	-1.621000	0.01562	-2.038000	0.00419	GAC	-	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355		0.438	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	protein_coding	OTTHUMT00000462764.1	G	NM_001010851		57485532	+1	no_errors	NM_001010851	genbank	human	validated	54_36p	missense	SNP	0.000	T
OR5A1	219982	genome.wustl.edu	37	11	59211067	59211067	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:59211067C>T	ENST00000302030.2	+	1	451	c.426C>T	c.(424-426)ggC>ggT	p.G142G		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						TGACCCAGGGCCTCTGTACAC	0.562																																																0			11											262.0	244.0	250.0					11																	59211067		2201	4295	6496	58967643	SO:0001819	synonymous_variant	219982			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.426C>T	11.37:g.59211067C>T			58967643	B9EH58|Q6IFF2|Q96RB1	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G142	ENST00000302030.2	37	c.426	CCDS31561.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.562	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A1	protein_coding	OTTHUMT00000394233.1	C	NM_001004728		58967643	+1	no_errors	NM_001004728	genbank	human	provisional	54_36p	silent	SNP	0.000	T
FAM110B	90362	genome.wustl.edu	37	8	59059507	59059507	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:59059507G>A	ENST00000361488.3	+	5	1598	c.718G>A	c.(718-720)Gag>Aag	p.E240K	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	240						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GAAGTCCCCCGAGGCCGACCC	0.617																																																0			8											84.0	94.0	91.0					8																	59059507		2203	4300	6503	59222061	SO:0001583	missense	90362			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.718G>A	8.37:g.59059507G>A	ENSP00000355204:p.Glu240Lys		59222061	Q5BM08|Q9Y4K2	Missense_Mutation	SNP	NULL	p.E240K	ENST00000361488.3	37	c.718	CCDS6170.1	8	.	.	.	.	.	.	.	.	.	.	G	5.728	0.318828	0.10845	.	.	ENSG00000169122	ENST00000361488	T	0.31247	1.5	5.39	5.39	0.77823	.	0.446739	0.24150	N	0.041089	T	0.24547	0.0595	L	0.27053	0.805	0.21579	N	0.999635	B	0.23249	0.082	B	0.15052	0.012	T	0.07908	-1.0748	9	.	.	.	-15.1787	19.1266	0.93388	0.0:0.0:1.0:0.0	.	240	Q8TC76	F110B_HUMAN	K	240	ENSP00000355204:E240K	.	E	+	1	0	FAM110B	59222061	1.000000	0.71417	0.462000	0.27118	0.881000	0.50899	6.993000	0.76245	2.497000	0.84241	0.561000	0.74099	GAG	-	NULL		0.617	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	protein_coding	OTTHUMT00000378095.2	G	NM_147189		59222061	+1	no_errors	NM_147189	genbank	human	validated	54_36p	missense	SNP	1.000	A
EML3	256364	genome.wustl.edu	37	11	62374563	62374563	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:62374563C>G	ENST00000394773.2	-	12	1678	c.1371G>C	c.(1369-1371)aaG>aaC	p.K457N	EML3_ENST00000531557.1_Missense_Mutation_p.K240N|EML3_ENST00000494176.2_Missense_Mutation_p.K429N|RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000438258.1_5'UTR|EML3_ENST00000278845.4_Missense_Mutation_p.K458N|EML3_ENST00000529309.1_Missense_Mutation_p.K457N	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	457						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACTTGGGTTTCTTGTATTTCT	0.532																																																0			11											75.0	78.0	77.0					11																	62374563		2202	4299	6501	62131139	SO:0001583	missense	256364			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.1371G>C	11.37:g.62374563C>G	ENSP00000378254:p.Lys457Asn		62131139	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	HMMPfam_HELP,HMMSmart_SM00320,HMMPfam_WD40,superfamily_WD40 repeat-like	p.K457N	ENST00000394773.2	37	c.1371	CCDS8023.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.977000|3.977000	0.74360|0.74360	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394776|ENST00000394773;ENST00000278845;ENST00000531557;ENST00000494176;ENST00000529309	.|T;T;T;T;T	.|0.27720	.|1.7;1.65;1.65;1.65;1.65	5.22|5.22	5.22|5.22	0.72569|0.72569	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46737|0.46737	0.1408|0.1408	L|L	0.36672|0.36672	1.1|1.1	0.58432|0.58432	D|D	0.999993|0.999993	.|D;D;B;D;D	.|0.76494	.|0.997;0.987;0.058;0.999;0.999	.|D;P;B;D;D	.|0.78314	.|0.958;0.87;0.039;0.991;0.943	T|T	0.45614|0.45614	-0.9249|-0.9249	5|10	.|0.87932	.|D	.|0	-20.0625|-20.0625	16.2719|16.2719	0.82626|0.82626	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|457;457;240;458;429	.|Q32P44-2;Q32P44;G3V195;B7WPE2;G3V1D0	.|.;EMAL3_HUMAN;.;.;.	Q|N	452|457;458;240;429;457	.|ENSP00000378254:K457N;ENSP00000278845:K458N;ENSP00000433417:K240N;ENSP00000435064:K429N;ENSP00000434513:K457N	.|ENSP00000278845:K458N	E|K	-|-	1|3	0|2	EML3|EML3	62131139|62131139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	3.113000|3.113000	0.50376|0.50376	2.447000|2.447000	0.82792|0.82792	0.467000|0.467000	0.42956|0.42956	GAA|AAG	-	superfamily_WD40 repeat-like,HMMSmart_SM00320		0.532	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	protein_coding	OTTHUMT00000313432.1	C	NM_153265		62131139	-1	no_errors	NM_153265	genbank	human	validated	54_36p	missense	SNP	1.000	G
DUXA	503835	genome.wustl.edu	37	19	57669774	57669774	+	Silent	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr19:57669774A>G	ENST00000554048.2	-	4	359	c.360T>C	c.(358-360)ttT>ttC	p.F120F		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		GGTTTTTCATAAATGCCTTGA	0.488																																																0			19											107.0	104.0	105.0					19																	57669774		2203	4300	6503	62361586	SO:0001819	synonymous_variant	503835				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.360T>C	19.37:g.57669774A>G			62361586		Silent	SNP	PatternScan_HOMEOBOX_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.F120	ENST00000554048.2	37	c.360	CCDS33126.1	19																																																																																			-	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox		0.488	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	DUXA	protein_coding	OTTHUMT00000410075.3	A	NM_001012729		62361586	-1	no_errors	NM_001012729	genbank	human	validated	54_36p	silent	SNP	0.009	G
SLC22A6	9356	genome.wustl.edu	37	11	62747321	62747321	+	Silent	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:62747321C>G	ENST00000377871.3	-	7	1403	c.1137G>C	c.(1135-1137)ctG>ctC	p.L379L	SLC22A6_ENST00000360421.4_Silent_p.L379L|SLC22A6_ENST00000537349.1_5'Flank|SLC22A6_ENST00000421062.2_Silent_p.L379L|SLC22A6_ENST00000458333.2_Silent_p.L379L	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	379					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GCTTGGCAGGCAGGTCCACAG	0.572																																																0			11											67.0	64.0	65.0					11																	62747321		2201	4298	6499	62503897	SO:0001819	synonymous_variant	9356			AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.1137G>C	11.37:g.62747321C>G			62503897	A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Silent	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.L379	ENST00000377871.3	37	c.1137	CCDS31591.1	11																																																																																			-	HMMPfam_MFS_1,superfamily_MFS general substrate transporter		0.572	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	SLC22A6	protein_coding	OTTHUMT00000396186.1	C	NM_004790		62503897	-1	no_errors	NM_004790	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
OVOL1	5017	genome.wustl.edu	37	11	65554906	65554906	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:65554906A>T	ENST00000335987.3	+	1	414	c.62A>T	c.(61-63)gAg>gTg	p.E21V	RP11-770G2.4_ENST00000527453.1_RNA|RP11-770G2.4_ENST00000534178.1_RNA|RP11-770G2.4_ENST00000532454.1_RNA	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	21					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		AACTGGAGCGAGCTCCCCGAC	0.701																																																0			11											29.0	29.0	29.0					11																	65554906		2188	4287	6475	65311482	SO:0001583	missense	5017			BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.62A>T	11.37:g.65554906A>T	ENSP00000337862:p.Glu21Val		65311482	Q6PCB1	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.E21V	ENST00000335987.3	37	c.62	CCDS8112.1	11	.	.	.	.	.	.	.	.	.	.	A	23.5	4.422768	0.83559	.	.	ENSG00000172818	ENST00000335987	T	0.12774	2.65	3.49	3.49	0.39957	.	0.000000	0.49916	U	0.000131	T	0.30978	0.0782	M	0.68593	2.085	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	T	0.03095	-1.1073	10	0.72032	D	0.01	-25.3494	9.9743	0.41774	1.0:0.0:0.0:0.0	.	21	O14753	OVOL1_HUMAN	V	21	ENSP00000337862:E21V	ENSP00000337862:E21V	E	+	2	0	OVOL1	65311482	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.716000	0.61916	1.233000	0.43693	0.363000	0.22086	GAG	-	NULL		0.701	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVOL1	protein_coding	OTTHUMT00000390690.1	A	NM_004561		65311482	+1	no_errors	NM_004561	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NAE1	8883	genome.wustl.edu	37	16	66839822	66839822	+	Missense_Mutation	SNP	G	G	C	rs11556608		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:66839822G>C	ENST00000290810.3	-	18	1535	c.1438C>G	c.(1438-1440)Cac>Gac	p.H480D	NAE1_ENST00000379463.2_Missense_Mutation_p.H474D|NAE1_ENST00000394074.2_Missense_Mutation_p.H391D|NAE1_ENST00000359087.4_Missense_Mutation_p.H483D			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	480					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	CACAATTCGTGGACATAATCA	0.373																																																0			16											100.0	92.0	95.0					16																	66839822		2200	4300	6500	65397323	SO:0001583	missense	8883			U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.1438C>G	16.37:g.66839822G>C	ENSP00000290810:p.His480Asp		65397323	A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Missense_Mutation	SNP	superfamily_Activating enzymes of the ubiquitin-like proteins,HMMPfam_ThiF	p.H480D	ENST00000290810.3	37	c.1438	CCDS10820.1	16	.	.	.	.	.	.	.	.	.	.	G	13.28	2.191481	0.38707	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463;ENST00000394074	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.78	4.83	0.62350	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.044839	0.85682	D	0.000000	T	0.48352	0.1495	L	0.58101	1.795	0.80722	D	1	B;P;P	0.52463	0.001;0.953;0.947	B;B;P	0.51701	0.005;0.398;0.677	T	0.41324	-0.9515	10	0.13470	T	0.59	-0.1447	14.6976	0.69134	0.0692:0.0:0.9308:0.0	.	483;480;474	A6NCK0;Q13564;A6NFN4	.;ULA1_HUMAN;.	D	483;480;474;391	ENSP00000351990:H483D;ENSP00000290810:H480D;ENSP00000368776:H474D;ENSP00000377637:H391D	ENSP00000290810:H480D	H	-	1	0	NAE1	65397323	1.000000	0.71417	0.992000	0.48379	0.866000	0.49608	9.074000	0.93998	1.460000	0.47911	0.643000	0.83706	CAC	-	superfamily_Activating enzymes of the ubiquitin-like proteins		0.373	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NAE1	protein_coding	OTTHUMT00000268832.1	G	NM_003905		65397323	-1	no_errors	NM_003905	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	9	68781874	68781874	+	IGR	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:68781874T>A								CR786580.1 (268687 upstream) : AL353763.2 (215534 downstream)																							GAATTTGTTCTCTAGGTCAAA	0.388																																																0			9																																								68171694	SO:0001628	intergenic_variant	0																															9.37:g.68781874T>A			68171694		Missense_Mutation	SNP	HMMPfam_PGM_PMM_I,superfamily_A-D-PHexomutase_a/b/a-I/II/III,PatternScan_PGM_PMM,HMMPfam_PGM_PMM_II,HMMPfam_PGM_PMM_III	p.E122V		37	c.365		9																																																																																			-	superfamily_A-D-PHexomutase_a/b/a-I/II/III	0	0.388					PGM5P2			T			68171694	-1	no_errors	ENST00000377476	ensembl	human	known	54_36p	missense	SNP	1.000	A
NFAT5	10725	genome.wustl.edu	37	16	69725709	69725709	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:69725709G>A	ENST00000354436.2	+	12	2245	c.1927G>A	c.(1927-1929)Gga>Aga	p.G643R	NFAT5_ENST00000393742.2_Missense_Mutation_p.G567R|NFAT5_ENST00000349945.1_Missense_Mutation_p.G567R|NFAT5_ENST00000566899.1_Missense_Mutation_p.G567R|NFAT5_ENST00000432919.1_Missense_Mutation_p.G661R|NFAT5_ENST00000567239.1_Missense_Mutation_p.G660R	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	643					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AAACATAGCAGGAAATGGCTC	0.368																																																0			16											105.0	107.0	106.0					16																	69725709		2198	4300	6498	68283210	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1927G>A	16.37:g.69725709G>A	ENSP00000346420:p.Gly643Arg		68283210	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	superfamily_p53-like transcription factors,HMMPfam_RHD,superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG	p.G661R	ENST00000354436.2	37	c.1981	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224017	0.79576	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.49720	0.78;0.78;0.77;0.78	6.08	6.08	0.98989	.	0.316333	0.35013	N	0.003503	T	0.62036	0.2395	L	0.54323	1.7	0.45762	D	0.998655	D;D;D	0.89917	0.988;0.988;1.0	P;P;D	0.85130	0.839;0.839;0.997	T	0.56914	-0.7900	10	0.34782	T	0.22	-2.1864	12.456	0.55704	0.0821:0.0:0.9179:0.0	.	660;643;661	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	R	661;660;567;643;567	ENSP00000396538:G661R;ENSP00000338806:G567R;ENSP00000346420:G643R;ENSP00000377343:G567R	ENSP00000338806:G567R	G	+	1	0	NFAT5	68283210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.828000	0.48120	2.894000	0.99253	0.655000	0.94253	GGA	-	NULL		0.368	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	G	NM_138714		68283210	+1	no_errors	NM_138713	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TPCN2	219931	genome.wustl.edu	37	11	68853169	68853169	+	Silent	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:68853169T>C	ENST00000294309.3	+	21	1970	c.1869T>C	c.(1867-1869)tgT>tgC	p.C623C	TPCN2_ENST00000542467.1_Intron|MIR3164_ENST00000581178.1_RNA|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	623					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CGGCGCCCTGTGGGAGCTTCG	0.662																																																0			11											66.0	72.0	70.0					11																	68853169		2200	4294	6494	68609745	SO:0001819	synonymous_variant	219931			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1869T>C	11.37:g.68853169T>C			68609745	Q9NT82	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans	p.W525R	ENST00000294309.3	37	c.1573	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	T	6.709	0.499558	0.12762	.	.	ENSG00000162341	ENST00000356782	.	.	.	3.77	-0.166	0.13351	.	.	.	.	.	T	0.61924	0.2386	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61232	-0.7104	5	0.87932	D	0	-14.1638	7.9767	0.30159	0.0:0.3302:0.0:0.6698	.	.	.	.	R	455	.	ENSP00000349231:W455R	W	+	1	0	TPCN2	68609745	0.952000	0.32445	0.875000	0.34327	0.620000	0.37586	-0.044000	0.12023	-0.172000	0.10779	-0.441000	0.05720	TGG	-	NULL		0.662	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	protein_coding	OTTHUMT00000396878.2	T	NM_139075		68609745	+1	no_errors	ENST00000356782	ensembl	human	known	54_36p	missense	SNP	1.000	C
ADAM21P1	145241	genome.wustl.edu	37	14	70714265	70714265	+	RNA	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:70714265G>T	ENST00000530196.1	-	0	253					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TTCCAGGGAAGTGAAATGCTG	0.542																																																0			14																																								69784018			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714265G>T			69784018		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.542	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P	pseudogene	OTTHUMT00000390451.1	G	NG_002467		69784018	-1	pseudogene	NR_003951	genbank	human	validated	54_36p	rna	SNP	0.001	T
TRPA1	8989	genome.wustl.edu	37	8	72951154	72951154	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:72951154G>C	ENST00000262209.4	-	19	2448	c.2241C>G	c.(2239-2241)aaC>aaG	p.N747K	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron|TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	747					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TGCCAGTTGAGTTGAAAGCCA	0.318																																																0			8											95.0	93.0	94.0					8																	72951154		2203	4300	6503	73113708	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2241C>G	8.37:g.72951154G>C	ENSP00000262209:p.Asn747Lys		73113708	A6NIN6	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,PatternScan_EF_HAND_1,HMMPfam_Ion_trans	p.N747K	ENST00000262209.4	37	c.2241	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505919	0.64410	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.78126	-1.15;-1.15	5.14	0.517	0.17025	.	0.312985	0.38164	N	0.001794	T	0.80199	0.4579	L	0.55481	1.735	0.49389	D	0.999786	D	0.69078	0.997	P	0.61477	0.889	T	0.77520	-0.2557	10	0.62326	D	0.03	-27.2357	8.5582	0.33494	0.5634:0.0:0.4366:0.0	.	747	O75762	TRPA1_HUMAN	K	599;747	ENSP00000428151:N599K;ENSP00000262209:N747K	ENSP00000262209:N747K	N	-	3	2	TRPA1	73113708	0.999000	0.42202	0.999000	0.59377	0.994000	0.84299	0.388000	0.20735	0.102000	0.17638	0.650000	0.86243	AAC	-	NULL		0.318	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	G	NM_007332		73113708	-1	no_errors	NM_007332	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
ELMSAN1	91748	genome.wustl.edu	37	14	74206317	74206317	+	Nonsense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:74206317G>T	ENST00000286523.5	-	2	1177	c.395C>A	c.(394-396)tCa>tAa	p.S132*	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Nonsense_Mutation_p.S132*	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GTTCCATGTTGAATGGGGTGG	0.627																																																0			14											76.0	80.0	79.0					14																	74206317		2203	4300	6503	73276070	SO:0001587	stop_gained	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.395C>A	14.37:g.74206317G>T	ENSP00000286523:p.Ser132*		73276070	Q6PK13|Q6PK59|Q6ZS23	Nonsense_Mutation	SNP	HMMPfam_ELM2,superfamily_Homeodomain_like,HMMSmart_SANT,HMMPfam_Myb_DNA-binding	p.S132*	ENST00000286523.5	37	c.395	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	G	41	9.084599	0.99061	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	.	.	.	4.66	4.66	0.58398	.	0.460791	0.20077	N	0.099730	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4361	12.6398	0.56702	0.0:0.166:0.834:0.0	.	.	.	.	X	132	.	ENSP00000286523:S132X	S	-	2	0	C14orf43	73276070	0.081000	0.21417	0.510000	0.27712	0.983000	0.72400	2.803000	0.47924	2.413000	0.81919	0.462000	0.41574	TCA	-	NULL		0.627	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf43	protein_coding	OTTHUMT00000317793.1	G	NM_194278		73276070	-1	no_errors	NM_001043318	genbank	human	validated	54_36p	nonsense	SNP	0.008	T
PRADC1	84279	genome.wustl.edu	37	2	73456033	73456033	+	Silent	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:73456033C>G	ENST00000258083.2	-	4	403	c.336G>C	c.(334-336)gtG>gtC	p.V112V	PRADC1_ENST00000480093.1_Intron	NM_032319.1	NP_115695.1	Q9BSG0	PADC1_HUMAN	protease-associated domain containing 1	112	PA.					extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(1)|lung(2)	4						CAGAGATGATCACCGCCCGCC	0.587																																																0			2											38.0	35.0	36.0					2																	73456033		2203	4300	6503	73309541	SO:0001819	synonymous_variant	84279			BC005069	CCDS1924.1	2p13.2	2012-10-31	2011-04-15	2011-04-15	ENSG00000135617	ENSG00000135617			16047	protein-coding gene	gene with protein product	"""protease-associated domain-containing glycoprotein 21 kDa"""		"""chromosome 2 open reading frame 7"""	C2orf7		15498570	Standard	NM_032319		Approved	MGC13004, PAP21, hPAP21	uc002siy.3	Q9BSG0	OTTHUMG00000129773	ENST00000258083.2:c.336G>C	2.37:g.73456033C>G			73309541	Q2Z1P2	Silent	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA	p.V112	ENST00000258083.2	37	c.336	CCDS1924.1	2																																																																																			-	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA		0.587	PRADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf7	protein_coding	OTTHUMT00000251989.1	C	NM_032319		73309541	-1	no_errors	NM_032319	genbank	human	provisional	54_36p	silent	SNP	1.000	G
CLIP2	7461	genome.wustl.edu	37	7	73771734	73771734	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:73771734A>T	ENST00000395060.1	+	5	1142	c.1142A>T	c.(1141-1143)gAg>gTg	p.E381V	CLIP2_ENST00000223398.6_Missense_Mutation_p.E381V|CLIP2_ENST00000361545.5_Missense_Mutation_p.E381V			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	381						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GAACGGGCTGAGGTGGCCAAG	0.632																																																0			7											39.0	27.0	31.0					7																	73771734		2203	4299	6502	73409670	SO:0001583	missense	7461			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1142A>T	7.37:g.73771734A>T	ENSP00000378500:p.Glu381Val		73409670	O14527|O43611	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.E381V	ENST00000395060.1	37	c.1142	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	A	23.6	4.435025	0.83885	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.64991	-0.1;-0.13;-0.1	4.83	4.83	0.62350	.	0.054945	0.64402	D	0.000001	T	0.78811	0.4342	M	0.83012	2.62	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;P	0.68039	0.955;0.903	T	0.82557	-0.0398	10	0.87932	D	0	-37.276	13.3683	0.60698	1.0:0.0:0.0:0.0	.	381;381	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	V	381	ENSP00000223398:E381V;ENSP00000355151:E381V;ENSP00000378500:E381V	ENSP00000223398:E381V	E	+	2	0	CLIP2	73409670	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	8.839000	0.92120	2.029000	0.59856	0.459000	0.35465	GAG	-	NULL		0.632	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	protein_coding	OTTHUMT00000252556.1	A	NM_003388		73409670	+1	no_errors	NM_003388	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TNRC6C	57690	genome.wustl.edu	37	17	76101076	76101076	+	3'UTR	SNP	G	G	A	rs113588386	byFrequency	TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr17:76101076G>A	ENST00000588061.1	+	0	5950				TNRC6C-AS1_ENST00000589217.1_RNA|TNRC6C_ENST00000335749.4_3'UTR|TNRC6C_ENST00000301624.4_3'UTR|TNRC6C_ENST00000588847.1_3'UTR			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C						embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CAGTCCTTGCGAACTGTTCGC	0.567													G|||	33	0.00658946	0.0015	0.0101	5008	,	,		16332	0.0		0.0189	False		,,,				2504	0.0051															0			17																																								73612671	SO:0001624	3_prime_UTR_variant	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.*150G>A	17.37:g.76101076G>A			73612671	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	RNA	SNP	-	NULL	ENST00000588061.1	37	NULL	CCDS45798.1	17																																																																																			-	-		0.567	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131096	protein_coding	OTTHUMT00000395947.1	G	NM_018996		73612671	-1	rna_with_coding_region	XM_001720907	genbank	human	model	54_36p	rna	SNP	1.000	A
GTF2IRD2	84163	genome.wustl.edu	37	7	74234087	74234087	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:74234087A>T	ENST00000405086.2	-	8	856	c.667T>A	c.(667-669)Tct>Act	p.S223T	GTF2IRD2_ENST00000453619.2_Intron|GTF2IRD2_ENST00000361071.5_Missense_Mutation_p.S223T	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						TACCCACCAGAATCTTCCATG	0.567																																					NSCLC(40;560 1096 7501 40315 49546)											0			7											1.0	1.0	1.0					7																	74234087		26	53	79	73872023	SO:0001583	missense	84163			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.667T>A	7.37:g.74234087A>T	ENSP00000385491:p.Ser223Thr		73872023	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	HMMPfam_GTF2I	p.S223T	ENST00000405086.2	37	c.667	CCDS5576.1	7	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488725	0.26686	.	.	ENSG00000196275	ENST00000405086;ENST00000361071	T;T	0.45668	2.91;0.89	2.61	-0.154	0.13399	.	.	.	.	.	T	0.34135	0.0887	M	0.66939	2.045	0.80722	D	1	B;B;B	0.29671	0.017;0.254;0.0	B;B;B	0.29077	0.007;0.098;0.0	T	0.08493	-1.0719	9	0.38643	T	0.18	.	3.9016	0.09164	0.6505:0.2159:0.1336:0.0	.	223;223;223	Q86UP8-3;Q86UP8-5;Q86UP8	.;.;GTD2A_HUMAN	T	223	ENSP00000385491:S223T;ENSP00000354362:S223T	ENSP00000354362:S223T	S	-	1	0	GTF2IRD2	73872023	0.823000	0.29233	0.861000	0.33841	0.815000	0.46073	0.716000	0.25836	-0.117000	0.11872	0.315000	0.21342	TCT	-	NULL		0.567	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2	protein_coding	OTTHUMT00000252712.3	A	NM_173537		73872023	-1	no_errors	NM_173537	genbank	human	validated	54_36p	missense	SNP	1.000	T
ETFA	2108	genome.wustl.edu	37	15	76523706	76523706	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr15:76523706T>C	ENST00000557943.1	-	10	930	c.850A>G	c.(850-852)Atc>Gtc	p.I284V	ETFA_ENST00000433983.2_Missense_Mutation_p.I235V|ETFA_ENST00000560726.1_Missense_Mutation_p.I24V|ETFA_ENST00000559602.1_Missense_Mutation_p.I180V	NM_000126.3	NP_000117.1	P13804	ETFA_HUMAN	electron-transfer-flavoprotein, alpha polypeptide	284	Domain II. {ECO:0000269|PubMed:8962055}.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9						AAATGTTGGATGGCTCCAGAT	0.318																																																0			15											121.0	108.0	112.0					15																	76523706		2197	4294	6491	74310761	SO:0001583	missense	2108			J04058	CCDS32299.1, CCDS45311.1	15q23-q25	2012-04-04	2008-08-01		ENSG00000140374	ENSG00000140374			3481	protein-coding gene	gene with protein product	"""glutaric aciduria II"""	608053					Standard	NM_000126		Approved	GA2, EMA, MADD	uc002bbt.2	P13804	OTTHUMG00000172586	ENST00000557943.1:c.850A>G	15.37:g.76523706T>C	ENSP00000452762:p.Ile284Val		74310761	B4DT43|Q53XN3	Missense_Mutation	SNP	superfamily_Adenine nucleotide alpha hydrolases-like,HMMPfam_ETF,superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_ETF_alpha,PatternScan_ETF_ALPHA	p.I284V	ENST00000557943.1	37	c.850	CCDS32299.1	15	.	.	.	.	.	.	.	.	.	.	T	24.4	4.522538	0.85600	.	.	ENSG00000140374	ENST00000433983;ENST00000267950	D	0.91996	-2.95	5.92	5.92	0.95590	Electron transfer flavoprotein, alpha subunit, C-terminal (1);Electron transfer flavoprotein, alpha subunit, C-terminal, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.92456	0.7605	L	0.55213	1.73	0.80722	D	1	D;P;P	0.54397	0.966;0.702;0.702	P;P;P	0.51079	0.658;0.658;0.658	D	0.92851	0.6297	10	0.62326	D	0.03	-24.3605	14.1045	0.65080	0.0:0.0:0.0:1.0	.	235;284;284	B4DT43;Q53XN3;P13804	.;.;ETFA_HUMAN	V	235;284	ENSP00000399273:I235V	ENSP00000267950:I284V	I	-	1	0	ETFA	74310761	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.531000	0.73820	2.267000	0.75376	0.528000	0.53228	ATC	-	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_ETF_alpha,PatternScan_ETF_ALPHA		0.318	ETFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFA	protein_coding	OTTHUMT00000419302.2	T	NM_000126		74310761	-1	no_errors	NM_000126	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TMED8	283578	genome.wustl.edu	37	14	77809609	77809609	+	Silent	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:77809609G>C	ENST00000216468.7	-	5	727	c.672C>G	c.(670-672)acC>acG	p.T224T		NM_213601.1	NP_998766.1	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain containing 8	224	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)	15			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		TAGTTACAGGGGTCCAGTCAA	0.468																																																0			14											105.0	89.0	94.0					14																	77809609		2203	4300	6503	76879362	SO:0001819	synonymous_variant	283578			AK095650	CCDS32125.1	14q24.3	2005-08-26	2005-08-26	2005-01-07		ENSG00000100580			18633	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member B"", ""transmembrane emp24 domain containing 8"""	FAM15B			Standard	NM_213601		Approved		uc001xto.1	Q6PL24		ENST00000216468.7:c.672C>G	14.37:g.77809609G>C			76879362	B3KTI6|Q3MJB0|Q9P1V9	Silent	SNP	superfamily_SSF101576	p.T224	ENST00000216468.7	37	c.672	CCDS32125.1	14																																																																																			-	superfamily_SSF101576		0.468	TMED8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED8	protein_coding	OTTHUMT00000414100.1	G	NM_213601		76879362	-1	no_errors	NM_213601	genbank	human	provisional	54_36p	silent	SNP	0.999	C
ZC3H18	124245	genome.wustl.edu	37	16	88697595	88697595	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr16:88697595C>G	ENST00000301011.5	+	18	2950	c.2750C>G	c.(2749-2751)aCc>aGc	p.T917S	ZC3H18_ENST00000452588.2_Missense_Mutation_p.T941S	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	917						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GCCGCCAGCACCAAATCAGGG	0.652																																					Ovarian(121;375 2276 20373 38669)											0			16											41.0	41.0	41.0					16																	88697595		2197	4300	6497	87225096	SO:0001583	missense	124245			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2750C>G	16.37:g.88697595C>G	ENSP00000301011:p.Thr917Ser		87225096	Q96DG4|Q96MP7	Missense_Mutation	SNP	HMMPfam_zf-CCCH,HMMSmart_SM00356	p.T917S	ENST00000301011.5	37	c.2750	CCDS10967.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.35|14.35	2.509585|2.509585	0.44660|0.44660	.|.	.|.	ENSG00000158545|ENSG00000158545	ENST00000289509|ENST00000301011;ENST00000452588	.|T;T	.|0.29397	.|1.6;1.57	5.61|5.61	2.45|2.45	0.29901|0.29901	.|.	.|0.731667	.|0.13799	.|N	.|0.361939	T|T	0.29223|0.29223	0.0727|0.0727	L|L	0.36672|0.36672	1.1|1.1	0.23107|0.23107	N|N	0.998282|0.998282	.|B;B	.|0.28470	.|0.213;0.213	.|B;B	.|0.32090	.|0.14;0.097	T|T	0.17379|0.17379	-1.0371|-1.0371	6|10	0.87932|0.39692	D|T	0|0.17	-1.5031|-1.5031	16.6258|16.6258	0.84970|0.84970	0.0:0.6124:0.3876:0.0|0.0:0.6124:0.3876:0.0	.|.	.|941;917	.|E7ERS3;Q86VM9	.|.;ZCH18_HUMAN	A|S	743|917;941	.|ENSP00000301011:T917S;ENSP00000416951:T941S	ENSP00000289509:P743A|ENSP00000301011:T917S	P|T	+|+	1|2	0|0	ZC3H18|ZC3H18	87225096|87225096	0.996000|0.996000	0.38824|0.38824	0.523000|0.523000	0.27875|0.27875	0.966000|0.966000	0.64601|0.64601	3.576000|3.576000	0.53878|0.53878	0.266000|0.266000	0.21894|0.21894	-0.305000|-0.305000	0.09177|0.09177	CCA|ACC	-	NULL		0.652	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	protein_coding	OTTHUMT00000269168.1	C	NM_144604		87225096	+1	no_errors	NM_144604	genbank	human	provisional	54_36p	missense	SNP	0.972	G
LOC101926911	101926911	genome.wustl.edu	37	15	91576001	91576001	+	RNA	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr15:91576001T>A	ENST00000557804.1	+	0	465				AC068831.10_ENST00000556904.1_RNA|AC068831.10_ENST00000501381.3_RNA																							accatattgatgccaaactta	0.542																																																0			15																																								89377005			0																															15.37:g.91576001T>A			89377005		RNA	SNP	-	NULL	ENST00000557804.1	37	NULL		15																																																																																			-	-		0.542	AC068831.10-004	KNOWN	basic	antisense	ENSG00000208919	antisense	OTTHUMT00000418639.1	T			89377005	-1	pseudogene	ENST00000386184	ensembl	human	novel	54_36p	rna	SNP	0.999	A
ITPK1	3705	genome.wustl.edu	37	14	93408232	93408232	+	Missense_Mutation	SNP	C	C	T	rs201410742		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:93408232C>T	ENST00000267615.6	-	11	1092	c.919G>A	c.(919-921)Gag>Aag	p.E307K	ITPK1_ENST00000555495.1_Missense_Mutation_p.E188K|ITPK1_ENST00000556603.2_Missense_Mutation_p.E307K|ITPK1_ENST00000354313.3_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	307	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GTGAAGAACTCGCTCACGCCC	0.647													c|||	1	0.000199681	0.0	0.0	5008	,	,		17541	0.0		0.001	False		,,,				2504	0.0															0			14						C	LYS/GLU,,LYS/GLU	2,4308		0,2,2153	23.0	19.0	20.0		919,,919	4.6	1.0	14	dbSNP_133	20	0,8438		0,0,4219	no	missense,intron,missense	ITPK1	NM_001142593.1,NM_001142594.1,NM_014216.4	56,,56	0,2,6372	TT,TC,CC		0.0,0.0464,0.0157	benign,,benign	307/415,,307/415	93408232	2,12746	2155	4219	6374	92477985	SO:0001583	missense	3705			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.919G>A	14.37:g.93408232C>T	ENSP00000267615:p.Glu307Lys		92477985	Q9BTL6|Q9H2E7	Missense_Mutation	SNP	HMMPfam_Ins134_P3_kin,superfamily_Glutathione synthetase ATP-binding domain-like	p.E307K	ENST00000267615.6	37	c.919	CCDS9907.1	14	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	21.9	4.211213	0.79240	4.64E-4	0.0	ENSG00000100605	ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	.	.	.	4.59	4.59	0.56863	ATP-grasp fold (1);	0.049617	0.85682	D	0.000000	T	0.55401	0.1918	L	0.45228	1.405	0.58432	D	0.999999	D	0.61697	0.99	P	0.45639	0.488	T	0.59284	-0.7483	9	0.42905	T	0.14	-2.7162	17.42	0.87512	0.0:1.0:0.0:0.0	.	307	Q13572	ITPK1_HUMAN	K	337;307;188;307;307	.	ENSP00000267615:E307K	E	-	1	0	ITPK1	92477985	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	5.709000	0.68384	2.113000	0.64589	0.563000	0.77884	GAG	-	HMMPfam_Ins134_P3_kin,superfamily_Glutathione synthetase ATP-binding domain-like		0.647	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1	protein_coding	OTTHUMT00000412421.2	C	NM_014216		92477985	-1	no_errors	NM_014216	genbank	human	validated	54_36p	missense	SNP	0.999	T
SLC36A4	120103	genome.wustl.edu	37	11	92887287	92887287	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:92887287C>A	ENST00000326402.4	-	10	1324	c.1194G>T	c.(1192-1194)ttG>ttT	p.L398F	SLC36A4_ENST00000529184.1_Missense_Mutation_p.L263F	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4	398					L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TAATACTAACCAAGAAGGATC	0.274																																																0			11											57.0	60.0	59.0					11																	92887287		2197	4290	6487	92526935	SO:0001583	missense	120103			AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.1194G>T	11.37:g.92887287C>A	ENSP00000317382:p.Leu398Phe		92526935	Q86X30|Q8IVM5|Q8N8S6	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.L398F	ENST00000326402.4	37	c.1194	CCDS8291.1	11	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584820	0.65992	.	.	ENSG00000180773	ENST00000326402;ENST00000529184	T;T	0.03330	3.97;3.97	5.8	4.79	0.61399	.	0.000000	0.64402	D	0.000003	T	0.13286	0.0322	M	0.67625	2.065	0.47441	D	0.999425	D	0.89917	1.0	D	0.81914	0.995	T	0.00024	-1.2325	10	0.87932	D	0	-7.0926	7.9933	0.30252	0.0:0.7036:0.1573:0.1391	.	398	Q6YBV0	S36A4_HUMAN	F	398;263	ENSP00000317382:L398F;ENSP00000436570:L263F	ENSP00000317382:L398F	L	-	3	2	SLC36A4	92526935	0.963000	0.33076	1.000000	0.80357	0.997000	0.91878	-0.018000	0.12568	2.748000	0.94277	0.655000	0.94253	TTG	-	HMMPfam_Aa_trans		0.274	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A4	protein_coding	OTTHUMT00000394329.2	C			92526935	-1	no_errors	NM_152313	genbank	human	provisional	54_36p	missense	SNP	0.998	A
BTAF1	9044	genome.wustl.edu	37	10	93702253	93702253	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr10:93702253A>G	ENST00000265990.6	+	4	636	c.328A>G	c.(328-330)Aga>Gga	p.R110G		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	110					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGATATATGTAGATTGTTACA	0.373																																																0			10											126.0	123.0	124.0					10																	93702253		2203	4300	6503	93692233	SO:0001583	missense	9044			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.328A>G	10.37:g.93702253A>G	ENSP00000265990:p.Arg110Gly		93692233	B4E0W6|O43578	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C	p.R110G	ENST00000265990.6	37	c.328	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	A	15.84	2.952216	0.53293	.	.	ENSG00000095564	ENST00000265990	D	0.90197	-2.63	5.71	4.57	0.56435	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85818	0.5785	L	0.52905	1.665	0.80722	D	1	P	0.44946	0.846	B	0.35114	0.196	T	0.82922	-0.0217	10	0.31617	T	0.26	-8.301	12.5871	0.56424	0.6733:0.3267:0.0:0.0	.	110	O14981	BTAF1_HUMAN	G	110	ENSP00000265990:R110G	ENSP00000265990:R110G	R	+	1	2	BTAF1	93692233	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.935000	0.63498	0.968000	0.38212	-0.321000	0.08615	AGA	-	superfamily_ARM repeat		0.373	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	protein_coding	OTTHUMT00000049380.4	A	NM_003972		93692233	+1	no_errors	NM_003972	genbank	human	validated	54_36p	missense	SNP	0.996	G
PDHA2	5161	genome.wustl.edu	37	4	96762459	96762459	+	Silent	SNP	C	C	T	rs146428499	byFrequency	TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr4:96762459C>T	ENST00000295266.4	+	1	1221	c.1158C>T	c.(1156-1158)tcC>tcT	p.S386S		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	386					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		AGTTTAAGTCCGTCAGTTAAA	0.403																																																0			4						C		1,4405	2.1+/-5.4	0,1,2202	89.0	82.0	84.0		1158	-3.2	0.0	4	dbSNP_134	84	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous	PDHA2	NM_005390.4		0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384		386/389	96762459	5,13001	2203	4300	6503	96981482	SO:0001819	synonymous_variant	5161				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.1158C>T	4.37:g.96762459C>T			96981482	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Silent	SNP	superfamily_SSF52518,HMMPfam_E1_dh	p.S386	ENST00000295266.4	37	c.1158	CCDS3644.1	4																																																																																			-	superfamily_SSF52518		0.403	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	protein_coding	OTTHUMT00000253608.1	C			96981482	+1	no_errors	NM_005390	genbank	human	validated	54_36p	silent	SNP	0.001	T
OCM2	4951	genome.wustl.edu	37	7	97617752	97617752	+	Missense_Mutation	SNP	C	C	A	rs201256816		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:97617752C>A	ENST00000257627.4	-	2	261	c.170G>T	c.(169-171)gGg>gTg	p.G57V	OCM2_ENST00000473987.2_5'UTR	NM_006188.3	NP_006179.2	P0CE71	OCM2_HUMAN	oncomodulin 2	57	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			lung(4)	4						ATCCAGATACCCGCTCTGGTC	0.537													.|||	1	0.000199681	0.0	0.0	5008	,	,		17467	0.001		0.0	False		,,,				2504	0.0															0			7											162.0	129.0	141.0					7																	97617752		2203	4300	6503	97455688	SO:0001583	missense	4951			BC156841	CCDS5653.1	7q21.2	2014-04-01			ENSG00000135175	ENSG00000135175		"""EF-hand domain containing"""	34396	protein-coding gene	gene with protein product							Standard	NM_006188		Approved		uc003upc.3	P0CE71	OTTHUMG00000154162	ENST00000257627.4:c.170G>T	7.37:g.97617752C>A	ENSP00000257627:p.Gly57Val		97455688	P32930|Q6ISI5|Q75MW0	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.G57V	ENST00000257627.4	37	c.170	CCDS5653.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	18.83	3.707682	0.68615	.	.	ENSG00000135175	ENST00000257627	D	0.81499	-1.5	3.98	3.98	0.46160	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94368	0.8189	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96746	0.9550	10	0.87932	D	0	-21.8956	14.8293	0.70135	0.0:1.0:0.0:0.0	.	57	P0CE71	OCM2_HUMAN	V	57	ENSP00000257627:G57V	ENSP00000257627:G57V	G	-	2	0	OCM2	97455688	1.000000	0.71417	0.979000	0.43373	0.855000	0.48748	5.432000	0.66514	2.074000	0.62210	0.472000	0.43445	GGG	-	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1		0.537	OCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCM2	protein_coding	OTTHUMT00000334188.1	C	NM_006188		97455688	-1	no_errors	NM_006188	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
AZGP1	563	genome.wustl.edu	37	7	99564733	99564733	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:99564733A>C	ENST00000292401.4	-	4	926	c.790T>G	c.(790-792)Tcc>Gcc	p.S264A	AZGP1_ENST00000483612.1_5'UTR|AZGP1_ENST00000411734.1_3'UTR	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	264	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					ACCACCCAGGACTGGTAAGTG	0.637																																																0			7											73.0	55.0	61.0					7																	99564733		2203	4300	6503	99402669	SO:0001583	missense	563			BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.790T>G	7.37:g.99564733A>C	ENSP00000292401:p.Ser264Ala		99402669	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	HMMPfam_MHC_I,superfamily_MHC antigen-recognition domain,superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC	p.S264A	ENST00000292401.4	37	c.790	CCDS5680.1	7	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550384	0.27739	.	.	ENSG00000160862	ENST00000292401	T	0.02579	4.24	2.17	-3.92	0.04155	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.620952	0.12281	N	0.482886	T	0.01489	0.0048	N	0.13299	0.325	0.80722	D	1	B	0.02656	0.0	B	0.12837	0.008	T	0.48658	-0.9016	10	0.87932	D	0	.	1.0502	0.01578	0.2579:0.399:0.1461:0.197	.	264	P25311	ZA2G_HUMAN	A	264	ENSP00000292401:S264A	ENSP00000292401:S264A	S	-	1	0	AZGP1	99402669	0.002000	0.14202	0.987000	0.45799	0.166000	0.22503	-0.202000	0.09451	-0.415000	0.07484	-0.940000	0.02684	TCC	-	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407		0.637	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	protein_coding	OTTHUMT00000059387.4	A	NM_001185		99402669	-1	no_errors	NM_001185	genbank	human	validated	54_36p	missense	SNP	0.980	C
XKRX	402415	genome.wustl.edu	37	X	100169627	100169627	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chrX:100169627G>A	ENST00000372956.2	-	3	1654	c.1050C>T	c.(1048-1050)ggC>ggT	p.G350G	XKRX_ENST00000468904.1_3'UTR|XKRX_ENST00000328526.5_Silent_p.G363G			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	350						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						TATAGTGCAGGCCCATATGTC	0.453																																																0			X											182.0	163.0	170.0					X																	100169627		2203	4300	6503	100056283	SO:0001819	synonymous_variant	402415			AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.1050C>T	X.37:g.100169627G>A			100056283	B2RNN6|B4DKU2|Q5H9J6	Silent	SNP	NULL	p.G363	ENST00000372956.2	37	c.1089	CCDS14476.2	X																																																																																			-	NULL		0.453	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKRX	protein_coding	OTTHUMT00000057501.3	G	NM_212559		100056283	-1	no_errors	NM_212559	genbank	human	provisional	54_36p	silent	SNP	0.982	A
EPHB4	2050	genome.wustl.edu	37	7	100411573	100411573	+	Silent	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:100411573C>G	ENST00000358173.3	-	9	2127	c.1659G>C	c.(1657-1659)ctG>ctC	p.L553L	EPHB4_ENST00000360620.3_Silent_p.L553L|EPHB4_ENST00000477446.1_5'Flank	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	553					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CAATGACCACCAGGACCAGGA	0.637																																					GBM(200;2113 3072 25865 52728)											0			7											118.0	92.0	101.0					7																	100411573		2203	4300	6503	100249509	SO:0001819	synonymous_variant	2050			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1659G>C	7.37:g.100411573C>G			100249509	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	superfamily_Galactose-binding domain-like,HMMPfam_Ephrin_lbd,HMMSmart_SM00615,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,PatternScan_EGF_2,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMSmart_SM00454,superfamily_SAM/Pointed domain,HMMPfam_SAM_1	p.L553	ENST00000358173.3	37	c.1659	CCDS5706.1	7																																																																																			-	NULL		0.637	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	protein_coding	OTTHUMT00000347222.1	C	NM_004444		100249509	-1	no_errors	NM_004444	genbank	human	reviewed	54_36p	silent	SNP	0.901	G
DLK1	8788	genome.wustl.edu	37	14	101200673	101200673	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr14:101200673G>A	ENST00000341267.4	+	5	834	c.592G>A	c.(592-594)Gcc>Acc	p.A198T	DLK1_ENST00000331224.6_Missense_Mutation_p.A198T	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	198	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CCGGTGCCCAGCCGGCTTCAT	0.657																																																0			14											37.0	44.0	42.0					14																	101200673		2200	4298	6498	100270426	SO:0001583	missense	8788			U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.592G>A	14.37:g.101200673G>A	ENSP00000340292:p.Ala198Thr		100270426	P15803|Q96DW5	Missense_Mutation	SNP	HMMSmart_SM00181,HMMPfam_EGF_2,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_ASX_HYDROXYL	p.A198T	ENST00000341267.4	37	c.592	CCDS9963.1	14	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889099	0.52014	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	T;T	0.66460	-0.21;-0.21	4.58	0.207	0.15214	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	1.053610	0.07440	N	0.897147	T	0.58949	0.2158	N	0.12471	0.22	0.09310	N	1	D;D	0.71674	0.998;0.96	D;P	0.68192	0.956;0.761	T	0.52983	-0.8502	10	0.13853	T	0.58	.	3.9572	0.09395	0.0905:0.4639:0.2206:0.2251	.	198;198	P80370-2;P80370	.;DLK1_HUMAN	T	198	ENSP00000340292:A198T;ENSP00000331081:A198T	ENSP00000331081:A198T	A	+	1	0	DLK1	100270426	0.000000	0.05858	0.517000	0.27799	0.977000	0.68977	-0.237000	0.08990	0.321000	0.23259	0.491000	0.48974	GCC	-	HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_2		0.657	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLK1	protein_coding	OTTHUMT00000414389.1	G			100270426	+1	no_errors	NM_003836	genbank	human	validated	54_36p	missense	SNP	0.000	A
MUC17	140453	genome.wustl.edu	37	7	100685766	100685766	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:100685766G>A	ENST00000306151.4	+	3	11133	c.11069G>A	c.(11068-11070)aGt>aAt	p.S3690N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3690	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGGACGCCTAGTGAAGGAAGC	0.512																																																0			7											212.0	201.0	205.0					7																	100685766		2203	4300	6503	100472486	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11069G>A	7.37:g.100685766G>A	ENSP00000302716:p.Ser3690Asn		100472486	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.S3690N	ENST00000306151.4	37	c.11069	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	g	7.497	0.651875	0.14516	.	.	ENSG00000169876	ENST00000306151	T	0.03035	4.07	0.814	-1.63	0.08345	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	P	0.38280	0.625	P	0.55161	0.77	T	0.50659	-0.8802	9	0.19147	T	0.46	.	5.2586	0.15561	0.0:0.6199:0.3801:0.0	.	3690	Q685J3	MUC17_HUMAN	N	3690	ENSP00000302716:S3690N	ENSP00000302716:S3690N	S	+	2	0	MUC17	100472486	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	-0.095000	0.11077	0.183000	0.20059	0.186000	0.17326	AGT	-	NULL		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100472486	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	missense	SNP	0.002	A
GABBR2	9568	genome.wustl.edu	37	9	101470794	101470794	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:101470794C>G	ENST00000259455.2	-	1	685	c.226G>C	c.(226-228)Ggt>Cgt	p.G76R		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	76					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGGAGCACACCGCGCCCGATG	0.711																																																0			9											38.0	36.0	37.0					9																	101470794		2202	4299	6501	100510615	SO:0001583	missense	9568			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.226G>C	9.37:g.101470794C>G	ENSP00000259455:p.Gly76Arg		100510615	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F3_1,PatternScan_G_PROTEIN_RECEP_F3_2,superfamily_SSF53822,HMMPfam_ANF_receptor,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.G76R	ENST00000259455.2	37	c.226	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745657	0.69418	.	.	ENSG00000136928	ENST00000259455	T	0.20200	2.09	3.04	3.04	0.35103	.	0.000000	0.38058	U	0.001823	T	0.36608	0.0973	L	0.48362	1.52	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.16719	-1.0393	10	0.72032	D	0.01	.	11.5986	0.50988	0.0:1.0:0.0:0.0	.	76	O75899	GABR2_HUMAN	R	76	ENSP00000259455:G76R	ENSP00000259455:G76R	G	-	1	0	GABBR2	100510615	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.082000	0.64450	1.545000	0.49373	0.456000	0.33151	GGT	-	superfamily_SSF53822,HMMPfam_ANF_receptor		0.711	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	protein_coding	OTTHUMT00000053373.1	C			100510615	-1	no_errors	NM_005458	genbank	human	validated	54_36p	missense	SNP	0.999	G
NIT2	56954	genome.wustl.edu	37	3	100053569	100053569	+	5'UTR	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr3:100053569C>A	ENST00000394140.4	+	0	25					NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2						asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						CCCACCGTAGCGACGCCGCGG	0.721																																																0			3											3.0	5.0	4.0					3																	100053569		625	1483	2108	101536259	SO:0001623	5_prime_UTR_variant	56954			AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.-67C>A	3.37:g.100053569C>A			101536259	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	superfamily_Carbon-nitrogen hydrolase,HMMPfam_CN_hydrolase	p.S2R	ENST00000394140.4	37	c.6	CCDS33806.1	3																																																																																			-	NULL		0.721	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIT2	protein_coding	OTTHUMT00000353142.2	C	NM_020202		101536259	+1	no_start_codon	ENST00000394140	ensembl	human	known	54_36p	missense	SNP	0.003	A
PKD2L1	9033	genome.wustl.edu	37	10	102053121	102053121	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr10:102053121T>C	ENST00000318222.3	-	10	2057	c.1675A>G	c.(1675-1677)Atc>Gtc	p.I559V	PKD2L1_ENST00000353274.3_Missense_Mutation_p.I559V|PKD2L1_ENST00000338519.3_Missense_Mutation_p.I484V	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	559					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TCATTGATGATGGCCAGGAAC	0.507																																																0			10											151.0	128.0	136.0					10																	102053121		2203	4300	6503	102043111	SO:0001583	missense	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1675A>G	10.37:g.102053121T>C	ENSP00000325296:p.Ile559Val		102043111	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	HMMPfam_PKD_channel,superfamily_Voltage-gated potassium channels	p.I559V	ENST00000318222.3	37	c.1675	CCDS7492.1	10	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632772	0.87660	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.69306	-0.39;-0.39;-0.39	5.67	5.67	0.87782	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	T	0.79155	0.4398	M	0.64170	1.965	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.78021	-0.2367	10	0.37606	T	0.19	-26.0684	15.153	0.72717	0.0:0.0:0.0:1.0	.	512;559	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	V	484;559;559;557	ENSP00000345068:I484V;ENSP00000266049:I559V;ENSP00000325296:I559V	ENSP00000325296:I559V	I	-	1	0	PKD2L1	102043111	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.982000	0.88131	2.185000	0.69588	0.529000	0.55759	ATC	-	HMMPfam_PKD_channel,superfamily_Voltage-gated potassium channels		0.507	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	protein_coding	OTTHUMT00000049863.2	T	NM_016112		102043111	-1	no_errors	NM_016112	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FOXP2	93986	genome.wustl.edu	37	7	114174756	114174756	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:114174756C>T	ENST00000393494.2	+	3	532	c.253C>T	c.(253-255)Ctg>Ttg	p.L85L	FOXP2_ENST00000403559.4_Silent_p.L85L|FOXP2_ENST00000360232.4_Silent_p.L85L|FOXP2_ENST00000393498.2_Silent_p.L85L|FOXP2_ENST00000393500.3_5'UTR|FOXP2_ENST00000378237.3_Silent_p.L85L|FOXP2_ENST00000459666.1_3'UTR|FOXP2_ENST00000350908.4_Silent_p.L85L|FOXP2_ENST00000393489.3_5'UTR|FOXP2_ENST00000408937.3_Silent_p.L85L|FOXP2_ENST00000390668.3_Silent_p.L84L			O15409	FOXP2_HUMAN	forkhead box P2	85	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						ACAGAGACCACTGCAGGTTAG	0.388																																																0			7											97.0	100.0	99.0					7																	114174756		2203	4300	6503	113961992	SO:0001819	synonymous_variant	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.253C>T	7.37:g.114174756C>T			113961992	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.L85	ENST00000393494.2	37	c.253	CCDS5760.1	7																																																																																			-	NULL		0.388	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	protein_coding	OTTHUMT00000317366.1	C	NM_014491		113961992	+1	no_errors	NM_148898	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CD200R1	131450	genome.wustl.edu	37	3	112643345	112643345	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr3:112643345C>A	ENST00000471858.1	-	6	1079	c.847G>T	c.(847-849)Gtt>Ttt	p.V283F	CD200R1_ENST00000295863.4_Intron|CD200R1_ENST00000308611.3_Missense_Mutation_p.V306F	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	283					regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						ACCTCCTCAACAACTGGAGTA	0.269																																																0			3											100.0	89.0	92.0					3																	112643345		2193	4287	6480	114126035	SO:0001583	missense	131450			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.847G>T	3.37:g.112643345C>A	ENSP00000418928:p.Val283Phe		114126035	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_C2-set_2	p.V306F	ENST00000471858.1	37	c.916	CCDS2970.1	3	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030882	0.35797	.	.	ENSG00000163606	ENST00000471858;ENST00000308611	T;T	0.15139	2.48;2.45	4.61	-1.14	0.09741	.	2.952780	0.01831	U	0.034700	T	0.12944	0.0314	L	0.27053	0.805	0.09310	N	1	B;B	0.14805	0.006;0.011	B;B	0.12156	0.003;0.007	T	0.32719	-0.9896	10	0.87932	D	0	.	4.3225	0.11023	0.4987:0.3073:0.0:0.1939	.	283;306	Q8TD46;Q8TD46-4	MO2R1_HUMAN;.	F	283;306	ENSP00000418928:V283F;ENSP00000311035:V306F	ENSP00000311035:V306F	V	-	1	0	CD200R1	114126035	0.000000	0.05858	0.005000	0.12908	0.077000	0.17291	-0.512000	0.06313	-0.517000	0.06461	0.563000	0.77884	GTT	-	NULL		0.269	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200R1	protein_coding	OTTHUMT00000354467.1	C	NM_138806		114126035	-1	no_errors	NM_138806	genbank	human	reviewed	54_36p	missense	SNP	0.057	A
INIP	58493	genome.wustl.edu	37	9	115456490	115456490	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:115456490C>T	ENST00000374242.4	-	3	354	c.49G>A	c.(49-51)Gca>Aca	p.A17T	INIP_ENST00000374234.1_5'UTR|INIP_ENST00000374236.1_5'UTR|INIP_ENST00000497712.2_5'UTR|INIP_ENST00000374238.1_5'UTR	NM_021218.1	NP_067041.1	Q9NRY2	SOSSC_HUMAN	INTS3 and NABP interacting protein	17					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)											GCCAAGATTGCAACTCTATTT	0.353																																																0			9											131.0	122.0	125.0					9																	115456490		2203	4299	6502	114496311	SO:0001583	missense	58493			AF161411	CCDS6785.1	9q32	2012-06-19	2012-06-19	2012-06-19	ENSG00000148153	ENSG00000148153			24994	protein-coding gene	gene with protein product	"""hSSB-interacting protein 1"", ""sensor of single-strand DNA complex subunit C"", ""minute INTS3/hSSB-associated element"""	613273	"""chromosome 9 open reading frame 80"""	C9orf80		11042152	Standard	NM_021218		Approved	HSPC043, hSSBIP1, SOSS-C, MISE	uc004bgg.3	Q9NRY2	OTTHUMG00000020509	ENST00000374242.4:c.49G>A	9.37:g.115456490C>T	ENSP00000363360:p.Ala17Thr		114496311	Q5VWJ7|Q96E04|Q9P090	Missense_Mutation	SNP	NULL	p.A17T	ENST00000374242.4	37	c.49	CCDS6785.1	9	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691319	0.88735	.	.	ENSG00000148153	ENST00000374242	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	L	0.57536	1.79	0.80722	D	1	P	0.40534	0.72	B	0.40565	0.333	T	0.67425	-0.5674	9	0.59425	D	0.04	-11.5975	19.5958	0.95536	0.0:1.0:0.0:0.0	.	17	Q9NRY2	SOSSC_HUMAN	T	17	.	ENSP00000363360:A17T	A	-	1	0	C9orf80	114496311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.666000	0.74446	2.806000	0.96561	0.655000	0.94253	GCA	-	NULL		0.353	INIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf80	protein_coding	OTTHUMT00000053692.2	C	NM_021218		114496311	-1	no_errors	NM_021218	genbank	human	predicted	54_36p	missense	SNP	1.000	T
COL27A1	85301	genome.wustl.edu	37	9	116930928	116930928	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:116930928C>A	ENST00000356083.3	+	3	1484	c.1093C>A	c.(1093-1095)Ccc>Acc	p.P365T		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	365	Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CACCAAAATCCCCAAAAGCCT	0.547																																																0			9											116.0	113.0	114.0					9																	116930928		2203	4300	6503	115970749	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.1093C>A	9.37:g.116930928C>A	ENSP00000348385:p.Pro365Thr		115970749	Q66K43|Q96JF7	Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.P365T	ENST00000356083.3	37	c.1093	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	c	6.773	0.511599	0.12944	.	.	ENSG00000196739	ENST00000356083;ENST00000357257;ENST00000374106;ENST00000451716	D;D	0.91068	-2.49;-2.78	4.69	2.61	0.31194	.	.	.	.	.	T	0.78773	0.4336	N	0.20986	0.625	0.09310	N	1	B;B	0.17038	0.001;0.02	B;B	0.12156	0.001;0.007	T	0.61544	-0.7041	9	0.02654	T	1	.	5.3647	0.16107	0.2653:0.6295:0.0:0.1053	.	365;312	Q8IZC6;Q5T1U7	CORA1_HUMAN;.	T	365;365;312;312	ENSP00000348385:P365T;ENSP00000391328:P312T	ENSP00000348385:P365T	P	+	1	0	COL27A1	115970749	0.001000	0.12720	0.010000	0.14722	0.109000	0.19521	0.831000	0.27476	0.247000	0.21414	0.457000	0.33378	CCC	-	NULL		0.547	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	protein_coding	OTTHUMT00000053763.1	C	NM_032888		115970749	+1	no_errors	NM_032888	genbank	human	provisional	54_36p	missense	SNP	0.002	A
IGSF3	3321	genome.wustl.edu	37	1	117122026	117122026	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:117122026C>T	ENST00000369486.3	-	10	4087	c.3322G>A	c.(3322-3324)Gtt>Att	p.V1108I	IGSF3_ENST00000318837.6_Missense_Mutation_p.V1128I|IGSF3_ENST00000369483.1_Missense_Mutation_p.V1128I	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1108					lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GTATCTAGAACACGGATGCCG	0.502																																																0			1											78.0	76.0	77.0					1																	117122026		2196	4285	6481	116923549	SO:0001583	missense	3321			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3322G>A	1.37:g.117122026C>T	ENSP00000358498:p.Val1108Ile		116923549	A6NJZ6|A6NMC7	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG,HMMPfam_ig	p.V1128I	ENST00000369486.3	37	c.3382	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322849	0.41096	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.06449	3.3;3.55;3.55	4.61	3.7	0.42460	Immunoglobulin subtype (1);	0.150342	0.44285	N	0.000478	T	0.11196	0.0273	M	0.65498	2.005	0.42328	D	0.992287	D;D	0.64830	0.994;0.966	D;P	0.72625	0.978;0.851	T	0.01961	-1.1239	10	0.41790	T	0.15	-19.1149	10.1279	0.42661	0.0:0.9023:0.0:0.0977	.	1108;1128	O75054;A6NJZ6	IGSF3_HUMAN;.	I	1108;1128;1128	ENSP00000358498:V1108I;ENSP00000358495:V1128I;ENSP00000321184:V1128I	ENSP00000321184:V1128I	V	-	1	0	IGSF3	116923549	0.999000	0.42202	0.070000	0.20053	0.015000	0.08874	4.397000	0.59690	1.158000	0.42547	0.462000	0.41574	GTT	-	HMMSmart_IG		0.502	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	protein_coding	OTTHUMT00000059040.1	C	NM_001542		116923549	-1	no_errors	NM_001542	genbank	human	validated	54_36p	missense	SNP	0.868	T
SCN4B	6330	genome.wustl.edu	37	11	118014566	118014566	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr11:118014566G>C	ENST00000324727.4	-	3	591	c.445C>G	c.(445-447)Ctc>Gtc	p.L149V	SCN4B_ENST00000423160.2_5'Flank|SCN4B_ENST00000529878.1_Intron	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit	149					AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ACGACTTGGAGGAAGATGGTG	0.552																																																0			11											182.0	174.0	177.0					11																	118014566		2200	4296	6496	117519776	SO:0001583	missense	6330			AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.445C>G	11.37:g.118014566G>C	ENSP00000322460:p.Leu149Val		117519776	E9PPT5|Q6PIG5	Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin	p.L149V	ENST00000324727.4	37	c.445	CCDS8389.1	11	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233231	0.79688	.	.	ENSG00000177098	ENST00000324727	D	0.97161	-4.27	4.44	4.44	0.53790	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97185	0.9080	M	0.71581	2.175	0.80722	D	1	P	0.46142	0.873	P	0.50754	0.649	D	0.97340	0.9956	10	0.49607	T	0.09	-6.9475	15.925	0.79609	0.0:0.0:1.0:0.0	.	149	Q8IWT1	SCN4B_HUMAN	V	149	ENSP00000322460:L149V	ENSP00000322460:L149V	L	-	1	0	SCN4B	117519776	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.167000	0.89668	2.021000	0.59480	0.558000	0.71614	CTC	-	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin		0.552	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	protein_coding	OTTHUMT00000392326.1	G			117519776	-1	no_errors	NM_174934	genbank	human	reviewed	54_36p	missense	SNP	0.991	C
LONRF3	79836	genome.wustl.edu	37	X	118143138	118143138	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chrX:118143138T>A	ENST00000371628.3	+	7	1611	c.1580T>A	c.(1579-1581)aTa>aAa	p.I527K	LONRF3_ENST00000304778.7_Missense_Mutation_p.I486K|LONRF3_ENST00000422289.2_Missense_Mutation_p.I271K|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	527							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GAGGAGCTCATAGCTAAATTC	0.363																																																0			X											113.0	102.0	106.0					X																	118143138		2203	4300	6503	118027166	SO:0001583	missense	79836			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1580T>A	X.37:g.118143138T>A	ENSP00000360690:p.Ile527Lys		118027166	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	superfamily_TPR-like,HMMSmart_SM00028,superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_TPR_1,HMMPfam_LON,HMMSmart_SM00464	p.I527K	ENST00000371628.3	37	c.1580	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.0|29.0	4.968808|4.968808	0.92855|0.92855	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000439603|ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	.|T;T;T;T	.|0.21543	.|2.0;2.0;2.0;2.0	6.08|6.08	6.08|6.08	0.98989|0.98989	.|Zinc finger, RING/FYVE/PHD-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46580|0.46580	0.1400|0.1400	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.998;0.999;1.0	.|D;D;D	.|0.78314	.|0.969;0.991;0.987	T|T	0.46965|0.46965	-0.9153|-0.9153	5|10	.|0.87932	.|D	.|0	-42.109|-42.109	14.5874|14.5874	0.68335|0.68335	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|271;486;527	.|B3KUN7;Q496Y0-2;Q496Y0	.|.;.;LONF3_HUMAN	Q|K	292|486;486;527;271	.|ENSP00000360691:I486K;ENSP00000307732:I486K;ENSP00000360690:I527K;ENSP00000408894:I271K	.|ENSP00000307732:I486K	H|I	+|+	3|2	2|0	LONRF3|LONRF3	118027166|118027166	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.957000|0.957000	0.61999|0.61999	8.008000|8.008000	0.88588|0.88588	2.044000|2.044000	0.60594|0.60594	0.486000|0.486000	0.48141|0.48141	CAT|ATA	-	superfamily_RING/U-box		0.363	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	protein_coding	OTTHUMT00000355124.2	T	NM_024778		118027166	+1	no_errors	NM_001031855	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118236316	118236316	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr10:118236316G>C	ENST00000369230.3	+	11	1471	c.1325G>C	c.(1324-1326)gGg>gCg	p.G442A		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	442	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		AATACATCTGGGAAATATGGA	0.308																																																0			10											87.0	95.0	92.0					10																	118236316		2203	4300	6503	118226306	SO:0001583	missense	119548			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1325G>C	10.37:g.118236316G>C	ENSP00000358232:p.Gly442Ala		118226306		Missense_Mutation	SNP	HMMPfam_Lipase,superfamily_alpha/beta-Hydrolases,PatternScan_LIPASE_SER,superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),HMMPfam_PLAT,PatternScan_HMG_COA_REDUCTASE_1	p.G442A	ENST00000369230.3	37	c.1325	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760326	0.49468	.	.	ENSG00000203837	ENST00000369230	D	0.89681	-2.55	4.07	4.07	0.47477	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.142425	0.29066	N	0.013252	D	0.93236	0.7845	M	0.81497	2.545	0.32642	N	0.520538	D	0.54207	0.965	P	0.61722	0.893	D	0.94427	0.7646	10	0.46703	T	0.11	.	14.007	0.64470	0.0:0.0:1.0:0.0	.	442	Q17RR3	LIPR3_HUMAN	A	442	ENSP00000358232:G442A	ENSP00000358232:G442A	G	+	2	0	PNLIPRP3	118226306	1.000000	0.71417	0.993000	0.49108	0.623000	0.37688	3.057000	0.49931	2.208000	0.71279	0.655000	0.94253	GGG	-	superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),HMMPfam_PLAT		0.308	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	protein_coding	OTTHUMT00000050520.1	G	XM_058404		118226306	+1	no_errors	NM_001011709	genbank	human	validated	54_36p	missense	SNP	0.992	C
RHOXF2B	727940	genome.wustl.edu	37	X	119211186	119211186	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chrX:119211186C>T	ENST00000371402.2	-	2	336	c.147G>A	c.(145-147)gaG>gaA	p.E49E	RP4-755D9.1_ENST00000553843.1_RNA	NM_001099685.1	NP_001093155.1	P0C7M4	RHF2B_HUMAN	Rhox homeobox family, member 2B	49					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|skin(3)|upper_aerodigestive_tract(1)	7						CTTGCTCAGGCTCAGGCTGTG	0.512																																																0			X											7.0	7.0	7.0					X																	119211186		1782	3556	5338	119095214	SO:0001819	synonymous_variant	727940				CCDS43985.1	Xq24	2011-06-20			ENSG00000203989	ENSG00000203989		"""Homeoboxes / PRD class"""	33519	protein-coding gene	gene with protein product							Standard	NM_001099685		Approved		uc004esj.4	P0C7M4	OTTHUMG00000022288	ENST00000371402.2:c.147G>A	X.37:g.119211186C>T			119095214		Silent	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.E49	ENST00000371402.2	37	c.147	CCDS43985.1	X																																																																																			-	NULL		0.512	RHOXF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2B	protein_coding	OTTHUMT00000058081.2	C	NM_001099685		119095214	-1	no_errors	NM_001099685	genbank	human	inferred	54_36p	silent	SNP	0.000	T
SAMD12	401474	genome.wustl.edu	37	8	119391936	119391936	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:119391936C>T	ENST00000314727.4	-	4	462	c.326G>A	c.(325-327)cGa>cAa	p.R109Q	SAMD12_ENST00000527515.1_5'Flank|SAMD12_ENST00000409003.4_Missense_Mutation_p.R109Q|AC023590.1_ENST00000430457.1_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	109	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CAGCAGGGCTCGCCCTGCAGG	0.478																																																0			8											78.0	74.0	75.0					8																	119391936		2203	4300	6503	119461117	SO:0001583	missense	401474			AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.326G>A	8.37:g.119391936C>T	ENSP00000314173:p.Arg109Gln		119461117	Q0P502	Missense_Mutation	SNP	superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_2	p.R109Q	ENST00000314727.4	37	c.326	CCDS6325.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.800952|5.800952	0.96960|0.96960	.|.	.|.	ENSG00000177570|ENSG00000177570	ENST00000526765|ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328	.|D;D;D;D	.|0.84873	.|-1.91;-1.91;-1.91;-1.91	6.17|6.17	6.17|6.17	0.99709|0.99709	.|Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92296|0.92296	0.7556|0.7556	M|M	0.70787|0.70787	2.145|2.145	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.998;1.0	.|D;D	.|0.78314	.|0.988;0.991	D|D	0.90412|0.90412	0.4410|0.4410	5|9	.|.	.|.	.|.	-4.9277|-4.9277	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|109;109	.|B8ZZB7;Q8N8I0	.|.;SAM12_HUMAN	K|Q	124|109;101;109;109	.|ENSP00000387133:R109Q;ENSP00000435927:R101Q;ENSP00000314173:R109Q;ENSP00000431360:R109Q	.|.	E|R	-|-	1|2	0|0	SAMD12|SAMD12	119461117|119461117	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.487000|7.487000	0.81328|0.81328	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAG|CGA	-	superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_2		0.478	SAMD12-001	KNOWN	basic|CCDS	protein_coding	SAMD12	protein_coding	OTTHUMT00000132989.3	C	NM_207506		119461117	-1	no_errors	NM_207506	genbank	human	validated	54_36p	missense	SNP	1.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120464419	120464419	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:120464419G>C	ENST00000256646.2	-	29	5446	c.5227C>G	c.(5227-5229)Caa>Gaa	p.Q1743E	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1743					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTGAGACTTGCACTGAGAGA	0.408			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0			1											100.0	97.0	98.0					1																	120464419		2203	4300	6503	120265942	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5227C>G	1.37:g.120464419G>C	ENSP00000256646:p.Gln1743Glu		120265942	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_NL,HMMPfam_Notch,superfamily_Notch_region,HMMPfam_NOD,HMMPfam_NODP,superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.Q1743E	ENST00000256646.2	37	c.5227	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218695	0.39201	.	.	ENSG00000134250	ENST00000256646	T	0.81163	-1.46	5.2	5.2	0.72013	.	0.000000	0.36665	U	0.002473	T	0.52058	0.1711	L	0.31845	0.965	0.47214	D	0.999356	B	0.33919	0.432	B	0.23419	0.046	T	0.62572	-0.6826	10	0.02654	T	1	.	17.9136	0.88942	0.0:0.0:1.0:0.0	.	1743	Q04721	NOTC2_HUMAN	E	1743	ENSP00000256646:Q1743E	ENSP00000256646:Q1743E	Q	-	1	0	NOTCH2	120265942	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.444000	0.60001	2.706000	0.92434	0.563000	0.77884	CAA	-	NULL		0.408	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	protein_coding	OTTHUMT00000033679.1	G	NM_024408		120265942	-1	no_errors	NM_024408	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
HYAL4	23553	genome.wustl.edu	37	7	123509246	123509246	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:123509246G>A	ENST00000223026.4	+	3	1557	c.919G>A	c.(919-921)Ggg>Agg	p.G307R	HYAL4_ENST00000476325.1_Missense_Mutation_p.G307R	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	307					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						CACAAGGCTAGGGTACAGAGA	0.413																																																0			7											47.0	44.0	45.0					7																	123509246		2203	4300	6503	123296482	SO:0001583	missense	23553			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.919G>A	7.37:g.123509246G>A	ENSP00000223026:p.Gly307Arg		123296482	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_56,superfamily_Glyco_hydro_cat,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.G307R	ENST00000223026.4	37	c.919	CCDS5789.1	7	.	.	.	.	.	.	.	.	.	.	G	16.21	3.060124	0.55432	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.21361	2.01;2.01	5.89	5.89	0.94794	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.41190	0.1148	L	0.44542	1.39	0.54753	D	0.999986	D;D	0.76494	0.999;0.999	D;D	0.75020	0.958;0.985	T	0.01675	-1.1298	9	.	.	.	-12.0053	20.2474	0.98399	0.0:0.0:1.0:0.0	.	307;307	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	R	307	ENSP00000223026:G307R;ENSP00000417186:G307R	.	G	+	1	0	HYAL4	123296482	1.000000	0.71417	0.310000	0.25168	0.002000	0.02628	7.958000	0.87877	2.763000	0.94921	0.655000	0.94253	GGG	-	HMMPfam_Glyco_hydro_56,superfamily_Glyco_hydro_cat		0.413	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	protein_coding	OTTHUMT00000348545.1	G	NM_012269		123296482	+1	no_errors	NM_012269	genbank	human	reviewed	54_36p	missense	SNP	0.994	A
ARF5	381	genome.wustl.edu	37	7	127231348	127231348	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:127231348C>T	ENST00000000233.5	+	6	692	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	FSCN3_ENST00000420086.2_5'Flank|FSCN3_ENST00000265825.5_5'Flank|GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	180					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						GCTGTCAAAGCGCTAACCAGC	0.627																																																0			7											34.0	31.0	32.0					7																	127231348		2203	4300	6503	127018584	SO:0001583	missense	381				CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.538C>T	7.37:g.127231348C>T	ENSP00000000233:p.Arg180Cys		127018584	P26437	Missense_Mutation	SNP	HMMSmart_SM00178,HMMSmart_SM00177,HMMPfam_Arf,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,PatternScan_ARF	p.R180C	ENST00000000233.5	37	c.538	CCDS34745.1	7	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134772	0.77662	.	.	ENSG00000004059	ENST00000000233	T	0.68903	-0.36	5.21	5.21	0.72293	.	0.128592	0.52532	D	0.000066	T	0.79112	0.4391	M	0.89287	3.02	0.47476	D	0.999433	D	0.67145	0.996	P	0.50825	0.651	D	0.84365	0.0540	10	0.87932	D	0	.	16.6166	0.84917	0.0:1.0:0.0:0.0	.	180	P84085	ARF5_HUMAN	C	180	ENSP00000000233:R180C	ENSP00000000233:R180C	R	+	1	0	ARF5	127018584	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.713000	0.61895	2.590000	0.87494	0.561000	0.74099	CGC	-	HMMSmart_SM00177,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175		0.627	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF5	protein_coding	OTTHUMT00000059567.2	C	NM_001662		127018584	+1	no_errors	NM_001662	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ABL1	25	genome.wustl.edu	37	9	133760930	133760930	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr9:133760930G>C	ENST00000318560.5	+	11	3634	c.3253G>C	c.(3253-3255)Gag>Cag	p.E1085Q		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	1085	F-actin-binding.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	TGCCTTCCGAGAGGCCATCAA	0.562			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	0			9											79.0	80.0	80.0					9																	133760930		2203	4300	6503	132750751	SO:0001583	missense	25			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.3253G>C	9.37:g.133760930G>C	ENSP00000323315:p.Glu1085Gln		132750751	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMPfam_F_actin_bind,HMMSmart_SM00808	p.E1104Q	ENST00000318560.5	37	c.3310	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142147	0.77775	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.45276	0.9;0.9	5.26	5.26	0.73747	F-actin binding (2);	0.049705	0.85682	D	0.000000	T	0.50599	0.1625	N	0.16833	0.445	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56774	-0.7923	10	0.59425	D	0.04	.	17.8543	0.88758	0.0:0.0:1.0:0.0	.	1085;1122	P00519;Q59FK4	ABL1_HUMAN;.	Q	900;1104;1085	ENSP00000361423:E1104Q;ENSP00000323315:E1085Q	ENSP00000323315:E1085Q	E	+	1	0	ABL1	132750751	1.000000	0.71417	0.947000	0.38551	0.995000	0.86356	7.984000	0.88150	2.457000	0.83068	0.555000	0.69702	GAG	-	HMMPfam_F_actin_bind,HMMSmart_SM00808		0.562	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	protein_coding	OTTHUMT00000054684.1	G	NM_007313		132750751	+1	no_errors	NM_007313	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
TMEM71	137835	genome.wustl.edu	37	8	133764044	133764044	+	Missense_Mutation	SNP	C	C	G	rs551754127		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:133764044C>G	ENST00000356838.3	-	4	443	c.301G>C	c.(301-303)Gag>Cag	p.E101Q	TMEM71_ENST00000377901.4_Missense_Mutation_p.E101Q|TMEM71_ENST00000523829.1_Missense_Mutation_p.E101Q|TMEM71_ENST00000517538.1_5'UTR	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	101						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			ACTAAGTTCTCCTTATACATA	0.383																																																0			8											139.0	128.0	132.0					8																	133764044		2203	4300	6503	133833226	SO:0001583	missense	137835			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.301G>C	8.37:g.133764044C>G	ENSP00000349296:p.Glu101Gln		133833226	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	NULL	p.E101Q	ENST00000356838.3	37	c.301	CCDS6366.1	8	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404820	0.62288	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000522334;ENST00000519016	.	.	.	5.95	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.79240	0.4412	M	0.77103	2.36	0.38897	D	0.957241	D;D;D	0.89917	0.995;0.99;1.0	P;P;D	0.87578	0.799;0.68;0.998	D	0.83549	0.0100	9	0.87932	D	0	-12.2582	14.604	0.68463	0.0:0.8548:0.1452:0.0	.	101;101;101	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	Q	101;101;101;4;4	.	ENSP00000349296:E101Q	E	-	1	0	TMEM71	133833226	1.000000	0.71417	1.000000	0.80357	0.179000	0.23085	6.586000	0.74067	1.508000	0.48769	0.655000	0.94253	GAG	-	NULL		0.383	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM71	protein_coding	OTTHUMT00000379591.1	C	NM_144649		133833226	-1	no_errors	NM_144649	genbank	human	validated	54_36p	missense	SNP	1.000	G
DDX46	9879	genome.wustl.edu	37	5	134147462	134147462	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr5:134147462C>G	ENST00000354283.4	+	18	2498	c.2363C>G	c.(2362-2364)gCt>gGt	p.A788G	DDX46_ENST00000452510.2_Missense_Mutation_p.A788G			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	788					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAAGCTTTGGCTAATGAGAGG	0.358																																					Colon(13;391 453 4901 21675 24897)											0			5											120.0	123.0	122.0					5																	134147462		2203	4300	6503	134175361	SO:0001583	missense	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2363C>G	5.37:g.134147462C>G	ENSP00000346236:p.Ala788Gly		134175361	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C	p.A788G	ENST00000354283.4	37	c.2363	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212539	0.58452	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.27256	1.69;1.68	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	M	0.78456	2.415	0.80722	D	1	P	0.38395	0.629	B	0.43331	0.416	T	0.21621	-1.0240	10	0.23891	T	0.37	-13.6189	18.4958	0.90864	0.0:1.0:0.0:0.0	.	788	Q7L014	DDX46_HUMAN	G	788	ENSP00000416534:A788G;ENSP00000346236:A788G	ENSP00000346236:A788G	A	+	2	0	DDX46	134175361	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.050000	0.71063	2.430000	0.82344	0.491000	0.48974	GCT	-	superfamily_SSF52540		0.358	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	protein_coding	OTTHUMT00000371584.1	C	NM_014829		134175361	+1	no_errors	NM_014829	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DGKI	9162	genome.wustl.edu	37	7	137269994	137269994	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr7:137269994G>A	ENST00000288490.5	-	14	1524	c.1524C>T	c.(1522-1524)ccC>ccT	p.P508P	DGKI_ENST00000446122.1_Silent_p.P508P|DGKI_ENST00000424189.2_Silent_p.P508P|DGKI_ENST00000453654.2_Silent_p.P208P	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	508					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAGGCAAGTCGGGGTTTCTTT	0.478																																																0			7											154.0	143.0	147.0					7																	137269994		2203	4300	6503	136920534	SO:0001819	synonymous_variant	9162			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1524C>T	7.37:g.137269994G>A			136920534	A4D1Q9|Q9NZ49	Silent	SNP	PatternScan_ZF_DAG_PE_1,HMMSmart_C1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_DAGKc,HMMPfam_DAGK_acc,HMMSmart_DAGKa,superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK	p.P508	ENST00000288490.5	37	c.1524	CCDS5845.1	7																																																																																			-	NULL		0.478	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	G	NM_004717		136920534	-1	no_errors	NM_004717	genbank	human	reviewed	54_36p	silent	SNP	0.932	A
TRAPPC9	83696	genome.wustl.edu	37	8	141436737	141436737	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:141436737G>A	ENST00000438773.2	-	5	996	c.863C>T	c.(862-864)gCa>gTa	p.A288V	TRAPPC9_ENST00000389327.3_Intron|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.A386V	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	288					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						AACTTCCTGTGCCCCTGGAAG	0.313																																																0			8											147.0	140.0	142.0					8																	141436737		2203	4300	6503	141505919	SO:0001583	missense	83696			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.863C>T	8.37:g.141436737G>A	ENSP00000405060:p.Ala288Val		141505919	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	HMMPfam_Trs120	p.A386V	ENST00000438773.2	37	c.1157	CCDS55278.1	8	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808926	0.50421	.	.	ENSG00000167632	ENST00000389328;ENST00000438773	.	.	.	5.39	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.47619	0.1455	L	0.34521	1.04	0.80722	D	1	B;P	0.35155	0.018;0.487	B;B	0.35470	0.035;0.203	T	0.47911	-0.9080	9	0.42905	T	0.14	.	14.1241	0.65208	0.0738:0.0:0.9262:0.0	.	288;386	Q96Q05;Q96Q05-2	TPPC9_HUMAN;.	V	386;288	.	ENSP00000373979:A386V	A	-	2	0	TRAPPC9	141505919	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.442000	0.80503	1.416000	0.47057	0.467000	0.42956	GCA	-	NULL		0.313	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	protein_coding	OTTHUMT00000377749.1	G	NM_031466		141505919	-1	no_errors	NM_031466	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ARHGAP15	55843	genome.wustl.edu	37	2	143986163	143986163	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:143986163A>G	ENST00000295095.6	+	5	477	c.310A>G	c.(310-312)Act>Gct	p.T104A	ARHGAP15_ENST00000409869.1_Missense_Mutation_p.T104A	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	104	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAACTGGTCTACTTCCTGGAT	0.328																																																0			2											89.0	94.0	93.0					2																	143986163		2203	4299	6502	143702633	SO:0001583	missense	55843			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.310A>G	2.37:g.143986163A>G	ENSP00000295095:p.Thr104Ala		143702633	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.T104A	ENST00000295095.6	37	c.310	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568001	0.45798	.	.	ENSG00000075884	ENST00000409869;ENST00000295095	T;T	0.75260	-0.92;-0.92	5.6	4.43	0.53597	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.452763	0.24708	N	0.036252	T	0.66626	0.2808	L	0.28274	0.84	0.42026	D	0.991007	P;B	0.44195	0.828;0.116	P;B	0.47251	0.542;0.101	T	0.62868	-0.6763	10	0.31617	T	0.26	.	10.6972	0.45905	0.8576:0.0:0.0:0.1424	.	104;104	B4E0R3;Q53QZ3	.;RHG15_HUMAN	A	104	ENSP00000386560:T104A;ENSP00000295095:T104A	ENSP00000295095:T104A	T	+	1	0	ARHGAP15	143702633	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.107000	0.57811	0.922000	0.37019	0.528000	0.53228	ACT	-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.328	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	protein_coding	OTTHUMT00000254793.2	A	NM_018460		143702633	+1	no_errors	NM_018460	genbank	human	validated	54_36p	missense	SNP	1.000	G
ARHGAP39	80728	genome.wustl.edu	37	8	145773414	145773414	+	Silent	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr8:145773414C>T	ENST00000276826.5	-	4	1257	c.1056G>A	c.(1054-1056)aaG>aaA	p.K352K	ARHGAP39_ENST00000540274.1_Silent_p.K352K|ARHGAP39_ENST00000377307.2_Silent_p.K352K|ARHGAP39_ENST00000528810.1_5'Flank			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	352	Pro-rich.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						ACGGCCGGGGCTTACGGCCCG	0.697																																																0			8											14.0	14.0	14.0					8																	145773414		2168	4235	6403	145744222	SO:0001819	synonymous_variant	80728				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.1056G>A	8.37:g.145773414C>T			145744222	B4E1I1	Silent	SNP	HMMSmart_SM00456,HMMPfam_WW,superfamily_WW domain,HMMSmart_SM00139,HMMPfam_MyTH4,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.K352	ENST00000276826.5	37	c.1056		8																																																																																			-	NULL		0.697	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	KIAA1688	protein_coding	OTTHUMT00000382509.1	C			145744222	-1	no_errors	NM_025251	genbank	human	validated	54_36p	silent	SNP	1.000	T
IFIH1	64135	genome.wustl.edu	37	2	163163342	163163342	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:163163342C>G	ENST00000263642.2	-	3	1041	c.646G>C	c.(646-648)Gat>Cat	p.D216H		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	216		Cleavage. {ECO:0000250}.			cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						TGAGGACCATCAACTTGTGAT	0.373																																																0			2											101.0	92.0	95.0					2																	163163342		2203	4300	6503	162871588	SO:0001583	missense	64135			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.646G>C	2.37:g.163163342C>G	ENSP00000263642:p.Asp216His		162871588	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_CARD,HMMSmart_SM00487,HMMPfam_ResIII,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00490,HMMPfam_Helicase_C	p.D216H	ENST00000263642.2	37	c.646	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	c	12.55	1.970806	0.34754	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.05513	3.43	4.32	1.5	0.22942	.	0.987711	0.08271	N	0.971476	T	0.07728	0.0194	L	0.57536	1.79	0.09310	N	0.999999	P	0.39216	0.664	B	0.39185	0.293	T	0.38802	-0.9644	10	0.15066	T	0.55	-0.8154	6.7397	0.23428	0.0:0.7009:0.0:0.2991	.	216	Q9BYX4	IFIH1_HUMAN	H	216	ENSP00000263642:D216H	ENSP00000263642:D216H	D	-	1	0	IFIH1	162871588	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.517000	0.06275	0.200000	0.20447	0.556000	0.70494	GAT	-	NULL		0.373	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	protein_coding	OTTHUMT00000255078.2	C	NM_022168		162871588	-1	no_errors	NM_022168	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
SLC19A2	10560	genome.wustl.edu	37	1	169439231	169439231	+	Missense_Mutation	SNP	C	C	A	rs199921604		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:169439231C>A	ENST00000236137.5	-	3	1237	c.1001G>T	c.(1000-1002)gGt>gTt	p.G334V	SLC19A2_ENST00000367804.4_Missense_Mutation_p.G133V	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	334					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	CTCCACGCCACCATTATAGAT	0.512																																																0			1											105.0	100.0	101.0					1																	169439231		2203	4300	6503	167705855	SO:0001583	missense	10560			AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.1001G>T	1.37:g.169439231C>A	ENSP00000236137:p.Gly334Val		167705855	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_Folate_carrier,PatternScan_G_PROTEIN_RECEP_F1_1	p.G334V	ENST00000236137.5	37	c.1001	CCDS1280.1	1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923329	0.92319	.	.	ENSG00000117479	ENST00000236137;ENST00000367804;ENST00000367802	D;D;D	0.90900	-2.75;-2.75;-2.75	5.87	5.87	0.94306	Major facilitator superfamily domain, general substrate transporter (1);	0.099516	0.64402	D	0.000002	D	0.96629	0.8900	M	0.92923	3.36	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96755	0.9557	9	0.87932	D	0	-13.1308	20.197	0.98244	0.0:1.0:0.0:0.0	.	133;334	O60779-2;O60779	.;S19A2_HUMAN	V	334;133;296	ENSP00000236137:G334V;ENSP00000356778:G133V;ENSP00000356776:G296V	ENSP00000236137:G334V	G	-	2	0	SLC19A2	167705855	1.000000	0.71417	0.919000	0.36401	0.979000	0.70002	7.487000	0.81328	2.776000	0.95493	0.585000	0.79938	GGT	-	superfamily_MFS general substrate transporter,HMMPfam_Folate_carrier		0.512	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A2	protein_coding	OTTHUMT00000086106.1	C	NM_006996		167705855	-1	no_errors	NM_006996	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
ZNF648	127665	genome.wustl.edu	37	1	182026653	182026653	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:182026653G>T	ENST00000339948.3	-	2	700	c.493C>A	c.(493-495)Ccc>Acc	p.P165T		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GGGAAGCTGGGTGGGACATCC	0.547																																					NSCLC(71;908 1374 5429 20458 35642)											0			1											75.0	75.0	75.0					1																	182026653		2203	4300	6503	180293276	SO:0001583	missense	127665			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.493C>A	1.37:g.182026653G>T	ENSP00000344129:p.Pro165Thr		180293276	B2RP16	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P165T	ENST00000339948.3	37	c.493	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	A	3.668	-0.068026	0.07228	.	.	ENSG00000179930	ENST00000339948	T	0.06528	3.29	2.71	1.51	0.23008	.	.	.	.	.	T	0.02649	0.0080	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43893	-0.9363	9	0.66056	D	0.02	.	2.1759	0.03862	0.4793:0.0:0.2768:0.2439	.	165	Q5T619	ZN648_HUMAN	T	165	ENSP00000344129:P165T	ENSP00000344129:P165T	P	-	1	0	ZNF648	180293276	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.323000	0.07997	0.025000	0.15241	-0.254000	0.11334	CCC	-	NULL		0.547	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	protein_coding	OTTHUMT00000090794.1	G	XM_060597		180293276	-1	no_errors	NM_001009992	genbank	human	provisional	54_36p	missense	SNP	0.000	T
APOBEC4	403314	genome.wustl.edu	37	1	183617796	183617796	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:183617796C>T	ENST00000308641.4	-	2	392	c.121G>A	c.(121-123)Gca>Aca	p.A41T	RGL1_ENST00000536277.1_Intron|APOBEC4_ENST00000481562.1_Intron|RGL1_ENST00000304685.4_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	41					mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						GAAACTCTTGCTTCTTCACCT	0.368																																																0			1											105.0	101.0	102.0					1																	183617796		2203	4300	6503	181884419	SO:0001583	missense	403314			BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.121G>A	1.37:g.183617796C>T	ENSP00000310622:p.Ala41Thr		181884419	Q8N7F6	Missense_Mutation	SNP	PatternScan_CYT_DCMP_DEAMINASES,HMMPfam_APOBEC_N	p.A41T	ENST00000308641.4	37	c.121	CCDS1358.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000453	0.74818	.	.	ENSG00000173627	ENST00000308641	T	0.17213	2.29	5.55	5.55	0.83447	.	0.131950	0.32753	N	0.005685	T	0.26991	0.0661	L	0.29908	0.895	0.36990	D	0.89475	D	0.63880	0.993	P	0.60789	0.879	T	0.07829	-1.0752	10	0.72032	D	0.01	-22.7054	14.003	0.64444	0.1515:0.8485:0.0:0.0	.	41	Q8WW27	ABEC4_HUMAN	T	41	ENSP00000310622:A41T	ENSP00000310622:A41T	A	-	1	0	APOBEC4	181884419	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.943000	0.49026	2.607000	0.88179	0.655000	0.94253	GCA	-	HMMPfam_APOBEC_N		0.368	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC4	protein_coding	OTTHUMT00000086126.1	C	NM_203454		181884419	-1	no_errors	NM_203454	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185269234	185269234	+	Silent	SNP	G	G	A			TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr1:185269234G>A	ENST00000367498.3	-	13	2020	c.1398C>T	c.(1396-1398)taC>taT	p.Y466Y	IVNS1ABP_ENST00000392007.3_Silent_p.Y248Y|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	466					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						CACCAACGATGTATAACTTTC	0.338																																																0			1											112.0	105.0	108.0					1																	185269234		2203	4300	6503	183535857	SO:0001819	synonymous_variant	10625			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1398C>T	1.37:g.185269234G>A			183535857	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.Y466	ENST00000367498.3	37	c.1398	CCDS1368.1	1																																																																																			-	superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612		0.338	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	protein_coding	OTTHUMT00000085774.1	G	NM_006469		183535857	-1	no_errors	NM_006469	genbank	human	validated	54_36p	silent	SNP	1.000	A
FAM149A	25854	genome.wustl.edu	37	4	187086508	187086508	+	Missense_Mutation	SNP	G	G	A	rs149087810		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr4:187086508G>A	ENST00000356371.5	+	11	1927	c.1927G>A	c.(1927-1929)Gtg>Atg	p.V643M	FAM149A_ENST00000227065.4_Missense_Mutation_p.V352M|FAM149A_ENST00000514153.1_Missense_Mutation_p.V352M|FAM149A_ENST00000502970.1_Missense_Mutation_p.V352M|FAM149A_ENST00000389354.5_Missense_Mutation_p.V352M|FAM149A_ENST00000503432.1_Missense_Mutation_p.V352M			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	643										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GCCGACTGGCGTGGACCACAT	0.552																																																0			4						G	MET/VAL,MET/VAL	0,4406		0,0,2203	111.0	103.0	106.0		1054,1054	-11.1	0.0	4	dbSNP_134	106	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense	FAM149A	NM_001006655.2,NM_015398.2	21,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	352/483,352/483	187086508	2,13004	2203	4300	6503	187323502	SO:0001583	missense	25854			AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1927G>A	4.37:g.187086508G>A	ENSP00000348732:p.Val643Met		187323502	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	NULL	p.V352M	ENST00000356371.5	37	c.1054		4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.92|10.92	1.486833|1.486833	0.26686|0.26686	0.0|0.0	2.33E-4|2.33E-4	ENSG00000109794|ENSG00000109794	ENST00000512271|ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	.|T;T;T;T;T;T	.|0.11712	.|2.77;2.75;2.77;2.77;2.77;2.77	5.55|5.55	-11.1|-11.1	0.00147|0.00147	.|.	.|2.038210	.|0.01708	.|N	.|0.027538	T|T	0.03959|0.03959	0.0111|0.0111	N|N	0.16478|0.16478	0.41|0.41	0.09310|0.09310	N|N	1|1	.|B;B	.|0.29253	.|0.239;0.188	.|B;B	.|0.13407	.|0.009;0.004	T|T	0.28996|0.28996	-1.0026|-1.0026	5|10	.|0.33141	.|T	.|0.24	1.0582|1.0582	1.0839|1.0839	0.01648|0.01648	0.2736:0.2621:0.2814:0.1829|0.2736:0.2621:0.2814:0.1829	.|.	.|643;643	.|A5PLN7-3;A5PLN7	.|.;F149A_HUMAN	H|M	29|352;643;352;352;352;352	.|ENSP00000426835:V352M;ENSP00000348732:V643M;ENSP00000227065:V352M;ENSP00000427155:V352M;ENSP00000424380:V352M;ENSP00000374005:V352M	.|ENSP00000227065:V352M	R|V	+|+	2|1	0|0	FAM149A|FAM149A	187323502|187323502	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.130000|-1.130000	0.03241|0.03241	-1.624000|-1.624000	0.01556|0.01556	-1.074000|-1.074000	0.02243|0.02243	CGT|GTG	-	NULL		0.552	FAM149A-201	KNOWN	basic	protein_coding	FAM149A	protein_coding		G	NM_001006655		187323502	+1	no_errors	NM_001006655	genbank	human	validated	54_36p	missense	SNP	0.005	A
NDUFA10	4705	genome.wustl.edu	37	2	240954195	240954195	+	Silent	SNP	G	G	A	rs148656779		TCGA-36-2534-01A-01D-1526-09	TCGA-36-2534-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e1740f99-948b-4312-89da-2f7ed9a3037c	030e27c3-a11a-49cb-87ef-3bb192d41c5b	g.chr2:240954195G>A	ENST00000252711.2	-	5	730	c.630C>T	c.(628-630)ccC>ccT	p.P210P	NDUFA10_ENST00000307300.4_Silent_p.P250P|NDUFA10_ENST00000404554.1_Silent_p.P210P	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	210					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)	p.P210P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		CCTCTGGAACGGGCACATCGA	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19054	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	lung(1)	2						G		1,4405	2.1+/-5.4	0,1,2202	132.0	121.0	124.0		630	-8.8	0.0	2	dbSNP_134	124	0,8600		0,0,4300	no	coding-synonymous	NDUFA10	NM_004544.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		210/356	240954195	1,13005	2203	4300	6503	240602868	SO:0001819	synonymous_variant	4705			AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.630C>T	2.37:g.240954195G>A			240602868	Q8WXC9	Silent	SNP	superfamily_SSF52540,HMMPfam_dNK	p.P210	ENST00000252711.2	37	c.630	CCDS2531.1	2																																																																																			-	superfamily_SSF52540,HMMPfam_dNK		0.483	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA10	protein_coding	OTTHUMT00000257180.2	G	NM_004544		240602868	-1	no_errors	NM_004544	genbank	human	reviewed	54_36p	silent	SNP	0.695	A
