#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLX4	84464	genome.wustl.edu	37	16	3656526	3656526	+	Missense_Mutation	SNP	G	G	A	rs199912910	byFrequency	TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr16:3656526G>A	ENST00000294008.3	-	3	1349	c.709C>T	c.(709-711)Cgg>Tgg	p.R237W		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	237	Interaction with SLX4IP, ERCC4 and MSH2.		R -> Q (in dbSNP:rs138615800). {ECO:0000269|PubMed:22911665}.		DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TTTTCTTCCCGCGCAGCCTCG	0.512								Direct reversal of damage					G|||	3	0.000599042	0.0	0.0	5008	,	,		19199	0.002		0.0	False		,,,				2504	0.001															0			16											228.0	224.0	225.0					16																	3656526		2197	4300	6497	3596527	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.709C>T	16.37:g.3656526G>A	ENSP00000294008:p.Arg237Trp		3596527	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.R237W	ENST00000294008.3	37	c.709	CCDS10506.2	16	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	11.34	1.610408	0.28712	.	.	ENSG00000188827	ENST00000294008	T	0.01126	5.3	5.16	-3.39	0.04868	.	2.253860	0.01848	N	0.035730	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	P	0.36616	0.561	B	0.19148	0.024	T	0.44590	-0.9318	10	0.59425	D	0.04	.	2.7089	0.05169	0.214:0.4239:0.2131:0.149	.	237	Q8IY92	SLX4_HUMAN	W	237	ENSP00000294008:R237W	ENSP00000294008:R237W	R	-	1	2	SLX4	3596527	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.870000	0.04228	-0.341000	0.08376	-0.345000	0.07892	CGG	-	NULL		0.512	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	G	NM_032444		3596527	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	missense	SNP	0.000	A
KIAA2026	158358	genome.wustl.edu	37	9	5921844	5921844	+	Missense_Mutation	SNP	G	G	T	rs117286418	byFrequency	TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr9:5921844G>T	ENST00000399933.3	-	8	4151	c.4152C>A	c.(4150-4152)caC>caA	p.H1384Q	KIAA2026_ENST00000381461.2_Missense_Mutation_p.H1354Q	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1384	Ser-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TATCTATCACGTGGCCCAAAT	0.443													G|||	167	0.0333466	0.0053	0.0461	5008	,	,		21842	0.001		0.0974	False		,,,				2504	0.0297															0			9						G	GLN/HIS	78,3690		0,78,1806	156.0	150.0	152.0		4152	-0.7	0.5	9	dbSNP_132	152	936,7296		52,832,3232	yes	missense	KIAA2026	NM_001017969.2	24	52,910,5038	TT,TG,GG		11.3703,2.0701,8.45	benign	1384/2104	5921844	1014,10986	1884	4116	6000	5911844	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4152C>A	9.37:g.5921844G>T	ENSP00000382815:p.His1384Gln		5911844	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.H1384Q	ENST00000399933.3	37	c.4152		9	115	0.052655677655677656	4	0.008130081300813009	23	0.06353591160220995	1	0.0017482517482517483	87	0.11477572559366754	G	0.015	-1.559182	0.00910	0.020701	0.113703	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.08	-0.703	0.11261	.	0.243817	0.28612	N	0.014739	T	0.00241	0.0007	N	0.14661	0.345	0.58432	P	1.999999999946489E-6	B	0.10296	0.003	B	0.06405	0.002	T	0.12192	-1.0557	8	0.06494	T	0.89	-3.0597	0.5155	0.00602	0.353:0.123:0.2814:0.2426	.	1384	Q5HYC2	K2026_HUMAN	Q	1384;1354	.	ENSP00000370870:H1354Q	H	-	3	2	KIAA2026	5911844	0.955000	0.32602	0.463000	0.27130	0.627000	0.37826	0.235000	0.17948	0.026000	0.15269	0.484000	0.47621	CAC	-	NULL		0.443	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	protein_coding	OTTHUMT00000051652.2	G	NM_001017969		5911844	-1	no_errors	NM_001017969	genbank	human	validated	54_36p	missense	SNP	0.073	T
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000455263.2_Missense_Mutation_p.C275Y|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y|TP53_ENST00000420246.2_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	17	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	7517839	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr		7517839	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C275Y	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517839	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CD163	9332	genome.wustl.edu	37	12	7640434	7640434	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr12:7640434C>T	ENST00000359156.4	-	7	1872	c.1670G>A	c.(1669-1671)tGc>tAc	p.C557Y	CD163_ENST00000432237.2_Missense_Mutation_p.C557Y|CD163_ENST00000541972.1_Missense_Mutation_p.C545Y|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000396620.3_Missense_Mutation_p.C557Y	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	557	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TGCTACTGGGCAGAGTGAAAG	0.502																																																0			12											102.0	96.0	98.0					12																	7640434		2203	4300	6503	7531701	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1670G>A	12.37:g.7640434C>T	ENSP00000352071:p.Cys557Tyr		7531701	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1	p.C557Y	ENST00000359156.4	37	c.1670	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704928	0.68615	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.33	5.33	0.75918	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	D	0.98485	0.9495	H	0.98446	4.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.99568	1.0970	10	0.87932	D	0	.	16.8765	0.86053	0.0:1.0:0.0:0.0	.	557;557;557	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	Y	557;545;557;557	ENSP00000352071:C557Y;ENSP00000444071:C545Y;ENSP00000379863:C557Y;ENSP00000403885:C557Y	ENSP00000352071:C557Y	C	-	2	0	CD163	7531701	1.000000	0.71417	0.978000	0.43139	0.644000	0.38419	7.239000	0.78182	2.663000	0.90544	0.655000	0.94253	TGC	-	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR		0.502	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	protein_coding	OTTHUMT00000399396.2	C	NM_004244, NM_203416		7531701	-1	no_errors	NM_004244	genbank	human	validated	54_36p	missense	SNP	0.989	T
MAP2K4	6416	genome.wustl.edu	37	17	12016610	12016610	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr17:12016610G>T	ENST00000353533.5	+	7	809	c.746G>T	c.(745-747)gGc>gTc	p.G249V	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Missense_Mutation_p.G260V	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TGTGACTTCGGCATCAGTGGA	0.418			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	17											103.0	101.0	102.0					17																	12016610		2203	4300	6503	11957335	SO:0001583	missense	6416			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.746G>T	17.37:g.12016610G>T	ENSP00000262445:p.Gly249Val		11957335	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.G249V	ENST00000353533.5	37	c.746	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474121	0.84640	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	D;D	0.89415	-2.51;-2.51	4.41	4.41	0.53225	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.058144	0.64402	D	0.000001	D	0.96632	0.8901	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98223	1.0479	10	0.87932	D	0	.	15.9715	0.80025	0.0:0.0:1.0:0.0	.	121;260;249	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	V	249;260;226;121	ENSP00000262445:G249V;ENSP00000410402:G260V	ENSP00000262445:G249V	G	+	2	0	MAP2K4	11957335	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.657000	0.98554	2.297000	0.77311	0.591000	0.81541	GGC	-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.418	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	protein_coding	OTTHUMT00000441226.1	G			11957335	+1	no_errors	NM_003010	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GPRC5A	9052	genome.wustl.edu	37	12	13061825	13061825	+	Silent	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr12:13061825C>T	ENST00000014914.5	+	2	1532	c.642C>T	c.(640-642)taC>taT	p.Y214Y	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	214					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	CCCACATCTACCTCACGATGC	0.572																																																0			12											216.0	190.0	199.0					12																	13061825		2203	4300	6503	12953092	SO:0001819	synonymous_variant	9052			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.642C>T	12.37:g.13061825C>T			12953092	B3KV45|O95357	Silent	SNP	HMMPfam_7tm_3	p.Y214	ENST00000014914.5	37	c.642	CCDS8657.1	12																																																																																			-	HMMPfam_7tm_3		0.572	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5A	protein_coding	OTTHUMT00000400682.1	C			12953092	+1	no_errors	NM_003979	genbank	human	reviewed	54_36p	silent	SNP	0.058	T
DDA1	79016	genome.wustl.edu	37	19	17425149	17425149	+	Silent	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr19:17425149C>T	ENST00000359866.4	+	3	211	c.87C>T	c.(85-87)aaC>aaT	p.N29N		NM_024050.5	NP_076955.1	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1	29										kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4						TCCTGCAGAACCGACGGCCCT	0.612																																																0			19											112.0	84.0	94.0					19																	17425149		2203	4300	6503	17286149	SO:0001819	synonymous_variant	79016			BC000615	CCDS12357.1	19p13.11	2008-02-05	2007-10-25	2007-10-25		ENSG00000130311			28360	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 58"""	C19orf58		17452440	Standard	NM_024050		Approved	PCIA1, MGC2594	uc002ngd.3	Q9BW61		ENST00000359866.4:c.87C>T	19.37:g.17425149C>T			17286149		Silent	SNP	HMMPfam_DDA1	p.N29	ENST00000359866.4	37	c.87	CCDS12357.1	19																																																																																			-	HMMPfam_DDA1		0.612	DDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDA1	protein_coding	OTTHUMT00000463519.1	C	NM_024050		17286149	+1	no_errors	NM_024050	genbank	human	validated	54_36p	silent	SNP	1.000	T
AC023490.2	0	genome.wustl.edu	37	22	20377320	20377320	+	lincRNA	SNP	A	A	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr22:20377320A>G	ENST00000426653.1	+	0	0				AC023490.1_ENST00000438669.1_lincRNA																							ACTTAAAAGGACGAGTTTACC	0.433																																																0			22																																								18757320			0																															22.37:g.20377320A>G			18757320		Missense_Mutation	SNP	NULL	p.T100A	ENST00000426653.1	37	c.298		22																																																																																			-	NULL		0.433	AC023490.2-001	KNOWN	basic|exp_conf	lincRNA	LOC100129389	lincRNA	OTTHUMT00000322210.1	A			18757320	+1	no_errors	XM_001726515	genbank	human	model	54_36p	missense	SNP	0.000	G
MKRN3	7681	genome.wustl.edu	37	15	23812335	23812335	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr15:23812335G>A	ENST00000314520.3	+	1	1882	c.1406G>A	c.(1405-1407)cGg>cAg	p.R469Q	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568945.1_Intron|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	469					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R469Q(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GTCGTGCTTCGGCTGGCCAGT	0.483																																																1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	15											146.0	133.0	137.0					15																	23812335		2203	4300	6503	21363428	SO:0001583	missense	7681			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.1406G>A	15.37:g.23812335G>A	ENSP00000313881:p.Arg469Gln		21363428		Missense_Mutation	SNP	HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.R469Q	ENST00000314520.3	37	c.1406	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	g	2.152	-0.394178	0.04899	.	.	ENSG00000179455	ENST00000314520	T	0.29917	1.55	4.09	-2.57	0.06248	.	0.797649	0.10922	N	0.619355	T	0.13286	0.0322	N	0.12182	0.205	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.18808	-1.0325	10	0.38643	T	0.18	.	4.391	0.11341	0.4995:0.0:0.339:0.1615	.	469	Q13064	MKRN3_HUMAN	Q	469	ENSP00000313881:R469Q	ENSP00000313881:R469Q	R	+	2	0	MKRN3	21363428	1.000000	0.71417	0.000000	0.03702	0.005000	0.04900	1.623000	0.37008	-0.503000	0.06586	-0.970000	0.02610	CGG	-	NULL		0.483	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	protein_coding	OTTHUMT00000251225.1	G	NM_005664		21363428	+1	no_errors	NM_005664	genbank	human	reviewed	54_36p	missense	SNP	0.991	A
SPATA13	221178	genome.wustl.edu	37	13	24696112	24696112	+	Intron	SNP	T	T	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr13:24696112T>A	ENST00000382141.4	+	4	467				SPATA13_ENST00000424834.2_Intron																							ATCATTAGTTTAGAGTAGATA	0.438																																																0			13																																								23594112	SO:0001627	intron_variant	0																														ENST00000382141.4:c.-111-100845T>A	13.37:g.24696112T>A			23594112		RNA	SNP	-	NULL	ENST00000382141.4	37	NULL		13																																																																																			-	-		0.438	RP11-307N16.6-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	LOC100128337	protein_coding	OTTHUMT00000472022.1	T			23594112	-1	pseudogene	XR_037222	genbank	human	model	54_36p	rna	SNP	1.000	A
TM9SF1	10548	genome.wustl.edu	37	14	24659667	24659667	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr14:24659667T>C	ENST00000261789.4	-	5	1704	c.1346A>G	c.(1345-1347)aAc>aGc	p.N449S	TM9SF1_ENST00000528669.1_Missense_Mutation_p.N449S|IPO4_ENST00000354464.6_5'Flank|TM9SF1_ENST00000396854.4_Missense_Mutation_p.N449S|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000524835.1_Missense_Mutation_p.N362S|TM9SF1_ENST00000556387.1_Missense_Mutation_p.N658S|TM9SF1_ENST00000530611.1_Missense_Mutation_p.N658S	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	449					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		CCGGGCGATGTTCTTGGTGCG	0.552																																																0			14											144.0	118.0	127.0					14																	24659667		2203	4300	6503	23729507	SO:0001583	missense	10548			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1346A>G	14.37:g.24659667T>C	ENSP00000261789:p.Asn449Ser		23729507	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	HMMPfam_EMP70	p.N449S	ENST00000261789.4	37	c.1346	CCDS9617.1	14	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189012	0.78789	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000396854;ENST00000530611	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.38719	0.1051	L	0.28649	0.875	0.58432	D	0.999999	B;B	0.32968	0.392;0.078	B;B	0.41174	0.349;0.089	T	0.36768	-0.9734	10	0.56958	D	0.05	-12.7233	12.701	0.57032	0.0:0.0:0.0:1.0	.	449;449	Q86SZ6;O15321	.;TM9S1_HUMAN	S	449;449;658;362;449;658	ENSP00000261789:N449S;ENSP00000432997:N449S;ENSP00000451949:N658S;ENSP00000434387:N362S;ENSP00000380063:N449S;ENSP00000433967:N658S	ENSP00000433967:N658S	N	-	2	0	TM9SF1;RP11-468E2.1	23729507	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.761000	0.74945	1.879000	0.54435	0.533000	0.62120	AAC	-	HMMPfam_EMP70		0.552	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	protein_coding	OTTHUMT00000073136.2	T	NM_006405		23729507	-1	no_errors	NM_006405	genbank	human	validated	54_36p	missense	SNP	1.000	C
PITHD1	57095	genome.wustl.edu	37	1	24113792	24113792	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:24113792A>C	ENST00000246151.4	+	6	673	c.562A>C	c.(562-564)Aat>Cat	p.N188H	PITHD1_ENST00000374524.1_Missense_Mutation_p.N75H	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	188	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						GACCATCTGCAATTACGAAGC	0.527																																																0			1											95.0	85.0	89.0					1																	24113792		2203	4300	6503	23986379	SO:0001583	missense	57095				CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.562A>C	1.37:g.24113792A>C	ENSP00000246151:p.Asn188His		23986379	B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Missense_Mutation	SNP	HMMPfam_DUF1000	p.N188H	ENST00000246151.4	37	c.562	CCDS240.1	1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.576049	0.86645	.	.	ENSG00000057757	ENST00000246151;ENST00000374524	.	.	.	5.88	5.88	0.94601	Proteasome-interacting thioredoxin-like domain, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.71206	2.165	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	T	0.76836	-0.2812	9	0.41790	T	0.15	-6.319	16.2997	0.82804	1.0:0.0:0.0:0.0	.	188	Q9GZP4	PITH1_HUMAN	H	188;75	.	ENSP00000246151:N188H	N	+	1	0	PITHD1	23986379	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.126000	0.94411	2.250000	0.74265	0.528000	0.53228	AAT	-	NULL		0.527	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf128	protein_coding	OTTHUMT00000008243.1	A	NM_020362		23986379	+1	no_errors	NM_020362	genbank	human	validated	54_36p	missense	SNP	1.000	C
TMEM57	55219	genome.wustl.edu	37	1	25773274	25773274	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:25773274C>A	ENST00000374343.4	+	2	281	c.102C>A	c.(100-102)ttC>ttA	p.F34L	TMEM57_ENST00000399766.3_Missense_Mutation_p.F34L|TMEM57_ENST00000399763.3_Intron	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	34					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTGAAATTCCTGGTGGTGT	0.343																																																0			1											87.0	82.0	84.0					1																	25773274		2203	4300	6503	25645861	SO:0001583	missense	55219			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.102C>A	1.37:g.25773274C>A	ENSP00000363463:p.Phe34Leu		25645861	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	HMMPfam_Macoilin,superfamily_Prefoldin	p.F34L	ENST00000374343.4	37	c.102	CCDS30638.1	1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.576922	0.65878	.	.	ENSG00000204178	ENST00000399766;ENST00000374343	D	0.83506	-1.73	5.87	2.83	0.33086	.	0.000000	0.85682	D	0.000000	D	0.88032	0.6328	M	0.67953	2.075	0.80722	D	1	P;B	0.52577	0.954;0.246	D;B	0.66351	0.943;0.262	D	0.86825	0.2007	10	0.72032	D	0.01	-12.6148	10.3163	0.43738	0.0:0.7848:0.0:0.2152	.	34;34	Q8N5G2-3;Q8N5G2	.;MACOI_HUMAN	L	34	ENSP00000382668:F34L	ENSP00000363463:F34L	F	+	3	2	TMEM57	25645861	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.742000	0.55097	0.400000	0.25396	0.655000	0.94253	TTC	-	HMMPfam_Macoilin		0.343	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	protein_coding	OTTHUMT00000009659.2	C	NM_018202		25645861	+1	no_errors	NM_018202	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZBED9	114821	genome.wustl.edu	37	6	28542983	28542983	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr6:28542983C>G	ENST00000452236.2	-	3	2116	c.1499G>C	c.(1498-1500)tGg>tCg	p.W500S	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTGAATGAACCACAAAAATTC	0.438																																																0			6											131.0	130.0	130.0					6																	28542983		2203	4300	6503	28650962	SO:0001583	missense	114821																														ENST00000452236.2:c.1499G>C	6.37:g.28542983C>G	ENSP00000395259:p.Trp500Ser		28650962		Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_RNaseH_fold,HMMPfam_rve,HMMPfam_hATC	p.W500S	ENST00000452236.2	37	c.1499	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390209	0.42410	.	.	ENSG00000232040	ENST00000452236	T	0.39406	1.08	3.28	3.28	0.37604	Integrase, catalytic core (1);Ribonuclease H-like (1);	.	.	.	.	T	0.39036	0.1063	L	0.36672	1.1	0.45056	D	0.998079	D	0.64830	0.994	D	0.76071	0.987	T	0.14420	-1.0473	9	0.36615	T	0.2	.	10.2107	0.43138	0.0:1.0:0.0:0.0	.	500	Q6R2W3	SCND3_HUMAN	S	500	ENSP00000395259:W500S	ENSP00000395259:W500S	W	-	2	0	SCAND3	28650962	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	1.675000	0.37555	1.841000	0.53522	0.462000	0.41574	TGG	-	superfamily_RNaseH_fold,HMMPfam_rve		0.438	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	C			28650962	-1	no_errors	NM_052923	genbank	human	provisional	54_36p	missense	SNP	0.590	G
GHRHR	2692	genome.wustl.edu	37	7	31016901	31016901	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr7:31016901C>A	ENST00000326139.2	+	12	1156	c.1110C>A	c.(1108-1110)ttC>ttA	p.F370L	GHRHR_ENST00000409316.1_Missense_Mutation_p.H137N|GHRHR_ENST00000461424.1_Intron|GHRHR_ENST00000409904.3_Missense_Mutation_p.F306L	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	370					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	CACAGGGCTTCATTGTTGCCA	0.542																																																0			7											219.0	192.0	201.0					7																	31016901		2203	4300	6503	30983426	SO:0001583	missense	2692				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.1110C>A	7.37:g.31016901C>A	ENSP00000320180:p.Phe370Leu		30983426	Q99863	Missense_Mutation	SNP	superfamily_SSF111418,HMMSmart_HormR,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1,superfamily_SSF81321,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.F370L	ENST00000326139.2	37	c.1110	CCDS5432.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	6.787|6.787	0.514227|0.514227	0.12944|0.12944	.|.	.|.	ENSG00000106128|ENSG00000106128	ENST00000326139;ENST00000409904|ENST00000409233;ENST00000409316	T;T|.	0.47177|.	0.85;0.85|.	5.25|5.25	3.43|3.43	0.39272|0.39272	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);|.	.|.	.|.	.|.	.|.	T|T	0.28499|0.28499	0.0705|0.0705	N|N	0.05574|0.05574	-0.02|-0.02	0.80722|0.80722	D|D	1|1	B;B|P	0.23316|0.37276	0.083;0.083|0.589	B;B|B	0.28916|0.39027	0.096;0.036|0.288	T|T	0.12243|0.12243	-1.0555|-1.0555	9|8	0.32370|0.87932	T|D	0.25|0	.|.	8.4542|8.4542	0.32888|0.32888	0.0:0.8214:0.0:0.1786|0.0:0.8214:0.0:0.1786	.|.	306;370|137	Q9HB45;Q02643|Q9HB43	.;GHRHR_HUMAN|.	L|N	370;306|158;137	ENSP00000320180:F370L;ENSP00000387113:F306L|.	ENSP00000320180:F370L|ENSP00000386919:H158N	F|H	+|+	3|1	2|0	GHRHR|GHRHR	30983426|30983426	0.854000|0.854000	0.29725|0.29725	0.918000|0.918000	0.36340|0.36340	0.270000|0.270000	0.26580|0.26580	0.450000|0.450000	0.21762|0.21762	0.601000|0.601000	0.29879|0.29879	0.645000|0.645000	0.84053|0.84053	TTC|CAT	-	superfamily_SSF81321,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2		0.542	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	protein_coding	OTTHUMT00000327967.2	C			30983426	+1	no_errors	NM_000823	genbank	human	reviewed	54_36p	missense	SNP	0.249	A
SLC26A8	116369	genome.wustl.edu	37	6	35927255	35927255	+	Silent	SNP	A	A	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr6:35927255A>G	ENST00000490799.1	-	16	2198	c.1845T>C	c.(1843-1845)gaT>gaC	p.D615D	SLC26A8_ENST00000355574.2_Silent_p.D615D|SLC26A8_ENST00000394602.2_Silent_p.D510D	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						GCGGCTCCAGATCATCACAGT	0.358																																																0			6											79.0	84.0	82.0					6																	35927255		2201	4300	6501	36035233	SO:0001819	synonymous_variant	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.1845T>C	6.37:g.35927255A>G			36035233		Silent	SNP	HMMPfam_Sulfate_transp,HMMPfam_STAS,superfamily_Anti-sigma factor antagonist SpoIIaa	p.D615	ENST00000490799.1	37	c.1845	CCDS4813.1	6																																																																																			-	HMMPfam_STAS,superfamily_Anti-sigma factor antagonist SpoIIaa		0.358	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A8	protein_coding	OTTHUMT00000040325.2	A			36035233	-1	no_errors	NM_052961	genbank	human	reviewed	54_36p	silent	SNP	0.081	G
EIF3L	51386	genome.wustl.edu	37	22	38271924	38271924	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr22:38271924G>A	ENST00000412331.2	+	10	1565	c.983G>A	c.(982-984)cGt>cAt	p.R328H	EIF3L_ENST00000381683.6_Missense_Mutation_p.R280H|EIF3L_ENST00000406934.1_Missense_Mutation_p.R230H	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ATGATGCGTCGTTACCAGGAT	0.483																																																0			22											198.0	177.0	184.0					22																	38271924		2203	4300	6503	36601870	SO:0001583	missense	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.983G>A	22.37:g.38271924G>A	ENSP00000416892:p.Arg328His		36601870		Missense_Mutation	SNP	HMMPfam_Paf67	p.R328H	ENST00000412331.2	37	c.983	CCDS13960.1	22	.	.	.	.	.	.	.	.	.	.	G	32	5.150497	0.94645	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.61040	0.14;0.14;0.14	4.75	4.75	0.60458	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.81908	0.4922	M	0.92691	3.335	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.976;0.97;0.991;0.995	D	0.87118	0.2189	10	0.87932	D	0	-9.8273	18.1352	0.89617	0.0:0.0:1.0:0.0	.	280;230;328;371	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	H	328;371;280;295;230	ENSP00000416892:R328H;ENSP00000371099:R280H;ENSP00000384634:R230H	ENSP00000262832:R295H	R	+	2	0	EIF3L	36601870	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	9.757000	0.98924	2.345000	0.79718	0.462000	0.41574	CGT	-	HMMPfam_Paf67		0.483	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3L	protein_coding	OTTHUMT00000319551.2	G	NM_016091		36601870	+1	no_errors	NM_016091	genbank	human	validated	54_36p	missense	SNP	1.000	A
CLEC14A	161198	genome.wustl.edu	37	14	38723818	38723818	+	Silent	SNP	A	A	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr14:38723818A>G	ENST00000342213.2	-	1	1756	c.1410T>C	c.(1408-1410)gaT>gaC	p.D470D		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	470						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TGTCCCGCAGATCACAGTCCC	0.587																																																0			14											76.0	78.0	77.0					14																	38723818		2203	4300	6503	37793569	SO:0001819	synonymous_variant	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1410T>C	14.37:g.38723818A>G			37793569	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	PatternScan_EGF_1,PatternScan_C_TYPE_LECTIN_1,HMMSmart_CLECT,superfamily_C-type_lectin_fold,HMMSmart_EGF,superfamily_SSF57196,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.D470	ENST00000342213.2	37	c.1410	CCDS9667.1	14																																																																																			-	NULL		0.587	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	protein_coding	OTTHUMT00000276729.1	A	NM_175060		37793569	-1	no_errors	NM_175060	genbank	human	provisional	54_36p	silent	SNP	0.606	G
KLB	152831	genome.wustl.edu	37	4	39439523	39439523	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr4:39439523G>T	ENST00000257408.4	+	3	1610	c.1513G>T	c.(1513-1515)Gaa>Taa	p.E505*		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	505	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GATCATACGAGAAAATGGTTT	0.428																																																0			4											114.0	106.0	109.0					4																	39439523		2203	4300	6503	39115918	SO:0001587	stop_gained	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1513G>T	4.37:g.39439523G>T	ENSP00000257408:p.Glu505*		39115918	Q2M3K8	Nonsense_Mutation	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1,PatternScan_GLYCOSYL_HYDROL_F1_2,HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat	p.E505*	ENST00000257408.4	37	c.1513	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.387208	0.97524	.	.	ENSG00000134962	ENST00000257408	.	.	.	6.03	6.03	0.97812	.	0.374480	0.32343	N	0.006235	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-12.1761	15.973	0.80034	0.0:0.1339:0.8661:0.0	.	.	.	.	X	505	.	ENSP00000257408:E505X	E	+	1	0	KLB	39115918	0.998000	0.40836	0.995000	0.50966	0.778000	0.44026	2.741000	0.47426	2.861000	0.98227	0.655000	0.94253	GAA	-	HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat		0.428	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	protein_coding	OTTHUMT00000250429.1	G	NM_175737		39115918	+1	no_errors	NM_175737	genbank	human	validated	54_36p	nonsense	SNP	0.581	T
LCA5L	150082	genome.wustl.edu	37	21	40777845	40777845	+	Missense_Mutation	SNP	G	G	A	rs201718230		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr21:40777845G>A	ENST00000358268.2	-	10	2504	c.1976C>T	c.(1975-1977)tCg>tTg	p.S659L	WRB_ENST00000541890.1_Intron|LCA5L_ENST00000288350.3_Missense_Mutation_p.S659L|LCA5L_ENST00000380671.2_Missense_Mutation_p.S659L|LCA5L_ENST00000495240.1_5'Flank			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	659										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				TGTAGGTGACGATGGCTTAAT	0.393													G|||	1	0.000199681	0.0	0.0	5008	,	,		17383	0.001		0.0	False		,,,				2504	0.0															0			21											62.0	65.0	64.0					21																	40777845		2203	4300	6503	39699715	SO:0001583	missense	150082			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1976C>T	21.37:g.40777845G>A	ENSP00000351008:p.Ser659Leu		39699715	D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.S659L	ENST00000358268.2	37	c.1976	CCDS13665.1	21	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	G|G	13.73|13.73	2.324790|2.324790	0.41197|0.41197	.|.	.|.	ENSG00000182093|ENSG00000157578	ENST00000415847|ENST00000288350;ENST00000380671;ENST00000358268	.|T;T;T	.|0.60920	.|0.15;0.15;0.15	4.98|4.98	4.04|4.04	0.47022|0.47022	.|.	.|0.429770	.|0.19820	.|N	.|0.105337	T|T	0.54902|0.54902	0.1887|0.1887	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	.|D	.|0.63880	.|0.993	.|P	.|0.45829	.|0.494	T|T	0.54899|0.54899	-0.8224|-0.8224	6|10	0.87932|0.62326	D|D	0|0.03	-0.9416|-0.9416	11.2026|11.2026	0.48749|0.48749	0.0:0.0:0.8174:0.1826|0.0:0.0:0.8174:0.1826	.|.	.|659	.|O95447	.|LCA5L_HUMAN	N|L	22|659	.|ENSP00000288350:S659L;ENSP00000370046:S659L;ENSP00000351008:S659L	ENSP00000410228:D22N|ENSP00000288350:S659L	D|S	+|-	1|2	0|0	WRB|LCA5L	39699715|39699715	0.960000|0.960000	0.32886|0.32886	0.102000|0.102000	0.21198|0.21198	0.771000|0.771000	0.43674|0.43674	3.045000|3.045000	0.49838|0.49838	2.465000|2.465000	0.83290|0.83290	0.655000|0.655000	0.94253|0.94253	GAT|TCG	-	NULL		0.393	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	protein_coding	OTTHUMT00000141807.2	G	NM_152505		39699715	-1	no_errors	NM_152505	genbank	human	validated	54_36p	missense	SNP	0.230	A
TP53TG5	27296	genome.wustl.edu	37	20	44006229	44006229	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr20:44006229C>A	ENST00000372726.3	-	2	229	c.73G>T	c.(73-75)Gag>Tag	p.E25*	TP53TG5_ENST00000537995.1_Nonsense_Mutation_p.E9*|SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000494455.1_5'UTR|SYS1-DBNDD2_ENST00000475242.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	25					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						TGCTCTGTCTCGTCCCGCAGT	0.527																																																0			20											80.0	67.0	71.0					20																	44006229		2203	4300	6503	43439643	SO:0001587	stop_gained	27296			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.73G>T	20.37:g.44006229C>A	ENSP00000361811:p.Glu25*		43439643		Nonsense_Mutation	SNP	NULL	p.E25*	ENST00000372726.3	37	c.73	CCDS13352.1	20	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478908	0.44044	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	.	.	.	4.18	3.08	0.35506	.	0.286994	0.29752	N	0.011292	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4382	6.4046	0.21658	0.0:0.1098:0.0:0.8902	.	.	.	.	X	25;9	.	ENSP00000361811:E25X	E	-	1	0	TP53TG5	43439643	0.579000	0.26725	0.985000	0.45067	0.033000	0.12548	1.019000	0.30014	0.967000	0.38186	-0.238000	0.12139	GAG	-	NULL		0.527	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG5	protein_coding	OTTHUMT00000079460.1	C	NM_014477		43439643	-1	no_errors	NM_014477	genbank	human	validated	54_36p	nonsense	SNP	0.016	A
SLC12A5	57468	genome.wustl.edu	37	20	44663619	44663619	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr20:44663619A>C	ENST00000454036.2	+	2	203	c.154A>C	c.(154-156)Atc>Ctc	p.I52L	SLC12A5_ENST00000372315.1_Missense_Mutation_p.I29L|SLC12A5_ENST00000243964.3_Missense_Mutation_p.I29L|SLC12A5_ENST00000608944.1_5'UTR	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	52					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAGTCCCTTCATCAACAGCAC	0.542																																																0			20											254.0	184.0	208.0					20																	44663619		2203	4300	6503	44097026	SO:0001583	missense	57468			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.154A>C	20.37:g.44663619A>C	ENSP00000387694:p.Ile52Leu		44097026	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	HMMPfam_AA_permease	p.I29L	ENST00000454036.2	37	c.85	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	A	12.28	1.890595	0.33348	.	.	ENSG00000124140	ENST00000454036;ENST00000372315;ENST00000539566;ENST00000243964	D;T;T;T	0.83591	-1.74;1.91;1.91;1.91	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	L	0.35542	1.07	0.58432	D	0.999999	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.15052	0.008;0.012;0.008	T	0.67055	-0.5767	10	0.12430	T	0.62	.	13.7397	0.62840	1.0:0.0:0.0:0.0	.	52;29;29	Q9H2X9;Q9H2X9-2;A8K143	S12A5_HUMAN;.;.	L	52;29;29;29	ENSP00000387694:I52L;ENSP00000361389:I29L;ENSP00000446091:I29L;ENSP00000243964:I29L	ENSP00000243964:I29L	I	+	1	0	SLC12A5	44097026	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.188000	0.50958	2.164000	0.68074	0.533000	0.62120	ATC	-	NULL		0.542	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	protein_coding	OTTHUMT00000471538.1	A			44097026	+1	no_errors	NM_020708	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PACSIN3	29763	genome.wustl.edu	37	11	47201085	47201085	+	Missense_Mutation	SNP	C	C	T	rs549826440		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr11:47201085C>T	ENST00000539589.1	-	7	998	c.656G>A	c.(655-657)cGc>cAc	p.R219H	ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.R219H|ARFGAP2_ENST00000319543.6_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|ARFGAP2_ENST00000419701.2_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	219	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CTCCATGTAGCGTGGAGTGTA	0.582											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		20095	0.0		0.0	False		,,,				2504	0.001															0			11											78.0	84.0	82.0					11																	47201085		2201	4298	6499	47157661	SO:0001583	missense	29763			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.656G>A	11.37:g.47201085C>T	ENSP00000440945:p.Arg219His	945	47157661	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	HMMPfam_FCH,HMMSmart_FCH,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.R219H	ENST00000539589.1	37	c.656	CCDS31481.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.688545|4.688545	0.88639|0.88639	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000415232|ENST00000298838;ENST00000539589;ENST00000528462	.|T;T;T	.|0.45276	.|0.9;0.9;0.9	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62624|0.62624	0.2443|0.2443	M|M	0.78637|0.78637	2.42|2.42	0.58432|0.58432	D|D	0.999998|0.999998	.|D	.|0.69078	.|0.997	.|D	.|0.67382	.|0.951	T|T	0.65092|0.65092	-0.6252|-0.6252	6|10	0.15066|0.54805	T|T	0.55|0.06	-18.2848|-18.2848	12.5167|12.5167	0.56036|0.56036	0.0:0.9237:0.0:0.0763|0.0:0.9237:0.0:0.0763	.|.	.|219	.|Q9UKS6	.|PACN3_HUMAN	T|H	218|219	.|ENSP00000298838:R219H;ENSP00000440945:R219H;ENSP00000437252:R219H	ENSP00000405352:A218T|ENSP00000298838:R219H	A|R	-|-	1|2	0|0	PACSIN3|PACSIN3	47157661|47157661	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.948000|4.948000	0.63590|0.63590	2.537000|2.537000	0.85549|0.85549	0.561000|0.561000	0.74099|0.74099	GCT|CGC	-	NULL		0.582	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	protein_coding	OTTHUMT00000391632.1	C	NM_016223		47157661	-1	no_errors	NM_016223	genbank	human	provisional	54_36p	missense	SNP	1.000	T
CD177	57126	genome.wustl.edu	37	19	43866449	43866449	+	RNA	SNP	G	G	A	rs78718189	byFrequency	TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr19:43866449G>A	ENST00000607109.1	-	0	300				CD177_ENST00000607517.1_RNA|CD177_ENST00000378009.4_RNA																							GCTGTGGTGGGGAGTGGTTTG	0.617													G|||	172	0.034345	0.0053	0.0562	5008	,	,		15230	0.0		0.1083	False		,,,				2504	0.0174															0			19						G	ARG/GLY	77,3945		2,73,1936	22.0	23.0	23.0		1291	1.0	0.0	19	dbSNP_131	23	839,7487		38,763,3362	yes	missense	CD177	NM_020406.2	125	40,836,5298	AA,AG,GG		10.0769,1.9145,7.4182	probably-damaging	431/438	43866449	916,11432	2011	4163	6174	48558289			57126																															19.37:g.43866449G>A			48558289		Missense_Mutation	SNP	superfamily_Snake toxin-like,HMMPfam_UPAR_LY6	p.G431R	ENST00000607109.1	37	c.1291		19																																																																																			-	NULL		0.617	CTC-490G23.4-001	KNOWN	basic	antisense	CD177	antisense	OTTHUMT00000470165.1	G			48558289	+1	pseudogene	NM_020406	genbank	human	validated	54_36p	missense	SNP	0.013	A
Unknown	0	genome.wustl.edu	37	11	49867174	49867174	+	IGR	SNP	A	A	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr11:49867174A>C								RP11-707M1.1 (35203 upstream) : OR4C13 (106768 downstream)																							AGAGGCTGGGACATGTGCAGT	0.458																																																0			11																																								49823750	SO:0001628	intergenic_variant	387770																															11.37:g.49867174A>C			49823750		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.458					LOC387770			A			49823750	-1	pseudogene	XR_017307	genbank	human	model	54_36p	rna	SNP	0.106	C
LILRA6	79168	genome.wustl.edu	37	19	54742857	54742857	+	Missense_Mutation	SNP	C	C	G	rs372286259		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr19:54742857C>G	ENST00000396365.2	-	8	1457	c.1418G>C	c.(1417-1419)aGa>aCa	p.R473T	LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000245621.5_Missense_Mutation_p.R456T|LILRA6_ENST00000270464.5_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	473					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTGGGGGTTTCTCTGGCTGTG	0.567																																																0			19											89.0	87.0	88.0					19																	54742857		2176	4298	6474	59434669	SO:0001583	missense	79168			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.1418G>C	19.37:g.54742857C>G	ENSP00000379651:p.Arg473Thr		59434669		Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_ig,HMMSmart_IG	p.R473T	ENST00000396365.2	37	c.1418	CCDS42610.1	19	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208286	0.39003	.	.	ENSG00000244482	ENST00000396365;ENST00000245621	T;T	0.00567	6.62;6.54	2.59	2.59	0.31030	.	6.584470	0.00735	U	0.000962	T	0.01029	0.0034	M	0.78916	2.43	0.22835	N	0.998671	B	0.15141	0.012	B	0.06405	0.002	T	0.54463	-0.8290	10	0.48119	T	0.1	.	8.6675	0.34130	0.0:1.0:0.0:0.0	.	473	Q6PI73	LIRA6_HUMAN	T	473;456	ENSP00000379651:R473T;ENSP00000245621:R456T	ENSP00000245621:R456T	R	-	2	0	LILRA6	59434669	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	0.389000	0.20751	1.455000	0.47813	0.174000	0.16983	AGA	-	NULL		0.567	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	protein_coding	OTTHUMT00000313725.1	C	NM_024318		59434669	-1	no_errors	NM_024318	genbank	human	validated	54_36p	missense	SNP	0.002	G
FIZ1	84922	genome.wustl.edu	37	19	56109104	56109104	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr19:56109104G>A	ENST00000221665.3	-	2	217	c.128C>T	c.(127-129)gCc>gTc	p.A43V	FIZ1_ENST00000592585.1_Missense_Mutation_p.A43V|ZNF524_ENST00000301073.3_5'Flank	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	43					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGTGTGCCGGGCAAAGTGGCG	0.672																																																0			19											50.0	46.0	48.0					19																	56109104		2203	4299	6502	60800916	SO:0001583	missense	84922			AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.128C>T	19.37:g.56109104G>A	ENSP00000221665:p.Ala43Val		60800916	A2RU72|Q6ZMJ7	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,PatternScan_2FE2S_FER_1	p.A43V	ENST00000221665.3	37	c.128	CCDS12928.1	19	.	.	.	.	.	.	.	.	.	.	G	1.458	-0.563208	0.03939	.	.	ENSG00000179943	ENST00000221665	T	0.19250	2.16	3.57	3.57	0.40892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22003	0.0530	N	0.12182	0.205	0.09310	N	1	D	0.53619	0.961	P	0.57620	0.824	T	0.07731	-1.0757	9	0.54805	T	0.06	-17.8725	9.9577	0.41678	0.0:0.0:0.7965:0.2035	.	43	Q96SL8	FIZ1_HUMAN	V	43	ENSP00000221665:A43V	ENSP00000221665:A43V	A	-	2	0	FIZ1	60800916	0.000000	0.05858	0.988000	0.46212	0.756000	0.42949	0.243000	0.18106	2.017000	0.59298	0.462000	0.41574	GCC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.672	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIZ1	protein_coding	OTTHUMT00000453350.1	G	NM_032836		60800916	-1	no_errors	NM_032836	genbank	human	reviewed	54_36p	missense	SNP	0.714	A
NFAT5	10725	genome.wustl.edu	37	16	69725884	69725884	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr16:69725884G>A	ENST00000354436.2	+	12	2420	c.2102G>A	c.(2101-2103)aGc>aAc	p.S701N	NFAT5_ENST00000567239.1_Missense_Mutation_p.S718N|NFAT5_ENST00000566899.1_Missense_Mutation_p.S625N|NFAT5_ENST00000432919.1_Missense_Mutation_p.S719N|NFAT5_ENST00000393742.2_Missense_Mutation_p.S625N|NFAT5_ENST00000349945.1_Missense_Mutation_p.S625N	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	701					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTGCCCAACAGCGATGCACTA	0.458																																																0			16											86.0	83.0	84.0					16																	69725884		2198	4300	6498	68283385	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2102G>A	16.37:g.69725884G>A	ENSP00000346420:p.Ser701Asn		68283385	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	superfamily_p53-like transcription factors,HMMPfam_RHD,superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG	p.S719N	ENST00000354436.2	37	c.2156	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760527	0.31137	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.46819	0.87;0.86;0.87;0.86	6.08	4.13	0.48395	.	0.394428	0.31884	N	0.006915	T	0.34803	0.0910	L	0.35414	1.06	0.39719	D	0.971443	B;B;B	0.13145	0.0;0.007;0.005	B;B;B	0.12837	0.001;0.008;0.006	T	0.12863	-1.0531	10	0.30854	T	0.27	-3.0274	10.0249	0.42066	0.2041:0.0:0.7958:0.0	.	718;701;719	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	N	719;718;625;701;625	ENSP00000396538:S719N;ENSP00000338806:S625N;ENSP00000346420:S701N;ENSP00000377343:S625N	ENSP00000338806:S625N	S	+	2	0	NFAT5	68283385	0.999000	0.42202	0.968000	0.41197	0.570000	0.35934	1.871000	0.39539	0.907000	0.36646	0.655000	0.94253	AGC	-	NULL		0.458	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	G	NM_138714		68283385	+1	no_errors	NM_138713	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
MFSD11	79157	genome.wustl.edu	37	17	74774306	74774306	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr17:74774306T>C	ENST00000588460.1	+	13	3264	c.1222T>C	c.(1222-1224)Tac>Cac	p.Y408H	MFSD11_ENST00000586622.1_Missense_Mutation_p.Y408H|MFSD11_ENST00000355954.3_Missense_Mutation_p.Y356H|MFSD11_ENST00000590514.1_Missense_Mutation_p.Y408H|MFSD11_ENST00000590070.1_3'UTR|MFSD11_ENST00000593181.1_Missense_Mutation_p.Y356H|MFSD11_ENST00000336509.4_Missense_Mutation_p.Y408H	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	408						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						CTACAGCAACTACCTTCTCCT	0.488																																																0			17											182.0	166.0	172.0					17																	74774306		2203	4300	6503	72285901	SO:0001583	missense	79157			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1222T>C	17.37:g.74774306T>C	ENSP00000464932:p.Tyr408His		72285901	O43442|Q9NXI5	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_DUF895	p.Y408H	ENST00000588460.1	37	c.1222	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940880	0.52972	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.81415	-1.49;-1.49	6.07	6.07	0.98685	Major facilitator superfamily domain, general substrate transporter (1);	0.051251	0.85682	D	0.000000	T	0.72716	0.3495	L	0.31752	0.955	0.80722	D	1	P;B	0.41080	0.737;0.11	B;B	0.41088	0.347;0.062	T	0.70081	-0.4970	10	0.15499	T	0.54	-18.0056	16.3021	0.82825	0.0:0.0:0.0:1.0	.	356;408	O43934-2;O43934	.;MFS11_HUMAN	H	408;356	ENSP00000337240:Y408H;ENSP00000348225:Y356H	ENSP00000337240:Y408H	Y	+	1	0	MFSD11	72285901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.174000	0.71943	2.326000	0.78906	0.533000	0.62120	TAC	-	superfamily_MFS general substrate transporter		0.488	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	protein_coding	OTTHUMT00000451516.1	T	NM_024311		72285901	+1	no_errors	NM_024311	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CLIP2	7461	genome.wustl.edu	37	7	73752998	73752998	+	Silent	SNP	C	C	T	rs201025665		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr7:73752998C>T	ENST00000395060.1	+	2	342	c.342C>T	c.(340-342)gaC>gaT	p.D114D	CLIP2_ENST00000223398.6_Silent_p.D114D|CLIP2_ENST00000361545.5_Silent_p.D114D			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	114	CAP-Gly 1. {ECO:0000255|PROSITE- ProRule:PRU00045}.					cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TGGTGCTGGACGACCCGGTGG	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		14586	0.001		0.0	False		,,,				2504	0.0															0			7											54.0	42.0	46.0					7																	73752998		2189	4289	6478	73390934	SO:0001819	synonymous_variant	7461			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.342C>T	7.37:g.73752998C>T			73390934	O14527|O43611	Silent	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.D114	ENST00000395060.1	37	c.342	CCDS5569.1	7																																																																																			-	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1		0.692	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	protein_coding	OTTHUMT00000252556.1	C	NM_003388		73390934	+1	no_errors	NM_003388	genbank	human	reviewed	54_36p	silent	SNP	0.973	T
KARS	3735	genome.wustl.edu	37	16	75665482	75665482	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr16:75665482C>T	ENST00000302445.3	-	9	1123	c.1084G>A	c.(1084-1086)Gtg>Atg	p.V362M	KARS_ENST00000319410.5_Missense_Mutation_p.V390M|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	362					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	ATATGCTTCACCATCCCTGGG	0.527																																																0			16											129.0	126.0	127.0					16																	75665482		2198	4300	6498	74222983	SO:0001583	missense	3735			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.1084G>A	16.37:g.75665482C>T	ENSP00000303043:p.Val362Met		74222983	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Splice_Site	SNP	-	e8+1	ENST00000302445.3	37	c.696+1	CCDS10923.1	16	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119898	0.77323	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.80393	-1.37;-1.37	5.91	4.96	0.65561	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.106578	0.64402	D	0.000005	D	0.92309	0.7560	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	0.966;1.0	P;D	0.79108	0.724;0.992	D	0.94215	0.7462	10	0.87932	D	0	-18.7261	13.7865	0.63112	0.0:0.9264:0.0:0.0736	.	390;362	Q15046-2;Q15046	.;SYK_HUMAN	M	390;362	ENSP00000325448:V390M;ENSP00000303043:V362M	ENSP00000303043:V362M	V	-	1	0	KARS	74222983	1.000000	0.71417	0.999000	0.59377	0.871000	0.50021	7.818000	0.86416	1.508000	0.48769	0.655000	0.94253	GTG	-	-		0.527	KARS-001	KNOWN	basic|CCDS	protein_coding	KARS	protein_coding	OTTHUMT00000269023.1	C	NM_005548		74222983	-1	no_errors	ENST00000378668	ensembl	human	known	54_36p	splice_site	SNP	1.000	T
E2F7	144455	genome.wustl.edu	37	12	77423726	77423726	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr12:77423726G>A	ENST00000322886.7	-	10	2004	c.1769C>T	c.(1768-1770)cCc>cTc	p.P590L	E2F7_ENST00000416496.2_Missense_Mutation_p.P590L	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	590					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTGAGCTGAGGGTGCAGATGA	0.572																																																0			12											100.0	91.0	94.0					12																	77423726		2203	4300	6503	75947857	SO:0001583	missense	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1769C>T	12.37:g.77423726G>A	ENSP00000323246:p.Pro590Leu		75947857	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_E2F_TDP"	p.P590L	ENST00000322886.7	37	c.1769	CCDS9016.1	12	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325212	0.24080	.	.	ENSG00000165891	ENST00000322886;ENST00000339887;ENST00000416496;ENST00000550669	T;T;T	0.20069	2.28;2.1;2.11	5.69	2.81	0.32909	.	0.932856	0.09197	N	0.835175	T	0.19287	0.0463	L	0.60455	1.87	0.09310	N	0.999997	B;B	0.14438	0.01;0.001	B;B	0.14023	0.01;0.001	T	0.38908	-0.9639	10	0.49607	T	0.09	-0.8601	1.4878	0.02451	0.2558:0.1421:0.4559:0.1462	.	590;590	Q96AV8-2;Q96AV8	.;E2F7_HUMAN	L	590;77;590;590	ENSP00000323246:P590L;ENSP00000393639:P590L;ENSP00000448245:P590L	ENSP00000323246:P590L	P	-	2	0	E2F7	75947857	0.311000	0.24536	0.001000	0.08648	0.011000	0.07611	1.368000	0.34216	0.302000	0.22762	-0.136000	0.14681	CCC	-	NULL		0.572	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	protein_coding	OTTHUMT00000406716.1	G	XM_084871		75947857	-1	no_errors	NM_203394	genbank	human	validated	54_36p	missense	SNP	0.020	A
IQGAP2	10788	genome.wustl.edu	37	5	75932999	75932999	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr5:75932999G>C	ENST00000274364.6	+	16	2218	c.1921G>C	c.(1921-1923)Gag>Cag	p.E641Q	IQGAP2_ENST00000502745.1_Missense_Mutation_p.E194Q|IQGAP2_ENST00000396234.3_Missense_Mutation_p.E194Q|IQGAP2_ENST00000379730.3_Missense_Mutation_p.E200Q	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	641					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAAAGAAATCGAGGTAGGAGG	0.363																																																0			5											94.0	93.0	94.0					5																	75932999		2203	4300	6503	75968755	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1921G>C	5.37:g.75932999G>C	ENSP00000274364:p.Glu641Gln		75968755	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,PatternScan_WW_DOMAIN_1,HMMSmart_SM00015,HMMPfam_IQ,superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_GTPase activation domain GAP,HMMSmart_SM00323,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,HMMPfam_RasGAP_C	p.E641Q	ENST00000274364.6	37	c.1921	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	G	1.402	-0.577759	0.03854	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000514350;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000545384;ENST00000502745	T;T;T;T;T;T;T	0.71461	1.11;-0.57;1.11;1.11;1.11;-0.57;-0.57	5.72	2.48	0.30137	.	0.170711	0.52532	D	0.000065	T	0.40398	0.1115	N	0.05574	-0.02	0.25472	N	0.987818	B;B;B;B	0.09022	0.002;0.001;0.002;0.001	B;B;B;B	0.14023	0.01;0.002;0.01;0.005	T	0.31024	-0.9958	10	0.02654	T	1	-20.2684	6.1727	0.20427	0.1891:0.1598:0.6511:0.0	.	200;591;194;641	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	Q	641;200;614;591;194;194;194;194	ENSP00000274364:E641Q;ENSP00000442313:E200Q;ENSP00000423672:E614Q;ENSP00000421097:E591Q;ENSP00000422661:E194Q;ENSP00000379535:E194Q;ENSP00000426027:E194Q	ENSP00000274364:E641Q	E	+	1	0	IQGAP2	75968755	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	0.814000	0.27239	0.748000	0.32831	0.585000	0.79938	GAG	-	NULL		0.363	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	protein_coding	OTTHUMT00000368877.1	G	NM_006633		75968755	+1	no_errors	NM_006633	genbank	human	validated	54_36p	missense	SNP	1.000	C
ARNT2	9915	genome.wustl.edu	37	15	80867401	80867401	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr15:80867401C>G	ENST00000303329.4	+	14	1628	c.1463C>G	c.(1462-1464)tCc>tGc	p.S488C	ARNT2_ENST00000533983.1_Missense_Mutation_p.S477C|ARNT2_ENST00000527771.1_Missense_Mutation_p.S477C	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	488					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			GCAATCTTCTCCCAGGAAAGA	0.473																																																0			15											203.0	197.0	199.0					15																	80867401		2203	4300	6503	78654456	SO:0001583	missense	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1463C>G	15.37:g.80867401C>G	ENSP00000307479:p.Ser488Cys		78654456	B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353,HMMSmart_SM00091,HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS_3,HMMSmart_SM00086	p.S488C	ENST00000303329.4	37	c.1463	CCDS32307.1	15	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961885	0.74016	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.07216	3.21	5.21	4.28	0.50868	.	0.401484	0.28161	N	0.016380	T	0.21841	0.0526	L	0.54323	1.7	0.58432	D	0.999999	D	0.69078	0.997	P	0.61800	0.894	T	0.00783	-1.1568	10	0.87932	D	0	.	15.1688	0.72854	0.1422:0.8578:0.0:0.0	.	488	Q9HBZ2	ARNT2_HUMAN	C	477;488;488	ENSP00000307479:S488C	ENSP00000307479:S488C	S	+	2	0	ARNT2	78654456	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.035000	0.76517	1.182000	0.42928	-0.188000	0.12872	TCC	-	NULL		0.473	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	protein_coding	OTTHUMT00000384389.2	C			78654456	+1	no_errors	NM_014862	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FZD4	8322	genome.wustl.edu	37	11	86662305	86662305	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr11:86662305G>C	ENST00000531380.1	-	2	1798	c.1493C>G	c.(1492-1494)gCc>gGc	p.A498G	PRSS23_ENST00000531521.1_3'UTR|PRSS23_ENST00000533902.2_Missense_Mutation_p.G85A	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	498					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAGAGTTTTGGCAGACCAAAT	0.423																																																0			11											112.0	110.0	111.0					11																	86662305		2201	4299	6500	86339953	SO:0001583	missense	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1493C>G	11.37:g.86662305G>C	ENSP00000434034:p.Ala498Gly		86339953	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	HMMPfam_Fz,superfamily_Frizzled_Cys-rich,HMMSmart_FRI,HMMPfam_Frizzled	p.A498G	ENST00000531380.1	37	c.1493	CCDS8279.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.30|11.30	1.599356|1.599356	0.28534|0.28534	.|.	.|.	ENSG00000174804|ENSG00000150687	ENST00000531380|ENST00000533902	D|.	0.81579|.	-1.51|.	6.17|6.17	6.17|6.17	0.99709|0.99709	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33059|0.33059	0.0850|0.0850	N|N	0.01417|0.01417	-0.88|-0.88	0.80722|0.80722	D|D	1|1	B|.	0.18013|.	0.025|.	B|.	0.25140|.	0.058|.	T|T	0.38222|0.38222	-0.9671|-0.9671	9|5	.|.	.|.	.|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	498|.	Q9ULV1|.	FZD4_HUMAN|.	G|A	498|85	ENSP00000434034:A498G|.	.|.	A|G	-|+	2|2	0|0	FZD4|PRSS23	86339953|86339953	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.800000|7.800000	0.85949|0.85949	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|GGC	-	HMMPfam_Frizzled		0.423	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	FZD4	protein_coding	OTTHUMT00000393818.2	G	NM_012193		86339953	-1	no_errors	NM_012193	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DBF4	10926	genome.wustl.edu	37	7	87537203	87537203	+	Nonsense_Mutation	SNP	C	C	T	rs144858770		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr7:87537203C>T	ENST00000265728.1	+	12	2254	c.1750C>T	c.(1750-1752)Cga>Tga	p.R584*		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	584				R -> Q (in Ref. 6; EAL24170). {ECO:0000305}.	DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AATATTAGGACGAAATAGAAA	0.328																																																0			7						C	stop/ARG	0,4404		0,0,2202	44.0	50.0	48.0		1750	0.3	1.0	7	dbSNP_134	48	1,8557		0,1,4278	no	stop-gained	DBF4	NM_006716.3		0,1,6480	TT,TC,CC		0.0117,0.0,0.0077		584/675	87537203	1,12961	2202	4279	6481	87375139	SO:0001587	stop_gained	10926			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1750C>T	7.37:g.87537203C>T	ENSP00000265728:p.Arg584*		87375139	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Nonsense_Mutation	SNP	HMMPfam_zf-DBF,HMMSmart_SM00586	p.R584*	ENST00000265728.1	37	c.1750	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	C	40	8.292962	0.98747	0.0	1.17E-4	ENSG00000006634	ENST00000265728	.	.	.	5.13	0.274	0.15654	.	0.113799	0.38897	N	0.001539	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3952	15.3419	0.74303	0.7422:0.2578:0.0:0.0	.	.	.	.	X	584	.	ENSP00000265728:R584X	R	+	1	2	DBF4	87375139	1.000000	0.71417	0.980000	0.43619	0.971000	0.66376	0.947000	0.29082	-0.483000	0.06772	-0.824000	0.03097	CGA	-	NULL		0.328	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	protein_coding	OTTHUMT00000253678.1	C	NM_006716		87375139	+1	no_errors	NM_006716	genbank	human	validated	54_36p	nonsense	SNP	0.998	T
KCNK10	54207	genome.wustl.edu	37	14	88737121	88737121	+	Intron	SNP	A	A	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr14:88737121A>G	ENST00000340700.5	-	2	489				KCNK10_ENST00000312350.5_Missense_Mutation_p.F5L|KCNK10_ENST00000319231.5_Intron	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10						signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						tcccccttaaatccatcctcc	0.517																																																0			14											366.0	288.0	314.0					14																	88737121		2203	4300	6503	87806874	SO:0001627	intron_variant	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.38-7226T>C	14.37:g.88737121A>G			87806874	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans_2	p.F5L	ENST00000340700.5	37	c.13	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	a	16.62	3.173033	0.57584	.	.	ENSG00000100433	ENST00000312350	D	0.90069	-2.61	3.57	-1.71	0.08133	.	.	.	.	.	T	0.72740	0.3498	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.60239	-0.7302	9	0.87932	D	0	.	2.3641	0.04315	0.4115:0.0:0.221:0.3674	.	5	Q6B014	.	L	5	ENSP00000310568:F5L	ENSP00000310568:F5L	F	-	1	0	KCNK10	87806874	0.000000	0.05858	0.011000	0.14972	0.704000	0.40688	-0.357000	0.07651	-0.323000	0.08602	0.529000	0.55759	TTT	-	NULL		0.517	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	A	NM_021161		87806874	-1	no_errors	NM_138318	genbank	human	reviewed	54_36p	missense	SNP	0.009	G
ASB4	51666	genome.wustl.edu	37	7	95115411	95115411	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr7:95115411A>G	ENST00000325885.5	+	1	199	c.128A>G	c.(127-129)gAt>gGt	p.D43G	ASB4_ENST00000428113.1_Missense_Mutation_p.D43G|ASB4_ENST00000257621.4_Intron	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	43					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			AGGCAAATAGATGTGGACACT	0.353																																																0			7											97.0	99.0	98.0					7																	95115411		2203	4300	6503	94953347	SO:0001583	missense	51666			AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.128A>G	7.37:g.95115411A>G	ENSP00000321388:p.Asp43Gly		94953347	A4D1H6|O14586|Q14D68|Q8TBT2	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_SOCS_box	p.D43G	ENST00000325885.5	37	c.128	CCDS5641.1	7	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298735	0.81025	.	.	ENSG00000005981	ENST00000325885;ENST00000428113	T;T	0.54675	0.56;0.56	5.2	5.2	0.72013	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	0.972;1.0	P;D	0.91635	0.696;0.999	T	0.62115	-0.6922	10	0.46703	T	0.11	-22.5375	15.5488	0.76129	1.0:0.0:0.0:0.0	.	43;43	Q9Y574;Q14D68	ASB4_HUMAN;.	G	43	ENSP00000321388:D43G;ENSP00000397070:D43G	ENSP00000321388:D43G	D	+	2	0	ASB4	94953347	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.978000	0.88095	2.324000	0.78689	0.533000	0.62120	GAT	-	superfamily_Ankyrin repeat		0.353	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB4	protein_coding	OTTHUMT00000333225.2	A	NM_016116		94953347	+1	no_errors	NM_016116	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ELOVL3	83401	genome.wustl.edu	37	10	103988238	103988238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr10:103988238C>T	ENST00000370005.3	+	3	519	c.298C>T	c.(298-300)Caa>Taa	p.Q100*		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	100					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		GGGCCTAAAGCAAACCGTGTG	0.488																																																0			10											124.0	118.0	120.0					10																	103988238		2203	4300	6503	103978228	SO:0001587	stop_gained	83401			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.298C>T	10.37:g.103988238C>T	ENSP00000359022:p.Gln100*		103978228	Q5VZL3|Q8N180	Nonsense_Mutation	SNP	HMMPfam_ELO,PatternScan_ELO	p.Q100*	ENST00000370005.3	37	c.298	CCDS7531.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442716	0.83993	.	.	ENSG00000119915	ENST00000370005	.	.	.	4.67	2.54	0.30619	.	0.664870	0.13936	N	0.352529	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-20.755	13.5915	0.61964	0.2922:0.7078:0.0:0.0	.	.	.	.	X	100	.	ENSP00000359022:Q100X	Q	+	1	0	ELOVL3	103978228	0.993000	0.37304	0.513000	0.27749	0.256000	0.26092	1.945000	0.40273	0.940000	0.37473	0.561000	0.74099	CAA	-	HMMPfam_ELO		0.488	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL3	protein_coding	OTTHUMT00000050030.1	C	NM_152310		103978228	+1	no_errors	NM_152310	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
LIG4	3981	genome.wustl.edu	37	13	108861672	108861672	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr13:108861672G>A	ENST00000356922.4	-	2	2217	c.1945C>T	c.(1945-1947)Ctt>Ttt	p.L649F	LIG4_ENST00000405925.1_Missense_Mutation_p.L649F|LIG4_ENST00000442234.1_Missense_Mutation_p.L649F	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	649					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					ACGTTAGTAAGGTTAGGTGCT	0.363								Non-homologous end-joining																																								0			13											72.0	72.0	72.0					13																	108861672		2202	4300	6502	107659673	SO:0001583	missense	3981			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1945C>T	13.37:g.108861672G>A	ENSP00000349393:p.Leu649Phe		107659673	Q8IY66|Q8TEU5	Missense_Mutation	SNP	HMMPfam_DNA_ligase_A_N,superfamily_SSF56091,HMMPfam_DNA_ligase_A_M,PatternScan_DNA_LIGASE_A1,PatternScan_DNA_LIGASE_A2,HMMPfam_DNA_ligase_A_C,HMMPfam_BRCT,HMMSmart_BRCT,superfamily_BRCT	p.L649F	ENST00000356922.4	37	c.1945	CCDS9508.1	13	.	.	.	.	.	.	.	.	.	.	G	11.30	1.596581	0.28445	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.12255	2.7;2.7;2.7	5.69	5.69	0.88448	BRCT (1);	0.000000	0.85682	D	0.000000	T	0.20901	0.0503	M	0.67953	2.075	0.58432	D	0.999999	B	0.32040	0.353	B	0.34301	0.179	T	0.01639	-1.1306	10	0.29301	T	0.29	.	18.8676	0.92300	0.0:0.0:1.0:0.0	.	649	P49917	DNLI4_HUMAN	F	649	ENSP00000385955:L649F;ENSP00000402030:L649F;ENSP00000349393:L649F	ENSP00000349393:L649F	L	-	1	0	LIG4	107659673	1.000000	0.71417	0.852000	0.33557	0.634000	0.38068	7.533000	0.81994	2.688000	0.91661	0.539000	0.68188	CTT	-	NULL		0.363	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG4	protein_coding	OTTHUMT00000045738.4	G	NM_002312		107659673	-1	no_errors	NM_001098268	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
KCNA3	3738	genome.wustl.edu	37	1	111217106	111217106	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:111217106T>A	ENST00000369769.2	-	1	549	c.326A>T	c.(325-327)aAc>aTc	p.N109I		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	109					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	CCCGGAGATGTTGATGACCAC	0.716																																																0			1											26.0	31.0	29.0					1																	111217106		2200	4299	6499	111018629	SO:0001583	missense	3738			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.326A>T	1.37:g.111217106T>A	ENSP00000358784:p.Asn109Ile		111018629	Q5VWN2	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra,superfamily_SSF81324,HMMPfam_Ion_trans	p.N109I	ENST00000369769.2	37	c.326	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808989	0.70797	.	.	ENSG00000177272	ENST00000369769	D	0.85629	-2.01	4.33	4.33	0.51752	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	U	0.000000	D	0.94447	0.8213	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95885	0.8902	10	0.87932	D	0	.	12.4631	0.55743	0.0:0.0:0.0:1.0	.	109	P22001	KCNA3_HUMAN	I	109	ENSP00000358784:N109I	ENSP00000358784:N109I	N	-	2	0	KCNA3	111018629	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.827000	0.86722	1.584000	0.49913	0.379000	0.24179	AAC	-	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra		0.716	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	protein_coding	OTTHUMT00000083391.1	T	NM_002232		111018629	-1	no_errors	NM_002232	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SLC6A14	11254	genome.wustl.edu	37	X	115588885	115588885	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chrX:115588885T>G	ENST00000371900.4	+	13	1813	c.1725T>G	c.(1723-1725)atT>atG	p.I575M	SLC6A14_ENST00000463626.1_Intron	NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	575					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TCTGCATTATTTGGATTCCAA	0.348																																																0			X											198.0	183.0	188.0					X																	115588885		2203	4300	6503	115502913	SO:0001583	missense	11254			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1725T>G	X.37:g.115588885T>G	ENSP00000360967:p.Ile575Met		115502913	Q5H942	Missense_Mutation	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2	p.I575M	ENST00000371900.4	37	c.1725	CCDS14570.1	X	.	.	.	.	.	.	.	.	.	.	T	12.59	1.982210	0.34942	.	.	ENSG00000087916	ENST00000371900	T	0.75938	-0.98	4.8	-4.61	0.03380	.	0.231305	0.42682	D	0.000680	T	0.59676	0.2211	L	0.45422	1.42	0.31412	N	0.675341	B	0.21147	0.052	B	0.26517	0.07	T	0.50516	-0.8819	10	0.48119	T	0.1	.	8.1458	0.31110	0.1518:0.6212:0.0:0.2271	.	575	Q9UN76	S6A14_HUMAN	M	575	ENSP00000360967:I575M	ENSP00000360967:I575M	I	+	3	3	SLC6A14	115502913	0.989000	0.36119	0.990000	0.47175	0.977000	0.68977	0.170000	0.16663	-0.498000	0.06632	0.437000	0.28790	ATT	-	HMMPfam_SNF		0.348	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A14	protein_coding	OTTHUMT00000057986.1	T			115502913	+1	no_errors	NM_007231	genbank	human	validated	54_36p	missense	SNP	1.000	G
CLIP1	6249	genome.wustl.edu	37	12	122839860	122839860	+	Splice_Site	SNP	C	C	G			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr12:122839860C>G	ENST00000540338.1	-	5	1047		c.e5-1		CLIP1_ENST00000537178.1_Splice_Site|CLIP1_ENST00000545889.1_Splice_Site|CLIP1_ENST00000361654.4_Splice_Site|CLIP1_ENST00000358808.2_Splice_Site|CLIP1_ENST00000302528.7_Splice_Site			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1						microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTTCAGTCAACTGTAAAGGAA	0.567																																																0			12											43.0	41.0	42.0					12																	122839860		2203	4300	6503	121405813	SO:0001630	splice_region_variant	6249				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1006-1G>C	12.37:g.122839860C>G			121405813	A0AVD3|Q17RS4|Q29RG0	Splice_Site	SNP	-	e5-1	ENST00000540338.1	37	c.1006-1	CCDS58285.1	12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538963	0.85917	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1007	0.93272	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLIP1	121405813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.504000	0.84457	0.655000	0.94253	.	-	-		0.567	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	protein_coding	OTTHUMT00000401625.1	C	NM_002956	Intron	121405813	-1	no_errors	NM_002956	genbank	human	validated	54_36p	splice_site	SNP	1.000	G
SEC23IP	11196	genome.wustl.edu	37	10	121677386	121677386	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr10:121677386T>A	ENST00000369075.3	+	9	1655	c.1583T>A	c.(1582-1584)tTt>tAt	p.F528Y	SEC23IP_ENST00000543134.1_Missense_Mutation_p.F317Y	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	528					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		ATTGGTCGATTTCGTCACTTT	0.318																																																0			10											50.0	52.0	51.0					10																	121677386		2203	4300	6503	121667376	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1583T>A	10.37:g.121677386T>A	ENSP00000358071:p.Phe528Tyr		121667376	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1,HMMPfam_DDHD	p.F528Y	ENST00000369075.3	37	c.1583	CCDS7618.1	10	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033735	0.75504	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.41758	0.99;0.99	5.32	5.32	0.75619	.	0.058622	0.64402	D	0.000001	T	0.33760	0.0874	N	0.25485	0.75	0.36730	D	0.881689	P;P	0.40794	0.666;0.729	B;B	0.38616	0.277;0.112	T	0.48364	-0.9042	10	0.87932	D	0	-24.1862	15.5763	0.76392	0.0:0.0:0.0:1.0	.	317;528	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	Y	528;317	ENSP00000358071:F528Y;ENSP00000438773:F317Y	ENSP00000358071:F528Y	F	+	2	0	SEC23IP	121667376	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.814000	0.86154	2.139000	0.66308	0.533000	0.62120	TTT	-	NULL		0.318	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23IP	protein_coding	OTTHUMT00000050688.1	T			121667376	+1	no_errors	NM_007190	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ADAMTS19	171019	genome.wustl.edu	37	5	128864285	128864285	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr5:128864285G>A	ENST00000274487.4	+	6	1370	c.1225G>A	c.(1225-1227)Ggc>Agc	p.G409S	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	409	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGAAGAATTTGGCAAAAAGAA	0.373																																																0			5											89.0	93.0	92.0					5																	128864285		2203	4300	6503	128892184	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1225G>A	5.37:g.128864285G>A	ENSP00000274487:p.Gly409Ser		128892184		Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_PLAC"	p.G409S	ENST00000274487.4	37	c.1225	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054226	0.75960	.	.	ENSG00000145808	ENST00000274487	D	0.86627	-2.15	4.02	4.02	0.46733	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000004	D	0.90546	0.7037	L	0.43923	1.385	0.53688	D	0.999974	D	0.89917	1.0	D	0.97110	1.0	D	0.89503	0.3765	9	.	.	.	.	17.5154	0.87771	0.0:0.0:1.0:0.0	.	409	Q8TE59	ATS19_HUMAN	S	409	ENSP00000274487:G409S	.	G	+	1	0	ADAMTS19	128892184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.077000	0.76814	2.530000	0.85305	0.650000	0.86243	GGC	-	"superfamily_Metalloproteases (""zincins"") catalytic domain"		0.373	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	protein_coding	OTTHUMT00000250979.2	G	NM_133638		128892184	+1	no_errors	NM_133638	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CEL	1056	genome.wustl.edu	37	9	135939856	135939856	+	Silent	SNP	T	T	C	rs543591885		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr9:135939856T>C	ENST00000372080.4	+	2	157	c.141T>C	c.(139-141)ggT>ggC	p.G47G	CEL_ENST00000351304.7_Silent_p.G44G	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	44	Heparin-binding.				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GCCTCCTGGGTGACTCTGTGG	0.627																																																0			9											89.0	102.0	98.0					9																	135939856		2066	4199	6265	134929677	SO:0001819	synonymous_variant	1056			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.141T>C	9.37:g.135939856T>C			134929677	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2,PatternScan_CARBOXYLESTERASE_B_1	p.G47	ENST00000372080.4	37	c.141	CCDS43896.1	9																																																																																			-	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases		0.627	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	T			134929677	+1	no_errors	NM_001807	genbank	human	validated	54_36p	silent	SNP	0.112	C
GYG1	2992	genome.wustl.edu	37	3	148744621	148744621	+	Silent	SNP	G	G	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr3:148744621G>C	ENST00000345003.4	+	8	1254	c.954G>C	c.(952-954)tcG>tcC	p.S318S	GYG1_ENST00000484197.1_Missense_Mutation_p.R228P|GYG1_ENST00000479119.1_3'UTR|GYG1_ENST00000296048.6_Silent_p.S301S	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	318	Interaction with GYS1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TTGTATCCTCGGAAGAACGGA	0.478																																																0			3											90.0	91.0	91.0					3																	148744621		2203	4300	6503	150227311	SO:0001819	synonymous_variant	2992			AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.954G>C	3.37:g.148744621G>C			150227311	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Silent	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Glyco_transf_8	p.S318	ENST00000345003.4	37	c.954	CCDS3139.1	3	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482147	0.44147	.	.	ENSG00000163754	ENST00000484197	T	0.78246	-1.16	5.55	-1.08	0.09936	.	.	.	.	.	T	0.61198	0.2328	.	.	.	0.22827	N	0.998683	B	0.34061	0.436	B	0.37780	0.258	T	0.50524	-0.8818	8	0.28530	T	0.3	-17.1313	1.7225	0.02915	0.534:0.1288:0.2134:0.1239	.	228	D3DNH0	.	P	228	ENSP00000420683:R228P	ENSP00000420683:R228P	R	+	2	0	GYG1	150227311	0.999000	0.42202	0.997000	0.53966	0.982000	0.71751	0.860000	0.27871	-0.170000	0.10816	-0.302000	0.09304	CGG	-	NULL		0.478	GYG1-001	KNOWN	basic|CCDS	protein_coding	GYG1	protein_coding	OTTHUMT00000356046.1	G	NM_004130		150227311	+1	no_errors	NM_004130	genbank	human	provisional	54_36p	silent	SNP	0.998	C
LCE1C	353133	genome.wustl.edu	37	1	152777810	152777810	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:152777810C>T	ENST00000607093.1	-	1	144	c.145G>A	c.(145-147)Gga>Aga	p.G49R	LCE1C_ENST00000368768.1_Missense_Mutation_p.G49R			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	49	Gly-rich.				keratinization (GO:0031424)					NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGCAGCCTCCGGAGCTGACA	0.662																																																0			1											45.0	48.0	47.0					1																	152777810		2202	4297	6499	151044434	SO:0001583	missense	353133				CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.145G>A	1.37:g.152777810C>T	ENSP00000475270:p.Gly49Arg		151044434		Missense_Mutation	SNP	NULL	p.G49R	ENST00000607093.1	37	c.145	CCDS1026.1	1	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188300	0.21954	.	.	ENSG00000197084	ENST00000368768	T	0.05786	3.39	3.22	3.22	0.36961	.	0.000000	0.35838	N	0.002946	T	0.09774	0.0240	M	0.68952	2.095	0.26012	N	0.98197	D	0.67145	0.996	D	0.63113	0.911	T	0.01675	-1.1298	10	0.87932	D	0	.	10.0757	0.42360	0.0:1.0:0.0:0.0	.	49	Q5T751	LCE1C_HUMAN	R	49	ENSP00000357757:G49R	ENSP00000357757:G49R	G	-	1	0	LCE1C	151044434	0.908000	0.30866	0.880000	0.34516	0.793000	0.44817	2.954000	0.49113	1.802000	0.52723	0.655000	0.94253	GGA	-	NULL		0.662	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1C	protein_coding	OTTHUMT00000034658.2	C	NM_178351		151044434	-1	no_errors	NM_178351	genbank	human	validated	54_36p	missense	SNP	0.992	T
GATAD2B	57459	genome.wustl.edu	37	1	153800519	153800519	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:153800519T>C	ENST00000368655.4	-	2	548	c.305A>G	c.(304-306)gAt>gGt	p.D102G		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	102					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CACAGGCTCATCATTGATGTT	0.493																																																0			1											173.0	149.0	157.0					1																	153800519		2203	4300	6503	152067143	SO:0001583	missense	57459			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.305A>G	1.37:g.153800519T>C	ENSP00000357644:p.Asp102Gly		152067143	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	PatternScan_GATA_ZN_FINGER_1,superfamily_SSF57716,HMMPfam_GATA	p.D102G	ENST00000368655.4	37	c.305	CCDS1054.1	1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.966218	0.92855	.	.	ENSG00000143614	ENST00000368655	T	0.50813	0.73	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.34513	0.0900	L	0.52573	1.65	0.80722	D	1	P	0.46784	0.884	B	0.43274	0.414	T	0.15838	-1.0423	10	0.38643	T	0.18	-21.6687	15.4208	0.75009	0.0:0.0:0.0:1.0	.	102	Q8WXI9	P66B_HUMAN	G	102	ENSP00000357644:D102G	ENSP00000357644:D102G	D	-	2	0	GATAD2B	152067143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.731000	0.84895	2.287000	0.76781	0.482000	0.46254	GAT	-	NULL		0.493	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATAD2B	protein_coding	OTTHUMT00000090305.1	T	NM_020699		152067143	-1	no_errors	NM_020699	genbank	human	validated	54_36p	missense	SNP	1.000	C
OR10K2	391107	genome.wustl.edu	37	1	158389843	158389843	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:158389843C>A	ENST00000314902.2	-	1	813	c.814G>T	c.(814-816)Gct>Tct	p.A272S		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GATATTAGAGCATCCTGGCTT	0.383																																																0			1											106.0	107.0	106.0					1																	158389843		2203	4300	6503	156656467	SO:0001583	missense	391107			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.814G>T	1.37:g.158389843C>A	ENSP00000324251:p.Ala272Ser		156656467		Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.A272S	ENST00000314902.2	37	c.814	CCDS30896.1	1	.	.	.	.	.	.	.	.	.	.	c	1.506	-0.550636	0.03996	.	.	ENSG00000180708	ENST00000314902	T	0.00123	8.7	4.23	0.144	0.14824	GPCR, rhodopsin-like superfamily (1);	0.503954	0.16555	N	0.209320	T	0.00039	0.0001	N	0.05554	-0.025	0.09310	N	1	B	0.17038	0.02	B	0.17098	0.017	T	0.40384	-0.9566	10	0.87932	D	0	.	4.1858	0.10397	0.0:0.3193:0.3226:0.3581	.	272	Q6IF99	O10K2_HUMAN	S	272	ENSP00000324251:A272S	ENSP00000324251:A272S	A	-	1	0	OR10K2	156656467	0.001000	0.12720	0.156000	0.22583	0.001000	0.01503	0.237000	0.17985	0.157000	0.19338	-0.930000	0.02707	GCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.383	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	protein_coding	OTTHUMT00000051854.1	C	NM_001004476		156656467	-1	no_errors	NM_001004476	genbank	human	provisional	54_36p	missense	SNP	0.008	A
DUSP12	11266	genome.wustl.edu	37	1	161719684	161719684	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:161719684G>C	ENST00000367943.4	+	1	125	c.93G>C	c.(91-93)caG>caC	p.Q31H		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	31					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TGGAAGTGCAGCCAGGATTGT	0.672																																																0			1											21.0	25.0	23.0					1																	161719684		2202	4299	6501	159986308	SO:0001583	missense	11266			AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.93G>C	1.37:g.161719684G>C	ENSP00000356920:p.Gln31His		159986308	Q5VXA8	Missense_Mutation	SNP	PatternScan_TYR_PHOSPHATASE_1,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc	p.Q31H	ENST00000367943.4	37	c.93	CCDS1234.1	1	.	.	.	.	.	.	.	.	.	.	G	5.013	0.188144	0.09547	.	.	ENSG00000081721	ENST00000367943	T	0.60040	0.22	4.72	1.78	0.24846	Dual specificity phosphatase, subgroup, catalytic domain (2);	0.774714	0.12171	N	0.493025	T	0.18467	0.0443	N	0.19112	0.55	0.09310	N	0.999997	B	0.30439	0.279	B	0.30029	0.11	T	0.14924	-1.0455	10	0.44086	T	0.13	.	5.3968	0.16273	0.0944:0.0:0.5484:0.3572	.	31	Q9UNI6	DUS12_HUMAN	H	31	ENSP00000356920:Q31H	ENSP00000356920:Q31H	Q	+	3	2	DUSP12	159986308	1.000000	0.71417	0.063000	0.19743	0.000000	0.00434	2.289000	0.43523	0.209000	0.20645	-1.114000	0.02060	CAG	-	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc		0.672	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP12	protein_coding	OTTHUMT00000083588.1	G	NM_007240		159986308	+1	no_errors	NM_007240	genbank	human	reviewed	54_36p	missense	SNP	0.958	C
COBLL1	22837	genome.wustl.edu	37	2	165600307	165600307	+	Silent	SNP	T	T	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr2:165600307T>C	ENST00000392717.2	-	3	238	c.234A>G	c.(232-234)gtA>gtG	p.V78V	COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000375458.2_Silent_p.V40V|COBLL1_ENST00000409184.3_Silent_p.V78V|COBLL1_ENST00000194871.6_Silent_p.V93V|COBLL1_ENST00000342193.4_Silent_p.V40V			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	78						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						CAGTGGATTCTACAGAATCAG	0.393																																																0			2											110.0	105.0	107.0					2																	165600307		2203	4300	6503	165308553	SO:0001819	synonymous_variant	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.234A>G	2.37:g.165600307T>C			165308553	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Silent	SNP	HMMPfam_Cobl	p.V40	ENST00000392717.2	37	c.120		2	.	.	.	.	.	.	.	.	.	.	T	6.191	0.403374	0.11754	.	.	ENSG00000082438	ENST00000452626	.	.	.	6.17	5.03	0.67393	.	.	.	.	.	T	0.56001	0.1956	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55392	-0.8148	4	.	.	.	-3.9612	5.9297	0.19132	0.0:0.1301:0.1458:0.7241	.	.	.	.	G	43	.	.	R	-	1	2	COBLL1	165308553	0.665000	0.27466	0.821000	0.32701	0.471000	0.32888	0.313000	0.19415	2.371000	0.80710	0.533000	0.62120	AGA	-	HMMPfam_Cobl		0.393	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	protein_coding		T	NM_014900		165308553	-1	no_errors	NM_014900	genbank	human	validated	54_36p	silent	SNP	0.974	C
WDR49	151790	genome.wustl.edu	37	3	167293809	167293809	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr3:167293809T>C	ENST00000308378.3	-	4	688	c.383A>G	c.(382-384)aAt>aGt	p.N128S	WDR49_ENST00000476376.1_5'Flank|WDR49_ENST00000479765.1_Missense_Mutation_p.N469S|WDR49_ENST00000453925.2_Missense_Mutation_p.N181S	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	128										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TAGCTGGTTATTAAACGAGAT	0.428																																																0			3											165.0	163.0	164.0					3																	167293809		2203	4300	6503	168776503	SO:0001583	missense	151790			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.383A>G	3.37:g.167293809T>C	ENSP00000311343:p.Asn128Ser		168776503	Q8N297	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.N128S	ENST00000308378.3	37	c.383	CCDS3201.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.17|12.17	1.858988|1.858988	0.32884|0.32884	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000479765;ENST00000453925	.|T;T;T	.|0.51071	.|0.72;1.95;1.15	5.76|5.76	4.6|4.6	0.57074|0.57074	.|WD40-repeat-containing domain (1);	.|0.477788	.|0.24098	.|N	.|0.041578	T|T	0.55273|0.55273	0.1910|0.1910	L|L	0.56769|0.56769	1.78|1.78	0.26051|0.26051	N|N	0.981478|0.981478	.|P;P;D	.|0.62365	.|0.911;0.911;0.991	.|P;P;P	.|0.57101	.|0.609;0.609;0.813	T|T	0.49624|0.49624	-0.8920|-0.8920	5|10	.|0.45353	.|T	.|0.12	.|.	8.5687|8.5687	0.33556|0.33556	0.0:0.1536:0.0:0.8464|0.0:0.1536:0.0:0.8464	.|.	.|181;469;128	.|E7EQK3;E9PDB0;Q8IV35	.|.;.;WDR49_HUMAN	V|S	193|128;469;181	.|ENSP00000311343:N128S;ENSP00000419749:N469S;ENSP00000410863:N181S	.|ENSP00000311343:N128S	I|N	-|-	1|2	0|0	WDR49|WDR49	168776503|168776503	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.470000|0.470000	0.32858|0.32858	1.970000|1.970000	0.40520|0.40520	1.026000|1.026000	0.39733|0.39733	0.529000|0.529000	0.55759|0.55759	ATA|AAT	-	NULL		0.428	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	protein_coding	OTTHUMT00000350592.3	T	NM_178824		168776503	-1	no_errors	NM_178824	genbank	human	provisional	54_36p	missense	SNP	0.998	C
TTN	7273	genome.wustl.edu	37	2	179641161	179641161	+	Silent	SNP	C	C	T			TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr2:179641161C>T	ENST00000591111.1	-	28	5654	c.5430G>A	c.(5428-5430)agG>agA	p.R1810R	TTN_ENST00000359218.5_Silent_p.R1764R|TTN_ENST00000460472.2_Silent_p.R1764R|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Silent_p.R1764R|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000589042.1_Silent_p.R1810R|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.R1810R|TTN_ENST00000360870.5_Silent_p.R1810R			Q8WZ42	TITIN_HUMAN	titin	12638					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTAAGCCTTTCCTCCCCTCAG	0.413																																																0			2											123.0	126.0	125.0					2																	179641161		2203	4300	6503	179349406	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5430G>A	2.37:g.179641161C>T			179349406	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.R1810	ENST00000591111.1	37	c.5430		2																																																																																			-	NULL		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179349406	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	silent	SNP	0.996	T
IRF6	3664	genome.wustl.edu	37	1	209974625	209974625	+	Missense_Mutation	SNP	C	C	G	rs121434229		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:209974625C>G	ENST00000367021.3	-	3	306	c.134G>C	c.(133-135)cGg>cCg	p.R45P	IRF6_ENST00000542854.1_Intron	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	45			R -> Q (in VWS1; dbSNP:rs121434229). {ECO:0000269|PubMed:14618417}.		cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		AGGGCTATGCCGGGTGGCATG	0.468										HNSCC(57;0.16)																																						0			1	GRCh37	CM034818	IRF6	M	rs121434229						87.0	94.0	92.0					1																	209974625		2203	4300	6503	208041248	SO:0001583	missense	3664			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.134G>C	1.37:g.209974625C>G	ENSP00000355988:p.Arg45Pro		208041248	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	HMMSmart_IRF,HMMPfam_IRF,superfamily_SSF46785,PatternScan_IRF,superfamily_SMAD_FHA,HMMPfam_IRF-3	p.R45P	ENST00000367021.3	37	c.134	CCDS1492.1	1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982735	0.93044	.	.	ENSG00000117595	ENST00000367021;ENST00000456314	D;D	0.98400	-4.91;-4.91	6.17	6.17	0.99709	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.052273	0.85682	D	0.000000	D	0.99315	0.9760	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98914	1.0781	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	45	O14896	IRF6_HUMAN	P	45	ENSP00000355988:R45P;ENSP00000403855:R45P	.	R	-	2	0	IRF6	208041248	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.311000	0.78958	2.941000	0.99782	0.655000	0.94253	CGG	-	HMMSmart_IRF,HMMPfam_IRF,superfamily_SSF46785,PatternScan_IRF		0.468	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF6	protein_coding	OTTHUMT00000088827.1	C	NM_006147		208041248	-1	no_errors	NM_006147	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
ALPP	250	genome.wustl.edu	37	2	233244520	233244520	+	Silent	SNP	G	G	A	rs559539627	byFrequency	TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr2:233244520G>A	ENST00000392027.2	+	5	800	c.531G>A	c.(529-531)tcG>tcA	p.S177S	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	177					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		AGCACGCCTCGCCAGCCGGCA	0.642													g|||	3	0.000599042	0.0	0.0	5008	,	,		17252	0.003		0.0	False		,,,				2504	0.0															0			2											60.0	59.0	59.0					2																	233244520		2203	4300	6503	232952764	SO:0001819	synonymous_variant	250			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.531G>A	2.37:g.233244520G>A			232952764	P05188|P06861|Q53S78|Q96DB7	Silent	SNP	superfamily_Alkaline_phosphatase_core,HMMPfam_Alk_phosphatase,HMMSmart_alkPPc,PatternScan_ALKALINE_PHOSPHATASE	p.S177	ENST00000392027.2	37	c.531	CCDS2490.1	2																																																																																			-	superfamily_Alkaline_phosphatase_core,HMMPfam_Alk_phosphatase,HMMSmart_alkPPc		0.642	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	protein_coding	OTTHUMT00000257032.3	G	NM_001632		232952764	+1	no_errors	NM_001632	genbank	human	reviewed	54_36p	silent	SNP	0.918	A
RYR2	6262	genome.wustl.edu	37	1	237778047	237778047	+	Silent	SNP	A	A	G	rs373282364		TCGA-61-2614-01A-01W-1092-09	TCGA-61-2614-10A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ec119114-e654-480b-a6ef-282992d76708	d95e281c-8521-42b7-922a-067244a4fcce	g.chr1:237778047A>G	ENST00000366574.2	+	37	5936	c.5619A>G	c.(5617-5619)gcA>gcG	p.A1873A	RYR2_ENST00000360064.6_Silent_p.A1871A|RYR2_ENST00000542537.1_Silent_p.A1857A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1873	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGACGATGCAAAGCTGCAAG	0.537																																																0			1						A		0,4094		0,0,2047	51.0	53.0	53.0		5619	-11.2	0.0	1		53	2,8364		0,2,4181	no	coding-synonymous	RYR2	NM_001035.2		0,2,6228	GG,GA,AA		0.0239,0.0,0.0161		1873/4968	237778047	2,12458	2047	4183	6230	235844670	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5619A>G	1.37:g.237778047A>G			235844670	Q15411|Q546N8|Q5T3P2	Silent	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.A1873	ENST00000366574.2	37	c.5619	CCDS55691.1	1																																																																																			-	NULL		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	A	NM_001035		235844670	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	silent	SNP	0.004	G
