#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RCC1	1104	broad.mit.edu	37	1	28863288	28863288	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr1:28863288T>G	ENST00000373833.6	+	12	1252	c.967T>G	c.(967-969)Tat>Gat	p.Y323D	RCC1_ENST00000373832.1_Missense_Mutation_p.Y323D|RCC1_ENST00000398958.2_Missense_Mutation_p.Y323D|RCC1_ENST00000373831.3_Missense_Mutation_p.Y354D			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	323					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.Y323D(1)		breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CCGGGCTGAGTATGGGCGGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	96.0	96.0					1																	28863288		2203	4300	6503	28735875	SO:0001583	missense	1104			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.967T>G	1.37:g.28863288T>G	ENSP00000362939:p.Tyr323Asp		28735875	Q16269|Q6NT97	Missense_Mutation	SNP	ENST00000373833.6	37	CCDS323.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.977065	0.74360	.	.	ENSG00000180198	ENST00000398958;ENST00000373833;ENST00000373832;ENST00000373831;ENST00000411533	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.8	5.8	0.92144	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.91310	0.7260	M	0.65677	2.01	0.80722	D	1	D;D;D	0.89917	0.99;1.0;1.0	P;D;D	0.97110	0.79;1.0;0.999	D	0.92053	0.5650	10	0.72032	D	0.01	-11.1551	14.9715	0.71238	0.0:0.0:0.0:1.0	.	354;340;323	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	D	323;323;323;354;340	ENSP00000381931:Y323D;ENSP00000362939:Y323D;ENSP00000362938:Y323D;ENSP00000362937:Y354D;ENSP00000413644:Y340D	ENSP00000362937:Y354D	Y	+	1	0	RCC1	28735875	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.005000	0.88553	2.212000	0.71576	0.533000	0.62120	TAT		0.607	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269	
FMO5	2330	broad.mit.edu	37	1	146673058	146673058	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr1:146673058C>T	ENST00000254090.4	-	7	1247	c.859G>A	c.(859-861)Gat>Aat	p.D287N	FMO5_ENST00000369272.3_Intron|RP11-337C18.8_ENST00000607149.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000441068.2_Missense_Mutation_p.D287N	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	287						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.D287N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					GGCAGGTCATCATTTAAGGTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	65.0	65.0					1																	146673058		2203	4300	6503	145139682	SO:0001583	missense	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.859G>A	1.37:g.146673058C>T	ENSP00000254090:p.Asp287Asn		145139682	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	.	.	.	.	.	.	.	.	.	.	.	35	5.436758	0.96168	.	.	ENSG00000131781	ENST00000441068;ENST00000254090	T;T	0.63744	-0.06;-0.06	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.76916	-0.2782	9	.	.	.	-17.6682	18.3732	0.90420	0.0:1.0:0.0:0.0	.	287;287	P49326;C9JJD1	FMO5_HUMAN;.	N	287	ENSP00000416011:D287N;ENSP00000254090:D287N	.	D	-	1	0	FMO5	145139682	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.782000	0.85680	2.941000	0.99782	0.655000	0.94253	GAT		0.423	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461	
FLG	2312	broad.mit.edu	37	1	152285796	152285796	+	Silent	SNP	T	T	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr1:152285796T>G	ENST00000368799.1	-	3	1601	c.1566A>C	c.(1564-1566)tcA>tcC	p.S522S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	522	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S522S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCTGCTTGACCCCGGGT	0.592									Ichthyosis																																							1	Substitution - coding silent(1)	ovary(1)	1											360.0	359.0	359.0					1																	152285796		2203	4300	6503	150552420	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1566A>C	1.37:g.152285796T>G			150552420	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
LGI1	9211	broad.mit.edu	37	10	95552607	95552607	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr10:95552607C>G	ENST00000371418.4	+	6	871	c.611C>G	c.(610-612)cCa>cGa	p.P204R	LGI1_ENST00000542308.1_Missense_Mutation_p.P156R|LGI1_ENST00000371413.3_Missense_Mutation_p.P204R	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	204	LRRCT.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.P204R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				GAAGGCCCCCCAGAATACAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	10	GRCh37	CD020573	LGI1	D							130.0	133.0	132.0					10																	95552607		2203	4300	6503	95542597	SO:0001583	missense	9211			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.611C>G	10.37:g.95552607C>G	ENSP00000360472:p.Pro204Arg		95542597	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880439	0.72294	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	D;D;D	0.90133	-2.62;-2.62;-2.62	5.19	4.28	0.50868	Cysteine-rich flanking region, C-terminal (1);	0.162750	0.56097	D	0.000033	D	0.89339	0.6687	L	0.49126	1.545	0.51233	D	0.999918	D;P;B	0.55172	0.97;0.567;0.225	P;B;B	0.49708	0.62;0.43;0.052	D	0.86586	0.1857	10	0.10636	T	0.68	-3.8792	15.3326	0.74226	0.1405:0.8595:0.0:0.0	.	156;204;204	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	R	156;204;204	ENSP00000440763:P156R;ENSP00000360472:P204R;ENSP00000360467:P204R	ENSP00000360467:P204R	P	+	2	0	LGI1	95542597	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	5.818000	0.69236	1.398000	0.46701	0.650000	0.86243	CCA		0.403	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
SBF2	81846	broad.mit.edu	37	11	9878254	9878254	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr11:9878254T>A	ENST00000256190.8	-	19	2251	c.2114A>T	c.(2113-2115)gAt>gTt	p.D705V	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	705					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.D705V(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		ATAATGGTCATCAGGAAGCTT	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											196.0	195.0	195.0					11																	9878254		2201	4294	6495	9834830	SO:0001583	missense	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2114A>T	11.37:g.9878254T>A	ENSP00000256190:p.Asp705Val		9834830	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	t	6.067	0.380760	0.11466	.	.	ENSG00000133812	ENST00000256190	T	0.41758	0.99	5.59	4.39	0.52855	.	0.963293	0.08685	N	0.908873	T	0.19886	0.0478	N	0.02539	-0.55	0.43054	D	0.994667	B	0.02656	0.0	B	0.10450	0.005	T	0.12993	-1.0526	10	0.27785	T	0.31	.	8.4938	0.33117	0.1276:0.0:0.1323:0.7401	.	705	Q86WG5	MTMRD_HUMAN	V	705	ENSP00000256190:D705V	ENSP00000256190:D705V	D	-	2	0	SBF2	9834830	0.833000	0.29383	0.986000	0.45419	0.191000	0.23601	3.167000	0.50793	2.251000	0.74343	0.456000	0.33151	GAT		0.393	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
NT5DC3	51559	broad.mit.edu	37	12	104171699	104171699	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr12:104171699G>C	ENST00000392876.3	-	14	1595	c.1555C>G	c.(1555-1557)Cgg>Ggg	p.R519G		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	519						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.R444G(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GGAGTCCTCCGGGGGTAGAAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											64.0	67.0	66.0					12																	104171699		2203	4300	6503	102695829	SO:0001583	missense	51559			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1555C>G	12.37:g.104171699G>C	ENSP00000376615:p.Arg519Gly		102695829	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466714	0.84425	.	.	ENSG00000111696	ENST00000392876	T	0.22743	1.94	5.8	-2.53	0.06326	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	M	0.86573	2.825	0.49582	D	0.999806	D	0.59357	0.985	P	0.62184	0.899	T	0.61456	-0.7059	10	0.72032	D	0.01	-24.1928	18.7136	0.91667	0.0:0.0:0.3514:0.6486	.	519	Q86UY8	NT5D3_HUMAN	G	519	ENSP00000376615:R519G	ENSP00000376615:R519G	R	-	1	2	NT5DC3	102695829	1.000000	0.71417	0.884000	0.34674	0.998000	0.95712	1.174000	0.31932	-0.719000	0.04942	0.655000	0.94253	CGG		0.622	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
RCBTB2	1102	broad.mit.edu	37	13	49077028	49077028	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr13:49077028G>A	ENST00000344532.3	-	11	1372	c.949C>T	c.(949-951)Cac>Tac	p.H317Y	RCBTB2_ENST00000544904.1_Missense_Mutation_p.S245L|RCBTB2_ENST00000430805.2_Missense_Mutation_p.H322Y|RCBTB2_ENST00000544492.1_Missense_Mutation_p.H43Y	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	317					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.H317Y(1)		breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TGTGTGGAGTGACAGGCTGCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											112.0	78.0	90.0					13																	49077028		2203	4300	6503	47975029	SO:0001583	missense	1102			AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.949C>T	13.37:g.49077028G>A	ENSP00000345144:p.His317Tyr		47975029	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	37	CCDS9411.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	30|30	5.054358|5.054358	0.93793|0.93793	.|.	.|.	ENSG00000136161|ENSG00000136161	ENST00000344532;ENST00000452987;ENST00000430805;ENST00000544492|ENST00000544904	D;D;T|T	0.84730|0.50548	-1.89;-1.89;-1.33|0.74	5.73|5.73	5.73|5.73	0.89815|0.89815	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56601|0.56601	0.1996|0.1996	M|M	0.79475|0.79475	2.455|2.455	0.40685|0.40685	D|D	0.982349|0.982349	D;D;D|B	0.89917|0.24963	1.0;0.977;0.967|0.115	D;P;P|B	0.91635|0.28139	0.999;0.893;0.838|0.086	T|T	0.58572|0.58572	-0.7613|-0.7613	10|9	0.62326|0.87932	D|D	0.03|0	.|.	20.2786|20.2786	0.98501|0.98501	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	43;322;317|245	B4E372;B4DWG0;O95199|B4DPP7	.;.;RCBT2_HUMAN|.	Y|L	317;322;322;43|245	ENSP00000345144:H317Y;ENSP00000389910:H322Y;ENSP00000443862:H43Y|ENSP00000443904:S245L	ENSP00000345144:H317Y|ENSP00000443904:S245L	H|S	-|-	1|2	0|0	RCBTB2|RCBTB2	47975029|47975029	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	9.420000|9.420000	0.97426|0.97426	2.868000|2.868000	0.98415|0.98415	0.557000|0.557000	0.71058|0.71058	CAC|TCA		0.572	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	
RCOR1	23186	broad.mit.edu	37	14	103167617	103167617	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr14:103167617G>C	ENST00000570597.1	+	4	439	c.439G>C	c.(439-441)Gat>Cat	p.D147H	RCOR1_ENST00000262241.6_Missense_Mutation_p.D150H			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	147	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)	p.D147H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						TTTTTCAGTGGATGAATACAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											153.0	142.0	145.0					14																	103167617		2203	4300	6503	102237370	SO:0001583	missense	23186			AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.439G>C	14.37:g.103167617G>C	ENSP00000459789:p.Asp147His		102237370	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	37		.	.	.	.	.	.	.	.	.	.	G	27.3	4.816638	0.90790	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.39	5.39	0.77823	ELM2 domain (2);	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86783	0.1980	9	0.87932	D	0	-27.2662	19.1463	0.93471	0.0:0.0:1.0:0.0	.	147	Q9UKL0	RCOR1_HUMAN	H	147	.	ENSP00000262241:D147H	D	+	1	0	RCOR1	102237370	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.835000	0.99442	2.527000	0.85204	0.655000	0.94253	GAT		0.368	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156	
ANKS4B	257629	broad.mit.edu	37	16	21261783	21261783	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr16:21261783C>G	ENST00000311620.5	+	2	969	c.896C>G	c.(895-897)cCc>cGc	p.P299R		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	299					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)		p.P299R(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TTTAAACTGCCCAGTGAATTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	16											99.0	104.0	103.0					16																	21261783		2001	4186	6187	21169284	SO:0001583	missense	257629			AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.896C>G	16.37:g.21261783C>G	ENSP00000308772:p.Pro299Arg		21169284		Missense_Mutation	SNP	ENST00000311620.5	37	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	C	1.618	-0.522336	0.04141	.	.	ENSG00000175311	ENST00000311620	T	0.39592	1.07	5.98	2.55	0.30701	.	0.987982	0.08288	N	0.968878	T	0.28433	0.0703	L	0.31065	0.9	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.25984	-1.0116	10	0.11485	T	0.65	-0.0416	8.1867	0.31343	0.1208:0.6898:0.1174:0.0721	.	299	Q8N8V4	ANS4B_HUMAN	R	299	ENSP00000308772:P299R	ENSP00000308772:P299R	P	+	2	0	ANKS4B	21169284	0.008000	0.16893	0.789000	0.31954	0.501000	0.33797	1.987000	0.40687	0.865000	0.35603	0.585000	0.79938	CCC		0.463	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865	
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	A	rs193920774		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr17:7577141C>A	ENST00000269305.4	-	8	986	c.797G>T	c.(796-798)gGa>gTa	p.G266V	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.G266V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V|TP53_ENST00000445888.2_Missense_Mutation_p.G266V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	17											50.0	44.0	46.0					17																	7577141		2203	4300	6503	7517866	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>T	17.37:g.7577141C>A	ENSP00000269305:p.Gly266Val		7517866	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388215	0.82902	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	266;266;266;266;266;255;134	ENSP00000352610:G266V;ENSP00000269305:G266V;ENSP00000398846:G266V;ENSP00000391127:G266V;ENSP00000391478:G266V;ENSP00000425104:G134V	ENSP00000269305:G266V	G	-	2	0	TP53	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
VTN	7448	broad.mit.edu	37	17	26695999	26695999	+	Silent	SNP	G	G	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr17:26695999G>C	ENST00000226218.4	-	5	1338	c.720C>G	c.(718-720)ccC>ccG	p.P240P	VTN_ENST00000536498.1_5'UTR|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000438614.1_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|CTB-96E2.2_ENST00000555059.2_5'Flank|SARM1_ENST00000457710.3_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	240					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P240P(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	AGATATTTCGGGGGTAATCAG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	17											96.0	98.0	98.0					17																	26695999		2203	4300	6503	23720126	SO:0001819	synonymous_variant	7448			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.720C>G	17.37:g.26695999G>C			23720126	B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	CCDS11229.1																																																																																				0.592	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
SERPINB3	6317	broad.mit.edu	37	18	61326648	61326648	+	Silent	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr18:61326648C>T	ENST00000283752.5	-	4	479	c.336G>A	c.(334-336)acG>acA	p.T112T	SERPINB3_ENST00000332821.8_Silent_p.T112T|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	112					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)	p.T112T(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						AAAATAGATACGTTTTTTCTC	0.413																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	18											167.0	157.0	160.0					18																	61326648		2203	4300	6503	59477628	SO:0001819	synonymous_variant	6317			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.336G>A	18.37:g.61326648C>T			59477628	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Silent	SNP	ENST00000283752.5	37	CCDS11987.1																																																																																				0.413	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
KCNN1	3780	broad.mit.edu	37	19	18092529	18092529	+	Silent	SNP	G	G	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr19:18092529G>T	ENST00000222249.9	+	5	829	c.510G>T	c.(508-510)gtG>gtT	p.V170V		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	170					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.V187V(1)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TGTTCATGGTGGACAACGGGG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	19											25.0	25.0	25.0					19																	18092529		2130	4230	6360	17953529	SO:0001819	synonymous_variant	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.510G>T	19.37:g.18092529G>T			17953529	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37																																																																																					0.682	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
GSK3A	2931	broad.mit.edu	37	19	42734952	42734952	+	Silent	SNP	G	G	A	rs370274345		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr19:42734952G>A	ENST00000222330.3	-	11	1573	c.1446C>T	c.(1444-1446)tcC>tcT	p.S482S	GSK3A_ENST00000398249.4_Silent_p.S400S	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	482					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.S482S(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				GCCCTCAGGAGGAGTTAGTGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19						G		1,4387		0,1,2193	73.0	59.0	64.0		1446	-3.3	1.0	19		64	0,8570		0,0,4285	no	coding-synonymous	GSK3A	NM_019884.2		0,1,6478	AA,AG,GG		0.0,0.0228,0.0077		482/484	42734952	1,12957	2194	4285	6479	47426792	SO:0001819	synonymous_variant	2931				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1446C>T	19.37:g.42734952G>A			47426792	O14959	Silent	SNP	ENST00000222330.3	37	CCDS12599.1																																																																																				0.627	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
PSG11	5680	broad.mit.edu	37	19	43523159	43523159	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr19:43523159G>C	ENST00000401740.1	-	3	575	c.472C>G	c.(472-474)Ccc>Gcc	p.P158A	PSG11_ENST00000403486.1_Missense_Mutation_p.P36A|PSG11_ENST00000320078.7_Missense_Mutation_p.P158A|PSG11_ENST00000306322.7_Missense_Mutation_p.P36A|PSG11_ENST00000595312.1_5'UTR			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	158	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.P158A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GCCTCCCTGGGGTTTAAGTTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											190.0	195.0	193.0					19																	43523159		2199	4297	6496	48214999	SO:0001583	missense	5680			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.472C>G	19.37:g.43523159G>C	ENSP00000384995:p.Pro158Ala		48214999	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	g	10.75	1.439046	0.25900	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	1.13	-0.571	0.11749	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23054	0.0557	L	0.45698	1.435	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.14200	-1.0481	9	0.46703	T	0.11	.	4.3746	0.11263	0.0:0.432:0.568:0.0	.	36;158	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	A	158;36;36;158	ENSP00000319140:P158A;ENSP00000385427:P36A;ENSP00000304913:P36A;ENSP00000384995:P158A	ENSP00000304913:P36A	P	-	1	0	PSG11	48214999	0.000000	0.05858	0.040000	0.18447	0.111000	0.19643	0.127000	0.15790	0.567000	0.29293	0.184000	0.17185	CCC		0.527	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
MYO3B	140469	broad.mit.edu	37	2	171260805	171260805	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr2:171260805G>C	ENST00000408978.4	+	20	2469	c.2326G>C	c.(2326-2328)Gac>Cac	p.D776H	MYO3B_ENST00000334231.6_Missense_Mutation_p.D785H|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000409044.3_Missense_Mutation_p.D776H	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	776	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)	p.D776H(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GGAATATGAGGACAACCGCCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											143.0	135.0	138.0					2																	171260805		1919	4132	6051	170969051	SO:0001583	missense	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2326G>C	2.37:g.171260805G>C	ENSP00000386213:p.Asp776His		170969051	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186051	0.78789	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.47	5.47	0.80525	Myosin head, motor domain (3);	0.088391	0.85682	D	0.000000	D	0.92909	0.7744	H	0.97491	4.015	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.94918	0.8071	10	0.87932	D	0	.	19.686	0.95979	0.0:0.0:1.0:0.0	.	776;776;776	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	H	776;776;775;785;785	ENSP00000386497:D776H;ENSP00000386213:D776H;ENSP00000446237:D785H;ENSP00000335100:D785H	ENSP00000314213:D775H	D	+	1	0	MYO3B	170969051	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.871000	0.87180	2.728000	0.93425	0.655000	0.94253	GAC		0.512	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
ZNF280B	140883	broad.mit.edu	37	22	22842614	22842614	+	Silent	SNP	C	C	T	rs544119930		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr22:22842614C>T	ENST00000406426.1	-	4	1852	c.1110G>A	c.(1108-1110)gaG>gaA	p.E370E	ZNF280B_ENST00000360412.2_Silent_p.E370E			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E370E(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CAGTAGAGGGCTCCTGGGCAG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		16783	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	22											121.0	113.0	116.0					22																	22842614		2203	4300	6503	21172614	SO:0001819	synonymous_variant	140883			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1110G>A	22.37:g.22842614C>T			21172614		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																				0.502	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
SLITRK3	22865	broad.mit.edu	37	3	164905717	164905717	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr3:164905717C>A	ENST00000475390.1	-	2	3345	c.2902G>T	c.(2902-2904)Gaa>Taa	p.E968*	SLITRK3_ENST00000241274.3_Nonsense_Mutation_p.E968*			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	968					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.E968*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TCCAGGACTTCGAGGTAATCC	0.388										HNSCC(40;0.11)																																						1	Substitution - Nonsense(1)	ovary(1)	3											135.0	134.0	134.0					3																	164905717		2203	4300	6503	166388411	SO:0001587	stop_gained	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2902G>T	3.37:g.164905717C>A	ENSP00000420091:p.Glu968*		166388411	Q1RMY6	Nonsense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	C	43	10.499899	0.99416	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	.	.	.	5.97	5.97	0.96955	.	0.000000	0.35708	N	0.003029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.5308	20.4388	0.99107	0.0:1.0:0.0:0.0	.	.	.	.	X	968	.	ENSP00000241274:E968X	E	-	1	0	SLITRK3	166388411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.455000	0.80726	2.836000	0.97738	0.655000	0.94253	GAA		0.388	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
ETV5	2119	broad.mit.edu	37	3	185823281	185823281	+	Silent	SNP	T	T	A			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr3:185823281T>A	ENST00000306376.5	-	4	384	c.138A>T	c.(136-138)ctA>ctT	p.L46L	ETV5_ENST00000434744.1_Silent_p.L46L|DGKG_ENST00000447054.1_5'Flank|ETV5_ENST00000537818.1_Silent_p.L88L	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	46					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L46L(1)		breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GATCCTGAAATAGCTCTGAAA	0.403			T	"""TMPRSS2, SCL45A3"""	Prostate																																		Dom	yes		3	3q28	2119	ets variant gene 5		E	1	Substitution - coding silent(1)	ovary(1)	3											77.0	82.0	80.0					3																	185823281		2203	4300	6503	187305975	SO:0001819	synonymous_variant	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.138A>T	3.37:g.185823281T>A			187305975	A6NH46|B7Z7D7|Q6IBN5	Silent	SNP	ENST00000306376.5	37	CCDS33906.1																																																																																				0.403	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
BOD1L1	259282	broad.mit.edu	37	4	13604894	13604894	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr4:13604894T>A	ENST00000040738.5	-	10	3765	c.3630A>T	c.(3628-3630)caA>caT	p.Q1210H		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1210						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q1210H(1)									ACACAGCACTTTGTATATGCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											168.0	175.0	173.0					4																	13604894		2203	4300	6503	13213992	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3630A>T	4.37:g.13604894T>A	ENSP00000040738:p.Gln1210His		13213992	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	9.325	1.059012	0.19987	.	.	ENSG00000038219	ENST00000040738	T	0.08458	3.09	5.02	-0.201	0.13212	.	0.313134	0.23391	N	0.048681	T	0.07413	0.0187	N	0.24115	0.695	0.09310	N	1	P	0.44578	0.838	P	0.47206	0.541	T	0.23691	-1.0181	10	0.54805	T	0.06	-0.8788	8.3417	0.32247	0.0:0.3078:0.0:0.6922	.	1210	Q8NFC6	BOD1L_HUMAN	H	1210	ENSP00000040738:Q1210H	ENSP00000040738:Q1210H	Q	-	3	2	BOD1L	13213992	0.131000	0.22433	0.001000	0.08648	0.172000	0.22775	0.481000	0.22260	-0.150000	0.11195	-0.274000	0.10170	CAA		0.408	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
CD38	952	broad.mit.edu	37	4	15835888	15835888	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr4:15835888A>T	ENST00000226279.3	+	4	685	c.548A>T	c.(547-549)aAc>aTc	p.N183I		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	183					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)	p.N183I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						TGCAGCAACAACCCTGTTTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	93.0	94.0					4																	15835888		2203	4300	6503	15444986	SO:0001583	missense	952			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.548A>T	4.37:g.15835888A>T	ENSP00000226279:p.Asn183Ile		15444986	O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	37	CCDS3417.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.01|15.01	2.707749|2.707749	0.48412|0.48412	.|.	.|.	ENSG00000004468|ENSG00000004468	ENST00000226279;ENST00000510674|ENST00000540195	T;T|.	0.18016|.	2.24;2.24|.	5.4|5.4	1.48|1.48	0.22813|0.22813	.|.	0.500775|.	0.24405|.	N|.	0.038804|.	T|T	0.56352|0.56352	0.1979|0.1979	M|M	0.84585|0.84585	2.705|2.705	0.09310|0.09310	N|N	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.49606|0.49606	-0.8922|-0.8922	10|6	0.87932|0.44086	D|T	0|0.13	-27.6845|-27.6845	5.3435|5.3435	0.15996|0.15996	0.5555:0.3538:0.0907:0.0|0.5555:0.3538:0.0907:0.0	.|.	183|.	P28907|.	CD38_HUMAN|.	I|S	183;71|138	ENSP00000226279:N183I;ENSP00000423047:N71I|.	ENSP00000226279:N183I|ENSP00000442176:T138S	N|T	+|+	2|1	0|0	CD38|CD38	15444986|15444986	0.003000|0.003000	0.15002|0.15002	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	0.343000|0.343000	0.19944|0.19944	0.386000|0.386000	0.24997|0.24997	0.528000|0.528000	0.53228|0.53228	AAC|ACC		0.383	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775	
BMP3	651	broad.mit.edu	37	4	81967139	81967139	+	Silent	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr4:81967139C>T	ENST00000282701.2	+	2	884	c.564C>T	c.(562-564)gcC>gcT	p.A188A		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	188					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.A188A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TGGATATGGCCAAATCTCATC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	4											147.0	152.0	151.0					4																	81967139		2203	4300	6503	82186163	SO:0001819	synonymous_variant	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.564C>T	4.37:g.81967139C>T			82186163	Q4VAS5	Silent	SNP	ENST00000282701.2	37	CCDS3588.1																																																																																				0.408	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1		
ANK2	287	broad.mit.edu	37	4	114161671	114161671	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr4:114161671C>T	ENST00000357077.4	+	8	777	c.724C>T	c.(724-726)Cat>Tat	p.H242Y	ANK2_ENST00000506722.1_Missense_Mutation_p.H221Y|ANK2_ENST00000394537.3_Missense_Mutation_p.H242Y|ANK2_ENST00000264366.6_Missense_Mutation_p.H242Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	242					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H242Y(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATAGCTGCACATTACGGAAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											156.0	147.0	150.0					4																	114161671		2203	4300	6503	114381120	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.724C>T	4.37:g.114161671C>T	ENSP00000349588:p.His242Tyr		114381120	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	31	5.082935	0.94050	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.63913	-0.07;0.11;0.11;0.11;0.11;0.11;0.11	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.000000	0.52532	D	0.000065	T	0.57695	0.2071	N	0.01209	-0.955	0.80722	D	1	D;D;D;D;P	0.89917	0.999;1.0;1.0;0.999;0.956	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.974	T	0.75889	-0.3158	10	0.72032	D	0.01	.	19.3647	0.94458	0.0:1.0:0.0:0.0	.	242;242;242;221;221	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	Y	221;221;221;257;242;242;242;221	ENSP00000423799:H221Y;ENSP00000421011:H221Y;ENSP00000421067:H221Y;ENSP00000424722:H257Y;ENSP00000378044:H242Y;ENSP00000349588:H242Y;ENSP00000264366:H242Y	ENSP00000264366:H242Y	H	+	1	0	ANK2	114381120	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.776000	0.85560	2.740000	0.93945	0.650000	0.86243	CAT		0.423	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
TLL1	7092	broad.mit.edu	37	4	166924625	166924625	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr4:166924625G>T	ENST00000061240.2	+	6	1362	c.715G>T	c.(715-717)Gtt>Ttt	p.V239F	TLL1_ENST00000507499.1_Missense_Mutation_p.V239F|TLL1_ENST00000513213.1_Missense_Mutation_p.V239F	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	239	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V239F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGGGATTGTTGTTCATGAATT	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											176.0	160.0	165.0					4																	166924625		2203	4300	6503	167144075	SO:0001583	missense	7092			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.715G>T	4.37:g.166924625G>T	ENSP00000061240:p.Val239Phe		167144075	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962809	0.74016	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	5.35	0.76521	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.64402	U	0.000001	D	0.85894	0.5803	H	0.96996	3.92	0.80722	D	1	D;D	0.71674	0.998;0.984	D;P	0.64042	0.921;0.746	D	0.90431	0.4424	10	0.72032	D	0.01	.	19.4213	0.94723	0.0:0.0:1.0:0.0	.	239;239	E9PD25;O43897	.;TLL1_HUMAN	F	239	ENSP00000061240:V239F;ENSP00000426082:V239F;ENSP00000422937:V239F	ENSP00000061240:V239F	V	+	1	0	TLL1	167144075	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	9.813000	0.99286	2.653000	0.90120	0.557000	0.71058	GTT		0.433	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
CATSPER3	347732	broad.mit.edu	37	5	134305677	134305677	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr5:134305677C>G	ENST00000282611.6	+	2	233	c.147C>G	c.(145-147)agC>agG	p.S49R	CATSPER3_ENST00000511235.1_3'UTR	NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	49					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.S49R(1)		NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCATAATGAGCCGTTTCTTTA	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											218.0	197.0	204.0					5																	134305677		2203	4300	6503	134333576	SO:0001583	missense	347732			AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.147C>G	5.37:g.134305677C>G	ENSP00000282611:p.Ser49Arg		134333576	Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	37	CCDS4181.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988304	0.35036	.	.	ENSG00000152705	ENST00000282611	D	0.97575	-4.44	5.42	-0.314	0.12750	.	0.092879	0.47852	D	0.000209	D	0.95357	0.8493	L	0.32530	0.975	0.09310	N	1	D	0.58268	0.982	P	0.55824	0.785	D	0.90922	0.4784	10	0.62326	D	0.03	-12.5051	9.9716	0.41757	0.0:0.5209:0.0:0.4791	.	49	Q86XQ3	CTSR3_HUMAN	R	49	ENSP00000282611:S49R	ENSP00000282611:S49R	S	+	3	2	CATSPER3	134333576	0.004000	0.15560	0.005000	0.12908	0.009000	0.06853	0.152000	0.16302	-0.186000	0.10533	-0.484000	0.04775	AGC		0.403	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019	
GABBR1	2550	broad.mit.edu	37	6	29589553	29589553	+	Silent	SNP	A	A	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr6:29589553A>G	ENST00000377034.4	-	10	1442	c.1107T>C	c.(1105-1107)acT>acC	p.T369T	GABBR1_ENST00000377016.4_Silent_p.T307T|GABBR1_ENST00000355973.3_Silent_p.T252T|GABBR1_ENST00000377012.4_Silent_p.T252T|GABBR1_ENST00000376977.3_Silent_p.T369T	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	369					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.T369T(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TCCGGGCTTCAGTCTCATAGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	6											62.0	66.0	65.0					6																	29589553		2203	4300	6503	29697532	SO:0001819	synonymous_variant	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1107T>C	6.37:g.29589553A>G			29697532	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1																																																																																				0.547	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
ROS1	6098	broad.mit.edu	37	6	117674279	117674279	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr6:117674279T>C	ENST00000368508.3	-	26	4393	c.4195A>G	c.(4195-4197)Atc>Gtc	p.I1399V	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.I1393V	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1399					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I1399V(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTTGCTGTGATGATCCAGTAT	0.388			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - Missense(1)	ovary(1)	6											183.0	161.0	169.0					6																	117674279		2203	4300	6503	117780972	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4195A>G	6.37:g.117674279T>C	ENSP00000357494:p.Ile1399Val		117780972	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	1.298	-0.605703	0.03717	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.90900	-2.75;-2.75	5.37	-0.676	0.11361	.	0.954411	0.08713	N	0.904729	T	0.50820	0.1638	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52525	-0.8564	10	0.05436	T	0.98	.	3.4152	0.07373	0.4188:0.2347:0.0:0.3465	.	1399	P08922	ROS1_HUMAN	V	1399;1393	ENSP00000357494:I1399V;ENSP00000357493:I1393V	ENSP00000357493:I1393V	I	-	1	0	ROS1	117780972	0.000000	0.05858	0.003000	0.11579	0.768000	0.43524	-0.654000	0.05354	-0.085000	0.12573	0.455000	0.32223	ATC		0.388	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
AKAP7	9465	broad.mit.edu	37	6	131490397	131490397	+	Silent	SNP	A	A	T	rs113026534		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr6:131490397A>T	ENST00000431975.2	+	5	671	c.573A>T	c.(571-573)tcA>tcT	p.S191S	AKAP7_ENST00000366358.2_Intron|AKAP7_ENST00000368123.4_Silent_p.S169S|AKAP7_ENST00000541650.1_Silent_p.S190S	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	191						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)	p.S169S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		ATGTAAACTCACTTTTGGAGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	6											140.0	142.0	141.0					6																	131490397		2203	4300	6503	131532090	SO:0001819	synonymous_variant	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.573A>T	6.37:g.131490397A>T			131532090	B4DUC3|Q9HCZ8	Silent	SNP	ENST00000431975.2	37	CCDS5142.2																																																																																				0.378	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042209.2	NM_004842	
SP4	6671	broad.mit.edu	37	7	21521627	21521627	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr7:21521627C>T	ENST00000222584.3	+	5	2211	c.1993C>T	c.(1993-1995)Cga>Tga	p.R665*		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	665					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R665*(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						ATCTCATTTACGAGCACATCT	0.398																																																2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	7											150.0	145.0	147.0					7																	21521627		2203	4300	6503	21488152	SO:0001587	stop_gained	6671				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1993C>T	7.37:g.21521627C>T	ENSP00000222584:p.Arg665*		21488152	O60402|Q32M52	Nonsense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	C	41	9.151051	0.99082	.	.	ENSG00000105866	ENST00000222584	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1935	0.98237	0.0:1.0:0.0:0.0	.	.	.	.	X	665	.	ENSP00000222584:R665X	R	+	1	2	SP4	21488152	0.997000	0.39634	0.994000	0.49952	0.980000	0.70556	1.498000	0.35660	2.779000	0.95612	0.591000	0.81541	CGA		0.398	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
HECW1	23072	broad.mit.edu	37	7	43581522	43581522	+	Silent	SNP	G	G	A	rs532223116		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr7:43581522G>A	ENST00000395891.2	+	26	4778	c.4173G>A	c.(4171-4173)ttG>ttA	p.L1391L	HECW1_ENST00000453890.1_Silent_p.L1357L	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1391	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L1370L(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACCAGAGTTTGCAGTGGATGA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	7											172.0	156.0	161.0					7																	43581522		1887	4137	6024	43548047	SO:0001819	synonymous_variant	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4173G>A	7.37:g.43581522G>A			43548047	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	9.113	1.007096	0.19199	.	.	ENSG00000002746	ENST00000429529	.	.	.	5.95	5.06	0.68205	.	.	.	.	.	T	0.59810	0.2221	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58487	-0.7628	4	.	.	.	.	8.8232	0.35039	0.2255:0.0:0.7745:0.0	.	.	.	.	Y	115	.	.	C	+	2	0	HECW1	43548047	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.765000	0.26546	1.491000	0.48482	0.563000	0.77884	TGC		0.433	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
SPAM1	6677	broad.mit.edu	37	7	123594492	123594492	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr7:123594492A>G	ENST00000439500.1	+	4	1481	c.868A>G	c.(868-870)Aaa>Gaa	p.K290E	SPAM1_ENST00000402183.2_Missense_Mutation_p.K290E|SPAM1_ENST00000340011.5_Missense_Mutation_p.K290E|SPAM1_ENST00000460182.1_Missense_Mutation_p.K290E|SPAM1_ENST00000223028.7_Missense_Mutation_p.K290E	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	290					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.K290E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAGAGTTTCCAAAATACCTGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											68.0	64.0	65.0					7																	123594492		2203	4299	6502	123381728	SO:0001583	missense	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.868A>G	7.37:g.123594492A>G	ENSP00000402123:p.Lys290Glu		123381728	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116352	0.37339	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	6.17	-10.1	0.00402	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.936106	0.09242	N	0.829133	T	0.15305	0.0369	L	0.55213	1.73	0.09310	N	1	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.20974	-1.0259	9	.	.	.	-2.534	3.3236	0.07059	0.2376:0.3911:0.2432:0.1281	.	290;290	Q8TC30;P38567	.;HYALP_HUMAN	E	290	ENSP00000386028:K290E;ENSP00000417934:K290E;ENSP00000345849:K290E;ENSP00000402123:K290E;ENSP00000223028:K290E	.	K	+	1	0	SPAM1	123381728	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.458000	0.06737	-1.413000	0.02027	-0.313000	0.08912	AAA		0.413	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
TG	7038	broad.mit.edu	37	8	133935586	133935586	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr8:133935586T>C	ENST00000220616.4	+	22	4572	c.4532T>C	c.(4531-4533)gTc>gCc	p.V1511A	TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1511	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.V1511A(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GTTCTAGGTGTCACTGACTGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	8											78.0	73.0	75.0					8																	133935586		2203	4300	6503	134004768	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4532T>C	8.37:g.133935586T>C	ENSP00000220616:p.Val1511Ala		134004768	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464755	0.63513	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	T	0.65178	-0.14	4.63	3.46	0.39613	Thyroglobulin type-1 (2);	0.683649	0.13302	N	0.398151	T	0.68705	0.3030	M	0.74881	2.28	0.80722	D	1	D	0.60575	0.988	P	0.52343	0.696	T	0.67225	-0.5724	10	0.87932	D	0	.	6.8684	0.24106	0.0:0.1087:0.0:0.8913	.	1511	P01266	THYG_HUMAN	A	317;1511	ENSP00000220616:V1511A	ENSP00000220616:V1511A	V	+	2	0	TG	134004768	1.000000	0.71417	0.991000	0.47740	0.838000	0.47535	3.010000	0.49559	0.636000	0.30508	0.454000	0.30748	GTC		0.542	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
PTAR1	375743	broad.mit.edu	37	9	72333391	72333391	+	Missense_Mutation	SNP	G	G	C	rs376519073		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr9:72333391G>C	ENST00000340434.4	-	8	1079	c.1076C>G	c.(1075-1077)aCg>aGg	p.T359R	PTAR1_ENST00000377200.5_Missense_Mutation_p.T307R	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	359					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)	p.T359R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						TGGAACTGGCGTCCGCTTCAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											115.0	115.0	115.0					9																	72333391		1948	4153	6101	71523211	SO:0001583	missense	375743			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.1076C>G	9.37:g.72333391G>C	ENSP00000344299:p.Thr359Arg		71523211	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	37	CCDS47978.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.42|18.42	3.621133|3.621133	0.66787|0.66787	.|.	.|.	ENSG00000188647|ENSG00000188647	ENST00000415701|ENST00000377200;ENST00000340434	.|T;T	.|0.41065	.|1.01;1.01	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.240692	.|0.44285	.|D	.|0.000463	T|T	0.39009|0.39009	0.1062|0.1062	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D	.|0.56746	.|0.977	.|P	.|0.46585	.|0.521	T|T	0.03728|0.03728	-1.1009|-1.1009	5|10	.|0.20046	.|T	.|0.44	.|.	20.5407|20.5407	0.99260|0.99260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|359	.|Q7Z6K3	.|PTAR1_HUMAN	E|R	124|307;359	.|ENSP00000366405:T307R;ENSP00000344299:T359R	.|ENSP00000344299:T359R	D|T	-|-	3|2	2|0	PTAR1|PTAR1	71523211|71523211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	5.504000|5.504000	0.66968|0.66968	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GAC|ACG		0.527	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	
OR13F1	138805	broad.mit.edu	37	9	107267333	107267333	+	Missense_Mutation	SNP	G	G	A	rs372415307		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr9:107267333G>A	ENST00000334726.2	+	1	879	c.790G>A	c.(790-792)Gct>Act	p.A264T		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A264T(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GAAGCCCTCCGCTGTAGATTC	0.473																																																1	Substitution - Missense(1)	ovary(1)	9						A	THR/ALA	1,4405	826.1+/-416.6	0,1,2202	94.0	91.0	92.0		790	-1.6	0.0	9		92	0,8600		0,0,4300	no	missense	OR13F1	NM_001004485.1	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	264/320	107267333	1,13005	2203	4300	6503	106307154	SO:0001583	missense	138805				CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.790G>A	9.37:g.107267333G>A	ENSP00000334452:p.Ala264Thr		106307154	Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	A	5.435	0.265378	0.10294	2.27E-4	0.0	ENSG00000186881	ENST00000334726	T	0.00099	8.73	4.29	-1.58	0.08479	GPCR, rhodopsin-like superfamily (1);	0.584933	0.15308	N	0.269257	T	0.00073	0.0002	N	0.20685	0.6	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.28650	-1.0037	10	0.66056	D	0.02	.	5.0094	0.14304	0.1827:0.0:0.3754:0.4418	.	264	Q8NGS4	O13F1_HUMAN	T	264	ENSP00000334452:A264T	ENSP00000334452:A264T	A	+	1	0	OR13F1	106307154	0.000000	0.05858	0.010000	0.14722	0.048000	0.14542	-0.342000	0.07801	-0.573000	0.05998	-1.632000	0.00781	GCT		0.473	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1		
COL27A1	85301	broad.mit.edu	37	9	116973264	116973264	+	Silent	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr9:116973264C>T	ENST00000356083.3	+	12	2716	c.2325C>T	c.(2323-2325)ggC>ggT	p.G775G	MIR455_ENST00000384993.1_RNA	NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	775	Collagen-like 3.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G775G(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CCCTGCAGGGCCTGCCTGGCG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9											96.0	84.0	88.0					9																	116973264		2203	4300	6503	116013085	SO:0001819	synonymous_variant	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2325C>T	9.37:g.116973264C>T			116013085	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																				0.632	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
DEC1	50514	broad.mit.edu	37	9	118163578	118163578	+	Missense_Mutation	SNP	C	C	A	rs369269380		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr9:118163578C>A	ENST00000374016.1	+	7	713	c.194C>A	c.(193-195)gCa>gAa	p.A65E		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	65					negative regulation of cell proliferation (GO:0008285)			p.A65E(1)		kidney(1)|large_intestine(1)|ovary(1)	3						CCCAAGGCTGCAGAGGGAATT	0.423																																																1	Substitution - Missense(1)	ovary(1)	9						C	GLU/ALA	0,4406		0,0,2203	114.0	111.0	112.0		194	-1.0	0.0	9		112	1,8599	1.2+/-3.3	0,1,4299	no	missense	DEC1	NM_017418.2	107	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	benign	65/71	118163578	1,13005	2203	4300	6503	117203399	SO:0001583	missense	50514			AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.194C>A	9.37:g.118163578C>A	ENSP00000363128:p.Ala65Glu		117203399		Missense_Mutation	SNP	ENST00000374016.1	37	CCDS6812.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473439	0.26423	0.0	1.16E-4	ENSG00000173077	ENST00000374016	T	0.57752	0.38	3.97	-0.984	0.10259	.	.	.	.	.	T	0.38665	0.1049	.	.	.	0.09310	N	1	B	0.28713	0.22	B	0.31686	0.134	T	0.38735	-0.9647	8	0.87932	D	0	.	4.5237	0.11971	0.5808:0.2752:0.0:0.144	.	65	Q9P2X7	DEC1_HUMAN	E	65	ENSP00000363128:A65E	ENSP00000363128:A65E	A	+	2	0	DEC1	117203399	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.410000	0.07151	-0.177000	0.10690	0.655000	0.94253	GCA		0.423	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1	NM_017418	
OR1L8	138881	broad.mit.edu	37	9	125330329	125330329	+	Missense_Mutation	SNP	A	A	G	rs562905023		TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chr9:125330329A>G	ENST00000304865.2	-	1	509	c.428T>C	c.(427-429)gTc>gCc	p.V143A		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V143A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CACCAGCAGGACACAGTGGTG	0.542													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21750	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											117.0	86.0	97.0					9																	125330329		2203	4300	6503	124370150	SO:0001583	missense	138881				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.428T>C	9.37:g.125330329A>G	ENSP00000306607:p.Val143Ala		124370150	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	A	4.293	0.053631	0.08291	.	.	ENSG00000171496	ENST00000304865	T	0.02067	4.47	4.49	0.461	0.16689	GPCR, rhodopsin-like superfamily (1);	0.599763	0.13503	N	0.383083	T	0.01661	0.0053	L	0.27053	0.805	0.09310	N	1	B	0.13145	0.007	B	0.21151	0.033	T	0.49041	-0.8980	10	0.07482	T	0.82	-14.1981	8.1852	0.31335	0.7267:0.0:0.2733:0.0	.	143	Q8NGR8	OR1L8_HUMAN	A	143	ENSP00000306607:V143A	ENSP00000306607:V143A	V	-	2	0	OR1L8	124370150	0.000000	0.05858	0.005000	0.12908	0.594000	0.36715	-0.528000	0.06193	0.004000	0.14682	0.369000	0.22263	GTC		0.542	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1		
FAM47A	158724	broad.mit.edu	37	X	34149721	34149721	+	Silent	SNP	C	C	T			TCGA-61-2113-01A-01W-0722-08	TCGA-61-2113-11A-01W-0723-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	1a8f84e5-693b-4950-992d-62496d5db43b	ae3ee868-56ab-406e-8a39-abf46e66f3ec	g.chrX:34149721C>T	ENST00000346193.3	-	1	726	c.675G>A	c.(673-675)ccG>ccA	p.P225P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	225	Pro-rich.							p.P225P(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CAGGAGGCTCCGGGCGGAGAC	0.657																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	X																																								34059642	SO:0001819	synonymous_variant	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.675G>A	X.37:g.34149721C>T			34059642	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																				0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
