#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113930																																								117722	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C			117722		Missense_Mutation	SNP	superfamily_SSF52283,HMMPfam_2-Hacid_dh	p.M118T		37	c.353		NT_113930																																																																																			-	NULL	0	0					ENSG00000212884			T			117722	+1	no_errors	ENST00000391571	ensembl	human	known	54_36p	missense	SNP	NULL	C
LMNB2	84823	genome.wustl.edu	37	19	2438255	2438255	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr19:2438255T>A	ENST00000582871.1	-	4	616	c.530A>T	c.(529-531)cAg>cTg	p.Q177L	LMNB2_ENST00000325327.3_Missense_Mutation_p.Q197L	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	177	Coil 1B.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCTCCAGCTGCTTTTTGGC	0.602																																																0			19											94.0	79.0	84.0					19																	2438255		2203	4299	6502	2389255	SO:0001583	missense	84823			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.530A>T	19.37:g.2438255T>A	ENSP00000462730:p.Gln177Leu		2389255	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF,superfamily_SSF74853,HMMPfam_IF_tail	p.Q177L	ENST00000582871.1	37	c.530		19	.	.	.	.	.	.	.	.	.	.	T	28.2	4.901607	0.92035	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.27	4.27	0.50696	Filament (1);	0.209827	0.43110	D	0.000605	T	0.50718	0.1632	L	0.48986	1.54	0.80722	D	1	B	0.33477	0.413	B	0.31547	0.132	T	0.57148	-0.7861	9	0.87932	D	0	.	12.2367	0.54520	0.0:0.0:0.0:1.0	.	177	Q03252	LMNB2_HUMAN	L	177	.	ENSP00000327054:Q177L	Q	-	2	0	LMNB2	2389255	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.889000	0.87307	1.569000	0.49696	0.459000	0.35465	CAG	-	HMMPfam_Filament		0.602	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	protein_coding		T	NM_032737		2389255	-1	no_errors	NM_032737	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CTNS	1497	genome.wustl.edu	37	17	3552143	3552143	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:3552143C>T	ENST00000046640.3	+	5	736	c.143C>T	c.(142-144)cCa>cTa	p.P48L	CTNS_ENST00000488623.1_3'UTR|CTNS_ENST00000381870.3_Missense_Mutation_p.P48L|CTNS_ENST00000414524.2_Intron|CTNS_ENST00000399306.2_Missense_Mutation_p.P48L|CTNS_ENST00000441220.2_Intron	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter	48					adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)			NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	CTCCACAGGCCACCATTAAAT	0.428																																																0			17											142.0	123.0	129.0					17																	3552143		2203	4300	6503	3498892	SO:0001583	missense	1497			AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.143C>T	17.37:g.3552143C>T	ENSP00000046640:p.Pro48Leu		3498892	D3DTJ5|Q8IZ01|Q9UNK6	Missense_Mutation	SNP	HMMPfam_PQ-loop,HMMSmart_SM00679	p.P48L	ENST00000046640.3	37	c.143	CCDS11031.1	17	.	.	.	.	.	.	.	.	.	.	C	7.003	0.555286	0.13436	.	.	ENSG00000040531	ENST00000046640;ENST00000381870;ENST00000452111;ENST00000399306	D;D;T;T	0.95238	-3.63;-3.65;1.55;1.55	5.06	-1.18	0.09617	.	1.225580	0.05213	N	0.507054	D	0.89153	0.6634	L	0.36672	1.1	0.22835	N	0.998675	B;B	0.12013	0.001;0.005	B;B	0.11329	0.004;0.006	T	0.75221	-0.3394	10	0.13853	T	0.58	1.5917	6.9869	0.24733	0.2363:0.4438:0.3199:0.0	.	48;48	O60931;O60931-2	CTNS_HUMAN;.	L	48	ENSP00000046640:P48L;ENSP00000371294:P48L;ENSP00000408652:P48L;ENSP00000382245:P48L	ENSP00000046640:P48L	P	+	2	0	CTNS	3498892	0.019000	0.18553	0.389000	0.26208	0.857000	0.48899	0.193000	0.17116	-0.120000	0.11809	-0.262000	0.10625	CCA	-	NULL		0.428	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	CTNS	protein_coding	OTTHUMT00000317696.1	C	NM_004937		3498892	+1	no_errors	NM_001031681	genbank	human	validated	54_36p	missense	SNP	0.411	T
SLX4	84464	genome.wustl.edu	37	16	3640727	3640727	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr16:3640727T>C	ENST00000294008.3	-	12	3552	c.2912A>G	c.(2911-2913)gAa>gGa	p.E971G		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	971	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AAGAGAGCCTTCTTTTCTCTC	0.597								Direct reversal of damage																																								0			16											66.0	68.0	67.0					16																	3640727		2197	4300	6497	3580728	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2912A>G	16.37:g.3640727T>C	ENSP00000294008:p.Glu971Gly		3580728	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.E971G	ENST00000294008.3	37	c.2912	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	T	10.93	1.488743	0.26686	.	.	ENSG00000188827	ENST00000294008	T	0.01228	5.14	4.6	0.996	0.19844	.	0.695426	0.13518	N	0.381882	T	0.01627	0.0052	L	0.50333	1.59	0.09310	N	1	B	0.15719	0.014	B	0.12156	0.007	T	0.44513	-0.9323	10	0.33940	T	0.23	.	4.7253	0.12938	0.0:0.231:0.2952:0.4738	.	971	Q8IY92	SLX4_HUMAN	G	971	ENSP00000294008:E971G	ENSP00000294008:E971G	E	-	2	0	SLX4	3580728	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-0.595000	0.05727	0.221000	0.20879	0.260000	0.18958	GAA	-	NULL		0.597	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	T	NM_032444		3580728	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	missense	SNP	0.013	C
CLEC2A	387836	genome.wustl.edu	37	12	10084923	10084923	+	Silent	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:10084923A>G	ENST00000455827.1	-	1	57	c.6T>C	c.(4-6)atT>atC	p.I2I	CLEC2A_ENST00000339766.4_Silent_p.I2I	NM_001130711.1	NP_001124183.1	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A	2					natural killer cell mediated cytotoxicity (GO:0042267)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	4						GCTCTGGATTAATCATGGCAA	0.418																																																0			12											87.0	74.0	78.0					12																	10084923		692	1591	2283	9976190	SO:0001819	synonymous_variant	387836			AY359126	CCDS44829.1, CCDS8606.1	12p13.31	2010-06-30			ENSG00000188393	ENSG00000188393		"""C-type lectin domain containing"""	24191	protein-coding gene	gene with protein product	"""keratinocyte-associated C-type lectin"", ""proliferation-induced lymphocyte-associated receptor"""	612087				12975309	Standard	NM_001130711		Approved	UNQ5792, INPE5792, KACL, PILAR	uc009zhc.2	Q6UVW9	OTTHUMG00000140393	ENST00000455827.1:c.6T>C	12.37:g.10084923A>G			9976190	A5Y4G5|A9QKS2|A9QKS3	Silent	SNP	superfamily_C-type_lectin_fold,HMMSmart_CLECT,HMMPfam_Lectin_C	p.I2	ENST00000455827.1	37	c.6	CCDS44829.1	12																																																																																			-	NULL		0.418	CLEC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC2A	protein_coding	OTTHUMT00000399919.1	A	NM_207375		9976190	-1	no_errors	ENST00000339766	ensembl	human	known	54_36p	silent	SNP	0.000	G
MRVI1	10335	genome.wustl.edu	37	11	10615136	10615136	+	Missense_Mutation	SNP	C	C	T	rs373906826		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:10615136C>T	ENST00000436272.1	-	16	2075	c.1997G>A	c.(1996-1998)cGc>cAc	p.R666H	MRVI1_ENST00000545852.1_Missense_Mutation_p.R378H|MRVI1_ENST00000423302.2_Missense_Mutation_p.R693H|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000527509.2_Missense_Mutation_p.R602H|MRVI1_ENST00000421747.1_Missense_Mutation_p.R684H|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000552103.1_Missense_Mutation_p.R602H|MRVI1_ENST00000531107.1_Missense_Mutation_p.R685H|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000424001.1_Missense_Mutation_p.R378H|MRVI1_ENST00000541483.1_Missense_Mutation_p.R487H|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000547195.1_Missense_Mutation_p.R602H|MRVI1_ENST00000534266.2_Missense_Mutation_p.R378H|MRVI1_ENST00000558540.1_Missense_Mutation_p.R378H			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	666					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GACCCTCCGGCGAGGCATATT	0.512																																																0			11						C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4402		0,0,2201	83.0	81.0	82.0		2054,1805,1133,1460,1133,2078	5.7	1.0	11		82	1,8587	1.2+/-3.3	0,1,4293	no	missense,missense,missense,missense,missense,missense	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	29,29,29,29,29,29	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	685/905,602/822,378/598,487/707,378/598,693/913	10615136	1,12989	2201	4294	6495	10571712	SO:0001583	missense	10335			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1997G>A	11.37:g.10615136C>T	ENSP00000412229:p.Arg666His		10571712	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	HMMPfam_MRVI1	p.R684H	ENST00000436272.1	37	c.2051		11	.	.	.	.	.	.	.	.	.	.	C	35	5.424686	0.96111	0.0	1.16E-4	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.998	T	0.12941	-1.0528	10	0.52906	T	0.07	-11.5375	19.9357	0.97140	0.0:1.0:0.0:0.0	.	487;666;685;684	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	H	684;667;666;602;602;378;378;693;487;685;602	ENSP00000414598:R684H;ENSP00000412229:R666H;ENSP00000448278:R602H;ENSP00000446764:R602H;ENSP00000441971:R378H;ENSP00000401205:R378H;ENSP00000412130:R693H;ENSP00000437784:R487H;ENSP00000432436:R685H;ENSP00000432067:R602H	ENSP00000307885:R667H	R	-	2	0	MRVI1	10571712	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.037000	0.76531	2.715000	0.92844	0.655000	0.94253	CGC	-	HMMPfam_MRVI1		0.512	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	protein_coding		C	NM_001098579		10571712	-1	no_errors	NM_001098579	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12164015	12164015	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr6:12164015T>A	ENST00000379388.2	+	9	7810	c.7478T>A	c.(7477-7479)aTg>aAg	p.M2493K	HIVEP1_ENST00000541134.1_Missense_Mutation_p.M358K	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2493					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TCGTTAAGCATGGAAACCGTC	0.517																																																0			6											75.0	79.0	78.0					6																	12164015		1961	4165	6126	12272001	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.7478T>A	6.37:g.12164015T>A	ENSP00000368698:p.Met2493Lys		12272001	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.M2493K	ENST00000379388.2	37	c.7478	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	T	15.53	2.860750	0.51482	.	.	ENSG00000095951	ENST00000379388;ENST00000541134;ENST00000542327	T;T	0.34472	2.86;1.36	5.92	5.92	0.95590	.	0.162693	0.29410	N	0.012233	T	0.25938	0.0632	L	0.54323	1.7	0.53005	D	0.999965	P	0.39665	0.682	B	0.37601	0.254	T	0.14035	-1.0487	10	0.87932	D	0	-6.5985	16.3662	0.83325	0.0:0.0:0.0:1.0	.	2493	P15822	ZEP1_HUMAN	K	2493;358;475	ENSP00000368698:M2493K;ENSP00000445617:M358K	ENSP00000368698:M2493K	M	+	2	0	HIVEP1	12272001	1.000000	0.71417	0.933000	0.37362	0.051000	0.14879	7.164000	0.77533	2.274000	0.75844	0.533000	0.62120	ATG	-	NULL		0.517	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	protein_coding	OTTHUMT00000039870.2	T	NM_002114		12272001	+1	no_errors	NM_002114	genbank	human	validated	54_36p	missense	SNP	0.992	A
ZFYVE20	64145	genome.wustl.edu	37	3	15116296	15116296	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr3:15116296G>T	ENST00000253699.3	-	14	1961	c.1348C>A	c.(1348-1350)Cag>Aag	p.Q450K	ZFYVE20_ENST00000476527.2_Missense_Mutation_p.Q450K	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	450	Necessary for the interaction with EHD1.|Necessary for the interaction with RAB4A.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						CTCTGCCCCTGACCTCCTGAC	0.647																																																0			3											47.0	44.0	45.0					3																	15116296		2203	4300	6503	15091300	SO:0001583	missense	64145			AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1348C>A	3.37:g.15116296G>T	ENSP00000253699:p.Gln450Lys		15091300	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_FYVE,HMMPfam_FYVE,superfamily_FYVE_PHD_ZnF	p.Q450K	ENST00000253699.3	37	c.1348	CCDS2623.1	3	.	.	.	.	.	.	.	.	.	.	G	2.745	-0.261285	0.05791	.	.	ENSG00000131381	ENST00000253699;ENST00000476527	T;T	0.41065	1.01;1.01	5.8	5.8	0.92144	.	0.406919	0.28877	N	0.013843	T	0.31358	0.0794	L	0.44542	1.39	0.24143	N	0.995724	B	0.23185	0.081	B	0.15870	0.014	T	0.19063	-1.0317	10	0.10636	T	0.68	-14.62	11.0386	0.47816	0.1118:0.0:0.8882:0.0	.	450	Q9H1K0	RBNS5_HUMAN	K	450	ENSP00000253699:Q450K;ENSP00000422551:Q450K	ENSP00000253699:Q450K	Q	-	1	0	ZFYVE20	15091300	0.988000	0.35896	0.020000	0.16555	0.710000	0.40934	5.028000	0.64115	2.745000	0.94114	0.491000	0.48974	CAG	-	NULL		0.647	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE20	protein_coding	OTTHUMT00000252102.2	G	NM_022340		15091300	-1	no_errors	NM_022340	genbank	human	validated	54_36p	missense	SNP	0.001	T
FAM171A1	221061	genome.wustl.edu	37	10	15255606	15255606	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr10:15255606C>T	ENST00000378116.4	-	8	1987	c.1981G>A	c.(1981-1983)Gca>Aca	p.A661T	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	661						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GACATGGATGCGTTCTGAGGG	0.612																																																0			10											55.0	59.0	58.0					10																	15255606		2203	4300	6503	15295612	SO:0001583	missense	221061			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1981G>A	10.37:g.15255606C>T	ENSP00000367356:p.Ala661Thr		15295612	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	HMMPfam_UPF0560	p.A661T	ENST00000378116.4	37	c.1981	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	2.583	-0.297072	0.05532	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.34275	1.37	5.25	3.39	0.38822	.	0.492110	0.22822	N	0.055207	T	0.22859	0.0552	L	0.31664	0.95	0.09310	N	1	B	0.16166	0.016	B	0.12837	0.008	T	0.15037	-1.0451	10	0.28530	T	0.3	-7.9323	6.5113	0.22224	0.1475:0.7059:0.0:0.1466	.	661	Q5VUB5	F1711_HUMAN	T	661;660	ENSP00000367356:A661T	ENSP00000367356:A661T	A	-	1	0	FAM171A1	15295612	0.596000	0.26866	0.002000	0.10522	0.036000	0.12997	1.713000	0.37951	0.777000	0.33496	-0.309000	0.09137	GCA	-	HMMPfam_UPF0560		0.612	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	protein_coding	OTTHUMT00000046984.1	C	XM_167709		15295612	-1	no_errors	NM_001010924	genbank	human	validated	54_36p	missense	SNP	0.009	T
CDRT1	374286	genome.wustl.edu	37	17	15492470	15492470	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:15492470G>A	ENST00000395906.3	-	12	2077	c.2078C>T	c.(2077-2079)gCt>gTt	p.A693V	RP11-385D13.1_ENST00000455584.2_Intron|CDRT1_ENST00000583965.1_3'UTR|CDRT1_ENST00000354433.3_Missense_Mutation_p.A193V	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	693										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		CTGAGCTGTAGCACTTGGTTC	0.517																																																0			17											93.0	99.0	97.0					17																	15492470		2197	4299	6496	15433195	SO:0001583	missense	374286			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.2078C>T	17.37:g.15492470G>A	ENSP00000379242:p.Ala693Val		15433195	O43848|O95611	Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.A693V	ENST00000395906.3	37	c.2078	CCDS45619.1	17	.	.	.	.	.	.	.	.	.	.	G	3.385	-0.125531	0.06795	.	.	ENSG00000241322;ENSG00000251537;ENSG00000251537	ENST00000354433;ENST00000261644;ENST00000395906	T;T	0.72835	-0.69;0.15	0.912	-0.385	0.12470	.	.	.	.	.	T	0.54515	0.1863	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38329	-0.9666	9	0.33141	T	0.24	.	3.8325	0.08880	0.2741:0.0:0.7259:0.0	.	693	O95170	CDRT1_HUMAN	V	193;723;693	ENSP00000346416:A193V;ENSP00000379242:A693V	ENSP00000346416:A193V	A	-	2	0	CDRT1;RP11-385D13.1	15433195	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.123000	0.15708	0.015000	0.14971	0.000000	0.15137	GCT	-	NULL		0.517	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	protein_coding	OTTHUMT00000448127.1	G	NM_006382		15433195	-1	no_errors	NM_006382	genbank	human	provisional	54_36p	missense	SNP	0.001	A
SPEN	23013	genome.wustl.edu	37	1	16247384	16247384	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:16247384A>G	ENST00000375759.3	+	9	1859	c.1655A>G	c.(1654-1656)aAa>aGa	p.K552R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	552	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GACCGCTTAAAAGGCATGGCC	0.418																																																0			1											79.0	79.0	79.0					1																	16247384		2203	4300	6503	16119971	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1655A>G	1.37:g.16247384A>G	ENSP00000364912:p.Lys552Arg		16119971	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SPOC-like,HMMPfam_SPOC	p.K552R	ENST00000375759.3	37	c.1655	CCDS164.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.20|12.20	1.867072|1.867072	0.32977|0.32977	.|.	.|.	ENSG00000065526|ENSG00000065526	ENST00000442985|ENST00000375759	T|T	0.15139|0.05996	2.45|3.36	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|.	.|.	.|.	.|.	T|T	0.12008|0.12008	0.0292|0.0292	N|N	0.11427|0.11427	0.14|0.14	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.38672|0.38672	-0.9650|-0.9650	7|9	0.62326|0.51188	D|T	0.03|0.08	-7.2082|-7.2082	16.0108|16.0108	0.80402|0.80402	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|552	.|Q96T58	.|MINT_HUMAN	E|R	292|552	ENSP00000400914:K292E|ENSP00000364912:K552R	ENSP00000400914:K292E|ENSP00000364912:K552R	K|K	+|+	1|2	0|0	SPEN|SPEN	16119971|16119971	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.824000|8.824000	0.92023|0.92023	2.242000|2.242000	0.73789|0.73789	0.482000|0.482000	0.46254|0.46254	AAG|AAA	-	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1		0.418	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	A	NM_015001		16119971	+1	no_errors	NM_015001	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
BCL2L13	23786	genome.wustl.edu	37	22	18138590	18138590	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr22:18138590C>A	ENST00000317582.5	+	2	460	c.113C>A	c.(112-114)tCa>tAa	p.S38*	BCL2L13_ENST00000337612.5_5'UTR|BCL2L13_ENST00000543133.1_5'UTR|BCL2L13_ENST00000538149.1_Missense_Mutation_p.H26N|BCL2L13_ENST00000355028.3_Nonsense_Mutation_p.S38*|BCL2L13_ENST00000418951.2_Nonsense_Mutation_p.S38*|BCL2L13_ENST00000493680.1_Nonsense_Mutation_p.S38*|BCL2L13_ENST00000399782.1_Nonsense_Mutation_p.S38*	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	38					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		CATCTTTCCTCACCCCAAGGT	0.358																																																0			22											94.0	83.0	87.0					22																	18138590		2203	4300	6503	16518590	SO:0001587	stop_gained	23786			AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.113C>A	22.37:g.18138590C>A	ENSP00000318883:p.Ser38*		16518590	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Nonsense_Mutation	SNP	superfamily_Bcl-2 inhibitors of programmed cell death,HMMPfam_Bcl-2	p.S38*	ENST00000317582.5	37	c.113	CCDS13746.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.122590|7.122590	0.98077|0.98077	.|.	.|.	ENSG00000099968|ENSG00000099968	ENST00000538149|ENST00000399782;ENST00000317582;ENST00000493680;ENST00000355028;ENST00000418951	T|.	0.42900|.	0.96|.	5.68|5.68	2.49|2.49	0.30216|0.30216	.|.	.|0.492205	.|0.20751	.|N	.|0.086347	T|.	0.29126|.	0.0724|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.33413|.	0.411|.	B|.	0.37731|.	0.257|.	T|.	0.13415|.	-1.0510|.	8|.	0.87932|0.02654	D|T	0|1	-0.0021|-0.0021	8.7678|8.7678	0.34713|0.34713	0.0:0.7614:0.0:0.2386|0.0:0.7614:0.0:0.2386	.|.	26|.	B7Z238|.	.|.	N|X	26|38	ENSP00000441344:H26N|.	ENSP00000441344:H26N|ENSP00000318883:S38X	H|S	+|+	1|2	0|0	BCL2L13|BCL2L13	16518590|16518590	0.012000|0.012000	0.17670|0.17670	0.956000|0.956000	0.39512|0.39512	0.989000|0.989000	0.77384|0.77384	0.630000|0.630000	0.24553|0.24553	0.343000|0.343000	0.23821|0.23821	0.591000|0.591000	0.81541|0.81541	CAC|TCA	-	superfamily_Bcl-2 inhibitors of programmed cell death		0.358	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L13	protein_coding	OTTHUMT00000316184.1	C	NM_015367		16518590	+1	no_errors	NM_015367	genbank	human	validated	54_36p	nonsense	SNP	0.811	A
SDC1	6382	genome.wustl.edu	37	2	20403867	20403867	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:20403867G>C	ENST00000254351.4	-	3	578	c.334C>G	c.(334-336)Cct>Gct	p.P112A	SDC1_ENST00000403076.1_Missense_Mutation_p.P112A|SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000381150.1_Missense_Mutation_p.P112A	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	112					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		GTGAGGCCAGGCTCCACTTCT	0.692																																																0			2											44.0	48.0	46.0					2																	20403867		2203	4300	6503	20267348	SO:0001583	missense	6382			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.334C>G	2.37:g.20403867G>C	ENSP00000254351:p.Pro112Ala		20267348	D6W523|Q53QV0|Q546D3|Q96HB7	Missense_Mutation	SNP	HMMPfam_Syndecan,HMMSmart_4.1m,PatternScan_SYNDECAN	p.P112A	ENST00000254351.4	37	c.334	CCDS1697.1	2	.	.	.	.	.	.	.	.	.	.	g	17.09	3.299394	0.60195	.	.	ENSG00000115884	ENST00000254351;ENST00000381150;ENST00000403076;ENST00000429035	T;T;T;T	0.37411	2.21;2.21;1.37;1.2	3.62	2.74	0.32292	.	0.317483	0.23708	N	0.045342	T	0.47673	0.1458	M	0.73962	2.25	0.35657	D	0.812234	D;D	0.56521	0.976;0.959	P;P	0.55260	0.772;0.713	T	0.60444	-0.7262	10	0.87932	D	0	-7.599	6.9567	0.24576	0.1246:0.0:0.8754:0.0	.	112;112	E9PHH3;P18827	.;SDC1_HUMAN	A	112;112;112;120	ENSP00000254351:P112A;ENSP00000370542:P112A;ENSP00000384613:P112A;ENSP00000400773:P120A	ENSP00000254351:P112A	P	-	1	0	SDC1	20267348	0.918000	0.31147	0.805000	0.32314	0.054000	0.15201	1.690000	0.37711	1.114000	0.41781	0.556000	0.70494	CCT	-	HMMPfam_Syndecan		0.692	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC1	protein_coding	OTTHUMT00000207495.1	G	NM_001006946		20267348	-1	no_errors	NM_001006946	genbank	human	reviewed	54_36p	missense	SNP	0.783	C
PLA2G2D	26279	genome.wustl.edu	37	1	20445968	20445968	+	Silent	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:20445968C>G	ENST00000375105.3	-	1	82	c.24G>C	c.(22-24)ggG>ggC	p.G8G		NM_012400.2	NP_036532.1	Q9UNK4	PA2GD_HUMAN	phospholipase A2, group IID	8					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000798)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCACCACCAGCCCACACAGCA	0.607										Multiple Myeloma(11;0.12)																											Melanoma(60;742 1548 31762 39240)											0			1											174.0	144.0	154.0					1																	20445968		2203	4300	6503	20318555	SO:0001819	synonymous_variant	26279			AF112982	CCDS203.1, CCDS72721.1	1p36.12	2008-09-19			ENSG00000117215	ENSG00000117215	3.1.1.4		9033	protein-coding gene	gene with protein product		605630				10455175	Standard	NM_012400		Approved	sPLA2S	uc001bcz.4	Q9UNK4	OTTHUMG00000002701	ENST00000375105.3:c.24G>C	1.37:g.20445968C>G			20318555	A8K2Z1|B1AEL9|Q9UK01	Silent	SNP	HMMSmart_PA2c,HMMPfam_Phospholip_A2_1,superfamily_PhospholipaseA2,PatternScan_PA2_HIS,PatternScan_PA2_ASP	p.G8	ENST00000375105.3	37	c.24	CCDS203.1	1																																																																																			-	NULL		0.607	PLA2G2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2D	protein_coding	OTTHUMT00000007683.1	C			20318555	-1	no_errors	NM_012400	genbank	human	provisional	54_36p	silent	SNP	0.544	G
CORO6	84940	genome.wustl.edu	37	17	27944243	27944243	+	Intron	SNP	C	C	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:27944243C>A	ENST00000445145.2	-	6	755				CORO6_ENST00000345068.5_Intron|CORO6_ENST00000456796.3_Intron|CORO6_ENST00000584969.1_Intron|CORO6_ENST00000388767.3_Intron|CORO6_ENST00000580212.1_Intron|RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000577909.1_Intron			Q6QEF8	CORO6_HUMAN	coronin 6						actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						ATAGCTCCTCCTCCCCTGCAC	0.642																																																0			17											32.0	32.0	32.0					17																	27944243		692	1591	2283	24968369	SO:0001627	intron_variant	84940			AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.754-183G>T	17.37:g.27944243C>A			24968369	B3KU26|Q71MF3|Q8WYH7|Q96K02	Nonsense_Mutation	SNP	HMMPfam_DUF1900	p.G5*	ENST00000445145.2	37	c.13		17																																																																																			-	NULL		0.642	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	CORO6	protein_coding	OTTHUMT00000447831.1	C	NM_032854		24968369	-1	no_errors	ENST00000337761	ensembl	human	known	54_36p	nonsense	SNP	0.001	A
ARID1A	8289	genome.wustl.edu	37	1	27105685	27105685	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:27105685G>T	ENST00000324856.7	+	20	5667	c.5296G>T	c.(5296-5298)Gaa>Taa	p.E1766*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1383*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.E94*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.E1549*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1766					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E1766fs*7(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGAAGAAGAAGAAGAACTTCT	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Insertion - Frameshift(1)	ovary(1)	1											66.0	68.0	67.0					1																	27105685		2203	4300	6503	26978272	SO:0001587	stop_gained	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5296G>T	1.37:g.27105685G>T	ENSP00000320485:p.Glu1766*		26978272	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	superfamily_ARID-like,HMMPfam_ARID,HMMSmart_SM00501	p.E1766*	ENST00000324856.7	37	c.5296	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.273664|9.273664	0.99122|0.99122	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.269268|.	0.41001|.	D|.	0.000972|.	.|T	.|0.73426	.|0.3585	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72934	.|-0.4141	.|4	0.35671|.	T|.	0.21|.	-3.7891|-3.7891	17.5528|17.5528	0.87881|0.87881	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1766;1549;1383;94|662	.|.	ENSP00000320485:E1766X|.	E|R	+|+	1|2	0|0	ARID1A|ARID1A	26978272|26978272	0.996000|0.996000	0.38824|0.38824	0.999000|0.999000	0.59377|0.59377	0.988000|0.988000	0.76386|0.76386	4.358000|4.358000	0.59442|0.59442	2.547000|2.547000	0.85894|0.85894	0.591000|0.591000	0.81541|0.81541	GAA|AGA	-	NULL		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	G	NM_139135		26978272	+1	no_errors	NM_006015	genbank	human	reviewed	54_36p	nonsense	SNP	0.998	T
RHOT1	55288	genome.wustl.edu	37	17	30477560	30477560	+	Intron	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:30477560G>A	ENST00000333942.6	+	1	276				RHOT1_ENST00000545287.2_Intron|RHOT1_ENST00000358365.3_Intron|RHOT1_ENST00000394692.2_Intron|RHOT1_ENST00000354266.3_Intron|RHOT1_ENST00000580976.1_Intron|RHOT1_ENST00000581094.1_Intron|RHOT1_ENST00000583994.1_Intron	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TTGTGTGGGAGATAGGCCTAC	0.468																																																0			17																																								27501673	SO:0001627	intron_variant	0			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.37+7812G>A	17.37:g.30477560G>A			27501673	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	RNA	SNP	-	NULL	ENST00000333942.6	37	NULL	CCDS32612.1	17																																																																																			-	-		0.468	RHOT1-001	KNOWN	basic|CCDS	protein_coding	ARGFXP2	protein_coding	OTTHUMT00000447097.1	G	NM_018307		27501673	-1	pseudogene	NR_002222	genbank	human	provisional	54_36p	rna	SNP	0.016	A
IFT172	26160	genome.wustl.edu	37	2	27668253	27668253	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:27668253G>T	ENST00000260570.3	-	46	5081	c.4978C>A	c.(4978-4980)Cag>Aag	p.Q1660K	KRTCAP3_ENST00000543753.1_Intron	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1660					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					GGCAGAACCTGCTCCAGCCGC	0.587																																																0			2											26.0	27.0	27.0					2																	27668253		2203	4300	6503	27521757	SO:0001583	missense	26160			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.4978C>A	2.37:g.27668253G>T	ENSP00000260570:p.Gln1660Lys		27521757	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase,superfamily_TPR-like,superfamily_HCP-like	p.Q1660K	ENST00000260570.3	37	c.4978	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.101365	0.94245	.	.	ENSG00000138002	ENST00000260570	T	0.48201	0.82	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.65831	0.2729	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.67581	-0.5634	10	0.59425	D	0.04	-14.2479	15.4675	0.75412	0.0:0.0:1.0:0.0	.	1660	Q9UG01	IF172_HUMAN	K	1660	ENSP00000260570:Q1660K	ENSP00000260570:Q1660K	Q	-	1	0	IFT172	27521757	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.430000	0.80321	2.447000	0.82792	0.561000	0.74099	CAG	-	NULL		0.587	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	protein_coding	OTTHUMT00000250213.2	G	NM_015662		27521757	-1	no_errors	NM_015662	genbank	human	validated	54_36p	missense	SNP	1.000	T
LINGO2	158038	genome.wustl.edu	37	9	27949202	27949202	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr9:27949202C>T	ENST00000379992.2	-	6	1917	c.1468G>A	c.(1468-1470)Ggg>Agg	p.G490R	LINGO2_ENST00000308675.3_Missense_Mutation_p.G490R	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	490	Ig-like C2-type.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GTATCATTCCCAGCAGCATTG	0.493																																																0			9											109.0	106.0	107.0					9																	27949202		2203	4300	6503	27939202	SO:0001583	missense	158038			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1468G>A	9.37:g.27949202C>T	ENSP00000369328:p.Gly490Arg		27939202	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2	p.G490R	ENST00000379992.2	37	c.1468	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162048	0.57368	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.98345	-4.88;-4.88	5.83	4.93	0.64822	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98595	1.0656	9	.	.	.	.	14.8791	0.70519	0.0:0.9316:0.0:0.0684	.	490	Q7L985	LIGO2_HUMAN	R	490	ENSP00000369328:G490R;ENSP00000310126:G490R	.	G	-	1	0	LINGO2	27939202	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	7.818000	0.86416	1.487000	0.48415	0.655000	0.94253	GGG	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2		0.493	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	protein_coding	OTTHUMT00000051978.2	C	NM_152570		27939202	-1	no_errors	NM_152570	genbank	human	provisional	54_36p	missense	SNP	1.000	T
KRTAP22-1	337979	genome.wustl.edu	37	21	31973486	31973486	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr21:31973486G>T	ENST00000334680.2	+	1	73	c.47G>T	c.(46-48)gGa>gTa	p.G16V	KRTAP6-2_ENST00000334897.3_5'Flank	NM_181620.1	NP_853651.1	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	16						intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	8						TATGCCAAAGGAGGCCTGGGC	0.483																																																0			21											178.0	163.0	168.0					21																	31973486		2203	4300	6503	30895357	SO:0001583	missense	337979			AP001708	CCDS13601.1	21q22.1	2011-02-10			ENSG00000186924	ENSG00000186924		"""Keratin associated proteins"""	18947	protein-coding gene	gene with protein product						12359730	Standard	NM_181620		Approved	KAP22.1	uc011add.2	Q3MIV0	OTTHUMG00000057778	ENST00000334680.2:c.47G>T	21.37:g.31973486G>T	ENSP00000333887:p.Gly16Val		30895357		Missense_Mutation	SNP	NULL	p.G16V	ENST00000334680.2	37	c.47	CCDS13601.1	21	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345792	0.24426	.	.	ENSG00000186924	ENST00000334680	T	0.34275	1.37	4.61	2.75	0.32379	.	0.319926	0.22090	N	0.064762	T	0.51719	0.1691	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.70487	0.969	T	0.37865	-0.9687	9	0.87932	D	0	.	5.5904	0.17297	0.1014:0.0:0.7036:0.195	.	16	Q3MIV0	KR221_HUMAN	V	16	ENSP00000333887:G16V	ENSP00000333887:G16V	G	+	2	0	KRTAP22-1	30895357	0.073000	0.21202	0.010000	0.14722	0.019000	0.09904	2.267000	0.43329	0.644000	0.30656	0.591000	0.81541	GGA	-	NULL		0.483	KRTAP22-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP22-1	protein_coding	OTTHUMT00000128230.2	G			30895357	+1	no_errors	NM_181620	genbank	human	provisional	54_36p	missense	SNP	0.005	T
IGHV3OR16-8	388255	genome.wustl.edu	37	16	33020879	33020879	+	RNA	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr16:33020879A>G	ENST00000565407.2	+	0	287				RP11-19N8.2_ENST00000567619.1_RNA					immunoglobulin heavy variable 3/OR16-8 (non-functional)																		AACGCCAATAACTCACCGTAT	0.512																																																0			16											209.0	194.0	199.0					16																	33020879		1991	4163	6154	32928380			0			Z29605		16p11.2	2013-05-22	2008-09-11		ENSG00000271130	ENSG00000271130		"""Immunoglobulins / IGH orphons"""	5643	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-8"""				Standard			Approved	IGHV3/OR16-8			OTTHUMG00000176449		16.37:g.33020879A>G			32928380		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.N77S	ENST00000565407.2	37	c.230		16																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.512	IGHV3OR16-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000214613	IG_V_gene	OTTHUMT00000432095.2	A			32928380	+1	no_start_codon:no_stop_codon	ENST00000398668	ensembl	human	known	54_36p	missense	SNP	0.000	G
RICTOR	253260	genome.wustl.edu	37	5	38967476	38967476	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:38967476C>T	ENST00000357387.3	-	13	1144	c.1114G>A	c.(1114-1116)Gag>Aag	p.E372K	RICTOR_ENST00000296782.5_Missense_Mutation_p.E372K	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					GTTTTTGCCTCAGCTGCCACA	0.368																																																0			5											61.0	64.0	63.0					5																	38967476		2203	4300	6503	39003233	SO:0001583	missense	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.1114G>A	5.37:g.38967476C>T	ENSP00000349959:p.Glu372Lys		39003233		Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_RasGEF_N	p.E372K	ENST00000357387.3	37	c.1114	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.696084	0.96802	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.53423	0.62;0.63	5.43	5.43	0.79202	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70090	0.3184	M	0.71036	2.16	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.987	T	0.72377	-0.4312	10	0.87932	D	0	-14.5883	19.6092	0.95599	0.0:1.0:0.0:0.0	.	372;372	Q6R327;Q6R327-3	RICTR_HUMAN;.	K	372	ENSP00000349959:E372K;ENSP00000296782:E372K	ENSP00000296782:E372K	E	-	1	0	RICTOR	39003233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.225000	0.78051	2.693000	0.91896	0.655000	0.94253	GAG	-	superfamily_ARM repeat		0.368	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	protein_coding	OTTHUMT00000366985.1	C	NM_152756		39003233	-1	no_errors	NM_152756	genbank	human	validated	54_36p	missense	SNP	1.000	T
CNTN1	1272	genome.wustl.edu	37	12	41408048	41408048	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:41408048C>T	ENST00000551295.2	+	18	2249	c.2132C>T	c.(2131-2133)tCa>tTa	p.S711L	CNTN1_ENST00000348761.2_Missense_Mutation_p.S700L|CNTN1_ENST00000347616.1_Missense_Mutation_p.S711L|CNTN1_ENST00000550305.1_3'UTR	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	711	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GTGGCTCCTTCAGATGTAGGA	0.383																																																0			12											115.0	104.0	107.0					12																	41408048		2203	4300	6503	39694315	SO:0001583	missense	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2132C>T	12.37:g.41408048C>T	ENSP00000447006:p.Ser711Leu		39694315	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_V-set,PatternScan_N6_MTASE,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.S711L	ENST00000551295.2	37	c.2132	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.174004	0.94807	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.53857	0.6;0.6;0.6	5.45	5.45	0.79879	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.068673	0.64402	D	0.000010	T	0.73737	0.3625	M	0.78049	2.395	0.80722	D	1	D;D	0.67145	0.995;0.996	P;D	0.65773	0.897;0.938	T	0.74598	-0.3612	10	0.59425	D	0.04	.	20.1745	0.98175	0.0:1.0:0.0:0.0	.	700;711	Q12860-2;Q12860	.;CNTN1_HUMAN	L	711;711;700	ENSP00000447006:S711L;ENSP00000325660:S711L;ENSP00000261160:S700L	ENSP00000325660:S711L	S	+	2	0	CNTN1	39694315	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	5.623000	0.67757	2.941000	0.99782	0.655000	0.94253	TCA	-	superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060		0.383	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	protein_coding	OTTHUMT00000403692.2	C	NM_001843		39694315	+1	no_errors	NM_001843	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MRPL2	51069	genome.wustl.edu	37	6	43023746	43023746	+	Splice_Site	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr6:43023746C>T	ENST00000388752.3	-	5	945		c.e5-1		CUL7_ENST00000265348.3_5'Flank|CUL7_ENST00000535468.1_5'Flank|MRPL2_ENST00000230413.5_Splice_Site|MRPL2_ENST00000489623.1_Intron	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		CGAGCAGCAACTAAAAGACAG	0.537																																																0			6											66.0	63.0	64.0					6																	43023746		2203	4300	6503	43131724	SO:0001630	splice_region_variant	51069			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.521-1G>A	6.37:g.43023746C>T			43131724	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Splice_Site	SNP	-	e5-1	ENST00000388752.3	37	c.521-1	CCDS34454.1	6	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114105	0.77210	.	.	ENSG00000112651	ENST00000388752;ENST00000230413	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.38	0.87402	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRPL2	43131724	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.947000	0.75959	2.536000	0.85505	0.563000	0.77884	.	-	-		0.537	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL2	protein_coding	OTTHUMT00000040577.2	C		Intron	43131724	-1	no_errors	NM_015950	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SGCA	6442	genome.wustl.edu	37	17	48247574	48247574	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:48247574C>T	ENST00000262018.3	+	7	854	c.818C>T	c.(817-819)cCg>cTg	p.P273L	SGCA_ENST00000513942.1_Intron|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000543315.1_Intron|SGCA_ENST00000344627.6_Intron	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	273					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						GAGCATGACCCGTTCTTCTGC	0.627																																																0			17											120.0	103.0	109.0					17																	48247574		2203	4300	6503	45602573	SO:0001583	missense	6442			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.818C>T	17.37:g.48247574C>T	ENSP00000262018:p.Pro273Leu		45602573	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	HMMPfam_Sarcoglycan_2,HMMSmart_SM00736,superfamily_Cadherin-like	p.P273L	ENST00000262018.3	37	c.818	CCDS32679.1	17	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321324	0.60634	.	.	ENSG00000108823	ENST00000262018	D	0.97505	-4.41	5.8	4.83	0.62350	.	0.139448	0.46442	D	0.000291	D	0.97632	0.9224	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.97408	1.0000	10	0.41790	T	0.15	-33.3867	14.3723	0.66849	0.0:0.5969:0.4031:0.0	.	273	Q16586	SGCA_HUMAN	L	273	ENSP00000262018:P273L	ENSP00000262018:P273L	P	+	2	0	SGCA	45602573	0.996000	0.38824	0.942000	0.38095	0.856000	0.48823	3.285000	0.51716	1.448000	0.47680	-0.176000	0.13171	CCG	-	HMMPfam_Sarcoglycan_2		0.627	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCA	protein_coding	OTTHUMT00000366841.1	C	NM_000023		45602573	+1	no_errors	NM_000023	genbank	human	reviewed	54_36p	missense	SNP	0.534	T
OR8S1	341568	genome.wustl.edu	37	12	48919653	48919653	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:48919653A>T	ENST00000310194.1	+	1	239	c.239A>T	c.(238-240)aAg>aTg	p.K80M	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						ATTGTGCCCAAGATGCTGGAG	0.488																																																0			12											141.0	133.0	136.0					12																	48919653		2203	4300	6503	47205920	SO:0001583	missense	341568				CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.239A>T	12.37:g.48919653A>T	ENSP00000310632:p.Lys80Met		47205920		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.K80M	ENST00000310194.1	37	c.239	CCDS31789.1	12	.	.	.	.	.	.	.	.	.	.	A	14.35	2.509047	0.44660	.	.	ENSG00000197376	ENST00000310194	T	0.01369	4.97	5.03	1.37	0.22104	GPCR, rhodopsin-like superfamily (1);	0.333227	0.21781	N	0.069213	T	0.09555	0.0235	M	0.93550	3.43	0.23559	N	0.997418	D	0.89917	1.0	D	0.76071	0.987	T	0.04664	-1.0935	10	0.87932	D	0	-35.135	7.418	0.27055	0.6444:0.0:0.3556:0.0	.	80	Q8NH09	OR8S1_HUMAN	M	80	ENSP00000310632:K80M	ENSP00000310632:K80M	K	+	2	0	OR8S1	47205920	0.729000	0.28090	0.176000	0.23000	0.677000	0.39632	1.630000	0.37081	0.074000	0.16767	0.533000	0.62120	AAG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.488	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8S1	protein_coding	OTTHUMT00000406881.1	A			47205920	+1	no_errors	NM_001005203	genbank	human	validated	54_36p	missense	SNP	0.776	T
MADD	8567	genome.wustl.edu	37	11	47333346	47333346	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:47333346G>T	ENST00000311027.5	+	29	4387	c.4222G>T	c.(4222-4224)Gtg>Ttg	p.V1408L	MADD_ENST00000395344.3_Missense_Mutation_p.V1302L|MADD_ENST00000402799.1_Missense_Mutation_p.V1306L|MADD_ENST00000402192.2_Missense_Mutation_p.V1348L|MADD_ENST00000406482.1_Missense_Mutation_p.V1306L|MADD_ENST00000342922.4_Missense_Mutation_p.V1349L|MADD_ENST00000405573.2_Missense_Mutation_p.V218L|MADD_ENST00000407859.3_Missense_Mutation_p.V1326L|MADD_ENST00000349238.3_Missense_Mutation_p.V1369L|MADD_ENST00000395336.3_Missense_Mutation_p.V1408L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.V1408L(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CATTGGGCTTGTGTACAGCCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	94.0	99.0					11																	47333346		2201	4298	6499	47289922	SO:0001583	missense	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4222G>T	11.37:g.47333346G>T	ENSP00000310933:p.Val1408Leu		47289922		Missense_Mutation	SNP	HMMPfam_uDENN,HMMSmart_SM00800,HMMPfam_DENN,HMMSmart_SM00799,HMMSmart_SM00801,HMMPfam_dDENN	p.V1408L	ENST00000311027.5	37	c.4222	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701121	0.48307	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.46063	3.45;3.31;3.32;3.44;3.45;3.32;3.32;3.45;3.45;0.88	5.14	4.23	0.50019	.	0.348813	0.29745	N	0.011313	T	0.29556	0.0737	L	0.27053	0.805	0.44880	D	0.997898	B;B;B;B;B;B;B;B;B;B;B	0.10296	0.003;0.001;0.001;0.0;0.0;0.001;0.002;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B	0.14578	0.011;0.003;0.003;0.003;0.002;0.006;0.006;0.003;0.006;0.001;0.002	T	0.06303	-1.0834	10	0.41790	T	0.15	-8.9646	10.2108	0.43138	0.0724:0.0:0.7926:0.135	.	218;1302;1302;1408;1306;1306;1306;1369;1326;1408;1349	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	L	1349;1306;1306;1306;1369;1408;1326;1302;1408;1348;218	ENSP00000343902:V1349L;ENSP00000385585:V1306L;ENSP00000384435:V1306L;ENSP00000304505:V1369L;ENSP00000310933:V1408L;ENSP00000384204:V1326L;ENSP00000378753:V1302L;ENSP00000378745:V1408L;ENSP00000384287:V1348L;ENSP00000384483:V218L	ENSP00000310933:V1408L	V	+	1	0	MADD	47289922	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.857000	0.48349	1.149000	0.42402	0.563000	0.77884	GTG	-	NULL		0.498	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	protein_coding	OTTHUMT00000317746.1	G			47289922	+1	no_errors	NM_003682	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
ZNF226	7769	genome.wustl.edu	37	19	44681671	44681671	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr19:44681671G>A	ENST00000590089.1	+	7	2623	c.2256G>A	c.(2254-2256)gaG>gaA	p.E752E	ZNF226_ENST00000337433.5_Silent_p.E752E|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Silent_p.E752E			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	752					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				ACACTGGGGAGAAACCTTATA	0.408																																					Pancreas(115;581 1665 13228 19278 50070)											0			19											102.0	111.0	108.0					19																	44681671		2178	4287	6465	49373511	SO:0001819	synonymous_variant	7769			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2256G>A	19.37:g.44681671G>A			49373511	Q8WWE6|Q96TE6|Q9NS44	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.E752	ENST00000590089.1	37	c.2256	CCDS46102.1	19																																																																																			-	superfamily_SSF57667		0.408	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF226	protein_coding	OTTHUMT00000460712.1	G			49373511	+1	no_errors	NM_001032372	genbank	human	validated	54_36p	silent	SNP	0.999	A
AGBL4	84871	genome.wustl.edu	37	1	50317078	50317078	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:50317078G>C	ENST00000371839.1	-	2	263	c.147C>G	c.(145-147)tgC>tgG	p.C49W	AGBL4_ENST00000371836.1_Missense_Mutation_p.C49W|AGBL4_ENST00000497451.1_5'UTR|AGBL4_ENST00000371838.1_Missense_Mutation_p.C49W	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	49					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CACTTTCAAAGCAAGCATCAA	0.363																																																0			1											145.0	121.0	129.0					1																	50317078		692	1591	2283	50089665	SO:0001583	missense	84871			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.147C>G	1.37:g.50317078G>C	ENSP00000360905:p.Cys49Trp		50089665	B3KT26|B4DG37	Missense_Mutation	SNP	superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14	p.C49W	ENST00000371839.1	37	c.147	CCDS44137.1	1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818504	0.50633	.	.	ENSG00000186094	ENST00000371839;ENST00000411952;ENST00000371838;ENST00000371836	T;T;T	0.13538	2.58;2.58;2.58	5.21	2.01	0.26516	.	0.000000	0.64402	D	0.000010	T	0.28928	0.0718	M	0.72894	2.215	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.63381	0.91;0.914	T	0.01312	-1.1388	9	.	.	.	-14.1706	9.6188	0.39708	0.3272:0.0:0.6728:0.0	.	49;49	Q5VU57-2;Q5VU57	.;CBPC6_HUMAN	W	49;43;49;49	ENSP00000360905:C49W;ENSP00000360904:C49W;ENSP00000360902:C49W	.	C	-	3	2	AGBL4	50089665	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.033000	0.30191	0.469000	0.27268	0.455000	0.32223	TGC	-	NULL		0.363	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL4	protein_coding	OTTHUMT00000021346.4	G	NM_032785		50089665	-1	no_errors	ENST00000371839	ensembl	human	known	54_36p	missense	SNP	1.000	C
MYH14	79784	genome.wustl.edu	37	19	50792834	50792834	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr19:50792834A>G	ENST00000596571.1	+	32	4771	c.4771A>G	c.(4771-4773)Act>Gct	p.T1591A	MYH14_ENST00000440075.2_Missense_Mutation_p.T1632A|MYH14_ENST00000262269.8_Missense_Mutation_p.T1632A|MYH14_ENST00000601313.1_Missense_Mutation_p.T1632A|MYH14_ENST00000598205.1_Missense_Mutation_p.T1599A|MYH14_ENST00000425460.1_Missense_Mutation_p.T1599A|MYH14_ENST00000376970.2_Missense_Mutation_p.T1624A			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1591					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGCTCTCAAGACTCAGCATGA	0.602																																																0			19											50.0	61.0	57.0					19																	50792834		2192	4294	6486	55484646	SO:0001583	missense	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4771A>G	19.37:g.50792834A>G	ENSP00000472819:p.Thr1591Ala		55484646	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,HMMPfam_Myosin_tail_1,superfamily_Prefoldin	p.T1599A	ENST00000596571.1	37	c.4795	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	A	3.021	-0.201667	0.06219	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	3.95	-3.76	0.04359	Myosin tail (1);	.	.	.	.	T	0.44787	0.1310	N	0.00985	-1.075	0.22389	N	0.999146	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.50482	-0.8823	9	0.02654	T	1	.	1.3646	0.02198	0.3046:0.1386:0.4158:0.141	.	1632;1591;1599	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	A	1632;1624;1599;1375;1632	ENSP00000406273:T1632A;ENSP00000366169:T1624A;ENSP00000407879:T1599A;ENSP00000262269:T1632A	ENSP00000262269:T1632A	T	+	1	0	MYH14	55484646	1.000000	0.71417	0.086000	0.20670	0.981000	0.71138	4.427000	0.59888	-0.655000	0.05387	0.402000	0.26972	ACT	-	HMMPfam_Myosin_tail_1,superfamily_Prefoldin		0.602	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	protein_coding	OTTHUMT00000464710.2	A	NM_024729		55484646	+1	no_errors	NM_001077186	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
VOPP1	81552	genome.wustl.edu	37	7	55588571	55588571	+	Intron	SNP	A	A	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr7:55588571A>C	ENST00000285279.5	-	2	314				VOPP1_ENST00000471168.1_Intron|VOPP1_ENST00000454227.1_Intron|VOPP1_ENST00000418904.1_Intron|VOPP1_ENST00000427700.1_Intron|VOPP1_ENST00000428648.1_Intron|VOPP1_ENST00000428097.1_Intron|VOPP1_ENST00000433959.1_Intron|VOPP1_ENST00000545390.1_Intron	NM_001284282.1|NM_030796.3	NP_001271211.1|NP_110423.3	Q96AW1	VOPP1_HUMAN	vesicular, overexpressed in cancer, prosurvival protein 1						regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|integral component of organelle membrane (GO:0031301)	signal transducer activity (GO:0004871)			endometrium(1)|lung(4)	5						GGCTGTCCTCAACGTAACTGG	0.582																																																0			7																																								55556065	SO:0001627	intron_variant	0				CCDS47588.1, CCDS64654.1, CCDS64656.1	7p11.2	2010-06-22			ENSG00000154978	ENSG00000154978			34518	protein-coding gene	gene with protein product	"""Glioblastoma-amplified secreted protein"", ""EGFR-coamplified and overexpressed protein"""	611915				15735698	Standard	NM_030796		Approved	ECop, GASP, FLJ20532, DKFZp564K0822	uc003tqs.3	Q96AW1	OTTHUMG00000156124	ENST00000285279.5:c.113+193T>G	7.37:g.55588571A>C			55556065	B0AZU1|B2RAT4|B3KS72|C9JWR3|Q6FIE3|Q8NBN8|Q96RE5|Q9H0W4	Missense_Mutation	SNP	NULL	p.L242W	ENST00000285279.5	37	c.725	CCDS47588.1	7																																																																																			-	NULL		0.582	VOPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100134747	protein_coding	OTTHUMT00000343074.1	A	NM_030796		55556065	-1	no_start_codon:pseudogene:no_stop_codon	XM_001719364	genbank	human	model	54_36p	missense	SNP	0.000	C
KLF8	11279	genome.wustl.edu	37	X	56259737	56259737	+	5'UTR	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:56259737C>T	ENST00000468660.1	+	0	258				KLF8_ENST00000374928.3_5'UTR	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						GGCATGAGTTCTGGACACTTC	0.572																																																0			X											156.0	105.0	122.0					X																	56259737		2203	4300	6503	56276462	SO:0001623	5_prime_UTR_variant	11279			U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.-31C>T	X.37:g.56259737C>T			56276462	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Silent	SNP	HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.F77	ENST00000468660.1	37	c.231	CCDS14373.1	X																																																																																			-	NULL		0.572	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	protein_coding	OTTHUMT00000056887.2	C	NM_007250		56276462	+1	no_start_codon	ENST00000313456	ensembl	human	known	54_36p	silent	SNP	0.367	T
OR10W1	81341	genome.wustl.edu	37	11	58034882	58034882	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:58034882A>C	ENST00000395079.2	-	1	850	c.449T>G	c.(448-450)cTg>cGg	p.L150R		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				GAAGGCCACCAGTTGTAAGGA	0.498																																																0			11											107.0	71.0	84.0					11																	58034882		2201	4295	6496	57791458	SO:0001583	missense	81341			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.449T>G	11.37:g.58034882A>C	ENSP00000378516:p.Leu150Arg		57791458	A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L150R	ENST00000395079.2	37	c.449	CCDS7968.1	11	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230403	0.58777	.	.	ENSG00000172772	ENST00000395079	T	0.00091	8.74	5.81	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40144	N	0.001161	T	0.00384	0.0012	M	0.63208	1.945	0.29189	N	0.875978	D	0.89917	1.0	D	0.79784	0.993	T	0.51332	-0.8719	10	0.66056	D	0.02	.	11.0134	0.47675	0.9268:0.0:0.0732:0.0	.	150	Q8NGF6	O10W1_HUMAN	R	150	ENSP00000378516:L150R	ENSP00000378516:L150R	L	-	2	0	OR10W1	57791458	0.000000	0.05858	0.932000	0.37286	0.689000	0.40095	0.612000	0.24283	2.215000	0.71742	0.533000	0.62120	CTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.498	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10W1	protein_coding	OTTHUMT00000394704.1	A	NM_207374		57791458	-1	no_errors	NM_207374	genbank	human	provisional	54_36p	missense	SNP	0.524	C
PHLPP1	23239	genome.wustl.edu	37	18	60562374	60562374	+	Missense_Mutation	SNP	G	G	A	rs376292612		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr18:60562374G>A	ENST00000262719.5	+	5	2431	c.2197G>A	c.(2197-2199)Gtt>Att	p.V733I	PHLPP1_ENST00000400316.4_Missense_Mutation_p.V221I			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	733					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CCCGGCAGCCGTTGGAGTGAT	0.537																																																0			18						G	ILE/VAL	1,3825		0,1,1912	51.0	50.0	50.0		2197	5.8	0.9	18		50	0,8244		0,0,4122	no	missense	PHLPP1	NM_194449.2	29	0,1,6034	AA,AG,GG		0.0,0.0261,0.0083	benign	733/1718	60562374	1,12069	1913	4122	6035	58713354	SO:0001583	missense	23239			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2197G>A	18.37:g.60562374G>A	ENSP00000262719:p.Val733Ile		58713354	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	HMMPfam_PH,superfamily_L domain-like,HMMSmart_SM00369,HMMSmart_SM00364,HMMPfam_LRR_1,HMMSmart_SM00332,superfamily_Protein serine/threonine phosphatase 2C catalytic domain,HMMPfam_PP2C	p.V221I	ENST00000262719.5	37	c.661	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297763	0.23650	2.61E-4	0.0	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.56444	0.46;0.46	5.81	5.81	0.92471	.	.	.	.	.	T	0.26629	0.0651	N	0.04746	-0.17	0.51767	D	0.999931	P	0.38992	0.653	B	0.26614	0.071	T	0.39014	-0.9634	9	0.02654	T	1	-18.3762	20.0831	0.97789	0.0:0.0:1.0:0.0	.	733	O60346	PHLP1_HUMAN	I	221;733	ENSP00000383170:V221I;ENSP00000262719:V733I	ENSP00000262719:V733I	V	+	1	0	PHLPP1	58713354	1.000000	0.71417	0.856000	0.33681	0.525000	0.34531	5.757000	0.68766	2.765000	0.95021	0.655000	0.94253	GTT	-	superfamily_L domain-like		0.537	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP	protein_coding	OTTHUMT00000319249.2	G	NM_194449		58713354	+1	no_errors	NM_194449	genbank	human	validated	54_36p	missense	SNP	0.853	A
ZP1	22917	genome.wustl.edu	37	11	60635063	60635063	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:60635063G>T	ENST00000278853.5	+	1	29	c.29G>T	c.(28-30)gGt>gTt	p.G10V		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	10					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						ACGACCTGGGGTTACCCTGTG	0.672																																																0			11											59.0	58.0	58.0					11																	60635063		2203	4299	6502	60391639	SO:0001583	missense	22917			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.29G>T	11.37:g.60635063G>T	ENSP00000278853:p.Gly10Val		60391639		Missense_Mutation	SNP	superfamily_P_trefoil,PatternScan_P_TREFOIL,HMMPfam_Zona_pellucida,HMMSmart_ZP,PatternScan_ZP_1	p.G10V	ENST00000278853.5	37	c.29	CCDS31572.1	11	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342231	0.41498	.	.	ENSG00000149506	ENST00000278853	T	0.27720	1.65	3.6	1.52	0.23074	.	0.499201	0.16759	N	0.200716	T	0.32194	0.0821	L	0.54323	1.7	0.09310	N	0.999996	P	0.52316	0.952	P	0.49140	0.601	T	0.12604	-1.0541	10	0.30078	T	0.28	-1.4044	8.0443	0.30540	0.1635:0.0:0.8365:0.0	.	10	P60852	ZP1_HUMAN	V	10	ENSP00000278853:G10V	ENSP00000278853:G10V	G	+	2	0	ZP1	60391639	0.009000	0.17119	0.001000	0.08648	0.110000	0.19582	0.569000	0.23638	0.153000	0.19213	0.195000	0.17529	GGT	-	NULL		0.672	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZP1	protein_coding	OTTHUMT00000396329.1	G	NM_207341		60391639	+1	no_errors	NM_207341	genbank	human	validated	54_36p	missense	SNP	0.015	T
OPRL1	4987	genome.wustl.edu	37	20	62729505	62729505	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr20:62729505A>T	ENST00000349451.3	+	5	996	c.584A>T	c.(583-585)gAt>gTt	p.D195V	OPRL1_ENST00000336866.2_Missense_Mutation_p.D195V|OPRL1_ENST00000355631.4_Missense_Mutation_p.D195V	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	195					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CAGGTCGAGGATGAAGGTCAG	0.672																																																0			20											65.0	56.0	59.0					20																	62729505		2203	4297	6500	62199949	SO:0001583	missense	4987				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.584A>T	20.37:g.62729505A>T	ENSP00000336764:p.Asp195Val		62199949	Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.D195V	ENST00000349451.3	37	c.584	CCDS13556.1	20	.	.	.	.	.	.	.	.	.	.	A	15.20	2.762334	0.49468	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.36878	1.23;1.23;1.23	4.88	3.78	0.43462	GPCR, rhodopsin-like superfamily (1);	0.788035	0.12125	N	0.497315	T	0.39118	0.1066	M	0.70108	2.13	0.53688	D	0.999974	P;P	0.42584	0.531;0.784	B;B	0.40009	0.153;0.316	T	0.11717	-1.0576	10	0.40728	T	0.16	.	10.285	0.43562	0.921:0.0:0.079:0.0	.	190;195	P41146-2;P41146	.;OPRX_HUMAN	V	195	ENSP00000336843:D195V;ENSP00000347848:D195V;ENSP00000336764:D195V	ENSP00000336843:D195V	D	+	2	0	OPRL1	62199949	0.434000	0.25570	0.938000	0.37757	0.652000	0.38707	2.084000	0.41625	0.719000	0.32188	0.369000	0.22263	GAT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.672	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	protein_coding	OTTHUMT00000080295.1	A	NM_182647		62199949	+1	no_errors	NM_000913	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
ASB12	142689	genome.wustl.edu	37	X	63445067	63445067	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:63445067A>T	ENST00000396130.2	-	1	436	c.437T>A	c.(436-438)cTg>cAg	p.L146Q	MTMR8_ENST00000453546.1_Missense_Mutation_p.L530Q|ASB12_ENST00000362002.2_Missense_Mutation_p.L155Q			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	146					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						GAGCTCCTGCAGGATAGCAAC	0.537																																																2	Whole gene deletion(2)	ovary(1)|large_intestine(1)	X											77.0	58.0	65.0					X																	63445067		2203	4300	6503	63361792	SO:0001583	missense	142689			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.437T>A	X.37:g.63445067A>T	ENSP00000379435:p.Leu146Gln		63361792	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_SOCS_box	p.L146Q	ENST00000396130.2	37	c.437		X	.	.	.	.	.	.	.	.	.	.	A	19.04	3.749417	0.69533	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.67171	-0.25;-0.25;-0.25	4.0	4.0	0.46444	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	D	0.83124	0.5186	M	0.90369	3.11	0.25771	N	0.984837	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76198	-0.3047	10	0.72032	D	0.01	-5.9604	11.2485	0.49010	1.0:0.0:0.0:0.0	.	530;146	B4DQL0;Q8WXK4	.;ASB12_HUMAN	Q	155;146;155;530	ENSP00000355195:L155Q;ENSP00000379435:L146Q;ENSP00000394003:L530Q	ENSP00000354626:L155Q	L	-	2	0	ASB12;MTMR8	63361792	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	8.397000	0.90193	1.595000	0.50050	0.381000	0.24937	CTG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.537	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	ASB12	protein_coding		A			63361792	-1	no_errors	NM_130388	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RAVER2	55225	genome.wustl.edu	37	1	65296602	65296602	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:65296602C>G	ENST00000294428.3	+	12	2088	c.2010C>G	c.(2008-2010)gaC>gaG	p.D670E	RAVER2_ENST00000430964.2_Missense_Mutation_p.D209E|RAVER2_ENST00000371072.4_Missense_Mutation_p.D657E			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	670						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						AATGTGTTGACCAGCATTCTC	0.408																																																0			1											150.0	139.0	143.0					1																	65296602		1883	4114	5997	65069190	SO:0001583	missense	55225			AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.2010C>G	1.37:g.65296602C>G	ENSP00000294428:p.Asp670Glu		65069190	Q6P141|Q9NPV7	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.D657E	ENST00000294428.3	37	c.1971		1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454251	0.26161	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T	0.33216	1.42;1.43	4.52	3.6	0.41247	.	0.494392	0.20395	N	0.093172	T	0.09335	0.0230	L	0.29908	0.895	0.25157	N	0.990387	B;B	0.20052	0.024;0.041	B;B	0.16722	0.007;0.016	T	0.20505	-1.0273	10	0.31617	T	0.26	-29.1327	11.9885	0.53161	0.1733:0.8267:0.0:0.0	.	670;657	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	E	657;670;209	ENSP00000360112:D657E;ENSP00000294428:D670E	ENSP00000294428:D670E	D	+	3	2	RAVER2	65069190	0.985000	0.35326	0.946000	0.38457	0.987000	0.75469	0.600000	0.24104	1.109000	0.41680	0.462000	0.41574	GAC	-	NULL		0.408	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	protein_coding		C	NM_018211		65069190	+1	no_errors	NM_018211	genbank	human	validated	54_36p	missense	SNP	0.957	G
MTL5	9633	genome.wustl.edu	37	11	68478358	68478358	+	Silent	SNP	T	T	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:68478358T>G	ENST00000255087.5	-	9	1501	c.1318A>C	c.(1318-1320)Aga>Cga	p.R440R		NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	440					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			TGACTGAATCTTGGAAGTCCT	0.428																																																0			11											130.0	115.0	120.0					11																	68478358		2200	4294	6494	68234934	SO:0001819	synonymous_variant	9633			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.1318A>C	11.37:g.68478358T>G			68234934	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Silent	SNP	HMMPfam_CXC	p.R440	ENST00000255087.5	37	c.1318	CCDS8184.1	11																																																																																			-	NULL		0.428	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTL5	protein_coding	OTTHUMT00000396844.1	T	NM_004923		68234934	-1	no_errors	NM_004923	genbank	human	reviewed	54_36p	silent	SNP	0.000	G
EDA	1896	genome.wustl.edu	37	X	69247761	69247761	+	Missense_Mutation	SNP	C	C	A	rs397516667|rs397516666		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:69247761C>A	ENST00000374552.4	+	4	823	c.581C>A	c.(580-582)cCa>cAa	p.P194Q	EDA_ENST00000524573.1_Missense_Mutation_p.P194Q|EDA_ENST00000374553.2_Missense_Mutation_p.P194Q	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	194	Collagen-like.		Missing (in XHED). {ECO:0000269|PubMed:11279189, ECO:0000269|PubMed:18231121}.|Missing (in XHED). {ECO:0000269|PubMed:11279189}.|Missing (in XHED). {ECO:0000269|PubMed:20979233}.		cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						ccaggacctccaggaccccag	0.542																																																0			X											14.0	14.0	14.0					X																	69247761		2168	4224	6392	69164486	SO:0001583	missense	1896			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.581C>A	X.37:g.69247761C>A	ENSP00000363680:p.Pro194Gln		69164486	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_TNF-like,HMMPfam_TNF	p.P194Q	ENST00000374552.4	37	c.581	CCDS14394.1	X	.	.	.	.	.	.	.	.	.	.	C	14.57	2.576272	0.45902	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573;ENST00000503592	D;D;D;D	0.93488	-2.05;-2.05;-2.05;-3.23	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.89653	0.6777	N	0.17838	0.53	0.80722	D	1	P;P;P	0.38551	0.582;0.636;0.582	B;B;B	0.42959	0.281;0.403;0.281	D	0.90507	0.4478	10	0.51188	T	0.08	-4.9714	15.7799	0.78252	0.0:1.0:0.0:0.0	.	194;194;194	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	Q	194;194;194;62	ENSP00000363680:P194Q;ENSP00000363681:P194Q;ENSP00000432585:P194Q;ENSP00000423037:P62Q	ENSP00000363680:P194Q	P	+	2	0	EDA	69164486	0.997000	0.39634	0.996000	0.52242	0.976000	0.68499	3.760000	0.55235	2.176000	0.68965	0.600000	0.82982	CCA	-	HMMPfam_Collagen		0.542	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDA	protein_coding	OTTHUMT00000057048.2	C	NM_001399		69164486	+1	no_errors	NM_001399	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LRRC7	57554	genome.wustl.edu	37	1	70488846	70488846	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:70488846G>A	ENST00000035383.5	+	15	1499	c.1469G>A	c.(1468-1470)cGt>cAt	p.R490H	RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Missense_Mutation_p.R495H|RP11-181B18.1_ENST00000425754.1_RNA	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	490						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGGGGCCAGCGTGGGATTACT	0.547																																																0			1											54.0	50.0	51.0					1																	70488846		2203	4300	6503	70261434	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1469G>A	1.37:g.70488846G>A	ENSP00000035383:p.Arg490His		70261434	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00364,HMMPfam_LRR_1,HMMSmart_SM00369,HMMSmart_SM00365,superfamily_RNI-like,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.R490H	ENST00000035383.5	37	c.1469	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.108824	0.56398	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.37752	1.18;1.25	5.86	5.86	0.93980	.	0.257341	0.35495	N	0.003162	T	0.10766	0.0263	N	0.08118	0	0.80722	D	1	P	0.49358	0.923	B	0.35859	0.212	T	0.04333	-1.0959	10	0.56958	D	0.05	.	15.6849	0.77402	0.0:0.0:1.0:0.0	.	490	Q96NW7	LRRC7_HUMAN	H	495;490;313	ENSP00000309245:R495H;ENSP00000035383:R490H	ENSP00000035383:R490H	R	+	2	0	LRRC7	70261434	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.453000	0.60061	2.775000	0.95449	0.585000	0.79938	CGT	-	NULL		0.547	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	protein_coding	OTTHUMT00000131261.1	G	NM_020794		70261434	+1	no_errors	NM_020794	genbank	human	validated	54_36p	missense	SNP	1.000	A
HN1	51155	genome.wustl.edu	37	17	73143679	73143679	+	Missense_Mutation	SNP	G	G	A	rs148356595		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:73143679G>A	ENST00000409753.3	-	3	554	c.269C>T	c.(268-270)gCa>gTa	p.A90V	HN1_ENST00000392566.2_Missense_Mutation_p.A44V|HN1_ENST00000470924.1_Missense_Mutation_p.A44V|HN1_ENST00000476258.1_Missense_Mutation_p.A44V|HN1_ENST00000581874.1_Missense_Mutation_p.A90V|HN1_ENST00000405458.3_Missense_Mutation_p.A44V|HN1_ENST00000481647.1_Missense_Mutation_p.A44V|HN1_ENST00000356033.4_Missense_Mutation_p.A90V|Y_RNA_ENST00000516233.1_RNA|HN1_ENST00000482348.1_Missense_Mutation_p.A44V|RP11-649A18.4_ENST00000579554.1_RNA|HN1_ENST00000465454.1_5'Flank	NM_016185.2	NP_057269.1	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1	90					developmental process (GO:0032502)	nucleus (GO:0005634)			HN1/USH1G(2)	breast(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					TCCGGAGCTTGCTTCAGAGGA	0.428																																																0			17											91.0	87.0	88.0					17																	73143679		2203	4300	6503	70655274	SO:0001583	missense	51155			AF086910	CCDS32729.1, CCDS45771.1, CCDS45772.1	17q25.1	2013-09-20			ENSG00000189159	ENSG00000189159			14569	protein-coding gene	gene with protein product	"""androgen-regulated protein 2"""					15094197	Standard	NM_001002032		Approved	ARM2, HN1A	uc002jnb.1	Q9UK76	OTTHUMG00000154521	ENST00000409753.3:c.269C>T	17.37:g.73143679G>A	ENSP00000387059:p.Ala90Val		70655274	B2R6K3|Q53FG7|Q7Z2D2|Q7Z2F0	Missense_Mutation	SNP	NULL	p.A90V	ENST00000409753.3	37	c.269	CCDS45771.1	17	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230873	0.58777	.	.	ENSG00000189159	ENST00000405458;ENST00000409753;ENST00000356033;ENST00000409135;ENST00000392566	.	.	.	5.64	2.46	0.29980	.	0.464631	0.22792	N	0.055587	T	0.56077	0.1961	L	0.54323	1.7	0.34763	D	0.732901	B;P;B	0.37330	0.392;0.59;0.449	B;B;B	0.39904	0.23;0.313;0.173	T	0.67177	-0.5736	9	0.59425	D	0.04	-49.2868	15.2228	0.73327	0.0:0.4027:0.5973:0.0	.	90;90;90	B8ZZT7;Q9UK76-2;Q9UK76	.;.;HN1_HUMAN	V	44;90;90;90;44	.	ENSP00000348316:A90V	A	-	2	0	HN1	70655274	0.937000	0.31787	0.197000	0.23402	0.932000	0.56968	1.402000	0.34600	0.283000	0.22279	0.462000	0.41574	GCA	-	NULL		0.428	HN1-001	KNOWN	basic|CCDS	protein_coding	HN1	protein_coding	OTTHUMT00000335692.1	G	NM_001002032		70655274	-1	no_errors	NM_001002032	genbank	human	validated	54_36p	missense	SNP	0.888	A
KAT6B	23522	genome.wustl.edu	37	10	76789262	76789262	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr10:76789262G>T	ENST00000287239.4	+	18	5169	c.4680G>T	c.(4678-4680)caG>caT	p.Q1560H	KAT6B_ENST00000372711.1_Missense_Mutation_p.Q1377H|KAT6B_ENST00000372725.1_Missense_Mutation_p.Q1268H|KAT6B_ENST00000372714.1_Missense_Mutation_p.Q1268H|KAT6B_ENST00000372724.1_Missense_Mutation_p.Q1268H	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1560	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										ACACCTTTCAGGATTGTGCCG	0.537																																																0			10											117.0	113.0	115.0					10																	76789262		2203	4300	6503	76459268	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4680G>T	10.37:g.76789262G>T	ENSP00000287239:p.Gln1560His		76459268	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	"HMMSmart_SM00526,superfamily_""Winged helix"" DNA-binding domain,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_MOZ_SAS"	p.Q1560H	ENST00000287239.4	37	c.4680	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	G	11.06	1.529110	0.27387	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.83673	-1.7;-1.7;-1.75;-1.7;-1.73	4.7	1.78	0.24846	.	0.142235	0.32068	N	0.006638	D	0.85327	0.5671	L	0.57536	1.79	0.38663	D	0.952125	P;P;D	0.65815	0.892;0.763;0.995	P;P;P	0.59703	0.542;0.621;0.862	D	0.85066	0.0937	10	0.87932	D	0	-2.0721	8.9361	0.35700	0.2444:0.0:0.7556:0.0	.	1377;1268;1560	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	H	1268;1268;1560;1268;1377	ENSP00000361810:Q1268H;ENSP00000361809:Q1268H;ENSP00000287239:Q1560H;ENSP00000361799:Q1268H;ENSP00000361796:Q1377H	ENSP00000287239:Q1560H	Q	+	3	2	KAT6B	76459268	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.221000	0.58574	0.402000	0.25451	0.563000	0.77884	CAG	-	NULL		0.537	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST4	protein_coding	OTTHUMT00000048771.1	G	NM_012330		76459268	+1	no_errors	NM_012330	genbank	human	validated	54_36p	missense	SNP	1.000	T
FSCN2	25794	genome.wustl.edu	37	17	79495605	79495605	+	Silent	SNP	C	C	T	rs199668780	byFrequency	TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr17:79495605C>T	ENST00000417245.2	+	1	184	c.48C>T	c.(46-48)ctC>ctT	p.L16L	RP13-766D20.2_ENST00000430912.1_RNA|RP13-766D20.2_ENST00000442532.1_RNA|FSCN2_ENST00000334850.7_Silent_p.L16L	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	16					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			AGTTTGGCCTCGTCAACGACA	0.632													c|||	5	0.000998403	0.0008	0.0	5008	,	,		16441	0.0		0.002	False		,,,				2504	0.002															0			17							,	2,4160		0,2,2079	25.0	27.0	27.0		48,48	-10.3	0.0	17		27	14,8390		0,14,4188	no	coding-synonymous,coding-synonymous	FSCN2	NM_001077182.2,NM_012418.3	,	0,16,6267	TT,TC,CC		0.1666,0.0481,0.1273	,	16/517,16/493	79495605	16,12550	2081	4202	6283	77110200	SO:0001819	synonymous_variant	25794			AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.48C>T	17.37:g.79495605C>T			77110200	A0AVC4|A8MRA6	Silent	SNP	superfamily_Actin_crosslink,HMMPfam_Fascin	p.L16	ENST00000417245.2	37	c.48	CCDS45811.1	17																																																																																			-	superfamily_Actin_crosslink		0.632	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN2	protein_coding	OTTHUMT00000394746.1	C	NM_012418		77110200	+1	no_errors	ENST00000334850	ensembl	human	known	54_36p	silent	SNP	0.427	T
LPAR4	2846	genome.wustl.edu	37	X	78010491	78010491	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:78010491A>G	ENST00000435339.3	+	2	511	c.125A>G	c.(124-126)aAt>aGt	p.N42S		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	42					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						TATAATCTCAATGGTGCTGTC	0.408																																																0			X											347.0	285.0	306.0					X																	78010491		2203	4300	6503	77897147	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.125A>G	X.37:g.78010491A>G	ENSP00000408205:p.Asn42Ser		77897147	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N42S	ENST00000435339.3	37	c.125	CCDS14441.1	X	.	.	.	.	.	.	.	.	.	.	A	12.50	1.956988	0.34565	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.36157	1.27;1.27	4.32	4.32	0.51571	.	0.072915	0.56097	D	0.000028	T	0.25419	0.0618	N	0.22421	0.69	0.34752	D	0.731838	B	0.22146	0.065	B	0.22753	0.041	T	0.30149	-0.9988	10	0.46703	T	0.11	.	11.575	0.50856	1.0:0.0:0.0:0.0	.	42	Q99677	LPAR4_HUMAN	S	42	ENSP00000408205:N42S;ENSP00000362398:N42S	ENSP00000362398:N42S	N	+	2	0	LPAR4	77897147	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.648000	0.74359	1.609000	0.50190	0.345000	0.21793	AAT	-	superfamily_Family A G protein-coupled receptor-like		0.408	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR4	protein_coding	OTTHUMT00000057322.2	A	NM_005296		77897147	+1	no_errors	NM_005296	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SYT1	6857	genome.wustl.edu	37	12	79679644	79679644	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:79679644A>T	ENST00000261205.4	+	5	901	c.244A>T	c.(244-246)Aaa>Taa	p.K82*	SYT1_ENST00000552744.1_Nonsense_Mutation_p.K82*|SYT1_ENST00000457153.2_Nonsense_Mutation_p.K82*|SYT1_ENST00000393240.3_Nonsense_Mutation_p.K82*	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	82					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						TATCTGTAAGAAATGTTTGTT	0.403																																																0			12											136.0	130.0	132.0					12																	79679644		2203	4300	6503	78203775	SO:0001587	stop_gained	6857				CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.244A>T	12.37:g.79679644A>T	ENSP00000261205:p.Lys82*		78203775	Q6AI31	Nonsense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.K82*	ENST00000261205.4	37	c.244	CCDS9017.1	12	.	.	.	.	.	.	.	.	.	.	A	34	5.358386	0.95854	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000552744;ENST00000552624;ENST00000446242	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	.	.	.	X	82	.	ENSP00000261205:K82X	K	+	1	0	SYT1	78203775	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.281000	0.76405	0.533000	0.62120	AAA	-	NULL		0.403	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT1	protein_coding	OTTHUMT00000259415.1	A	NM_005639		78203775	+1	no_errors	NM_005639	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79030243	79030243	+	Missense_Mutation	SNP	C	C	G	rs531447714		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:79030243C>G	ENST00000446378.2	+	2	5686	c.5655C>G	c.(5653-5655)ttC>ttG	p.F1885L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1885					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGGAAGAATTCTTTATTTCTC	0.393																																																0			5											56.0	55.0	55.0					5																	79030243		1838	4092	5930	79065999	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5655C>G	5.37:g.79030243C>G	ENSP00000394770:p.Phe1885Leu		79065999	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	superfamily_FN_III-like,HMMPfam_fn3,HMMSmart_FN3,HMMPfam_SPRY	p.F1885L	ENST00000446378.2	37	c.5655	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026891	0.35797	.	.	ENSG00000164309	ENST00000446378	T	0.03689	3.84	5.64	1.09	0.20402	.	1.855810	0.02649	N	0.106205	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B	0.16396	0.017	B	0.11329	0.006	T	0.42548	-0.9445	10	0.49607	T	0.09	.	3.663	0.08245	0.1671:0.5006:0.0:0.3323	.	1885	Q8N3K9	CMYA5_HUMAN	L	1885	ENSP00000394770:F1885L	ENSP00000394770:F1885L	F	+	3	2	CMYA5	79065999	0.000000	0.05858	0.000000	0.03702	0.302000	0.27658	-0.424000	0.07025	-0.096000	0.12329	-0.355000	0.07637	TTC	-	NULL		0.393	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	C	NM_153610		79065999	+1	no_errors	NM_153610	genbank	human	validated	54_36p	missense	SNP	0.000	G
FUNDC2P2	388965	genome.wustl.edu	37	2	84518454	84518454	+	RNA	SNP	T	T	A	rs565937074		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:84518454T>A	ENST00000331369.5	+	0	648									FUN14 domain containing 2 pseudogene 2																		GCCTCTACACTCCATCACAGG	0.488																																																0			2																																								84371965			388965					2p11.2	2010-03-12			ENSG00000182814	ENSG00000182814			17247	pseudogene	pseudogene							Standard	NR_003663		Approved		uc010ffz.1		OTTHUMG00000152875		2.37:g.84518454T>A			84371965		RNA	SNP	-	NULL	ENST00000331369.5	37	NULL		2																																																																																			-	-		0.488	FUNDC2P2-001	KNOWN	basic	processed_transcript	LOC388965	pseudogene	OTTHUMT00000333681.1	T	NR_003663		84371965	+1	pseudogene	NR_003663	genbank	human	provisional	54_36p	rna	SNP	0.196	A
TMTC3	160418	genome.wustl.edu	37	12	88560309	88560309	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:88560309G>A	ENST00000266712.6	+	7	1220	c.1000G>A	c.(1000-1002)Gga>Aga	p.G334R		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	334					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						GGGGATGTTGGGAGTATTCAG	0.358																																																0			12											163.0	162.0	162.0					12																	88560309		2203	4300	6503	87084440	SO:0001583	missense	160418				CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1000G>A	12.37:g.88560309G>A	ENSP00000266712:p.Gly334Arg		87084440	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	HMMPfam_DUF1736,superfamily_Prenyl_trans,HMMPfam_TPR_1,HMMSmart_TPR	p.G334R	ENST00000266712.6	37	c.1000	CCDS9032.1	12	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659271	0.29515	.	.	ENSG00000139324	ENST00000266712	T	0.62639	0.01	5.43	3.43	0.39272	.	0.282446	0.39274	N	0.001416	T	0.36026	0.0952	N	0.08118	0	0.31293	N	0.689159	P	0.36683	0.565	B	0.41466	0.358	T	0.32375	-0.9909	10	0.25106	T	0.35	-13.9408	0.7648	0.01013	0.2013:0.1881:0.3796:0.231	.	334	Q6ZXV5-2	.	R	334	ENSP00000266712:G334R	ENSP00000266712:G334R	G	+	1	0	TMTC3	87084440	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.297000	0.43593	2.541000	0.85698	0.585000	0.79938	GGA	-	NULL		0.358	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	protein_coding	OTTHUMT00000406421.1	G	NM_181783		87084440	+1	no_errors	NM_181783	genbank	human	validated	54_36p	missense	SNP	0.985	A
FOLH1B	219595	genome.wustl.edu	37	11	89424182	89424182	+	RNA	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr11:89424182G>T	ENST00000532352.1	+	0	1645							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						GATGGTGTTTGAGCTAGCCAA	0.383																																																0			11											46.0	45.0	46.0					11																	89424182		2200	4276	6476	89063830			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89424182G>T			89063830		Nonsense_Mutation	SNP	superfamily_SSF53187,HMMPfam_Peptidase_M28,superfamily_Transferrin_rcpt-like_dimerise,HMMPfam_TFR_dimer	p.E278*	ENST00000532352.1	37	c.832		11																																																																																			-	superfamily_SSF53187,superfamily_Transferrin_rcpt-like_dimerise		0.383	FOLH1B-004	KNOWN	basic	processed_transcript	PSMAL	pseudogene	OTTHUMT00000395421.1	G	NM_153696		89063830	+1	no_errors	NM_153696	genbank	human	predicted	54_36p	nonsense	SNP	0.991	T
CDK20	23552	genome.wustl.edu	37	9	90584801	90584801	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr9:90584801A>C	ENST00000325303.8	-	6	902	c.597T>G	c.(595-597)aaT>aaG	p.N199K	CDK20_ENST00000605159.1_Missense_Mutation_p.N178K|CDK20_ENST00000375883.3_Missense_Mutation_p.N178K|CDK20_ENST00000375871.4_Intron|CDK20_ENST00000336654.5_Missense_Mutation_p.N191K	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20	199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			skin(1)	1						GGGGGGACCCATTCAACAGCT	0.577																																																0			9											88.0	87.0	87.0					9																	90584801		2203	4300	6503	89774621	SO:0001583	missense	23552			AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.597T>G	9.37:g.90584801A>C	ENSP00000322343:p.Asn199Lys		89774621	A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.N199K	ENST00000325303.8	37	c.597	CCDS35060.1	9	.	.	.	.	.	.	.	.	.	.	.	17.62	3.434514	0.62955	.	.	ENSG00000156345	ENST00000375883;ENST00000336654;ENST00000325303;ENST00000286878	T;T;T	0.42513	0.97;0.97;0.97	4.7	-2.79	0.05841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.103760	0.64402	D	0.000006	T	0.37293	0.0998	N	0.25825	0.765	0.80722	D	1	D;P;P	0.56746	0.977;0.943;0.943	P;P;P	0.59761	0.863;0.854;0.775	T	0.28490	-1.0042	10	0.62326	D	0.03	-23.0861	6.3673	0.21461	0.2814:0.1805:0.5381:0.0	.	191;178;199	A2A390;E7EQ88;Q8IZL9	.;.;CDK20_HUMAN	K	178;191;199;178	ENSP00000365043:N178K;ENSP00000338975:N191K;ENSP00000322343:N199K	ENSP00000286878:N178K	N	-	3	2	CDK20	89774621	0.014000	0.17966	0.921000	0.36526	0.995000	0.86356	-0.282000	0.08445	-0.312000	0.08741	0.459000	0.35465	AAT	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.577	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRK	protein_coding	OTTHUMT00000214996.1	A	NM_012119		89774621	-1	no_errors	NM_001039803	genbank	human	reviewed	54_36p	missense	SNP	0.680	C
CCDC88C	440193	genome.wustl.edu	37	14	91782048	91782048	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr14:91782048C>A	ENST00000389857.6	-	14	1697	c.1611G>T	c.(1609-1611)gaG>gaT	p.E537D		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	537					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCTGCTCCTTCTCTCTGATCA	0.532																																																0			14											123.0	133.0	130.0					14																	91782048		2076	4220	6296	90851801	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1611G>T	14.37:g.91782048C>A	ENSP00000374507:p.Glu537Asp		90851801	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	superfamily_Prefoldin	p.E537D	ENST00000389857.6	37	c.1611	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469458	0.63625	.	.	ENSG00000015133	ENST00000389857	T	0.17213	2.29	5.19	5.19	0.71726	.	0.000000	0.49305	U	0.000158	T	0.21590	0.0520	L	0.55213	1.73	0.80722	D	1	B	0.31581	0.329	B	0.40375	0.327	T	0.03221	-1.1059	10	0.49607	T	0.09	-36.0609	8.7187	0.34428	0.151:0.7722:0.0:0.0767	.	537	Q9P219	DAPLE_HUMAN	D	537	ENSP00000374507:E537D	ENSP00000374507:E537D	E	-	3	2	CCDC88C	90851801	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	1.823000	0.39062	2.423000	0.82170	0.563000	0.77884	GAG	-	NULL		0.532	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	protein_coding	OTTHUMT00000411650.1	C	XM_029353		90851801	-1	no_errors	NM_001080414	genbank	human	validated	54_36p	missense	SNP	1.000	A
SLC9B1P2	389000	genome.wustl.edu	37	2	92118423	92118423	+	IGR	SNP	A	A	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:92118423A>G								SLC9B1P2 (16185 upstream) : None (None downstream)																							ACTTGCCTCCATAAGGCATGG	0.383																																																0			2																																								91482150	SO:0001628	intergenic_variant	389000																															2.37:g.92118423A>G			91482150		Missense_Mutation	SNP	HMMPfam_Na_H_Exchanger	p.M192T		37	c.575		2																																																																																			-	HMMPfam_Na_H_Exchanger	0	0.383					LOC389000			A			91482150	-1	pseudogene	XM_371534	genbank	human	model	54_36p	missense	SNP	0.397	G
SYK	6850	genome.wustl.edu	37	9	93639852	93639852	+	Splice_Site	SNP	G	G	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr9:93639852G>C	ENST00000375754.4	+	10	1329		c.e10-1		SYK_ENST00000375747.1_Splice_Site|SYK_ENST00000375751.4_Splice_Site|SYK_ENST00000375746.1_Splice_Site	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase						activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						TTCTCTTGCAGAGTTGTGAAA	0.423			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	0			9											70.0	69.0	69.0					9																	93639852		2203	4300	6503	92679673	SO:0001630	splice_region_variant	6850			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1182-1G>C	9.37:g.93639852G>C			92679673		Splice_Site	SNP	-	e9-1	ENST00000375754.4	37	c.1182-1	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917182	0.33815	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7551	0.91828	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYK	92679673	1.000000	0.71417	0.886000	0.34754	0.112000	0.19704	5.638000	0.67861	2.730000	0.93505	0.655000	0.94253	.	-	-		0.423	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	protein_coding	OTTHUMT00000053018.1	G		Intron	92679673	+1	no_errors	NM_003177	genbank	human	validated	54_36p	splice_site	SNP	0.994	C
CCDC180	100499483	genome.wustl.edu	37	9	100090308	100090308	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr9:100090308A>T	ENST00000357054.1	+	30	3152	c.2217A>T	c.(2215-2217)gaA>gaT	p.E739D	CCDC180_ENST00000375202.2_Missense_Mutation_p.E600D|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.E597D|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.E600D			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	739						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CCAGGTATGAATGTTTTCACA	0.517																																																0			9											213.0	200.0	204.0					9																	100090308		2203	4300	6503	99130129	SO:0001583	missense	57653			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2217A>T	9.37:g.100090308A>T	ENSP00000349562:p.Glu739Asp		99130129	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.E739D	ENST00000357054.1	37	c.2217		9	.	.	.	.	.	.	.	.	.	.	A	14.35	2.508892	0.44660	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	5.18	-6.75	0.01738	.	0.600787	0.16878	N	0.195814	T	0.39306	0.1073	M	0.73598	2.24	0.18873	N	0.999981	P;P;P;P	0.49961	0.93;0.93;0.93;0.93	P;P;P;P	0.52646	0.636;0.705;0.636;0.705	T	0.41016	-0.9532	10	0.40728	T	0.16	-7.1213	14.1771	0.65549	0.7603:0.0:0.2397:0.0	.	597;739;600;739	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	D	739;600;597;623;600	ENSP00000349562:E739D;ENSP00000364348:E600D;ENSP00000414000:E597D;ENSP00000434727:E600D	ENSP00000349562:E739D	E	+	3	2	C9orf174	99130129	0.007000	0.16637	0.001000	0.08648	0.007000	0.05969	-0.217000	0.09253	-1.427000	0.01992	-0.290000	0.09829	GAA	-	NULL		0.517	CCDC180-201	KNOWN	basic	protein_coding	KIAA1529	protein_coding		A	NM_020893		99130129	+1	no_errors	NM_020893	genbank	human	predicted	54_36p	missense	SNP	0.013	T
NOX1	27035	genome.wustl.edu	37	X	100103707	100103707	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:100103707C>T	ENST00000372966.3	-	12	1685	c.1480G>A	c.(1480-1482)Gac>Aac	p.D494N	NOX1_ENST00000372960.4_Missense_Mutation_p.D457N|NOX1_ENST00000217885.5_Missense_Mutation_p.D445N|NOX1_ENST00000372964.1_Intron	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	494	Interaction with NOXO1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						GTCACGATGTCAGTGGCCTTG	0.458																																																0			X											160.0	146.0	151.0					X																	100103707		2203	4300	6503	99990363	SO:0001583	missense	27035			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1480G>A	X.37:g.100103707C>T	ENSP00000362057:p.Asp494Asn		99990363	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	HMMPfam_Ferric_reduct,superfamily_Riboflavin synthase domain-like,HMMPfam_FAD_binding_8,superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain,HMMPfam_NAD_binding_6	p.D494N	ENST00000372966.3	37	c.1480	CCDS14474.1	X	.	.	.	.	.	.	.	.	.	.	c	20.7	4.031209	0.75504	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960	D;D;D	0.97575	-4.44;-4.44;-4.44	4.53	3.66	0.41972	Ferric reductase, NAD binding (1);	0.768539	0.11334	N	0.574683	D	0.98664	0.9552	M	0.93106	3.38	0.53005	D	0.999968	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96893	0.9654	10	0.30854	T	0.27	-9.5133	13.0242	0.58806	0.0:0.8419:0.1581:0.0	.	457;445;494	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	N	494;445;457	ENSP00000362057:D494N;ENSP00000217885:D445N;ENSP00000362051:D457N	ENSP00000217885:D445N	D	-	1	0	NOX1	99990363	0.999000	0.42202	0.999000	0.59377	0.931000	0.56810	4.536000	0.60636	0.896000	0.36366	0.522000	0.50473	GAC	-	superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain,HMMPfam_NAD_binding_6		0.458	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX1	protein_coding	OTTHUMT00000057495.1	C	NM_007052		99990363	-1	no_errors	NM_007052	genbank	human	reviewed	54_36p	missense	SNP	0.796	T
COL11A1	1301	genome.wustl.edu	37	1	103379237	103379237	+	Missense_Mutation	SNP	C	C	A	rs559885800		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:103379237C>A	ENST00000370096.3	-	53	4300	c.3988G>T	c.(3988-3990)Ggt>Tgt	p.G1330C	COL11A1_ENST00000353414.4_Missense_Mutation_p.G1291C|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1342C|COL11A1_ENST00000512756.1_Missense_Mutation_p.G1214C	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1330	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCACCAACACCATCTTGACCC	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		15799	0.0		0.001	False		,,,				2504	0.0															0			1											122.0	121.0	121.0					1																	103379237		2203	4300	6503	103151825	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3988G>T	1.37:g.103379237C>A	ENSP00000359114:p.Gly1330Cys		103151825	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.G1342C	ENST00000370096.3	37	c.4024	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580506	0.65992	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99637	-4.24;-4.24;-6.29;-6.29	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.99834	0.9925	H	0.97611	4.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;0.999	D	0.96824	0.9606	10	0.87932	D	0	.	18.3142	0.90213	0.0:1.0:0.0:0.0	.	1214;1291;1342;1330;550	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	C	1330;1342;1291;550;1214	ENSP00000359114:G1330C;ENSP00000351163:G1342C;ENSP00000302551:G1291C;ENSP00000426533:G1214C	ENSP00000302551:G1291C	G	-	1	0	COL11A1	103151825	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.183000	0.77697	2.569000	0.86673	0.585000	0.79938	GGT	-	NULL		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	C	NM_080630		103151825	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CXorf57	55086	genome.wustl.edu	37	X	105855748	105855748	+	Silent	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:105855748G>T	ENST00000372548.4	+	1	547	c.438G>T	c.(436-438)ggG>ggT	p.G146G	CXorf57_ENST00000372544.2_Silent_p.G146G	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	146							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TAGGCCAGGGGATCCTGTGCA	0.428																																																0			X											110.0	117.0	115.0					X																	105855748		2203	4300	6503	105742404	SO:0001819	synonymous_variant	55086			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.438G>T	X.37:g.105855748G>T			105742404	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Silent	SNP	superfamily_Nucleic acid-binding proteins	p.G146	ENST00000372548.4	37	c.438	CCDS14519.1	X																																																																																			-	NULL		0.428	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	protein_coding	OTTHUMT00000057800.2	G	NM_018015		105742404	+1	no_errors	NM_018015	genbank	human	validated	54_36p	silent	SNP	0.984	T
HECTD4	283450	genome.wustl.edu	37	12	112704779	112704779	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr12:112704779A>C	ENST00000430131.2	-	13	2178	c.1033T>G	c.(1033-1035)Tta>Gta	p.L345V	RN7SKP71_ENST00000364558.1_RNA|HECTD4_ENST00000550722.1_Missense_Mutation_p.L633V|HECTD4_ENST00000377560.5_Missense_Mutation_p.L595V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	345					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AAGATATTTAAACCAGAGCTG	0.274																																																0			12											37.0	37.0	37.0					12																	112704779		2173	4235	6408	111189162	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1033T>G	12.37:g.112704779A>C	ENSP00000404379:p.Leu345Val		111189162	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.L345V	ENST00000430131.2	37	c.1033		12	.	.	.	.	.	.	.	.	.	.	A	12.33	1.904514	0.33628	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000550724	T;T;T	0.60920	0.15;0.17;0.15	6.03	4.89	0.63831	.	0.000000	0.64402	D	0.000002	T	0.52933	0.1765	N	0.08118	0	0.34295	D	0.683713	D;P;D	0.56035	0.974;0.956;0.974	D;D;D	0.70487	0.969;0.931;0.969	T	0.61836	-0.6981	10	0.27082	T	0.32	.	9.8372	0.40977	0.8636:0.0:0.1364:0.0	.	345;345;345	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	V	595;345;633;23	ENSP00000366783:L595V;ENSP00000404379:L345V;ENSP00000449784:L633V	ENSP00000366783:L595V	L	-	1	2	C12orf51	111189162	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.112000	0.64634	1.103000	0.41568	0.533000	0.62120	TTA	-	NULL		0.274	HECTD4-202	KNOWN	basic	protein_coding	C12orf51	protein_coding		A	NM_173813		111189162	-1	no_errors	NM_001109662	genbank	human	validated	54_36p	missense	SNP	1.000	C
CD96	10225	genome.wustl.edu	37	3	111356976	111356976	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr3:111356976G>A	ENST00000283285.5	+	13	1617	c.1486G>A	c.(1486-1488)Gcc>Acc	p.A496T	CD96_ENST00000352690.4_Missense_Mutation_p.A480T	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	496	Pro/Ser/Thr-rich.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						CCCCACAACTGCCAATGGATC	0.378									Opitz Trigonocephaly syndrome																																							0			3											180.0	165.0	170.0					3																	111356976		2203	4300	6503	112839666	SO:0001583	missense	10225	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1486G>A	3.37:g.111356976G>A	ENSP00000283285:p.Ala496Thr		112839666	Q5JPB3	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409	p.A496T	ENST00000283285.5	37	c.1486	CCDS2959.1	3	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402684	0.62288	.	.	ENSG00000153283	ENST00000352690;ENST00000283285	T;T	0.66815	-0.23;-0.23	4.7	2.9	0.33743	.	0.485844	0.21244	N	0.077780	T	0.61664	0.2365	L	0.29908	0.895	0.80722	D	1	D;D;D	0.57257	0.964;0.979;0.964	P;P;P	0.54270	0.563;0.747;0.563	T	0.58747	-0.7582	10	0.46703	T	0.11	-2.1594	7.2337	0.26057	0.2035:0.0:0.7965:0.0	.	479;480;496	E9PEJ1;P40200-2;P40200	.;.;TACT_HUMAN	T	480;496	ENSP00000342040:A480T;ENSP00000283285:A496T	ENSP00000283285:A496T	A	+	1	0	CD96	112839666	0.915000	0.31059	0.995000	0.50966	0.686000	0.39977	1.121000	0.31283	0.697000	0.31718	-0.253000	0.11424	GCC	-	NULL		0.378	CD96-001	KNOWN	basic|CCDS	protein_coding	CD96	protein_coding	OTTHUMT00000354312.2	G			112839666	+1	no_errors	NM_198196	genbank	human	reviewed	54_36p	missense	SNP	0.955	A
AMPD1	270	genome.wustl.edu	37	1	115222923	115222923	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:115222923C>T	ENST00000520113.2	-	6	838	c.823G>A	c.(823-825)Gac>Aac	p.D275N	AMPD1_ENST00000369538.3_Missense_Mutation_p.D271N|AMPD1_ENST00000353928.6_Missense_Mutation_p.D242N			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	275					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TTCATATCGTCTAAGAAGGTG	0.393																																																0			1											184.0	169.0	174.0					1																	115222923		2203	4300	6503	115024446	SO:0001583	missense	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.823G>A	1.37:g.115222923C>T	ENSP00000430075:p.Asp275Asn		115024446	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	superfamily_SSF51556,HMMPfam_A_deaminase,PatternScan_A_DEAMINASE	p.D242N	ENST00000520113.2	37	c.724	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098019	0.76870	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.91180	-2.8;-2.8;-2.8	6.07	6.07	0.98685	.	0.040657	0.85682	D	0.000000	D	0.90508	0.7026	L	0.45228	1.405	0.80722	D	1	D;B	0.71674	0.998;0.04	P;B	0.60415	0.874;0.039	D	0.86103	0.1557	10	0.15499	T	0.54	-26.1184	20.6525	0.99598	0.0:1.0:0.0:0.0	.	271;242	Q5TF02;P23109	.;AMPD1_HUMAN	N	275;271;242	ENSP00000430075:D275N;ENSP00000358551:D271N;ENSP00000316520:D242N	ENSP00000316520:D242N	D	-	1	0	AMPD1	115024446	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.912000	0.69948	2.890000	0.99128	0.585000	0.79938	GAC	-	NULL		0.393	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	protein_coding	OTTHUMT00000032860.4	C			115024446	-1	no_errors	NM_000036	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
QTRTD1	79691	genome.wustl.edu	37	3	113804604	113804604	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr3:113804604G>A	ENST00000493014.1	+	6	851	c.783G>A	c.(781-783)ctG>ctA	p.L261L	QTRTD1_ENST00000281273.4_Silent_p.L367L|QTRTD1_ENST00000479882.1_Silent_p.L244L|QTRTD1_ENST00000485050.1_Silent_p.L379L	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						TCCACCATCTGCTGGTGACCA	0.478																																																0			3											205.0	175.0	185.0					3																	113804604		2203	4300	6503	115287294	SO:0001819	synonymous_variant	79691			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.783G>A	3.37:g.113804604G>A			115287294		Silent	SNP	superfamily_tRNA_ribo_trans,HMMPfam_TGT	p.L367	ENST00000493014.1	37	c.1101	CCDS58845.1	3																																																																																			-	superfamily_tRNA_ribo_trans,HMMPfam_TGT		0.478	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	protein_coding	OTTHUMT00000354711.1	G	NM_024638		115287294	+1	no_errors	NM_024638	genbank	human	provisional	54_36p	silent	SNP	1.000	A
KIAA1210	57481	genome.wustl.edu	37	X	118222061	118222061	+	Silent	SNP	A	A	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:118222061A>T	ENST00000402510.2	-	11	3131	c.3132T>A	c.(3130-3132)acT>acA	p.T1044T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1044										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GTTCCACATAAGTGCCTTCCT	0.522																																																0			X											123.0	124.0	124.0					X																	118222061		2064	4189	6253	118106089	SO:0001819	synonymous_variant	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3132T>A	X.37:g.118222061A>T			118106089	B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.T1044	ENST00000402510.2	37	c.3132	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	A	4.707	0.131532	0.08981	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.54	-9.09	0.00717	.	.	.	.	.	T	0.17109	0.0411	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.12811	-1.0533	4	.	.	.	.	4.3112	0.10971	0.1385:0.5088:0.1503:0.2024	.	.	.	.	I	451	.	.	L	-	1	2	KIAA1210	118106089	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.709000	0.01890	-2.724000	0.00387	-0.369000	0.07265	TTA	-	NULL		0.522	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	A	NM_020721		118106089	-1	no_errors	NM_020721	genbank	human	validated	54_36p	silent	SNP	0.000	T
TBX15	6913	genome.wustl.edu	37	1	119474403	119474403	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:119474403G>A	ENST00000369429.3	-	2	267	c.258C>T	c.(256-258)tcC>tcT	p.S86S	TBX15_ENST00000207157.3_5'UTR			Q96SF7	TBX15_HUMAN	T-box 15	86					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TGAAGGAGCAGGAAGTCCGCT	0.537																																																0			1																																								119275926	SO:0001819	synonymous_variant	6913			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.258C>T	1.37:g.119474403G>A			119275926	Q08E76|Q5JT54|Q5T9S7	Silent	SNP	superfamily_P53_like_DNA_bnd,HMMSmart_TBOX,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.S86	ENST00000369429.3	37	c.258		1																																																																																			-	NULL		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	protein_coding	OTTHUMT00000034351.1	G	NM_152380		119275926	-1	no_errors	ENST00000369429	ensembl	human	known	54_36p	silent	SNP	1.000	A
CNTRL	11064	genome.wustl.edu	37	9	123921148	123921148	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr9:123921148C>G	ENST00000373855.1	+	31	5040	c.4780C>G	c.(4780-4782)Cag>Gag	p.Q1594E	CNTRL_ENST00000373850.1_Missense_Mutation_p.Q1042E|CNTRL_ENST00000238341.5_Missense_Mutation_p.Q1594E|CNTRL_ENST00000373844.1_Missense_Mutation_p.Q39E|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1594					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AAGTCAGCAGCAGGAGATGGC	0.478																																																0			9											129.0	133.0	132.0					9																	123921148		2203	4300	6503	122960969	SO:0001583	missense	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4780C>G	9.37:g.123921148C>G	ENSP00000362962:p.Gln1594Glu		122960969	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00365,HMMPfam_LRR_1,HMMSmart_SM00369,superfamily_Prefoldin,superfamily_tRNA-binding arm	p.Q1594E	ENST00000373855.1	37	c.4780	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306698	0.60305	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000431571;ENST00000373845;ENST00000373844	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.64	4.73	0.59995	.	.	.	.	.	T	0.61261	0.2333	M	0.61703	1.905	0.39578	D	0.969389	D	0.58268	0.982	D	0.67548	0.952	T	0.60193	-0.7311	9	0.08837	T	0.75	.	15.9157	0.79517	0.0:0.8646:0.1354:0.0	.	1594	Q7Z7A1	CNTRL_HUMAN	E	1594;1594;1594;350;1042;263;276;39	ENSP00000362962:Q1594E;ENSP00000238341:Q1594E;ENSP00000362956:Q1042E;ENSP00000413014:Q263E;ENSP00000362950:Q39E	ENSP00000238341:Q1594E	Q	+	1	0	CNTRL	122960969	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	1.511000	0.35801	1.482000	0.48325	0.650000	0.86243	CAG	-	NULL		0.478	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP110	protein_coding	OTTHUMT00000250216.1	C	NM_007018		122960969	+1	no_errors	NM_007018	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PHAX	51808	genome.wustl.edu	37	5	125936697	125936697	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:125936697G>T	ENST00000297540.4	+	1	738	c.43G>T	c.(43-45)Gac>Tac	p.D15Y	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	15	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						GCAGCTTTCCGACTCGGATTC	0.667																																																0			5											52.0	42.0	46.0					5																	125936697		2203	4300	6503	125964596	SO:0001583	missense	51808			AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.43G>T	5.37:g.125936697G>T	ENSP00000297540:p.Asp15Tyr		125964596	Q9H8W1	Missense_Mutation	SNP	HMMPfam_RNA_GG_bind	p.D15Y	ENST00000297540.4	37	c.43	CCDS4138.1	5	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086242	0.76642	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.54279	0.58	4.61	4.61	0.57282	.	0.240141	0.39834	U	0.001260	T	0.49932	0.1586	L	0.55481	1.735	0.52501	D	0.999956	P	0.40398	0.716	B	0.38921	0.285	T	0.58657	-0.7598	10	0.72032	D	0.01	1.1389	14.9347	0.70944	0.0:0.0:1.0:0.0	.	15	Q9H814	PHAX_HUMAN	Y	15	ENSP00000297540:D15Y	ENSP00000297540:D15Y	D	+	1	0	PHAX	125964596	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	5.242000	0.65389	2.076000	0.62316	0.563000	0.77884	GAC	-	NULL		0.667	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHAX	protein_coding	OTTHUMT00000250924.1	G	NM_032177		125964596	+1	no_errors	NM_032177	genbank	human	validated	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	5	125999268	125999268	+	IGR	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:125999268C>T								C5orf48 (27289 upstream) : RP11-434D11.4 (88386 downstream)																							GGGTGGCAAACATCCCATGGT	0.607																																																0			5																																								126027167	SO:0001628	intergenic_variant	644754																															5.37:g.125999268C>T			126027167		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.607					LOC644754			C			126027167	-1	pseudogene	XR_016963	genbank	human	model	54_36p	rna	SNP	0.009	T
TRPC7	57113	genome.wustl.edu	37	5	135601991	135601991	+	Missense_Mutation	SNP	A	A	T	rs373034305		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:135601991A>T	ENST00000513104.1	-	5	1544	c.1262T>A	c.(1261-1263)tTc>tAc	p.F421Y	TRPC7_ENST00000426057.2_Missense_Mutation_p.F305Y|TRPC7_ENST00000355180.3_Missense_Mutation_p.F360Y	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	421					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTAGTCTGTGAAGGTTTCGTT	0.398																																																0			5											239.0	224.0	228.0					5																	135601991		1856	4114	5970	135629890	SO:0001583	missense	57113			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.1262T>A	5.37:g.135601991A>T	ENSP00000426070:p.Phe421Tyr		135629890	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_TRP_2,HMMPfam_Ion_trans	p.F420Y	ENST00000513104.1	37	c.1259	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	A	11.43	1.635335	0.29068	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.78003	-0.96;-1.14;-1.08	5.37	4.15	0.48705	.	0.049940	0.85682	D	0.000000	T	0.56891	0.2016	N	0.24115	0.695	0.31286	N	0.689999	B;B;B;B	0.29909	0.261;0.01;0.006;0.02	B;B;B;B	0.30716	0.119;0.028;0.012;0.024	T	0.55373	-0.8151	10	0.02654	T	1	-10.4086	7.1076	0.25372	0.7964:0.0:0.0717:0.1319	.	305;360;366;421	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	Y	360;305;421;421	ENSP00000347312:F360Y;ENSP00000441628:F305Y;ENSP00000426070:F421Y	ENSP00000265193:F421Y	F	-	2	0	TRPC7	135629890	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.146000	0.58072	2.254000	0.74563	0.460000	0.39030	TTC	-	NULL		0.398	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	protein_coding	OTTHUMT00000366975.1	A	NM_020389		135629890	-1	no_errors	ENST00000265193	ensembl	human	known	54_36p	missense	SNP	1.000	T
BRD8	10902	genome.wustl.edu	37	5	137500568	137500568	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr5:137500568G>A	ENST00000254900.5	-	12	1937	c.1566C>T	c.(1564-1566)gcC>gcT	p.A522A	BRD8_ENST00000515014.1_5'UTR|BRD8_ENST00000455658.2_Silent_p.A481A|BRD8_ENST00000411594.2_Silent_p.A525A|BRD8_ENST00000230901.5_Silent_p.A595A|BRD8_ENST00000402931.1_Silent_p.A522A	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	522					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTACTATTTCGGCTCCTGAAA	0.507																																																0			5											136.0	124.0	128.0					5																	137500568		2203	4300	6503	137528467	SO:0001819	synonymous_variant	10902			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1566C>T	5.37:g.137500568G>A			137528467	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Silent	SNP	superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.A522	ENST00000254900.5	37	c.1566	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	G	3.854	-0.031177	0.07543	.	.	ENSG00000112983	ENST00000441656	.	.	.	5.52	3.08	0.35506	.	.	.	.	.	T	0.58163	0.2103	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51679	-0.8675	4	.	.	.	0.3093	8.6953	0.34291	0.8567:0.0:0.1433:0.0	.	.	.	.	L	516	.	.	P	-	2	0	BRD8	137528467	0.997000	0.39634	0.980000	0.43619	0.873000	0.50193	0.546000	0.23284	0.521000	0.28445	-1.511000	0.00944	CCG	-	NULL		0.507	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	protein_coding	OTTHUMT00000251282.3	G	NM_006696		137528467	-1	no_errors	NM_139199	genbank	human	reviewed	54_36p	silent	SNP	0.972	A
MAGEC1	9947	genome.wustl.edu	37	X	140993493	140993493	+	Silent	SNP	T	T	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chrX:140993493T>C	ENST00000285879.4	+	4	589	c.303T>C	c.(301-303)agT>agC	p.S101S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	101										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					ATTCTCAGAGTTCTCCTGAGG	0.567										HNSCC(15;0.026)																																						0			X																																								140821159	SO:0001819	synonymous_variant	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.303T>C	X.37:g.140993493T>C			140821159	A0PK03|O75451|Q8TCV4	Silent	SNP	HMMPfam_MAGE	p.S101	ENST00000285879.4	37	c.303	CCDS35417.1	X																																																																																			-	NULL		0.567	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	T	NM_005462		140821159	+1	no_errors	NM_005462	genbank	human	reviewed	54_36p	silent	SNP	0.002	C
MROH5	389690	genome.wustl.edu	37	8	142481221	142481221	+	RNA	SNP	C	C	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr8:142481221C>A	ENST00000430863.1	-	0	2020					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		CTGGGTGGCCCTGTCTGGGTC	0.537																																																0			8											118.0	126.0	123.0					8																	142481221		2059	4194	6253	142550403			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142481221C>A			142550403		Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.R647M	ENST00000430863.1	37	c.1940		8																																																																																			-	superfamily_ARM repeat		0.537	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	polymorphic_pseudogene	OTTHUMT00000342412.4	C	NM_207414		142550403	-1	pseudogene	NM_207414	genbank	human	validated	54_36p	missense	SNP	0.044	A
PLEC	5339	genome.wustl.edu	37	8	144991692	144991692	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr8:144991692G>A	ENST00000322810.4	-	32	12877	c.12708C>T	c.(12706-12708)ctC>ctT	p.L4236L	PLEC_ENST00000357649.2_Silent_p.L4103L|PLEC_ENST00000354958.2_Silent_p.L4077L|PLEC_ENST00000345136.3_Silent_p.L4099L|PLEC_ENST00000356346.3_Silent_p.L4085L|PLEC_ENST00000436759.2_Silent_p.L4126L|PLEC_ENST00000398774.2_Silent_p.L4067L|PLEC_ENST00000354589.3_Silent_p.L4099L|PLEC_ENST00000527096.1_Silent_p.L4122L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4236	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCAGGTAGGTGAGGTTCTCCT	0.592																																																0			8											58.0	64.0	62.0					8																	144991692		2100	4220	6320	145063680	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12708C>T	8.37:g.144991692G>A			145063680	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	HMMPfam_S10_plectin,superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,superfamily_Plakin repeat,HMMSmart_SM00250,HMMPfam_Plectin	p.L4236	ENST00000322810.4	37	c.12708	CCDS43772.1	8																																																																																			-	superfamily_Plakin repeat,HMMSmart_SM00250		0.592	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC1	protein_coding	OTTHUMT00000383281.1	G	NM_000445		145063680	-1	no_errors	NM_201380	genbank	human	reviewed	54_36p	silent	SNP	0.908	A
PBXIP1	57326	genome.wustl.edu	37	1	154923989	154923989	+	Silent	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:154923989G>A	ENST00000368463.3	-	4	272	c.201C>T	c.(199-201)agC>agT	p.S67S	PBXIP1_ENST00000368465.1_Silent_p.S38S|PBXIP1_ENST00000542459.1_Intron|PBXIP1_ENST00000539880.1_Intron|PBXIP1_ENST00000368460.3_Silent_p.S67S|PBXIP1_ENST00000498553.1_5'UTR	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	67					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGACTGAGGGCTTTCAGTCT	0.577																																																0			1											90.0	95.0	93.0					1																	154923989		2203	4300	6503	153190613	SO:0001819	synonymous_variant	57326			AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.201C>T	1.37:g.154923989G>A			153190613	Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Silent	SNP	NULL	p.S67	ENST00000368463.3	37	c.201	CCDS1074.1	1																																																																																			-	NULL		0.577	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PBXIP1	protein_coding	OTTHUMT00000090943.1	G	NM_020524		153190613	-1	no_errors	NM_020524	genbank	human	provisional	54_36p	silent	SNP	0.000	A
RABGAP1L	9910	genome.wustl.edu	37	1	174247875	174247875	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:174247875C>G	ENST00000251507.4	+	10	1455	c.1281C>G	c.(1279-1281)agC>agG	p.S427R	RABGAP1L_ENST00000367689.3_Missense_Mutation_p.S74R|RABGAP1L_ENST00000357444.6_Missense_Mutation_p.S390R	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						GGTATTTCAGCAGAAAGACTT	0.418																																																0			1											148.0	151.0	150.0					1																	174247875		2203	4300	6503	172514498	SO:0001583	missense	9910			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1281C>G	1.37:g.174247875C>G	ENSP00000251507:p.Ser427Arg		172514498	B7ZAA4	Missense_Mutation	SNP	superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PID,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164	p.S427R	ENST00000251507.4	37	c.1281	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109219	0.77096	.	.	ENSG00000152061	ENST00000357444;ENST00000367689;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.50548	0.74;3.37;0.77	5.2	2.29	0.28610	.	0.000000	0.85682	D	0.000000	T	0.64527	0.2606	M	0.76328	2.33	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.996;0.986;0.987;0.987;0.997	T	0.67604	-0.5628	10	0.66056	D	0.02	.	10.4621	0.44585	0.0:0.7908:0.0:0.2092	.	439;74;427;427;390	B7WPG6;Q5JZA9;F1LJ00;Q5R372;Q5R372-2	.;.;.;RBG1L_HUMAN;.	R	390;74;427;439;439	ENSP00000350027:S390R;ENSP00000251507:S427R;ENSP00000403136:S439R	ENSP00000251507:S427R	S	+	3	2	RABGAP1L	172514498	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.466000	0.45084	1.205000	0.43262	0.305000	0.20034	AGC	-	NULL		0.418	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	protein_coding	OTTHUMT00000084497.1	C	NM_001243765		172514498	+1	no_errors	NM_014857	genbank	human	validated	54_36p	missense	SNP	1.000	G
NCEH1	57552	genome.wustl.edu	37	3	172365750	172365750	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr3:172365750G>A	ENST00000475381.1	-	2	526	c.293C>T	c.(292-294)cCt>cTt	p.P98L	NCEH1_ENST00000538775.1_Missense_Mutation_p.P130L|NCEH1_ENST00000543711.1_Intron|NCEH1_ENST00000273512.3_Missense_Mutation_p.P130L			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	98					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						GGGCTTCGGAGGGCCTTCAAA	0.527																																																0			3											83.0	75.0	78.0					3																	172365750		2203	4300	6503	173848444	SO:0001583	missense	57552			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.293C>T	3.37:g.172365750G>A	ENSP00000418571:p.Pro98Leu		173848444	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_3,PatternScan_LIPASE_GDXG_SER	p.P130L	ENST00000475381.1	37	c.389		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.411|9.411	1.080401|1.080401	0.20309|0.20309	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000424772|ENST00000475381;ENST00000538775;ENST00000273512	.|T;T;T	.|0.58940	.|0.3;0.3;0.3	5.66|5.66	3.85|3.85	0.44370|0.44370	.|.	.|0.964533	.|0.08683	.|N	.|0.909144	T|T	0.48150|0.48150	0.1484|0.1484	N|N	0.25647|0.25647	0.755|0.755	0.26292|0.26292	N|N	0.978115|0.978115	.|B;B	.|0.09022	.|0.002;0.0	.|B;B	.|0.04013	.|0.001;0.0	T|T	0.43893|0.43893	-0.9363|-0.9363	5|10	.|0.59425	.|D	.|0.04	-0.0037|-0.0037	13.3504|13.3504	0.60599|0.60599	0.1342:0.0:0.8658:0.0|0.1342:0.0:0.8658:0.0	.|.	.|130;98	.|F5H7K4;Q6PIU2	.|.;NCEH1_HUMAN	F|L	121|98;130;130	.|ENSP00000418571:P98L;ENSP00000442464:P130L;ENSP00000273512:P130L	.|ENSP00000273512:P130L	L|P	-|-	1|2	0|0	NCEH1|NCEH1	173848444|173848444	0.279000|0.279000	0.24239|0.24239	0.002000|0.002000	0.10522|0.10522	0.066000|0.066000	0.16364|0.16364	3.708000|3.708000	0.54845|0.54845	1.533000|1.533000	0.49186|0.49186	0.655000|0.655000	0.94253|0.94253	CTC|CCT	-	superfamily_alpha/beta-Hydrolases		0.527	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	AADACL1	protein_coding	OTTHUMT00000346367.3	G	NM_020792		173848444	-1	no_errors	NM_020792	genbank	human	provisional	54_36p	missense	SNP	0.039	A
CHRNA1	1134	genome.wustl.edu	37	2	175618203	175618203	+	Intron	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:175618203C>G	ENST00000261007.5	-	7	920				CHRNA1_ENST00000409542.1_Intron|CHRNA1_ENST00000409323.1_Missense_Mutation_p.C269S|CHRNA1_ENST00000409219.1_Intron|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000348749.5_Intron	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TCAGCGTCAGCAGCAGCAGTC	0.522																																																0			2											168.0	161.0	164.0					2																	175618203		2203	4300	6503	175326449	SO:0001627	intron_variant	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.853+27G>C	2.37:g.175618203C>G			175326449	B4DRV6|D3DPE8	Missense_Mutation	SNP	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.C269S	ENST00000261007.5	37	c.806	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	C	8.153	0.787716	0.16258	.	.	ENSG00000138435	ENST00000409323	T	0.72394	-0.65	4.55	2.53	0.30540	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53711	-0.8400	8	0.87932	D	0	.	6.8882	0.24214	0.3498:0.4799:0.1704:0.0	.	269	G5E9G9	.	S	269	ENSP00000386684:C269S	ENSP00000386684:C269S	C	-	2	0	CHRNA1	175326449	0.001000	0.12720	0.310000	0.25168	0.053000	0.15095	-0.244000	0.08903	1.007000	0.39238	0.557000	0.71058	TGC	-	NULL		0.522	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	protein_coding	OTTHUMT00000334116.1	C			175326449	-1	no_errors	ENST00000409323	ensembl	human	known	54_36p	missense	SNP	0.004	G
TRMT1L	81627	genome.wustl.edu	37	1	185112522	185112522	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:185112522G>C	ENST00000367506.5	-	7	1094	c.826C>G	c.(826-828)Cct>Gct	p.P276A	TRMT1L_ENST00000367504.3_Missense_Mutation_p.P120A	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	276	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						CATTCCAAAGGTTTTCGTTCC	0.358																																																0			1											98.0	106.0	103.0					1																	185112522		2203	4300	6503	183379145	SO:0001583	missense	81627			AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.826C>G	1.37:g.185112522G>C	ENSP00000356476:p.Pro276Ala		183379145	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_TRM	p.P276A	ENST00000367506.5	37	c.826	CCDS1366.1	1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138612	0.56936	.	.	ENSG00000121486	ENST00000367504;ENST00000367506	.	.	.	5.34	5.34	0.76211	.	0.053600	0.85682	D	0.000000	T	0.55609	0.1931	L	0.33339	1.005	0.58432	D	0.999997	P	0.48407	0.91	P	0.49999	0.628	T	0.52087	-0.8622	9	0.32370	T	0.25	-12.9751	14.6251	0.68616	0.0:0.1454:0.8546:0.0	.	276	Q7Z2T5	TRM1L_HUMAN	A	120;276	.	ENSP00000356474:P120A	P	-	1	0	TRMT1L	183379145	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.637000	0.83313	2.495000	0.84180	0.591000	0.81541	CCT	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_TRM		0.358	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf25	protein_coding	OTTHUMT00000085787.1	G	NM_030934		183379145	-1	no_errors	NM_030934	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MUC4	4585	genome.wustl.edu	37	3	195517994	195517994	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr3:195517994C>G	ENST00000463781.3	-	2	916	c.457G>C	c.(457-459)Gag>Cag	p.E153Q	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.E153Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	158					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTTGATGTCTCTTCTGTGTTT	0.468																																																0			3											202.0	174.0	183.0					3																	195517994		1998	4183	6181	197002389	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.457G>C	3.37:g.195517994C>G	ENSP00000417498:p.Glu153Gln		197002389	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	HMMSmart_SM00539,HMMPfam_NIDO,PatternScan_SUGAR_TRANSPORT_2,HMMSmart_SM00723,HMMPfam_AMOP,HMMSmart_SM00216,HMMPfam_VWD,PatternScan_EGF_1,HMMSmart_SM00181,superfamily_EGF/Laminin	p.E153Q	ENST00000463781.3	37	c.457	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	4.484	0.089733	0.08632	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.36878	1.23;1.23	3.56	-0.922	0.10468	.	2.174240	0.02463	N	0.086758	T	0.26629	0.0651	L	0.34521	1.04	0.09310	N	1	B;B	0.22983	0.078;0.021	B;B	0.15484	0.013;0.003	T	0.12993	-1.0526	10	0.14252	T	0.57	0.0158	8.5506	0.33449	0.0:0.2619:0.6303:0.1078	.	153;158	E7ESK3;Q99102	.;MUC4_HUMAN	Q	153;153;127	ENSP00000417498:E153Q;ENSP00000420243:E153Q	ENSP00000376209:E127Q	E	-	1	0	MUC4	197002389	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-2.466000	0.00994	-0.184000	0.10567	-0.358000	0.07595	GAG	-	NULL		0.468	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	C	NM_018406		197002389	-1	no_errors	NM_018406	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
FZD7	8324	genome.wustl.edu	37	2	202900334	202900334	+	Missense_Mutation	SNP	G	G	A	rs201094355		TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:202900334G>A	ENST00000286201.1	+	1	1025	c.964G>A	c.(964-966)Gat>Aat	p.D322N	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	322					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CTTCTCGGACGATGGCTACCG	0.632											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											66.0	65.0	65.0					2																	202900334		2203	4300	6503	202608579	SO:0001583	missense	8324			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.964G>A	2.37:g.202900334G>A	ENSP00000286201:p.Asp322Asn	2133	202608579	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	HMMPfam_Fz,superfamily_Frizzled cysteine-rich domain,HMMSmart_SM00063,HMMPfam_Frizzled	p.D322N	ENST00000286201.1	37	c.964	CCDS2351.1	2	.	.	.	.	.	.	.	.	.	.	G	17.33	3.363215	0.61513	.	.	ENSG00000155760	ENST00000286201	D	0.81821	-1.54	5.54	5.54	0.83059	GPCR, family 2-like (1);	0.165679	0.50627	D	0.000103	T	0.72471	0.3464	N	0.25144	0.715	0.80722	D	1	B	0.15141	0.012	B	0.18561	0.022	T	0.65331	-0.6194	10	0.33141	T	0.24	.	19.4882	0.95039	0.0:0.0:1.0:0.0	.	322	O75084	FZD7_HUMAN	N	322	ENSP00000286201:D322N	ENSP00000286201:D322N	D	+	1	0	FZD7	202608579	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.004000	0.88535	2.618000	0.88619	0.563000	0.77884	GAT	-	HMMPfam_Frizzled		0.632	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD7	protein_coding	OTTHUMT00000256314.1	G	NM_003507		202608579	+1	no_errors	NM_003507	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
USP37	57695	genome.wustl.edu	37	2	219353107	219353107	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr2:219353107C>T	ENST00000258399.3	-	15	1922	c.1510G>A	c.(1510-1512)Gac>Aac	p.D504N	USP37_ENST00000475553.1_5'Flank|USP37_ENST00000454775.1_Missense_Mutation_p.D504N|USP37_ENST00000418019.1_Missense_Mutation_p.D504N|USP37_ENST00000415516.1_Missense_Mutation_p.D432N	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	504	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		ATAGAGAGGTCATTAAACTGT	0.343																																																0			2											117.0	122.0	120.0					2																	219353107		2203	4299	6502	219061351	SO:0001583	missense	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1510G>A	2.37:g.219353107C>T	ENSP00000258399:p.Asp504Asn		219061351	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,HMMSmart_SM00726,HMMPfam_UIM,PatternScan_UCH_2_2	p.D504N	ENST00000258399.3	37	c.1510	CCDS2418.1	2	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674675	0.29693	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.16	4.27	0.50696	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.045401	0.85682	D	0.000000	T	0.60702	0.2289	M	0.63843	1.955	0.80722	D	1	P;D	0.57899	0.946;0.981	P;D	0.63033	0.723;0.91	T	0.58578	-0.7612	10	0.02654	T	1	-13.154	13.4251	0.61020	0.0:0.924:0.0:0.0759	.	432;504	Q86T82-2;Q86T82	.;UBP37_HUMAN	N	504;504;432;504	ENSP00000258399:D504N;ENSP00000393662:D504N;ENSP00000400902:D432N;ENSP00000396585:D504N	ENSP00000258399:D504N	D	-	1	0	USP37	219061351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.989000	0.70587	2.587000	0.87381	0.655000	0.94253	GAC	-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.343	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	protein_coding	OTTHUMT00000256779.3	C	NM_020935		219061351	-1	no_errors	NM_020935	genbank	human	validated	54_36p	missense	SNP	1.000	T
MTR	4548	genome.wustl.edu	37	1	237052521	237052521	+	Silent	SNP	T	T	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:237052521T>C	ENST00000366577.5	+	28	3286	c.2892T>C	c.(2890-2892)taT>taC	p.Y964Y	MTR_ENST00000535889.1_Silent_p.Y913Y	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	964	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TTGAAGACTATGACCTGCAGA	0.517																																																0			1											119.0	109.0	112.0					1																	237052521		2203	4300	6503	235119144	SO:0001819	synonymous_variant	4548			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2892T>C	1.37:g.237052521T>C			235119144	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	superfamily_Homocysteine S-methyltransferase,HMMPfam_S-methyl_trans,HMMPfam_Pterin_bind,superfamily_Dihydropteroate synthetase-like,superfamily_Methionine synthase domain,HMMPfam_B12-binding_2,superfamily_Cobalamin (vitamin B12)-binding domain,HMMPfam_B12-binding,superfamily_Methionine synthase activation domain-like,HMMPfam_Met_synt_B12	p.Y964	ENST00000366577.5	37	c.2892	CCDS1614.1	1																																																																																			-	superfamily_Methionine synthase activation domain-like		0.517	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	protein_coding	OTTHUMT00000096632.2	T	NM_000254		235119144	+1	no_errors	NM_000254	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
MT1HL1	645745	genome.wustl.edu	37	1	237167560	237167560	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2610-02A-01W-1092-09	TCGA-61-2610-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5dfba551-6f51-46e4-826a-c38c2c319fc8	6cc00fb7-0b02-4df3-90f4-eafcd684cba5	g.chr1:237167560G>C	ENST00000464121.2	-	1	158	c.113C>G	c.(112-114)cCc>cGc	p.P38R		NM_001276687.1	NP_001263616.1	P0DM35	M1BL1_HUMAN	metallothionein 1H-like 1	38	Alpha.|Cys-rich.						metal ion binding (GO:0046872)										ACAGCCCAGGGGGCAACAGGA	0.627																																																0			1											33.0	32.0	33.0					1																	237167560		692	1591	2283	235234183	SO:0001583	missense	645745			AF333388	CCDS31068.1	1q43	2013-03-07	2013-03-07	2013-03-07	ENSG00000244020	ENSG00000244020		"""Metallothioneins"""	31864	protein-coding gene	gene with protein product			"""metallothionein 1 pseudogene 2"""	MT1P2			Standard	NM_001276687		Approved		uc001hyk.2	P0DM35	OTTHUMG00000040065	ENST00000464121.2:c.113C>G	1.37:g.237167560G>C	ENSP00000476141:p.Pro38Arg		235234183		Missense_Mutation	SNP	HMMPfam_Metallothio,superfamily_Metallothionein,PatternScan_TNFR_NGFR_1	p.P38R	ENST00000464121.2	37	c.113		1																																																																																			-	HMMPfam_Metallothio,superfamily_Metallothionein,PatternScan_TNFR_NGFR_1		0.627	MT1HL1-001	KNOWN	basic|appris_principal	protein_coding	MT1P2	protein_coding	OTTHUMT00000096642.4	G	NM_001039954		235234183	-1	no_errors	ENST00000294916	ensembl	human	known	54_36p	missense	SNP	0.582	C
