#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
H6PD	9563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9305536	9305536	+	Silent	SNP	C	C	T	rs375431974		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:9305536C>T	ENST00000377403.2	+	2	845	c.543C>T	c.(541-543)ttC>ttT	p.F181F	H6PD_ENST00000602477.1_Silent_p.F192F	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	181	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		ATGACCACTTCTCAGCCCAGC	0.587																																					p.F181F		.											.	H6PD-90	0			c.C543T						.						47.0	52.0	50.0					1																	9305536		2203	4300	6503	SO:0001819	synonymous_variant	9563	exon2			CCACTTCTCAGCC	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.543C>T	1.37:g.9305536C>T		108	0		101	39	NM_004285	0	0	5	10	5	Q4TT33|Q66I35|Q68DT3	Silent	SNP	ENST00000377403.2	37	CCDS101.1																																																																																			.		0.587	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
NCMAP	400746	broad.mit.edu;bcgsc.ca	37	1	24921934	24921934	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:24921934A>T	ENST00000374392.2	+	2	79	c.13A>T	c.(13-15)Acc>Tcc	p.T5S	NCMAP_ENST00000486262.1_3'UTR	NM_001010980.4	NP_001010980.1	Q5T1S8	NCMAP_HUMAN	noncompact myelin associated protein	5					peripheral nervous system myelin formation (GO:0032290)|positive regulation of myelination (GO:0031643)	integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|Schmidt-Lanterman incisure (GO:0043220)	structural constituent of myelin sheath (GO:0019911)										GACCACAGCCACCCCTCTGGG	0.423																																					p.T5S													.	.	0			c.A13T						.						63.0	60.0	61.0					1																	24921934		2203	4300	6503	SO:0001583	missense	400746	exon2			ACAGCCACCCCTC	AK124519	CCDS30632.1	1p36.11	2012-07-31	2012-07-31	2012-07-31	ENSG00000184454	ENSG00000184454			29332	protein-coding gene	gene with protein product	"""myelin protein of 11 kDa"""		"""chromosome 1 open reading frame 130"""	C1orf130		18650334	Standard	NM_001010980		Approved	FLJ42528, MP11	uc001bjk.2	Q5T1S8	OTTHUMG00000003317	ENST00000374392.2:c.13A>T	1.37:g.24921934A>T	ENSP00000363513:p.Thr5Ser	93	3		78	36	NM_001010980	0	0	1	1	0	A0PK04|B2RV34	Missense_Mutation	SNP	ENST00000374392.2	37	CCDS30632.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.815513	0.70912	.	.	ENSG00000184454	ENST00000374392	.	.	.	5.51	4.21	0.49690	.	0.249082	0.40385	N	0.001107	T	0.21631	0.0521	L	0.27053	0.805	0.28038	N	0.933887	P	0.40180	0.705	B	0.38264	0.269	T	0.07539	-1.0767	9	0.30854	T	0.27	-28.5482	5.6803	0.17771	0.8527:0.0:0.1473:0.0	.	5	Q5T1S8	CA130_HUMAN	S	5	.	ENSP00000363513:T5S	T	+	1	0	C1orf130	24794521	0.984000	0.35163	1.000000	0.80357	0.868000	0.49771	1.756000	0.38390	2.212000	0.71576	0.460000	0.39030	ACC	.		0.423	NCMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009288.2	NM_001010980	
KANK4	163782	bcgsc.ca	37	1	62740358	62740358	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:62740358A>T	ENST00000371153.4	-	3	796	c.418T>A	c.(418-420)Ttg>Atg	p.L140M	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	140						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GCAGCTTCCAACTGTCTGGTG	0.602																																					p.L140M													.	KANK4-74	0			c.T418A						.						35.0	40.0	38.0					1																	62740358		2202	4300	6502	SO:0001583	missense	163782	exon3			CTTCCAACTGTCT	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.418T>A	1.37:g.62740358A>T	ENSP00000360195:p.Leu140Met	51	1		61	27	NM_181712	0	0	0	0	0	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.588891	0.46110	.	.	ENSG00000132854	ENST00000371153	T	0.78364	-1.17	4.99	-9.97	0.00440	.	2.125810	0.03072	N	0.157253	T	0.63570	0.2522	L	0.36672	1.1	0.09310	N	1	P	0.36438	0.553	B	0.33042	0.157	T	0.63024	-0.6729	10	0.40728	T	0.16	3.7777	9.5324	0.39202	0.1:0.429:0.4065:0.0645	.	140	Q5T7N3	KANK4_HUMAN	M	140	ENSP00000360195:L140M	ENSP00000360195:L140M	L	-	1	2	KANK4	62512946	0.000000	0.05858	0.000000	0.03702	0.492000	0.33523	-2.970000	0.00668	-3.647000	0.00127	-0.376000	0.06991	TTG	.		0.602	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
RABGGTB	5876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	76253203	76253203	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:76253203A>G	ENST00000319942.3	+	2	96	c.25A>G	c.(25-27)Att>Gtt	p.I9V	RABGGTB_ENST00000535300.1_5'UTR|SNORD45A_ENST00000384512.1_RNA|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000370826.3_Missense_Mutation_p.I9V|SNORD45B_ENST00000364617.1_RNA|RABGGTB_ENST00000496055.1_3'UTR	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	9					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						GAAGGATGTTATTATCAAGTC	0.368																																					p.I9V		.											.	RABGGTB-227	0			c.A25G						.						147.0	134.0	139.0					1																	76253203		2203	4300	6503	SO:0001583	missense	5876	exon2			GATGTTATTATCA	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.25A>G	1.37:g.76253203A>G	ENSP00000317473:p.Ile9Val	127	0		162	72	NM_004582	0	0	56	113	57	Q92697	Missense_Mutation	SNP	ENST00000319942.3	37	CCDS669.1	.	.	.	.	.	.	.	.	.	.	A	9.952	1.220540	0.22457	.	.	ENSG00000137955	ENST00000319942;ENST00000370824;ENST00000370826	.	.	.	5.05	0.547	0.17202	.	0.830524	0.11309	N	0.577349	T	0.07683	0.0193	N	0.05199	-0.095	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.39292	-0.9621	9	0.29301	T	0.29	-8.2035	10.2082	0.43126	0.5747:0.0:0.4253:0.0	.	9	P53611	PGTB2_HUMAN	V	9	.	ENSP00000317473:I9V	I	+	1	0	RABGGTB	76025791	0.001000	0.12720	0.210000	0.23637	0.847000	0.48162	0.335000	0.19806	0.044000	0.15775	0.533000	0.62120	ATT	.		0.368	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582	
OVGP1	5016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	111957940	111957940	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:111957940A>C	ENST00000369732.3	-	11	1238	c.1183T>G	c.(1183-1185)Ttt>Gtt	p.F395V	OVGP1_ENST00000540696.1_3'UTR	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	395					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GACAGCCAAAATTGTGGTAAA	0.433																																					p.F395V		.											.	OVGP1-135	0			c.T1183G						.						48.0	46.0	47.0					1																	111957940		2203	4300	6503	SO:0001583	missense	5016	exon11			GCCAAAATTGTGG	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1183T>G	1.37:g.111957940A>C	ENSP00000358747:p.Phe395Val	91	0		98	38	NM_002557	0	0	34	63	29	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791958	0.31685	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.03860	3.78	4.43	0.705	0.18127	.	0.784649	0.10922	N	0.619328	T	0.00875	0.0029	L	0.36672	1.1	0.09310	N	1	B;P	0.39831	0.105;0.69	B;B	0.29598	0.014;0.104	T	0.47623	-0.9103	10	0.22109	T	0.4	-2.4013	3.3373	0.07106	0.5411:0.0:0.0994:0.3595	.	395;459	Q12889;Q59HH5	OVGP1_HUMAN;.	V	395;459;203	ENSP00000358747:F395V	ENSP00000358743:F459V	F	-	1	0	OVGP1	111759463	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	0.154000	0.16343	0.097000	0.17492	0.477000	0.44152	TTT	.		0.433	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
NOTCH2	4853	bcgsc.ca	37	1	120506375	120506375	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:120506375G>T	ENST00000256646.2	-	11	1956	c.1737C>A	c.(1735-1737)tgC>tgA	p.C579*		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	579	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACCATGGTGGCAAGGATCGG	0.468			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C579X				Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C1737A						.						203.0	191.0	195.0					1																	120506375		2203	4300	6503	SO:0001587	stop_gained	4853	exon11	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	ATGGTGGCAAGGA	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.1737C>A	1.37:g.120506375G>T	ENSP00000256646:p.Cys579*	74	0		93	5	NM_024408	0	0	14	14	0	Q5T3X7|Q99734|Q9H240	Nonsense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	40	8.141015	0.98672	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	.	.	.	5.53	2.61	0.31194	.	0.000000	0.41194	U	0.000931	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2182	0.37360	0.2947:0.0:0.7053:0.0	.	.	.	.	X	579;540	.	ENSP00000256646:C579X	C	-	3	2	NOTCH2	120307898	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.660000	0.37397	0.817000	0.34445	0.655000	0.94253	TGC	.		0.468	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
CCT3	7203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156294858	156294858	+	Silent	SNP	A	A	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:156294858A>G	ENST00000295688.3	-	6	607	c.327T>C	c.(325-327)gcT>gcC	p.A109A	CCT3_ENST00000368261.3_Silent_p.A64A|CCT3_ENST00000368259.2_Silent_p.A71A|CCT3_ENST00000472765.2_Silent_p.A64A	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	109					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGAAGTGCTCAGCTACAGACA	0.413																																					p.A109A		.											.	CCT3-92	0			c.T327C						.						92.0	84.0	87.0					1																	156294858		2203	4300	6503	SO:0001819	synonymous_variant	7203	exon6			GTGCTCAGCTACA	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.327T>C	1.37:g.156294858A>G		30	0		36	17	NM_005998	0	0	88	172	84	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	ENST00000295688.3	37	CCDS1140.2																																																																																			.		0.413	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
HHIPL2	79802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	222705394	222705394	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:222705394C>T	ENST00000343410.6	-	6	1695	c.1637G>A	c.(1636-1638)tGc>tAc	p.C546Y		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	546					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCTGCCCAGGCAAAGATCCTG	0.428																																					p.C546Y		.											.	HHIPL2-69	0			c.G1637A						.						87.0	87.0	87.0					1																	222705394		2203	4300	6503	SO:0001583	missense	79802	exon6			CCCAGGCAAAGAT	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1637G>A	1.37:g.222705394C>T	ENSP00000342118:p.Cys546Tyr	56	0		65	31	NM_024746	0	0	0	0	0	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.343683	0.82022	.	.	ENSG00000143512	ENST00000343410	T	0.13307	2.6	5.0	5.0	0.66597	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.47600	0.1454	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58532	-0.7620	10	0.51188	T	0.08	-17.4954	17.9254	0.88982	0.0:1.0:0.0:0.0	.	546	Q6UWX4	HIPL2_HUMAN	Y	546	ENSP00000342118:C546Y	ENSP00000342118:C546Y	C	-	2	0	HHIPL2	220772017	1.000000	0.71417	0.980000	0.43619	0.936000	0.57629	5.693000	0.68264	2.304000	0.77564	0.591000	0.81541	TGC	.		0.428	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
C1orf95	375057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	226784625	226784625	+	Missense_Mutation	SNP	G	G	A	rs531129279		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:226784625G>A	ENST00000366788.3	+	2	430	c.325G>A	c.(325-327)Gtc>Atc	p.V109I	C1orf95_ENST00000366789.4_Missense_Mutation_p.V109I	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	109						integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		CACTGCCATCGTCATGGTGGG	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22256	0.0		0.0	False		,,,				2504	0.0				p.V109I		.											.	C1orf95-91	0			c.G325A						.						167.0	143.0	151.0					1																	226784625		2203	4300	6503	SO:0001583	missense	375057	exon2			GCCATCGTCATGG	AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.325G>A	1.37:g.226784625G>A	ENSP00000355752:p.Val109Ile	84	0		91	38	NM_001003665	0	0	0	0	0	A6NGL2	Missense_Mutation	SNP	ENST00000366788.3	37	CCDS31044.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469818	0.43839	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	5.82	5.82	0.92795	.	0.154593	0.43919	D	0.000509	T	0.34658	0.0905	N	0.03324	-0.35	0.38912	D	0.957563	B	0.24368	0.102	B	0.17979	0.02	T	0.34825	-0.9813	9	0.08599	T	0.76	1.3905	19.6956	0.96023	0.0:0.0:1.0:0.0	.	109	Q69YW2	CA095_HUMAN	I	109	.	ENSP00000355752:V109I	V	+	1	0	C1orf95	224851248	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.144000	0.71762	2.756000	0.94617	0.561000	0.74099	GTC	.		0.612	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665	
CYP26C1	340665	broad.mit.edu	37	10	94828244	94828244	+	Silent	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr10:94828244C>A	ENST00000285949.5	+	6	1359	c.1359C>A	c.(1357-1359)ggC>ggA	p.G453G		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	453					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				TCCCGTTCGGCGGCGGTGCGC	0.697																																					p.G453G													.	CYP26C1-90	0			c.C1359A						.						8.0	10.0	9.0					10																	94828244		1922	3896	5818	SO:0001819	synonymous_variant	340665	exon6			GTTCGGCGGCGGT		CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.1359C>A	10.37:g.94828244C>A		42	0		54	4	NM_183374	0	0	0	0	0	Q5VXH6	Silent	SNP	ENST00000285949.5	37	CCDS7425.1																																																																																			.		0.697	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374	
MUC5B	727897	hgsc.bcm.edu	37	11	1276776	1276776	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:1276776G>T	ENST00000529681.1	+	37	16112	c.16054G>T	c.(16054-16056)Ggt>Tgt	p.G5352C	MUC5B_ENST00000447027.1_Missense_Mutation_p.G5355C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5352					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGGTGCAACCGGTGGCCTGTG	0.746																																					p.G5352C		.											.	.	0			c.G16054T						.						6.0	7.0	7.0					11																	1276776		1853	3899	5752	SO:0001583	missense	727897	exon37			GCAACCGGTGGCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16054G>T	11.37:g.1276776G>T	ENSP00000436812:p.Gly5352Cys	53	0		62	4	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	g	7.246	0.602241	0.13939	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.17054	2.3;2.47	4.01	-2.42	0.06542	.	.	.	.	.	T	0.34513	0.0900	M	0.79475	2.455	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.977	T	0.16012	-1.0417	9	0.87932	D	0	.	5.244	0.15487	0.4649:0.181:0.3541:0.0	.	5689;5355	A7Y9J9;E9PBJ0	.;.	C	5352;5355;5296;251;5064	ENSP00000436812:G5352C;ENSP00000415793:G5355C	ENSP00000343037:G5296C	G	+	1	0	MUC5B	1233352	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-3.094000	0.00607	-0.833000	0.04245	0.448000	0.29417	GGT	.		0.746	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OSBPL5	114879	ucsc.edu	37	11	3143330	3143330	+	Splice_Site	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:3143330T>C	ENST00000263650.7	-	5	460		c.e5-2		OSBPL5_ENST00000348039.5_Splice_Site|OSBPL5_ENST00000389989.3_Splice_Site|OSBPL5_ENST00000542243.1_Splice_Site|OSBPL5_ENST00000525498.1_Splice_Site	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5						cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CTTCTGCGCCTGGGCCCGGGG	0.692																																					.													.	OSBPL5-113	0			c.301-2A>G						.						37.0	30.0	32.0					11																	3143330		2189	4290	6479	SO:0001630	splice_region_variant	114879	exon6			TGCGCCTGGGCCC	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.301-2A>G	11.37:g.3143330T>C		33	0		39	4	NM_001144063	0	0	0	0	0	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Splice_Site	SNP	ENST00000263650.7	37	CCDS31344.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066069	0.36470	.	.	ENSG00000021762	ENST00000263650;ENST00000389989;ENST00000525498;ENST00000542243;ENST00000348039;ENST00000533234;ENST00000526122	.	.	.	4.17	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3464	0.60575	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	OSBPL5	3099906	1.000000	0.71417	0.973000	0.42090	0.193000	0.23685	7.255000	0.78338	1.760000	0.52011	0.459000	0.35465	.	.		0.692	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		Intron
DTX4	23220	ucsc.edu;bcgsc.ca	37	11	58949824	58949824	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:58949824C>T	ENST00000227451.3	+	2	928	c.824C>T	c.(823-825)gCc>gTc	p.A275V	DTX4_ENST00000532982.1_Missense_Mutation_p.A169V	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	275					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				GGCTCTCCTGCCAGTCCCCCA	0.642																																					p.A275V													.	DTX4-501	0			c.C824T						.						26.0	37.0	33.0					11																	58949824		2040	4177	6217	SO:0001583	missense	23220	exon2			CTCCTGCCAGTCC	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.824C>T	11.37:g.58949824C>T	ENSP00000227451:p.Ala275Val	30	0		32	4	NM_015177	0	0	2	2	0	Q0VF38	Missense_Mutation	SNP	ENST00000227451.3	37	CCDS44612.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156869	0.38119	.	.	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.11604	2.76;2.95	4.62	4.62	0.57501	.	0.565173	0.14508	U	0.315331	T	0.13114	0.0318	L	0.54323	1.7	0.36624	D	0.875918	P	0.37061	0.58	B	0.35114	0.196	T	0.15838	-1.0423	10	0.33940	T	0.23	.	14.4938	0.67670	0.0:1.0:0.0:0.0	.	275	Q9Y2E6	DTX4_HUMAN	V	169;275	ENSP00000434055:A169V;ENSP00000227451:A275V	ENSP00000227451:A275V	A	+	2	0	DTX4	58706400	0.999000	0.42202	0.997000	0.53966	0.943000	0.58893	3.118000	0.50414	2.410000	0.81850	0.655000	0.94253	GCC	.		0.642	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394228.1	XM_166213	
SF3B2	10992	broad.mit.edu;bcgsc.ca	37	11	65826742	65826742	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:65826742C>T	ENST00000322535.6	+	11	1302	c.1253C>T	c.(1252-1254)gCc>gTc	p.A418V	SF3B2_ENST00000528302.1_Missense_Mutation_p.A401V	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	418					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AACTCTGCAGCCCCCAAGAAG	0.532																																					p.A418V													.	SF3B2-92	0			c.C1253T						.						62.0	55.0	58.0					11																	65826742		2201	4295	6496	SO:0001583	missense	10992	exon11			CTGCAGCCCCCAA	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1253C>T	11.37:g.65826742C>T	ENSP00000318861:p.Ala418Val	132	0		141	6	NM_006842	0	0	152	153	1	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	37	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315405	0.23908	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000355456	.	.	.	5.06	-0.939	0.10408	.	0.379232	0.29073	N	0.013223	T	0.23289	0.0563	L	0.27053	0.805	0.19575	N	0.999966	B	0.02656	0.0	B	0.04013	0.001	T	0.20140	-1.0284	9	0.18276	T	0.48	0.0053	8.4596	0.32921	0.0:0.4852:0.0:0.5148	.	418	Q13435	SF3B2_HUMAN	V	401;418;322	.	ENSP00000318861:A418V	A	+	2	0	SF3B2	65583318	0.339000	0.24784	0.028000	0.17463	0.984000	0.73092	0.269000	0.18589	-0.516000	0.06470	0.555000	0.69702	GCC	.		0.532	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
VPS26B	112936	broad.mit.edu;bcgsc.ca	37	11	134095054	134095054	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:134095054A>T	ENST00000281187.5	+	1	516	c.38A>T	c.(37-39)gAa>gTa	p.E13V	NCAPD3_ENST00000534548.2_5'Flank|VPS26B_ENST00000525095.2_Missense_Mutation_p.E13V|NCAPD3_ENST00000526422.1_5'Flank	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	13					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GTGGAGGTGGAAATCCTTCTG	0.642																																					p.E13V	Colon(171;1263 1952 15904 45703 47982)												.	VPS26B-90	0			c.A38T						.						58.0	61.0	60.0					11																	134095054		2201	4297	6498	SO:0001583	missense	112936	exon1			AGGTGGAAATCCT		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.38A>T	11.37:g.134095054A>T	ENSP00000281187:p.Glu13Val	92	2		89	44	NM_052875	0	0	5	7	2	Q96A55	Missense_Mutation	SNP	ENST00000281187.5	37	CCDS8495.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497538	0.85069	.	.	ENSG00000151502	ENST00000281187;ENST00000525095	.	.	.	4.82	4.82	0.62117	.	0.227351	0.44688	D	0.000426	T	0.76513	0.3998	M	0.86268	2.805	0.80722	D	1	B	0.27853	0.191	B	0.40329	0.326	T	0.78904	-0.2020	9	0.72032	D	0.01	0.1557	14.3603	0.66766	1.0:0.0:0.0:0.0	.	13	Q4G0F5	VP26B_HUMAN	V	13	.	ENSP00000281187:E13V	E	+	2	0	VPS26B	133600264	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.048000	0.93830	1.780000	0.52325	0.460000	0.39030	GAA	.		0.642	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1	NM_052875	
WNT10B	7480	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49362081	49362081	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr12:49362081G>T	ENST00000301061.4	-	4	707	c.359C>A	c.(358-360)tCc>tAc	p.S120Y	WNT10B_ENST00000403957.1_Missense_Mutation_p.S120Y|WNT10B_ENST00000407467.1_Missense_Mutation_p.S120Y	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	120					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						CATGGAGAAGGAAAAAGCACT	0.572																																					p.S120Y													.	WNT10B-565	0			c.C359A						.						64.0	59.0	61.0					12																	49362081		2203	4300	6503	SO:0001583	missense	7480	exon4			GAGAAGGAAAAAG	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.359C>A	12.37:g.49362081G>T	ENSP00000301061:p.Ser120Tyr	16	0		16	12	NM_003394	0	0	0	0	0	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	ENST00000301061.4	37	CCDS8775.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.82|10.82	1.457007|1.457007	0.26161|0.26161	.|.	.|.	ENSG00000169884|ENSG00000169884	ENST00000413630|ENST00000301061;ENST00000407467;ENST00000403957	T|T;T;T	0.79141|0.75938	-1.24|-0.98;-0.98;-0.98	5.01|5.01	4.12|4.12	0.48240|0.48240	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79452|0.79452	0.4448|0.4448	L|L	0.52573|0.52573	1.65|1.65	0.46586|0.46586	D|D	0.999111|0.999111	.|D;D	.|0.64830	.|0.994;0.973	.|D;P	.|0.64410	.|0.925;0.793	T|T	0.80111|0.80111	-0.1519|-0.1519	7|10	0.87932|0.87932	D|D	0|0	.|.	9.1429|9.1429	0.36914|0.36914	0.1709:0.0:0.8291:0.0|0.1709:0.0:0.8291:0.0	.|.	.|120;120	.|Q4VAJ4;O00744	.|.;WN10B_HUMAN	T|Y	132|120	ENSP00000398473:P132T|ENSP00000301061:S120Y;ENSP00000384691:S120Y;ENSP00000385980:S120Y	ENSP00000398473:P132T|ENSP00000301061:S120Y	P|S	-|-	1|2	0|0	WNT10B|WNT10B	47648348|47648348	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	6.797000|6.797000	0.75150|0.75150	1.256000|1.256000	0.44068|0.44068	0.491000|0.491000	0.48974|0.48974	CCT|TCC	.		0.572	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
BAZ2A	11176	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57006901	57006901	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr12:57006901T>A	ENST00000551812.1	-	5	1232	c.1039A>T	c.(1039-1041)Aat>Tat	p.N347Y	BAZ2A_ENST00000379441.3_Missense_Mutation_p.N317Y|BAZ2A_ENST00000179765.5_Missense_Mutation_p.N315Y|BAZ2A_ENST00000549884.1_Missense_Mutation_p.N345Y	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	347					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GCAGTAGCATTATTGAGGGAA	0.512																																					p.N347Y													.	BAZ2A-22	0			c.A1039T						.						126.0	128.0	127.0					12																	57006901		2020	4186	6206	SO:0001583	missense	11176	exon5			TAGCATTATTGAG	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1039A>T	12.37:g.57006901T>A	ENSP00000446880:p.Asn347Tyr	88	1		122	57	NM_013449	0	0	2	8	6	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	T	18.62	3.663979	0.67700	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.14	5.14	0.70334	.	0.666605	0.15507	N	0.258746	T	0.40297	0.1111	N	0.14661	0.345	0.30496	N	0.77083	P;B	0.36837	0.571;0.435	B;B	0.35607	0.206;0.102	T	0.49606	-0.8922	10	0.87932	D	0	-27.8089	9.888	0.41272	0.0:0.0:0.279:0.721	.	345;347	F8VU39;Q9UIF9	.;BAZ2A_HUMAN	Y	317;315;347;345	ENSP00000368754:N317Y;ENSP00000179765:N315Y;ENSP00000446880:N347Y;ENSP00000447941:N345Y	ENSP00000179765:N315Y	N	-	1	0	BAZ2A	55293168	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.938000	0.40203	2.291000	0.77112	0.533000	0.62120	AAT	.		0.512	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
TMTC2	160335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	83251132	83251132	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr12:83251132G>T	ENST00000321196.3	+	2	1134	c.427G>T	c.(427-429)Ggg>Tgg	p.G143W	TMTC2_ENST00000549919.1_Missense_Mutation_p.G137W|TMTC2_ENST00000548305.1_Missense_Mutation_p.G143W	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	143					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						AGCCGATGTCGGGGCCAGTCT	0.547																																					p.G143W		.											.	TMTC2-92	0			c.G427T						.						115.0	95.0	102.0					12																	83251132		2203	4300	6503	SO:0001583	missense	160335	exon2			GATGTCGGGGCCA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.427G>T	12.37:g.83251132G>T	ENSP00000322300:p.Gly143Trp	82	0		84	37	NM_152588	0	0	0	1	1	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146896	0.77888	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	T;T;T	0.60797	0.82;0.16;0.72	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.80171	-0.1493	10	0.72032	D	0.01	-15.2295	18.1624	0.89712	0.0:0.0:1.0:0.0	.	143;143	Q8N394;F8VSH2	TMTC2_HUMAN;.	W	143;143;137	ENSP00000322300:G143W;ENSP00000448292:G143W;ENSP00000447609:G137W	ENSP00000322300:G143W	G	+	1	0	TMTC2	81775263	1.000000	0.71417	0.941000	0.38009	0.945000	0.59286	9.174000	0.94824	2.788000	0.95919	0.650000	0.86243	GGG	.		0.547	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
FOXA1	3169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	38060788	38060788	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:38060788A>T	ENST00000250448.2	-	2	1262	c.1201T>A	c.(1201-1203)Tcc>Acc	p.S401T	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.S368T	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	401					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TTGTTGATGGAGAACGGGTGG	0.602																																					p.S401T		.											.	FOXA1-226	0			c.T1201A						.						109.0	78.0	89.0					14																	38060788		2203	4300	6503	SO:0001583	missense	3169	exon2			TGATGGAGAACGG	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1201T>A	14.37:g.38060788A>T	ENSP00000250448:p.Ser401Thr	98	0		116	63	NM_004496	0	0	1	1	0	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	37	CCDS9665.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.861765	0.71949	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	T;T	0.72051	-0.62;-0.62	4.29	4.29	0.51040	Forkhead box protein, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83727	0.5317	M	0.83384	2.64	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.86303	0.1681	10	0.87932	D	0	.	12.5253	0.56083	1.0:0.0:0.0:0.0	.	401	P55317	FOXA1_HUMAN	T	401;368	ENSP00000250448:S401T;ENSP00000440178:S368T	ENSP00000250448:S401T	S	-	1	0	FOXA1	37130539	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.050000	0.93843	1.798000	0.52647	0.329000	0.21502	TCC	.		0.602	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1		
HEATR4	399671	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73959009	73959009	+	Intron	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:73959009G>A	ENST00000553558.1	-	17	3166				C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Intron|HEATR4_ENST00000334988.2_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TACCTGGGGTGACTTCTTAGA	0.542																																					.													.	.	0			.						.						74.0	75.0	75.0					14																	73959009		2042	4191	6233	SO:0001627	intron_variant	79697	.			TGGGGTGACTTCT	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2844+760C>T	14.37:g.73959009G>A		45	0		53	24	.	0	0	8	13	5	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2																																																																																			.		0.542	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493794	77493794	+	Silent	SNP	T	T	C	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:77493794T>C	ENST00000238647.3	-	1	1240	c.342A>G	c.(340-342)caA>caG	p.Q114Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgttgctgctgct	0.697													T|||	1146	0.228834	0.1649	0.1758	5008	,	,		5976	0.2659		0.2614	False		,,,				2504	0.2812				p.Q114Q		.											.	IRF2BPL-90	0			c.A342G						.	-		160,2330		6,148,1091	2.0	2.0	2.0		342	0.6	0.0	14	dbSNP_125	2	324,4012		7,310,1851	no	coding-synonymous	IRF2BPL	NM_024496.2		13,458,2942	CC,CT,TT		7.4723,6.4257,7.0905		114/797	77493794	484,6342	1245	2168	3413	SO:0001819	synonymous_variant	64207	exon1			CTGCTGTTGCTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342A>G	14.37:g.77493794T>C		3	0		6	5	NM_024496	4	11	69	9962	9878	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			.		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
MOK	5891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102718326	102718326	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:102718326C>A	ENST00000361847.2	-	5	521	c.290G>T	c.(289-291)aGa>aTa	p.R97I	MOK_ENST00000524214.1_Missense_Mutation_p.R67I|MOK_ENST00000193029.6_5'UTR|MOK_ENST00000522874.1_Missense_Mutation_p.R97I	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	97	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										TAATGGGTATCTTCTCCCTGT	0.333																																					p.R97I		.											.	.	0			c.G290T						.						73.0	80.0	78.0					14																	102718326		2203	4299	6502	SO:0001583	missense	5891	exon5			GGGTATCTTCTCC	AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.290G>T	14.37:g.102718326C>A	ENSP00000355304:p.Arg97Ile	124	0		130	60	NM_014226	0	0	0	0	0	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	ENST00000361847.2	37	CCDS9971.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703155	0.48412	.	.	ENSG00000080823	ENST00000522874;ENST00000361847;ENST00000524214	T;T;T	0.45668	0.89;0.89;0.89	5.42	4.52	0.55395	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.177262	0.50627	D	0.000113	T	0.49762	0.1576	L	0.55481	1.735	0.80722	D	1	D;D	0.53151	0.958;0.958	P;P	0.55667	0.781;0.781	T	0.51395	-0.8711	10	0.72032	D	0.01	-8.7163	8.6721	0.34156	0.0:0.765:0.154:0.081	.	67;97	E7ERR8;Q9UQ07	.;MOK_HUMAN	I	97;97;67	ENSP00000429469:R97I;ENSP00000355304:R97I;ENSP00000428942:R67I	ENSP00000355304:R97I	R	-	2	0	RAGE	101788079	1.000000	0.71417	0.988000	0.46212	0.863000	0.49368	1.056000	0.30480	1.273000	0.44346	0.650000	0.86243	AGA	.		0.333	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380848.3		
C15orf56	644809	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	40544920	40544920	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr15:40544920C>T	ENST00000319503.3	-	1	191	c.170G>A	c.(169-171)cGa>cAa	p.R57Q	PAK6_ENST00000453867.1_Intron|RP11-133K1.2_ENST00000558658.1_Intron|PAK6_ENST00000455577.2_Intron|PAK6_ENST00000441369.1_Intron|PAK6_ENST00000542403.2_5'Flank|PAK6_ENST00000260404.4_Intron|C15orf56_ENST00000559727.1_Missense_Mutation_p.R57Q|PAK6_ENST00000560346.1_Intron	NM_001039905.1	NP_001034994.1	Q8N910	CO056_HUMAN	chromosome 15 open reading frame 56	57										lung(1)	1		all_cancers(109;1.62e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;3.4e-09)|all_lung(180;6.88e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.28e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0503)		CCCGGAGGTTCGCGGCGAGAG	0.756																																					p.R57Q		.											.	C15orf56-68	0			c.G170A						.						4.0	5.0	5.0					15																	40544920		2008	3995	6003	SO:0001583	missense	644809	exon1			GAGGTTCGCGGCG		CCDS32197.1	15q15.1	2012-05-30			ENSG00000176753	ENSG00000176753			33868	protein-coding gene	gene with protein product							Standard	NM_001039905		Approved	FLJ38596	uc001zla.2	Q8N910	OTTHUMG00000172399	ENST00000319503.3:c.170G>A	15.37:g.40544920C>T	ENSP00000315794:p.Arg57Gln	121	0		137	59	NM_001039905	0	0	1	1	0		Missense_Mutation	SNP	ENST00000319503.3	37	CCDS32197.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440220	0.25900	.	.	ENSG00000176753	ENST00000319503	T	0.30714	1.52	2.0	-1.71	0.08133	.	.	.	.	.	T	0.10035	0.0246	N	0.08118	0	0.09310	N	0.999999	P	0.44241	0.829	B	0.29353	0.101	T	0.17868	-1.0355	9	0.87932	D	0	.	3.9423	0.09333	0.0:0.3247:0.4801:0.1952	.	57	Q8N910	CO056_HUMAN	Q	57	ENSP00000315794:R57Q	ENSP00000315794:R57Q	R	-	2	0	C15orf56	38332212	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.435000	0.07264	-1.253000	0.01494	CGA	.		0.756	C15orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418370.2	NM_001039905	
EME2	197342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1826070	1826070	+	Splice_Site	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:1826070C>T	ENST00000568449.1	+	8	992	c.971C>T	c.(970-972)gCg>gTg	p.A324V	EME2_ENST00000307394.7_Splice_Site_p.A389V|MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	324					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						TGCTCCTAGGCGCTGGAGGCC	0.726								Direct reversal of damage;Homologous recombination																													p.A324V		.											.	EME2-229	0			c.C971T						.						20.0	23.0	22.0					16																	1826070		2187	4278	6465	SO:0001630	splice_region_variant	197342	exon8			CCTAGGCGCTGGA	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.970-1C>T	16.37:g.1826070C>T		39	0		62	22	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Missense_Mutation	SNP	ENST00000568449.1	37	CCDS58404.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716192	0.68844	.	.	ENSG00000197774	ENST00000307394;ENST00000454910	.	.	.	3.4	2.43	0.29744	ERCC4 domain (2);	0.097008	0.41396	D	0.000895	T	0.75664	0.3880	M	0.80847	2.515	0.53688	D	0.999978	D;D	0.89917	1.0;0.977	D;B	0.91635	0.999;0.425	T	0.74405	-0.3676	9	0.49607	T	0.09	-7.8093	8.3214	0.32132	0.0:0.883:0.0:0.117	.	338;190	A4GXA9;A4GXA9-2	EME2_HUMAN;.	V	389;345	.	ENSP00000303779:A389V	A	+	2	0	EME2	1766071	0.931000	0.31567	0.515000	0.27774	0.021000	0.10359	1.875000	0.39578	0.756000	0.33013	0.561000	0.74099	GCG	.		0.726	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	Missense_Mutation
ABCA3	21	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2369834	2369834	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:2369834G>C	ENST00000301732.5	-	8	1321	c.621C>G	c.(619-621)atC>atG	p.I207M	ABCA3_ENST00000382381.3_Missense_Mutation_p.I207M	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	207					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AGCCTTCCCGGATGTACCCTG	0.652																																					p.I207M		.											.	ABCA3-1015	0			c.C621G						.						71.0	62.0	65.0					16																	2369834		2198	4300	6498	SO:0001583	missense	21	exon8			TTCCCGGATGTAC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.621C>G	16.37:g.2369834G>C	ENSP00000301732:p.Ile207Met	34	0		33	10	NM_001089	0	0	0	0	0	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419127	0.25552	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.89939	-2.59	5.04	3.05	0.35203	.	0.339378	0.32314	N	0.006271	D	0.91858	0.7423	M	0.78637	2.42	0.80722	D	1	B;P;B	0.37370	0.302;0.592;0.287	B;P;B	0.54590	0.297;0.756;0.217	D	0.89048	0.3453	10	0.42905	T	0.14	.	6.8397	0.23955	0.148:0.1482:0.7038:0.0	.	207;269;207	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	M	207;269	ENSP00000301732:I207M	ENSP00000301732:I207M	I	-	3	3	ABCA3	2309835	1.000000	0.71417	0.843000	0.33291	0.138000	0.21146	3.628000	0.54259	0.688000	0.31529	0.655000	0.94253	ATC	.		0.652	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
PRM2	5620	hgsc.bcm.edu	37	16	11367405	11367405	+	IGR	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:11367405G>C	ENST00000241808.4	-	0	680				SNORA48_ENST00000390926.1_RNA|RMI2_ENST00000572173.1_Intron|PRM3_ENST00000327157.2_Missense_Mutation_p.H16Q	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2						cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						ggcctgggctgtggcctgggc	0.617																																					p.H16Q		.											.	.	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C48G						.						28.0	30.0	29.0					16																	11367405		1980	4149	6129	SO:0001628	intergenic_variant	58531	exon1			TGGGCTGTGGCCT		CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317		16.37:g.11367405G>C		15	0		21	7	NM_021247	0	0	0	0	0	Q6ZMM0	Missense_Mutation	SNP	ENST00000241808.4	37	CCDS42118.1	.	.	.	.	.	.	.	.	.	.	G	2.311	-0.357977	0.05138	.	.	ENSG00000178257	ENST00000327157	T	0.53640	0.61	0.559	-1.12	0.09808	.	.	.	.	.	T	0.39963	0.1098	N	0.19112	0.55	0.09310	N	0.999999	P	0.47106	0.89	P	0.55055	0.767	T	0.31081	-0.9956	8	0.66056	D	0.02	.	.	.	.	.	16	Q9NNZ6	PRM3_HUMAN	Q	16	ENSP00000325638:H16Q	ENSP00000325638:H16Q	H	-	3	2	PRM3	11274906	0.193000	0.23313	0.002000	0.10522	0.005000	0.04900	-0.194000	0.09559	-1.041000	0.03266	-1.036000	0.02392	CAC	.		0.617	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417808.1		
DCTPP1	79077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30435583	30435583	+	Missense_Mutation	SNP	A	A	T	rs36092481		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:30435583A>T	ENST00000319285.4	-	3	578	c.484T>A	c.(484-486)Tgt>Agt	p.C162S	DCTPP1_ENST00000567983.1_Missense_Mutation_p.C63S|DCTPP1_ENST00000568434.1_Missense_Mutation_p.C41S|DCTPP1_ENST00000568973.1_Missense_Mutation_p.C41S|ZNF771_ENST00000566625.1_Intron|DCTPP1_ENST00000565758.1_Missense_Mutation_p.C41S	NM_024096.1	NP_077001.1	Q9H773	DCTP1_HUMAN	dCTP pyrophosphatase 1	162					nucleoside triphosphate catabolic process (GO:0009143)|protein homotetramerization (GO:0051289)	cytosol (GO:0005829)	dCTP diphosphatase activity (GO:0047840)|magnesium ion binding (GO:0000287)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|pyrimidine deoxyribonucleotide binding (GO:0032556)			kidney(1)|large_intestine(3)|upper_aerodigestive_tract(1)	5						GTGGAGTCACAGGGAATGTCC	0.597																																					p.C162S		.											.	DCTPP1-90	0			c.T484A						.						40.0	37.0	38.0					16																	30435583		2197	4300	6497	SO:0001583	missense	79077	exon3			AGTCACAGGGAAT	BC001344	CCDS10680.1	16p11.2	2009-02-11			ENSG00000179958	ENSG00000179958	3.6.1.12		28777	protein-coding gene	gene with protein product	"""XTP3-transactivated protein A"""	615840				15740738	Standard	NM_024096		Approved	MGC5627, RS21C6, CDA03, XTP3TPA	uc002dyf.3	Q9H773	OTTHUMG00000132416	ENST00000319285.4:c.484T>A	16.37:g.30435583A>T	ENSP00000322524:p.Cys162Ser	54	0		80	43	NM_024096	0	0	35	77	42		Missense_Mutation	SNP	ENST00000319285.4	37	CCDS10680.1	.	.	.	.	.	.	.	.	.	.	A	1.012	-0.687538	0.03328	.	.	ENSG00000179958	ENST00000319285	.	.	.	3.72	-0.855	0.10700	.	1.452180	0.04273	N	0.342559	T	0.23611	0.0571	N	0.20685	0.6	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.17531	-1.0366	9	0.05525	T	0.97	-32.526	6.9119	0.24340	0.5009:0.0:0.4991:0.0	.	162	Q9H773	DCTP1_HUMAN	S	162	.	ENSP00000322524:C162S	C	-	1	0	DCTPP1	30343084	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.017000	0.12590	-0.100000	0.12241	-0.353000	0.07706	TGT	.		0.597	DCTPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255553.2	NM_024096	
DHX38	9785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72142801	72142801	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:72142801C>T	ENST00000268482.3	+	24	3867	c.3358C>T	c.(3358-3360)Cac>Tac	p.H1120Y	DHX38_ENST00000536867.1_Missense_Mutation_p.H432Y	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	1120					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CATAGTGTATCACGAGTTGGT	0.542																																					p.H1120Y	Melanoma(97;711 1442 7855 13832 28836)	.											.	DHX38-227	0			c.C3358T						.						78.0	64.0	69.0					16																	72142801		2198	4300	6498	SO:0001583	missense	9785	exon24			GTGTATCACGAGT	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.3358C>T	16.37:g.72142801C>T	ENSP00000268482:p.His1120Tyr	80	0		62	23	NM_014003	0	0	14	26	12	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	37	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.922424	0.92319	.	.	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.02656	4.21;4.21	5.14	5.14	0.70334	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.02683	-1.1124	10	0.52906	T	0.07	.	18.8078	0.92045	0.0:1.0:0.0:0.0	.	432;1120	B4DVG8;Q92620	.;PRP16_HUMAN	Y	1120;432	ENSP00000268482:H1120Y;ENSP00000437898:H432Y	ENSP00000268482:H1120Y	H	+	1	0	DHX38	70700302	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	7.097000	0.76967	2.677000	0.91161	0.655000	0.94253	CAC	.		0.542	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
NCOR1	9611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	15971431	15971431	+	Silent	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:15971431T>G	ENST00000268712.3	-	32	4775	c.4518A>C	c.(4516-4518)acA>acC	p.T1506T	NCOR1_ENST00000395857.3_Silent_p.T90T|NCOR1_ENST00000395851.1_Silent_p.T1522T	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1506	Interaction with C1D. {ECO:0000250}.|Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TAGAAGAAATTGTAACTGGAA	0.403																																					p.T1522T		.											.	NCOR1-229	0			c.A4566C						.						33.0	33.0	33.0					17																	15971431		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon31			AGAAATTGTAACT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4518A>C	17.37:g.15971431T>G		90	0		117	32	NM_001190440	0	0	0	0	0	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.162182	0.38217	.	.	ENSG00000141027	ENST00000395849	.	.	.	5.76	-9.98	0.00438	.	.	.	.	.	.	.	.	.	.	.	0.36017	D	0.8385	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3886	0.07281	0.1594:0.3155:0.0807:0.4444	.	.	.	.	.	-1	.	.	.	-	.	.	NCOR1	15912156	0.000000	0.05858	0.041000	0.18516	0.927000	0.56198	-0.918000	0.04021	-1.256000	0.02478	0.460000	0.39030	.	.		0.403	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
CCR7	1236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38711306	38711306	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:38711306G>T	ENST00000246657.2	-	3	887	c.825C>A	c.(823-825)ttC>ttA	p.F275L	CCR7_ENST00000579344.1_Missense_Mutation_p.F269L	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	275					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				AGGGCAGCTGGAAGACTATGA	0.552																																					p.F275L		.											.	CCR7-659	0			c.C825A						.						209.0	173.0	185.0					17																	38711306		2203	4300	6503	SO:0001583	missense	1236	exon3			CAGCTGGAAGACT		CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.825C>A	17.37:g.38711306G>T	ENSP00000246657:p.Phe275Leu	72	0		129	41	NM_001838	0	0	0	0	0		Missense_Mutation	SNP	ENST00000246657.2	37	CCDS11369.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286284	0.80803	.	.	ENSG00000126353	ENST00000246657	T	0.35973	1.28	5.83	5.83	0.93111	GPCR, rhodopsin-like superfamily (1);	0.225560	0.45867	D	0.000323	T	0.43033	0.1229	L	0.58669	1.825	0.80722	D	1	B	0.22541	0.071	B	0.30401	0.115	T	0.18023	-1.0350	10	0.35671	T	0.21	.	20.1082	0.97900	0.0:0.0:1.0:0.0	.	275	P32248	CCR7_HUMAN	L	275	ENSP00000246657:F275L	ENSP00000246657:F275L	F	-	3	2	CCR7	35964832	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.764000	0.94973	0.555000	0.69702	TTC	.		0.552	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257222.1		
SLC4A1	6521	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42335911	42335911	+	Silent	SNP	T	T	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:42335911T>A	ENST00000262418.6	-	10	1112	c.957A>T	c.(955-957)ctA>ctT	p.L319L	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	319	Dimerization arm.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAGGCAGCACTAGGCTGCAGT	0.632																																					p.L319L													.	SLC4A1-92	0			c.A957T						.						46.0	47.0	47.0					17																	42335911		2203	4300	6503	SO:0001819	synonymous_variant	6521	exon10			CAGCACTAGGCTG		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.957A>T	17.37:g.42335911T>A		118	1		189	56	NM_000342	0	0	0	0	0	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	ENST00000262418.6	37	CCDS11481.1																																																																																			.		0.632	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
PPP1R9B	84687	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48216644	48216644	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:48216644T>C	ENST00000316878.6	-	9	2053	c.2051A>G	c.(2050-2052)cAg>cGg	p.Q684R	PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	684	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						TTTCAGCTGCTGGATCTCTGC	0.597																																					.													.	PPP1R9B-90	0			.						.						194.0	204.0	201.0					17																	48216644		2153	4255	6408	SO:0001583	missense	84687	.			AGCTGCTGGATCT	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.2051A>G	17.37:g.48216644T>C	ENSP00000475417:p.Gln684Arg	39	0		55	16	.	0	0	37	52	15	Q8TCR9	Missense_Mutation	SNP	ENST00000316878.6	37																																																																																				.		0.597	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032595	
KIF2B	84643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	51901648	51901648	+	Silent	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:51901648C>T	ENST00000268919.4	+	1	1410	c.1254C>T	c.(1252-1254)gtC>gtT	p.V418V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	418	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAACACCTGTCAACGCTCACT	0.512																																					p.V418V		.											.	KIF2B-98	0			c.C1254T						.						102.0	76.0	85.0					17																	51901648		2203	4300	6503	SO:0001819	synonymous_variant	84643	exon1			ACCTGTCAACGCT	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1254C>T	17.37:g.51901648C>T		137	0		221	68	NM_032559	0	0	0	0	0	Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	CCDS32685.1																																																																																			.		0.512	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
KCNH6	81033	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61613115	61613115	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:61613115A>G	ENST00000583023.1	+	6	1198	c.1187A>G	c.(1186-1188)tAt>tGt	p.Y396C	KCNH6_ENST00000580652.1_Missense_Mutation_p.Y396C|KCNH6_ENST00000581784.1_Missense_Mutation_p.Y396C|KCNH6_ENST00000456941.2_Missense_Mutation_p.Y396C|KCNH6_ENST00000314672.5_Missense_Mutation_p.Y396C	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	396					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TACTCTGAGTATGGGGCGGCT	0.622																																					p.Y396C													.	KCNH6-91	0			c.A1187G						.						88.0	78.0	81.0					17																	61613115		2203	4300	6503	SO:0001583	missense	81033	exon6			CTGAGTATGGGGC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1187A>G	17.37:g.61613115A>G	ENSP00000463533:p.Tyr396Cys	72	1		98	56	NM_030779	0	0	0	0	0	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	A	7.758	0.704715	0.15172	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.98493	-4.96;-4.96	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99121	0.9697	M	0.94021	3.485	0.58432	D	0.999999	D;D;D;D;D	0.71674	0.998;0.971;0.998;0.971;0.987	D;D;D;D;D	0.81914	0.995;0.916;0.975;0.942;0.933	D	0.99278	1.0895	10	0.87932	D	0	.	13.7107	0.62667	1.0:0.0:0.0:0.0	.	273;396;396;396;396	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	C	396	ENSP00000318212:Y396C;ENSP00000396900:Y396C	ENSP00000318212:Y396C	Y	+	2	0	KCNH6	58966847	1.000000	0.71417	0.991000	0.47740	0.060000	0.15804	9.139000	0.94554	1.821000	0.53095	0.260000	0.18958	TAT	.		0.622	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
LAMA1	284217	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	6992669	6992669	+	Silent	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr18:6992669G>A	ENST00000389658.3	-	36	5152	c.5059C>T	c.(5059-5061)Cta>Tta	p.L1687L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1687	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAATTGGGTAGTAGGAAATCT	0.358																																					p.L1687L													.	LAMA1-149	0			c.C5059T						.						148.0	143.0	145.0					18																	6992669		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon36			TGGGTAGTAGGAA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5059C>T	18.37:g.6992669G>A		118	1		137	69	NM_005559	0	0	5	6	1		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																			.		0.358	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	9257703	9257703	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr18:9257703C>G	ENST00000262126.4	+	9	4678	c.4438C>G	c.(4438-4440)Cag>Gag	p.Q1480E	ANKRD12_ENST00000400020.3_Missense_Mutation_p.Q1457E|ANKRD12_ENST00000383440.2_Missense_Mutation_p.Q1457E|RP11-888D10.4_ENST00000609701.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1480						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTCTTGTGCTCAGGATCCGGC	0.418																																					p.Q1480E		.											.	ANKRD12-92	0			c.C4438G						.						49.0	52.0	51.0					18																	9257703		2200	4299	6499	SO:0001583	missense	23253	exon9			TGTGCTCAGGATC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4438C>G	18.37:g.9257703C>G	ENSP00000262126:p.Gln1480Glu	118	0		104	40	NM_015208	0	0	2	3	1	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234306	0.39498	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.68479	-0.33;-0.33	5.69	5.69	0.88448	.	0.303615	0.32444	N	0.006084	T	0.55768	0.1941	L	0.29908	0.895	0.44946	D	0.997969	P;P	0.38195	0.571;0.622	B;B	0.31101	0.124;0.097	T	0.58967	-0.7542	10	0.48119	T	0.1	-11.1383	19.8263	0.96618	0.0:1.0:0.0:0.0	.	1457;1480	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	E	1457;1480	ENSP00000372932:Q1457E;ENSP00000262126:Q1480E	ENSP00000262126:Q1480E	Q	+	1	0	ANKRD12	9247703	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	5.359000	0.66074	2.676000	0.91093	0.655000	0.94253	CAG	.		0.418	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
MBP	4155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74700845	74700845	+	Silent	SNP	C	C	T	rs112511603		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr18:74700845C>T	ENST00000397869.3	-	3	352	c.306G>A	c.(304-306)ccG>ccA	p.P102P	MBP_ENST00000397875.3_Silent_p.P112P|MBP_ENST00000397866.4_Silent_p.P102P|MBP_ENST00000527041.1_Intron|MBP_ENST00000580402.1_Silent_p.P235P|MBP_ENST00000359645.3_Silent_p.P128P|MBP_ENST00000397865.5_Silent_p.P102P|MBP_ENST00000382582.3_Silent_p.P128P|MBP_ENST00000354542.4_Intron|MBP_ENST00000528160.1_Intron|MBP_ENST00000579129.1_Silent_p.P235P|MBP_ENST00000526111.1_Silent_p.P80P|MBP_ENST00000355994.2_Silent_p.P235P|MBP_ENST00000578193.1_Silent_p.P102P			P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TTCCCTGCGACGGGGGTGGTG	0.527																																					p.P235P	NSCLC(17;72 1131 19392)	.											.	MBP-515	0			c.G705A						.						121.0	130.0	127.0					18																	74700845		2203	4300	6503	SO:0001819	synonymous_variant	4155	exon6			CTGCGACGGGGGT		CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397869.3:c.306G>A	18.37:g.74700845C>T		80	0		65	28	NM_001025101	0	0	0	0	0	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Silent	SNP	ENST00000397869.3	37																																																																																				C|0.500;T|0.500		0.527	MBP-024	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000267964.1	NM_001025081	
ZNF43	7594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21990696	21990696	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr19:21990696A>T	ENST00000354959.4	-	4	2312	c.2143T>A	c.(2143-2145)Ttt>Att	p.F715I	ZNF43_ENST00000598381.1_Missense_Mutation_p.F709I|ZNF43_ENST00000595461.1_Missense_Mutation_p.F709I|ZNF43_ENST00000594012.1_Missense_Mutation_p.F709I	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		GATCGGTTAAAAGCTTTGCCA	0.363																																					p.F724I		.											.	ZNF43-154	0			c.T2170A						.						50.0	54.0	53.0					19																	21990696		2203	4299	6502	SO:0001583	missense	7594	exon4			GGTTAAAAGCTTT	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2143T>A	19.37:g.21990696A>T	ENSP00000347045:p.Phe715Ile	27	0		37	20	NM_001256653	0	0	6	7	1	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	A	17.13	3.311136	0.60414	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.46451	0.87	1.76	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.66499	0.2795	M	0.91972	3.26	0.36120	D	0.845417	D	0.89917	1.0	D	0.81914	0.995	T	0.73953	-0.3820	9	0.87932	D	0	.	8.2856	0.31926	1.0:0.0:0.0:0.0	.	715	P17038	ZNF43_HUMAN	I	714;715	ENSP00000347045:F715I	ENSP00000347045:F715I	F	-	1	0	ZNF43	21782536	0.986000	0.35501	0.177000	0.23020	0.629000	0.37895	6.109000	0.71528	0.808000	0.34231	0.254000	0.18369	TTT	.		0.363	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
FBXO46	23403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46215847	46215847	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr19:46215847T>C	ENST00000317683.3	-	2	1040	c.907A>G	c.(907-909)Aag>Gag	p.K303E		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	303										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CATGTGATCTTGTCCTTGGCT	0.682																																					p.K303E		.											.	FBXO46-159	0			c.A907G						.						31.0	36.0	34.0					19																	46215847		2004	4156	6160	SO:0001583	missense	23403	exon2			TGATCTTGTCCTT	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.907A>G	19.37:g.46215847T>C	ENSP00000410007:p.Lys303Glu	75	0		101	47	NM_001080469	0	0	0	5	5		Missense_Mutation	SNP	ENST00000317683.3	37	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.498092	0.26861	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.39	3.37	0.38596	.	.	.	.	.	T	0.32194	0.0821	N	0.22421	0.69	0.38310	D	0.943215	B	0.31705	0.336	B	0.27796	0.083	T	0.12915	-1.0529	8	0.28530	T	0.3	-10.0116	6.4522	0.21910	0.0:0.1111:0.0:0.8889	.	303	Q6PJ61	FBX46_HUMAN	E	303	.	ENSP00000410007:K303E	K	-	1	0	FBXO46	50907687	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	3.177000	0.50871	0.737000	0.32582	-0.371000	0.07208	AAG	.		0.682	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179	
FANCL	55120	broad.mit.edu	37	2	58386912	58386912	+	Silent	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:58386912T>C	ENST00000233741.4	-	14	1152	c.1116A>G	c.(1114-1116)ggA>ggG	p.G372G	VRK2_ENST00000340157.4_3'UTR|VRK2_ENST00000440705.2_3'UTR|VRK2_ENST00000435505.2_3'UTR|FANCL_ENST00000403295.3_Silent_p.G344G|VRK2_ENST00000412104.2_3'UTR|VRK2_ENST00000417641.2_3'UTR|FANCL_ENST00000402135.3_Silent_p.G377G|FANCL_ENST00000403676.1_Silent_p.G255G	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	372					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						AGTGTTTCCTTCCAGACATTT	0.279								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.G377G													.	FANCL-661	0			c.A1131G						.						88.0	91.0	90.0					2																	58386912		2203	4293	6496	SO:0001819	synonymous_variant	55120	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTTCCTTCCAGAC	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.1116A>G	2.37:g.58386912T>C		142	0		158	6	NM_001114636	0	0	11	11	0	Q6GU60	Silent	SNP	ENST00000233741.4	37	CCDS1860.1																																																																																			.		0.279	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	80136916	80136916	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:80136916T>C	ENST00000402739.4	+	6	1054	c.1049T>C	c.(1048-1050)aTg>aCg	p.M350T	CTNNA2_ENST00000540488.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000496558.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000466387.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000361291.4_Missense_Mutation_p.M384T|CTNNA2_ENST00000541047.1_Missense_Mutation_p.M350T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	350					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGCGAGTACATGAATAATGTA	0.547																																					p.M350T		.											.	CTNNA2-368	0			c.T1049C						.						37.0	42.0	40.0					2																	80136916		2057	4213	6270	SO:0001583	missense	1496	exon7			AGTACATGAATAA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1049T>C	2.37:g.80136916T>C	ENSP00000384638:p.Met350Thr	156	0		169	70	NM_001164883	0	0	0	0	0	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	T	16.91	3.252854	0.59212	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24	5.6	5.6	0.85130	.	0.283582	0.39759	N	0.001274	T	0.47673	0.1458	M	0.71581	2.175	0.80722	D	1	P;B;B	0.43231	0.801;0.23;0.111	P;B;B	0.48063	0.565;0.064;0.064	T	0.39901	-0.9591	10	0.27785	T	0.31	.	15.7808	0.78257	0.0:0.0:0.0:1.0	.	350;350;350	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	T	350;350;384;350;350;350	ENSP00000418191:M350T;ENSP00000419295:M350T;ENSP00000355398:M384T;ENSP00000384638:M350T;ENSP00000444675:M350T;ENSP00000441705:M350T	ENSP00000355398:M384T	M	+	2	0	CTNNA2	79990427	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.988000	0.88194	2.142000	0.66516	0.482000	0.46254	ATG	.		0.547	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802211	185802211	+	Missense_Mutation	SNP	C	C	A	rs5836928|rs3046266	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:185802211C>A	ENST00000302277.6	+	4	2682	c.2088C>A	c.(2086-2088)aaC>aaA	p.N696K		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	696							metal ion binding (GO:0046872)	p.N696K(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GTAAAAAGAACACAATACTTT	0.289																																					p.N696K		.											.	ZNF804A-163	1	Substitution - Missense(1)	ovary(1)	c.C2088A						.						73.0	68.0	70.0					2																	185802211		2194	4291	6485	SO:0001583	missense	91752	exon4			AAAGAACACAATA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2088C>A	2.37:g.185802211C>A	ENSP00000303252:p.Asn696Lys	137	0		570	32	NM_194250	0	0	0	0	0	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663251	0.29515	.	.	ENSG00000170396	ENST00000302277	T	0.06068	3.35	5.63	3.8	0.43715	.	0.582383	0.16465	N	0.213215	T	0.06325	0.0163	L	0.46157	1.445	0.09310	N	1	B	0.24258	0.1	B	0.24541	0.054	T	0.29243	-1.0018	10	0.42905	T	0.14	-1.8543	4.6402	0.12545	0.1573:0.6004:0.0:0.2423	.	696	Q7Z570	Z804A_HUMAN	K	696	ENSP00000303252:N696K	ENSP00000303252:N696K	N	+	3	2	ZNF804A	185510456	0.000000	0.05858	0.002000	0.10522	0.041000	0.13682	-0.003000	0.12901	1.353000	0.45828	0.655000	0.94253	AAC	.		0.289	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802216	185802216	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:185802216T>C	ENST00000302277.6	+	4	2687	c.2093T>C	c.(2092-2094)aTa>aCa	p.I698T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	698							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAGAACACAATACTTTTAAAT	0.294																																					p.I698T		.											.	ZNF804A-163	0			c.T2093C						.						73.0	67.0	69.0					2																	185802216		2194	4291	6485	SO:0001583	missense	91752	exon4			ACACAATACTTTT	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2093T>C	2.37:g.185802216T>C	ENSP00000303252:p.Ile698Thr	137	0		569	30	NM_194250	0	0	0	0	0	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	3.795	-0.042847	0.07452	.	.	ENSG00000170396	ENST00000302277	T	0.05258	3.47	5.63	0.374	0.16183	.	1.826620	0.02817	N	0.125135	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40776	-0.9545	10	0.27082	T	0.32	-0.3078	8.4113	0.32644	0.0:0.5963:0.0:0.4037	.	698	Q7Z570	Z804A_HUMAN	T	698	ENSP00000303252:I698T	ENSP00000303252:I698T	I	+	2	0	ZNF804A	185510461	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.483000	0.22292	0.077000	0.16863	0.533000	0.62120	ATA	.		0.294	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
WDR75	84128	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190306269	190306269	+	Missense_Mutation	SNP	G	G	C	rs201125667		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:190306269G>C	ENST00000314761.4	+	1	111	c.51G>C	c.(49-51)ttG>ttC	p.L17F		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	17						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			GCAGCGAGTTGAACTTTAGGA	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		14558	0.0		0.001	False		,,,				2504	0.0				p.L17F													.	WDR75-92	0			c.G51C						.						89.0	73.0	79.0					2																	190306269		2197	4284	6481	SO:0001583	missense	84128	exon1			CGAGTTGAACTTT	AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.51G>C	2.37:g.190306269G>C	ENSP00000314193:p.Leu17Phe	173	1		406	80	NM_032168	0	0	13	20	7	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	ENST00000314761.4	37	CCDS2298.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	19.74	3.884015	0.72410	.	.	ENSG00000115368	ENST00000314761	T	0.64438	-0.1	5.29	2.5	0.30297	.	0.212159	0.34046	N	0.004305	T	0.66992	0.2846	M	0.64404	1.975	0.48696	D	0.999699	D	0.67145	0.996	P	0.62649	0.905	T	0.64228	-0.6457	10	0.10111	T	0.7	-8.8137	8.5408	0.33390	0.0793:0.2906:0.6301:0.0	.	17	Q8IWA0	WDR75_HUMAN	F	17	ENSP00000314193:L17F	ENSP00000314193:L17F	L	+	3	2	WDR75	190014514	1.000000	0.71417	0.917000	0.36280	0.915000	0.54546	0.488000	0.22371	0.362000	0.24319	-0.262000	0.10625	TTG	G|0.999;C|0.001		0.587	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255913.1	NM_032168	
CUL3	8452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225362540	225362540	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:225362540C>G	ENST00000264414.4	-	12	1975	c.1637G>C	c.(1636-1638)cGa>cCa	p.R546P	CUL3_ENST00000409096.1_Missense_Mutation_p.R522P|CUL3_ENST00000409777.1_Missense_Mutation_p.R522P|CUL3_ENST00000344951.4_Missense_Mutation_p.R480P	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	546					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TGTGAGCTGTCGACCACTGTG	0.353																																					p.R552P		.											.	CUL3-229	0			c.G1655C						.						150.0	140.0	143.0					2																	225362540		2203	4300	6503	SO:0001583	missense	8452	exon12			AGCTGTCGACCAC	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1637G>C	2.37:g.225362540C>G	ENSP00000264414:p.Arg546Pro	122	0		52	48	NM_001257198	0	0	0	33	33	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	34	5.352209	0.95830	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	6.16	6.16	0.99307	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.96719	0.8929	H	0.98276	4.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97283	0.9919	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	480;524;546	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	P	546;480;522;522	ENSP00000264414:R546P;ENSP00000343601:R480P;ENSP00000387200:R522P;ENSP00000386525:R522P	ENSP00000264414:R546P	R	-	2	0	CUL3	225070784	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.802000	0.85969	2.937000	0.99478	0.650000	0.86243	CGA	.		0.353	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
TRIP12	9320	bcgsc.ca	37	2	230675639	230675639	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:230675639C>T	ENST00000283943.5	-	14	2212	c.2034G>A	c.(2032-2034)atG>atA	p.M678I	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Missense_Mutation_p.M381I|TRIP12_ENST00000389044.4_Missense_Mutation_p.M726I	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	678					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGTTGGAACACATCAGAGAAA	0.363																																					p.M678I													.	TRIP12-572	0			c.G2034A						.						69.0	67.0	68.0					2																	230675639		2203	4300	6503	SO:0001583	missense	9320	exon14			GGAACACATCAGA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2034G>A	2.37:g.230675639C>T	ENSP00000283943:p.Met678Ile	262	4		167	149	NM_004238	0	0	0	7	7	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984619	0.74474	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.27890	1.64;1.64;1.64	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25827	0.0629	N	0.21508	0.67	0.80722	D	1	B;B;B;B	0.28933	0.068;0.127;0.228;0.127	B;B;B;B	0.33846	0.035;0.094;0.171;0.094	T	0.05209	-1.0899	10	0.14252	T	0.57	.	19.5388	0.95266	0.0:1.0:0.0:0.0	.	684;381;726;678	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	I	678;381;726	ENSP00000283943:M678I;ENSP00000373697:M381I;ENSP00000373696:M726I	ENSP00000283943:M678I	M	-	3	0	TRIP12	230383883	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.741000	0.84997	2.622000	0.88805	0.650000	0.86243	ATG	.		0.363	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
FRG1B	284802	bcgsc.ca	37	20	29625956	29625956	+	Missense_Mutation	SNP	G	G	A	rs147809085		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr20:29625956G>A	ENST00000278882.3	+	5	580	c.200G>A	c.(199-201)aGa>aAa	p.R67K	FRG1B_ENST00000439954.2_Missense_Mutation_p.R72K|FRG1B_ENST00000358464.4_Missense_Mutation_p.R67K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	67								p.R67K(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATTGGACCAAGAGAACAATGG	0.338																																					.													.	FRG1B-22	2	Substitution - Missense(2)	kidney(2)	.						.																																			SO:0001583	missense	284802	.			GACCAAGAGAACA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.200G>A	20.37:g.29625956G>A	ENSP00000278882:p.Arg67Lys	415	6		462	15	.	0	0	92	92	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.648	1.140706	0.21205	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.46063	0.88	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	.	.	.	0.46901	D	0.99924	B	0.02656	0.0	B	0.15484	0.013	T	0.07986	-1.0744	9	0.28530	T	0.3	.	9.3557	0.38164	0.0:0.0:1.0:0.0	.	72	F5H5R5	.	K	67;72;67	ENSP00000408863:R72K	ENSP00000278882:R67K	R	+	2	0	FRG1B	28239617	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.360000	0.73064	1.250000	0.43966	0.184000	0.17185	AGA	.		0.338	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
EDN3	1908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57876603	57876603	+	Missense_Mutation	SNP	G	G	T	rs457651		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr20:57876603G>T	ENST00000337938.2	+	2	577	c.191G>T	c.(190-192)gGg>gTg	p.G64V	EDN3_ENST00000311585.7_Missense_Mutation_p.G64V|EDN3_ENST00000395654.3_Missense_Mutation_p.G64V|EDN3_ENST00000371028.2_Missense_Mutation_p.G64V|EDN3_ENST00000371025.3_Missense_Mutation_p.G64V	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	64					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CCTGGCGAGGGGACTGTGGCC	0.716																																					p.G64V		.											.	EDN3-91	0			c.G191T						.						33.0	37.0	35.0					20																	57876603		2201	4300	6501	SO:0001583	missense	1908	exon2			GCGAGGGGACTGT	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.191G>T	20.37:g.57876603G>T	ENSP00000337128:p.Gly64Val	77	0		94	43	NM_207034	0	0	0	0	0	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	37	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720028	0.30503	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22	3.59	-7.18	0.01505	.	.	.	.	.	T	0.63105	0.2483	N	0.08118	0	0.09310	N	1	P;P;P;P	0.38110	0.618;0.543;0.483;0.51	B;B;B;B	0.33690	0.168;0.138;0.081;0.067	T	0.61053	-0.7140	9	0.36615	T	0.2	1.9985	0.3953	0.00417	0.2776:0.1274:0.2815:0.3135	.	64;64;64;64	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	V	64	ENSP00000337128:G64V;ENSP00000311854:G64V;ENSP00000360067:G64V;ENSP00000360064:G64V;ENSP00000379015:G64V	ENSP00000311854:G64V	G	+	2	0	EDN3	57309998	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-0.348000	0.07740	-1.885000	0.01118	0.313000	0.20887	GGG	G|1.000;A|0.000		0.716	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114	
CISH	1154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50645901	50645901	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:50645901C>A	ENST00000348721.3	-	2	324	c.144G>T	c.(142-144)gaG>gaT	p.E48D	CISH_ENST00000443053.2_Missense_Mutation_p.E65D	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	48					intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CTGGGGTACCCTCTGCCACCT	0.642																																					p.E65D		.											.	CISH-710	0			c.G195T						.						54.0	49.0	51.0					3																	50645901		2203	4300	6503	SO:0001583	missense	1154	exon3			GGTACCCTCTGCC	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.144G>T	3.37:g.50645901C>A	ENSP00000294173:p.Glu48Asp	64	0		49	28	NM_013324	0	0	35	64	29	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	37	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	C	7.873	0.728634	0.15507	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.47177	0.85;0.87	6.03	2.26	0.28386	.	0.367420	0.28209	N	0.016181	T	0.35885	0.0947	L	0.57536	1.79	0.28436	N	0.917019	B;B	0.28082	0.2;0.048	B;B	0.23574	0.047;0.012	T	0.21690	-1.0238	10	0.14656	T	0.56	-8.0475	6.8677	0.24102	0.0:0.587:0.119:0.294	.	65;48	G5E9R1;Q9NSE2	.;CISH_HUMAN	D	65;48	ENSP00000409346:E65D;ENSP00000294173:E48D	ENSP00000294173:E48D	E	-	3	2	CISH	50620905	0.991000	0.36638	1.000000	0.80357	0.071000	0.16799	0.437000	0.21543	0.441000	0.26529	-0.150000	0.13652	GAG	.		0.642	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52380547	52380547	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:52380547C>A	ENST00000420323.2	+	11	1977	c.1716C>A	c.(1714-1716)agC>agA	p.S572R		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	572	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCGCAGCAGCCTGCGCGACA	0.572																																					p.S572R		.											.	DNAH1-67	0			c.C1716A						.						55.0	57.0	56.0					3																	52380547		2141	4243	6384	SO:0001583	missense	25981	exon11			CAGCAGCCTGCGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.1716C>A	3.37:g.52380547C>A	ENSP00000401514:p.Ser572Arg	36	0		42	11	NM_015512	0	0	1	1	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127059	0.56721	.	.	ENSG00000114841	ENST00000420323	T	0.24350	1.86	4.53	4.53	0.55603	.	0.443881	0.19011	N	0.125064	T	0.34513	0.0900	M	0.72894	2.215	0.39055	D	0.960409	P;P	0.45957	0.713;0.869	B;P	0.47981	0.434;0.563	T	0.15263	-1.0443	10	0.23302	T	0.38	.	11.8369	0.52330	0.0:0.9149:0.0:0.0851	.	572;572	C9JXH6;Q9P2D7-3	.;.	R	572	ENSP00000401514:S572R	ENSP00000401514:S572R	S	+	3	2	DNAH1	52355587	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	2.033000	0.41136	2.085000	0.62840	0.563000	0.77884	AGC	.		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
A4GNT	51146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137849689	137849689	+	Splice_Site	SNP	A	A	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:137849689A>C	ENST00000236709.3	-	2	610		c.e2+1			NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase						carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						CTAAACACTTACTTGATTGTA	0.403																																					.		.											.	A4GNT-90	0			c.408+2T>G						.						65.0	65.0	65.0					3																	137849689		2202	4300	6502	SO:0001630	splice_region_variant	51146	exon3			ACACTTACTTGAT	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.408+1T>G	3.37:g.137849689A>C		136	0		195	96	NM_016161	0	0	0	0	0	Q0VDK1|Q0VDK2	Splice_Site	SNP	ENST00000236709.3	37	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	A	13.58	2.279090	0.40294	.	.	ENSG00000118017	ENST00000236709	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4479	0.75248	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	A4GNT	139332379	1.000000	0.71417	0.995000	0.50966	0.387000	0.30353	6.414000	0.73318	2.046000	0.60703	0.454000	0.30748	.	.		0.403	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161	Intron
PLS1	5357	ucsc.edu;bcgsc.ca	37	3	142403182	142403182	+	Missense_Mutation	SNP	A	A	G	rs375726625		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:142403182A>G	ENST00000337777.3	+	8	1046	c.833A>G	c.(832-834)tAc>tGc	p.Y278C	PLS1_ENST00000457734.2_Missense_Mutation_p.Y278C|PLS1_ENST00000497002.1_Missense_Mutation_p.Y278C	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	278	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						TGGGTGAACTACCATCTGACC	0.418																																					p.Y278C													.	PLS1-91	0			c.A833G						.	A	CYS/TYR,CYS/TYR,CYS/TYR	0,4406		0,0,2203	96.0	88.0	91.0		833,833,833	3.6	1.0	3		91	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PLS1	NM_001145319.1,NM_001172312.1,NM_002670.2	194,194,194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	278/630,278/630,278/630	142403182	1,13005	2203	4300	6503	SO:0001583	missense	5357	exon8			TGAACTACCATCT	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.833A>G	3.37:g.142403182A>G	ENSP00000336831:p.Tyr278Cys	212	2		230	112	NM_001172312	0	0	30	57	27	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	37	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.631084	0.67015	0.0	1.16E-4	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64	4.83	3.59	0.41128	Calponin homology domain (5);	0.285780	0.40385	N	0.001105	D	0.96163	0.8749	M	0.91459	3.21	0.80722	D	1	P	0.50710	0.938	P	0.50791	0.65	D	0.96513	0.9380	10	0.87932	D	0	-13.5133	11.4387	0.50083	0.865:0.0:0.0:0.135	.	278	Q14651	PLSI_HUMAN	C	278;199;278;278	ENSP00000387890:Y278C;ENSP00000417481:Y199C;ENSP00000336831:Y278C;ENSP00000418700:Y278C	ENSP00000336831:Y278C	Y	+	2	0	PLS1	143885872	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.115000	0.41921	2.155000	0.67459	0.482000	0.46254	TAC	.		0.418	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
ACTL6A	86	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179298770	179298770	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:179298770G>T	ENST00000429709.2	+	10	1132	c.919G>T	c.(919-921)Gga>Tga	p.G307*	ACTL6A_ENST00000392662.1_Nonsense_Mutation_p.G265*|ACTL6A_ENST00000467615.1_3'UTR|ACTL6A_ENST00000450518.2_Nonsense_Mutation_p.G265*|RP11-15L13.4_ENST00000608818.1_RNA	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	307					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			GATTCCAGAAGGATTATTTGA	0.373																																					p.G307X													.	ACTL6A-91	0			c.G919T						.						105.0	109.0	107.0					3																	179298770		2203	4300	6503	SO:0001587	stop_gained	86	exon10			CCAGAAGGATTAT	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.919G>T	3.37:g.179298770G>T	ENSP00000397552:p.Gly307*	306	2		304	158	NM_004301	0	0	17	17	0	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Nonsense_Mutation	SNP	ENST00000429709.2	37	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	G	40	7.977909	0.98591	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	.	.	.	5.41	5.41	0.78517	.	0.101413	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.1807	0.93622	0.0:0.0:1.0:0.0	.	.	.	.	X	307;265;265	.	ENSP00000376430:G265X	G	+	1	0	ACTL6A	180781464	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.476000	0.97823	2.542000	0.85734	0.467000	0.42956	GGA	.		0.373	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	
KLB	152831	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39435920	39435920	+	Nonsense_Mutation	SNP	G	G	T	rs369333502		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr4:39435920G>T	ENST00000257408.4	+	2	1013	c.916G>T	c.(916-918)Gag>Tag	p.E306*		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	306	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						TCATTGGATCGAGCCAAACCG	0.463																																					p.E306X													.	KLB-69	0			c.G916T						.						113.0	97.0	103.0					4																	39435920		2203	4300	6503	SO:0001587	stop_gained	152831	exon2			TGGATCGAGCCAA	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.916G>T	4.37:g.39435920G>T	ENSP00000257408:p.Glu306*	175	1		185	76	NM_175737	0	0	0	0	0	Q2M3K8	Nonsense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387429	0.82902	.	.	ENSG00000134962	ENST00000257408	.	.	.	6.17	6.17	0.99709	.	0.098850	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-32.149	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	.	.	.	X	306	.	ENSP00000257408:E306X	E	+	1	0	KLB	39112315	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	5.417000	0.66423	2.941000	0.99782	0.655000	0.94253	GAG	.		0.463	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	85722839	85722839	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr4:85722839C>A	ENST00000295888.4	-	17	3193	c.2786G>T	c.(2785-2787)cGa>cTa	p.R929L	WDFY3_ENST00000512267.1_5'Flank|WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Missense_Mutation_p.R929L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	929					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGAGGCTAATCGTTCAAACAT	0.493																																					p.R929L		.											.	WDFY3-93	0			c.G2786T						.						109.0	112.0	111.0					4																	85722839		2203	4300	6503	SO:0001583	missense	23001	exon17			GCTAATCGTTCAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2786G>T	4.37:g.85722839C>A	ENSP00000295888:p.Arg929Leu	24	0		36	16	NM_014991	0	0	1	3	2	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890055	0.91889	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.57107	0.42;0.42	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.72475	-0.4282	10	0.54805	T	0.06	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	929	Q8IZQ1	WDFY3_HUMAN	L	929	ENSP00000318466:R929L;ENSP00000295888:R929L	ENSP00000295888:R929L	R	-	2	0	WDFY3	85941863	1.000000	0.71417	0.883000	0.34634	0.737000	0.42083	7.487000	0.81328	2.827000	0.97445	0.650000	0.86243	CGA	.		0.493	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
ADAMTS12	81792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	33534943	33534943	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr5:33534943C>A	ENST00000504830.1	-	23	4936	c.4601G>T	c.(4600-4602)aGt>aTt	p.S1534I	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.S1449I	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1534					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CCCACCGGCACTTTTCTTGCA	0.433										HNSCC(64;0.19)																											p.S1534I		.											.	ADAMTS12-232	0			c.G4601T						.						130.0	124.0	126.0					5																	33534943		2203	4300	6503	SO:0001583	missense	81792	exon23			CCGGCACTTTTCT	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4601G>T	5.37:g.33534943C>A	ENSP00000422554:p.Ser1534Ile	65	0		91	44	NM_030955	0	0	0	0	0	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963656	0.34659	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60548	0.19;0.18	4.98	0.386	0.16254	.	0.588898	0.19280	N	0.118200	T	0.43366	0.1244	L	0.52364	1.645	0.53005	D	0.999961	P;B	0.36837	0.571;0.435	B;B	0.36989	0.238;0.12	T	0.14392	-1.0474	10	0.30854	T	0.27	.	3.6087	0.08052	0.0:0.3846:0.2143:0.401	.	1449;1534	P58397-3;P58397	.;ATS12_HUMAN	I	1534;1449	ENSP00000422554:S1534I;ENSP00000344847:S1449I	ENSP00000344847:S1449I	S	-	2	0	ADAMTS12	33570700	0.000000	0.05858	0.922000	0.36590	0.973000	0.67179	0.033000	0.13754	0.202000	0.20498	0.563000	0.77884	AGT	.		0.433	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
PCDHB14	56122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140605127	140605127	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr5:140605127G>A	ENST00000239449.4	+	1	2050	c.2050G>A	c.(2050-2052)Gac>Aac	p.D684N	PCDHB14_ENST00000515856.2_Missense_Mutation_p.D531N	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	684					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCCAGGCCGACTCCCTCAC	0.701																																					p.D684N	Ovarian(141;50 1831 27899 33809 37648)	.											.	PCDHB14-91	0			c.G2050A						.						69.0	77.0	74.0					5																	140605127		2187	4284	6471	SO:0001583	missense	56122	exon1			CAGGCCGACTCCC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2050G>A	5.37:g.140605127G>A	ENSP00000239449:p.Asp684Asn	85	0		73	5	NM_018934	0	0	3	3	0	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	11.91	1.778390	0.31502	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.52983	0.65;0.64	4.17	4.17	0.49024	.	.	.	.	.	T	0.47135	0.1429	M	0.83483	2.645	0.09310	N	1	P	0.35575	0.51	B	0.30572	0.117	T	0.52540	-0.8562	9	0.59425	D	0.04	.	6.9347	0.24461	0.0935:0.0:0.7321:0.1744	.	684	Q9Y5E9	PCDBE_HUMAN	N	531;684	ENSP00000444518:D531N;ENSP00000239449:D684N	ENSP00000239449:D684N	D	+	1	0	PCDHB14	140585311	0.747000	0.28283	0.039000	0.18376	0.064000	0.16182	2.451000	0.44952	2.022000	0.59522	0.650000	0.86243	GAC	.		0.701	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
E2F3	1871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	20490451	20490451	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:20490451C>G	ENST00000346618.3	+	7	1254	c.1188C>G	c.(1186-1188)aaC>aaG	p.N396K	E2F3_ENST00000535432.1_Missense_Mutation_p.N265K	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	396	Transactivation. {ECO:0000255}.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			CTATGGGAAACCTTTCTCCTC	0.443																																					p.N396K		.											.	E2F3-414	0			c.C1188G						.						72.0	71.0	71.0					6																	20490451		2203	4300	6503	SO:0001583	missense	1871	exon7			GGGAAACCTTTCT	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.1188C>G	6.37:g.20490451C>G	ENSP00000262904:p.Asn396Lys	83	0		101	52	NM_001949	0	0	1	2	1	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	37	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	C	0.070	-1.205397	0.01568	.	.	ENSG00000112242	ENST00000346618;ENST00000535432	T;T	0.06294	3.32;3.35	5.49	2.71	0.32032	.	0.637186	0.17731	N	0.163882	T	0.00637	0.0021	N	0.08118	0	0.20489	N	0.999892	B	0.15473	0.013	B	0.11329	0.006	T	0.46190	-0.9209	10	0.06236	T	0.91	.	3.2605	0.06846	0.2493:0.5042:0.1104:0.1361	.	396	O00716	E2F3_HUMAN	K	396;265	ENSP00000262904:N396K;ENSP00000443418:N265K	ENSP00000262904:N396K	N	+	3	2	E2F3	20598430	0.274000	0.24191	0.948000	0.38648	0.975000	0.68041	0.955000	0.29188	0.355000	0.24131	-0.224000	0.12420	AAC	.		0.443	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
HLA-A	3105	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	29910554	29910554	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:29910554T>G	ENST00000396634.1	+	4	435	c.94T>G	c.(94-96)Ttc>Gtc	p.F32V	HLA-A_ENST00000376806.5_Missense_Mutation_p.F32V|HLA-A_ENST00000376802.2_Missense_Mutation_p.F32V|HLA-A_ENST00000376809.5_Missense_Mutation_p.F32V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	32	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CATGAGGTATTTCTTCACATC	0.726									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.F32V		.											.	HLA-A-92	0			c.T94G						.						15.0	15.0	15.0					6																	29910554		2179	4265	6444	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	AGGTATTTCTTCA	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.94T>G	6.37:g.29910554T>G	ENSP00000379873:p.Phe32Val	109	0		134	38	NM_001242758	0	0	958	958	0	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	10.84	1.463317	0.26248	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00932	5.53;5.53;5.53;5.53	3.72	2.53	0.30540	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.000000	0.35349	U	0.003271	T	0.03178	0.0093	H	0.96142	3.775	0.09310	N	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.998;0.999	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.998;0.999	T	0.29971	-0.9994	10	0.87932	D	0	.	5.839	0.18623	0.0:0.1258:0.0:0.8742	.	32;32;32;32;32	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	V	32	ENSP00000379873:F32V;ENSP00000366002:F32V;ENSP00000366005:F32V;ENSP00000365998:F32V	ENSP00000348012:F32V	F	+	1	0	HLA-A	30018533	0.004000	0.15560	0.034000	0.17996	0.201000	0.24016	0.452000	0.21795	0.620000	0.30215	0.391000	0.25812	TTC	.		0.726	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
BRD2	6046	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	32944714	32944714	+	Splice_Site	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:32944714G>A	ENST00000374825.4	+	7	2901		c.e7+1		BRD2_ENST00000395287.1_Splice_Site|BRD2_ENST00000374831.4_Splice_Site|BRD2_ENST00000449085.2_Splice_Site|BRD2_ENST00000395289.2_Splice_Site|BRD2_ENST00000443797.2_Splice_Site	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2						chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)	p.?(1)		central_nervous_system(3)|stomach(2)	5						CACTGTCAAGGTACCCACTGC	0.507																																					.		.											.	BRD2-398	1	Unknown(1)	upper_aerodigestive_tract(1)	c.1200+1G>A						.						60.0	64.0	63.0					6																	32944714		1472	2670	4142	SO:0001630	splice_region_variant	6046	exon7			GTCAAGGTACCCA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1200+1G>A	6.37:g.32944714G>A		29	0		42	21	NM_005104	0	0	1	21	20	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Splice_Site	SNP	ENST00000374825.4	37	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493736	0.64186	.	.	ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449025;ENST00000449085	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8266	0.78711	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BRD2	33052692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.592000	0.98245	2.679000	0.91253	0.637000	0.83480	.	.		0.507	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		Intron
CAPN11	11131	broad.mit.edu	37	6	44148401	44148401	+	Splice_Site	SNP	T	T	G	rs200836901	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:44148401T>G	ENST00000398776.1	+	16	1784		c.e16+2		CAPN11_ENST00000542245.1_Splice_Site	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCAGGAGAGGTGAGCAGGCCA	0.607													t|||	28	0.00559105	0.0098	0.0014	5008	,	,		11389	0.003		0.003	False		,,,				2504	0.0082				.													.	CAPN11-136	0			c.1746+2T>G						.						32.0	36.0	35.0					6																	44148401		1912	4125	6037	SO:0001630	splice_region_variant	11131	exon16			GAGAGGTGAGCAG	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1746+2T>G	6.37:g.44148401T>G		89	15		76	21	NM_007058	0	0	0	0	0	B2RA64|Q5T3G1|Q8N4R5	Splice_Site	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	t	26.6	4.751671	0.89753	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4973	0.61434	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPN11	44256379	1.000000	0.71417	0.988000	0.46212	0.751000	0.42716	5.666000	0.68059	2.045000	0.60652	0.404000	0.27445	.	T|0.999;A|0.000		0.607	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		Intron
MDN1	23195	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90392973	90392973	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:90392973T>G	ENST00000369393.3	-	73	12095	c.11980A>C	c.(11980-11982)Aag>Cag	p.K3994Q	MDN1_ENST00000428876.1_Missense_Mutation_p.K3994Q			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3994					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGTTCTTCCTTGTCACTCTCC	0.493																																					p.K3994Q													.	MDN1-100	0			c.A11980C						.						95.0	82.0	87.0					6																	90392973		2203	4300	6503	SO:0001583	missense	23195	exon73			CTTCCTTGTCACT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.11980A>C	6.37:g.90392973T>G	ENSP00000358400:p.Lys3994Gln	99	1		113	46	NM_014611	0	0	0	0	0	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	11.13	1.548514	0.27652	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03301	3.98;3.98	5.7	0.196	0.15159	.	0.418027	0.27802	N	0.017789	T	0.00784	0.0026	L	0.35793	1.09	0.24730	N	0.993092	B	0.14805	0.011	B	0.14023	0.01	T	0.47861	-0.9084	10	0.10902	T	0.67	.	6.7775	0.23628	0.0:0.2036:0.2011:0.5954	.	3994	Q9NU22	MDN1_HUMAN	Q	3994	ENSP00000358400:K3994Q;ENSP00000413970:K3994Q	ENSP00000358400:K3994Q	K	-	1	0	MDN1	90449694	1.000000	0.71417	0.988000	0.46212	0.877000	0.50540	1.992000	0.40737	0.122000	0.18314	0.459000	0.35465	AAG	.		0.493	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
ASCC3	10973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	101075824	101075824	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:101075824C>A	ENST00000369162.2	-	28	4759	c.4415G>T	c.(4414-4416)cGa>cTa	p.R1472L		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1472	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AAAATTTGTTCGAGATACAAT	0.393																																					p.R1472L		.											.	ASCC3-96	0			c.G4415T						.						108.0	105.0	106.0					6																	101075824		2203	4300	6503	SO:0001583	missense	10973	exon28			TTTGTTCGAGATA	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4415G>T	6.37:g.101075824C>A	ENSP00000358159:p.Arg1472Leu	74	0		69	30	NM_006828	0	0	1	10	9	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124487	0.94429	.	.	ENSG00000112249	ENST00000369162	T	0.14640	2.49	6.17	6.17	0.99709	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68383	-0.5423	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1472	Q8N3C0	HELC1_HUMAN	L	1472	ENSP00000358159:R1472L	ENSP00000358159:R1472L	R	-	2	0	ASCC3	101182545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGA	.		0.393	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
NRCAM	4897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107807453	107807453	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:107807453T>C	ENST00000425651.2	-	27	3378	c.3379A>G	c.(3379-3381)Atg>Gtg	p.M1127V	NRCAM_ENST00000379028.3_Missense_Mutation_p.M1127V|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379022.4_Missense_Mutation_p.M1127V|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1127	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GTTCCTGGCATTAGACCCTTT	0.433																																					p.M1127V		.											.	NRCAM-156	0			c.A3379G						.						76.0	81.0	79.0					7																	107807453		1972	4151	6123	SO:0001583	missense	4897	exon27			CTGGCATTAGACC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3379A>G	7.37:g.107807453T>C	ENSP00000401244:p.Met1127Val	123	0		133	50	NM_001037132	0	0	0	0	0	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	T	9.859	1.195856	0.22037	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000425651;ENST00000379022	T;T;T	0.55760	0.5;0.5;0.5	5.67	3.17	0.36434	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.360043	0.35838	N	0.002958	T	0.29945	0.0749	N	0.14661	0.345	0.27571	N	0.949892	B	0.02656	0.0	B	0.01281	0.0	T	0.14531	-1.0469	10	0.14656	T	0.56	.	8.9597	0.35840	0.0:0.0674:0.126:0.8066	.	1127	Q92823	NRCAM_HUMAN	V	1127	ENSP00000368314:M1127V;ENSP00000401244:M1127V;ENSP00000368308:M1127V	ENSP00000368308:M1127V	M	-	1	0	NRCAM	107594689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.529000	0.60588	1.086000	0.41228	0.523000	0.50628	ATG	.		0.433	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
OR6V1	346517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142750247	142750247	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:142750247G>C	ENST00000418316.1	+	1	831	c.810G>C	c.(808-810)aaG>aaC	p.K270N		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					AAGTCAGGAAGGTCGTGGCCT	0.507																																					p.K270N		.											.	OR6V1-23	0			c.G810C						.						104.0	112.0	110.0					7																	142750247		2053	4182	6235	SO:0001583	missense	346517	exon1			CAGGAAGGTCGTG		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.810G>C	7.37:g.142750247G>C	ENSP00000396085:p.Lys270Asn	72	0		80	41	NM_001001667	0	0	0	0	0	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	37	CCDS47728.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109344	0.37242	.	.	ENSG00000225781	ENST00000418316	T	0.00207	8.55	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00666	0.0022	M	0.85041	2.73	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.48103	-0.9064	9	0.87932	D	0	.	14.772	0.69688	0.0:0.0:1.0:0.0	.	270	Q8N148	OR6V1_HUMAN	N	270	ENSP00000396085:K270N	ENSP00000396085:K270N	K	+	3	2	OR6V1	142460369	0.000000	0.05858	0.506000	0.27664	0.262000	0.26303	0.085000	0.14912	2.349000	0.79799	0.655000	0.94253	AAG	.		0.507	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1		
DNAJB6	10049	broad.mit.edu;bcgsc.ca	37	7	157177601	157177601	+	Silent	SNP	T	T	C	rs569868286		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:157177601T>C	ENST00000262177.4	+	7	724	c.519T>C	c.(517-519)acT>acC	p.T173T	DNAJB6_ENST00000452797.2_Silent_p.T124T|DNAJB6_ENST00000429029.2_Silent_p.T173T|DNAJB6_ENST00000443280.1_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	173	Interaction with KRT18.|Ser-rich.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GGGGCCTCACTTCATTCTCTT	0.383													T|||	1	0.000199681	0.0	0.0	5008	,	,		19350	0.0		0.0	False		,,,				2504	0.001				p.T173T	Esophageal Squamous(46;195 967 1350 20350 43814)												.	DNAJB6-93	0			c.T519C						.						122.0	119.0	120.0					7																	157177601		2203	4298	6501	SO:0001819	synonymous_variant	10049	exon7			CCTCACTTCATTC	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.519T>C	7.37:g.157177601T>C		78	1		95	37	NM_058246	0	0	31	31	0	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	ENST00000262177.4	37	CCDS5946.1																																																																																			.		0.383	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
DNAJB6	10049	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	157177612	157177612	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:157177612C>T	ENST00000262177.4	+	7	735	c.530C>T	c.(529-531)tCc>tTc	p.S177F	DNAJB6_ENST00000452797.2_Missense_Mutation_p.S128F|DNAJB6_ENST00000429029.2_Missense_Mutation_p.S177F|DNAJB6_ENST00000443280.1_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	177	Interaction with KRT18.|Ser-rich.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		TCATTCTCTTCCACGTCATTT	0.393																																					p.S177F	Esophageal Squamous(46;195 967 1350 20350 43814)												.	DNAJB6-93	0			c.C530T						.						122.0	118.0	120.0					7																	157177612		2203	4300	6503	SO:0001583	missense	10049	exon7			TCTCTTCCACGTC	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.530C>T	7.37:g.157177612C>T	ENSP00000262177:p.Ser177Phe	96	1		104	43	NM_058246	0	0	61	61	0	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Missense_Mutation	SNP	ENST00000262177.4	37	CCDS5946.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673592	0.29693	.	.	ENSG00000105993	ENST00000429029;ENST00000262177;ENST00000417758;ENST00000452797;ENST00000421417	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.52	4.52	0.55395	.	0.233153	0.29021	N	0.013381	D	0.84669	0.5523	M	0.84156	2.68	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;0.999;0.983	D;D;D;P	0.76575	0.988;0.956;0.956;0.731	D	0.84838	0.0806	10	0.35671	T	0.21	.	17.5948	0.88009	0.0:1.0:0.0:0.0	.	128;177;177;177	B4DN73;A8KAG0;O75190;O75190-2	.;.;DNJB6_HUMAN;.	F	177;177;177;128;177	ENSP00000397556:S177F;ENSP00000262177:S177F;ENSP00000400665:S177F;ENSP00000402270:S128F	ENSP00000262177:S177F	S	+	2	0	DNAJB6	156870373	1.000000	0.71417	0.104000	0.21259	0.085000	0.17905	6.331000	0.72929	2.245000	0.73994	0.655000	0.94253	TCC	.		0.393	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
SNAI2	6591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	49833817	49833817	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr8:49833817C>G	ENST00000396822.1	-	2	365	c.8G>C	c.(7-9)cGc>cCc	p.R3P	SNAI2_ENST00000020945.1_Missense_Mutation_p.R3P			O43623	SNAI2_HUMAN	snail family zinc finger 2	3	SNAG domain. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CAGGAAGGAGCGCGGCATCTT	0.587																																					p.R3P		.											.	SNAI2-188	0			c.G8C						.						107.0	108.0	107.0					8																	49833817		2203	4300	6503	SO:0001583	missense	6591	exon1			AAGGAGCGCGGCA	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.8G>C	8.37:g.49833817C>G	ENSP00000380034:p.Arg3Pro	36	0		38	22	NM_003068	0	0	0	0	0	B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	37	CCDS6146.1	.	.	.	.	.	.	.	.	.	.	C	32	5.143242	0.94560	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.19938	2.11;2.11	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.52885	0.1762	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58808	-0.7571	9	.	.	.	-21.1684	18.5472	0.91052	0.0:1.0:0.0:0.0	.	3	O43623	SNAI2_HUMAN	P	3	ENSP00000020945:R3P;ENSP00000380034:R3P	.	R	-	2	0	SNAI2	49996370	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.380000	0.79704	2.377000	0.81083	0.313000	0.20887	CGC	.		0.587	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068	
RFX3	5991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	3301560	3301560	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr9:3301560G>A	ENST00000382004.3	-	6	846	c.535C>T	c.(535-537)Ctt>Ttt	p.L179F	RFX3_ENST00000302303.1_Missense_Mutation_p.L179F|RFX3_ENST00000358730.2_Missense_Mutation_p.L179F	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	179					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CTGTTGAGAAGAGAGCTTCTG	0.398																																					p.L179F		.											.	RFX3-93	0			c.C535T						.						157.0	135.0	143.0					9																	3301560		2203	4300	6503	SO:0001583	missense	5991	exon6			TGAGAAGAGAGCT	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.535C>T	9.37:g.3301560G>A	ENSP00000371434:p.Leu179Phe	75	0		87	44	NM_134428	0	0	0	0	0	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832324	0.91036	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000451859	D;D;D;T	0.83075	-1.68;-1.68;-1.68;0.27	5.87	5.87	0.94306	.	0.137392	0.50627	D	0.000106	T	0.75110	0.3805	N	0.02011	-0.69	0.58432	D	0.999994	D;B;D	0.58620	0.983;0.037;0.965	P;B;P	0.55345	0.731;0.037;0.774	T	0.82536	-0.0408	10	0.56958	D	0.05	-9.8293	16.4906	0.84200	0.0:0.0:0.8686:0.1314	.	179;179;179	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	F	179	ENSP00000371434:L179F;ENSP00000351574:L179F;ENSP00000303847:L179F;ENSP00000411756:L179F	ENSP00000303847:L179F	L	-	1	0	RFX3	3291560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.781000	0.95711	0.655000	0.94253	CTT	.		0.398	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
RASEF	158158	broad.mit.edu;bcgsc.ca	37	9	85637283	85637283	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr9:85637283T>G	ENST00000376447.3	-	3	897	c.637A>C	c.(637-639)Att>Ctt	p.I213L		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	213					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GCAGCCTGAATCCTCTGATCC	0.468																																					p.I213L													.	RASEF-280	0			c.A637C						.						276.0	237.0	250.0					9																	85637283		2203	4300	6503	SO:0001583	missense	158158	exon3			CCTGAATCCTCTG	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.637A>C	9.37:g.85637283T>G	ENSP00000365630:p.Ile213Leu	95	2		69	27	NM_152573	0	0	4	7	3	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261658	0.59431	.	.	ENSG00000165105	ENST00000376447	T	0.61627	0.09	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	L	0.46947	1.48	0.80722	D	1	B	0.34329	0.449	B	0.35312	0.2	T	0.49322	-0.8952	10	0.25106	T	0.35	.	16.2792	0.82664	0.0:0.0:0.0:1.0	.	213	Q8IZ41	RASEF_HUMAN	L	213	ENSP00000365630:I213L	ENSP00000365630:I213L	I	-	1	0	RASEF	84827103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.504000	0.53347	2.243000	0.73865	0.533000	0.62120	ATT	.		0.468	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
GLUD2	2747	ucsc.edu	37	X	120183026	120183026	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrX:120183026T>G	ENST00000328078.1	+	1	1565	c.1488T>G	c.(1486-1488)agT>agG	p.S496R		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	496					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TCCAAGACAGTATATCGGGTG	0.453																																					p.S496R													.	GLUD2-131	0			c.T1488G						.						163.0	129.0	141.0					X																	120183026		2203	4300	6503	SO:0001583	missense	2747	exon1			AGACAGTATATCG	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1488T>G	X.37:g.120183026T>G	ENSP00000327589:p.Ser496Arg	145	0		176	2	NM_012084	1	0	5	157	151	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.467675	0.00011	.	.	ENSG00000182890	ENST00000328078	D	0.95918	-3.85	1.99	-3.98	0.04082	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.045906	0.85682	N	0.000000	T	0.72961	0.3526	N	0.00453	-1.485	0.19300	N	0.999976	B	0.02656	0.0	B	0.01281	0.0	T	0.76277	-0.3018	10	0.02654	T	1	.	4.3409	0.11110	0.6313:0.0:0.1881:0.1806	.	496	P49448	DHE4_HUMAN	R	496	ENSP00000327589:S496R	ENSP00000327589:S496R	S	+	3	2	GLUD2	120010707	1.000000	0.71417	0.043000	0.18650	0.080000	0.17528	0.344000	0.19962	-1.074000	0.03132	-1.405000	0.01134	AGT	.		0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
ATP11C	286410	broad.mit.edu;bcgsc.ca	37	X	138857091	138857091	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrX:138857091C>G	ENST00000327569.3	-	19	2081	c.1983G>C	c.(1981-1983)gaG>gaC	p.E661D	ATP11C_ENST00000359686.2_Missense_Mutation_p.E661D|ATP11C_ENST00000370557.1_Missense_Mutation_p.E658D|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Missense_Mutation_p.E661D|ATP11C_ENST00000370543.1_Missense_Mutation_p.E661D	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	661					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					CTTCAATGGTCTCTGCAGCTT	0.463																																					p.E661D													.	ATP11C-198	0			c.G1983C						.						77.0	67.0	70.0					X																	138857091		2203	4300	6503	SO:0001583	missense	286410	exon19			AATGGTCTCTGCA	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1983G>C	X.37:g.138857091C>G	ENSP00000332756:p.Glu661Asp	94	1		97	54	NM_001010986	0	0	2	2	0	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416378	0.42918	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22	5.84	4.07	0.47477	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.86381	0.5919	N	0.16368	0.405	0.50171	D	0.999855	B;B	0.23377	0.069;0.084	B;B	0.28139	0.051;0.086	T	0.80765	-0.1236	10	0.28530	T	0.3	.	10.299	0.43642	0.0:0.8396:0.0:0.1604	.	661;661	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	D	658;661;661;661;661	ENSP00000359588:E658D;ENSP00000355165:E661D;ENSP00000332756:E661D;ENSP00000359574:E661D;ENSP00000352715:E661D	ENSP00000332756:E661D	E	-	3	2	ATP11C	138684757	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.859000	0.27858	1.239000	0.43787	0.529000	0.55759	GAG	.		0.463	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
CNGA2	1260	bcgsc.ca	37	X	150912596	150912596	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrX:150912596C>A	ENST00000329903.4	+	6	1654	c.1621C>A	c.(1621-1623)Cgc>Agc	p.R541S		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	541					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					AGCTAATATCCGCAGCCTGGG	0.498																																					p.R541S													.	CNGA2-193	0			c.C1621A						.						156.0	134.0	142.0					X																	150912596		2203	4300	6503	SO:0001583	missense	1260	exon7			AATATCCGCAGCC	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1621C>A	X.37:g.150912596C>A	ENSP00000328478:p.Arg541Ser	90	1		97	5	NM_005140	0	0	0	0	0	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307310	0.60305	.	.	ENSG00000183862	ENST00000329903	D	0.97114	-4.25	5.33	5.33	0.75918	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.98523	0.9507	M	0.90019	3.08	0.80722	D	1	D	0.62365	0.991	D	0.64595	0.927	D	0.99632	1.0986	10	0.87932	D	0	.	15.3498	0.74373	0.0:1.0:0.0:0.0	.	541	Q16280	CNGA2_HUMAN	S	541	ENSP00000328478:R541S	ENSP00000328478:R541S	R	+	1	0	CNGA2	150663252	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.561000	0.60809	2.216000	0.71823	0.529000	0.55759	CGC	.		0.498	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
KANK4	163782	bcgsc.ca	37	1	62740357	62740357	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:62740357delA	ENST00000371153.4	-	3	797	c.419delT	c.(418-420)ttgfs	p.L140fs	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	140						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGCAGCTTCCAACTGTCTGGT	0.607																																					p.L140fs													.	KANK4-74	0			c.419delT						.						35.0	40.0	38.0					1																	62740357		2202	4300	6502	SO:0001589	frameshift_variant	163782	exon3			GCTTCCAACTGTC	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.419delT	1.37:g.62740357delA	ENSP00000360195:p.Leu140fs	50	1		61	24	NM_181712	0	0	0	0	0	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Frame_Shift_Del	DEL	ENST00000371153.4	37	CCDS620.1																																																																																			.		0.607	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
KANK4	163782	hgsc.bcm.edu	37	1	62740357	62740358	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:62740357_62740358delAA	ENST00000371153.4	-	3	796_797	c.418_419delTT	c.(418-420)ttgfs	p.L140fs	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	140						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGCAGCTTCCAACTGTCTGGTG	0.604																																					p.140_140del		.											.	KANK4-74	0			c.418_419del						.																																			SO:0001589	frameshift_variant	163782	exon3			.	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.418_419delTT	1.37:g.62740357_62740358delAA	ENSP00000360195:p.Leu140fs	51	0		62	15	NM_181712	0	0	0	0	0	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Frame_Shift_Del	DEL	ENST00000371153.4	37	CCDS620.1																																																																																			.		0.604	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
CASC5	57082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	40914359	40914359	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr15:40914359delA	ENST00000346991.5	+	11	2365	c.1975delA	c.(1975-1977)agcfs	p.S659fs	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Frame_Shift_Del_p.S633fs			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	659	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGCCAAAAACAGCTTAACCGA	0.388																																					p.S659fs		.											.	CASC5-660	0			c.1975delA						.						82.0	79.0	80.0					15																	40914359		1881	4102	5983	SO:0001589	frameshift_variant	57082	exon11			.	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1975delA	15.37:g.40914359delA	ENSP00000335463:p.Ser659fs	103	0		111	45	NM_170589	0	0	0	0	0	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Frame_Shift_Del	DEL	ENST00000346991.5	37	CCDS42023.1																																																																																			.		0.388	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
ADCY9	115	hgsc.bcm.edu;bcgsc.ca	37	16	4042307	4042307	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:4042307delC	ENST00000294016.3	-	5	2585	c.2047delG	c.(2047-2049)gagfs	p.E683fs	ADCY9_ENST00000571889.1_Intron	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	683					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTGAGCTTCTCCTCTTGGGGA	0.582																																					p.E683fs		.											.	ADCY9-139	0			c.2047delG						.						72.0	67.0	69.0					16																	4042307		2197	4300	6497	SO:0001589	frameshift_variant	115	exon5			.	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2047delG	16.37:g.4042307delC	ENSP00000294016:p.Glu683fs	69	0		76	26	NM_001116	0	0	0	0	0	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Frame_Shift_Del	DEL	ENST00000294016.3	37	CCDS32382.1																																																																																			.		0.582	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
MYH13	8735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	10215392	10215392	+	Splice_Site	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:10215392delA	ENST00000418404.3	-	31	4530	c.4367delT	c.(4366-4368)gtc>gc	p.V1456fs	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Splice_Site_p.V1456fs			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1456					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCTGCAAGGACCTGGGAGAT	0.517																																					p.V1456fs		.											.	MYH13-6	0			c.4367delT						.						56.0	54.0	55.0					17																	10215392		1981	4180	6161	SO:0001630	splice_region_variant	8735	exon32			.	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4366-1T>-	17.37:g.10215392delA		63	0		93	30	NM_003802	0	0	0	0	0	O95252|Q9P0U8	Frame_Shift_Del	DEL	ENST00000418404.3	37	CCDS45613.1																																																																																			.		0.517	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	Frame_Shift_Del
DLX2	1746	broad.mit.edu	37	2	172967129	172967131	+	In_Frame_Del	DEL	GCT	GCT	-	rs376692475		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:172967129_172967131delGCT	ENST00000234198.4	-	1	497_499	c.136_138delAGC	c.(136-138)agcdel	p.S46del	AC104801.1_ENST00000448117.1_lincRNA|DLX2_ENST00000466293.2_In_Frame_Del_p.S46del	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	46	Poly-Ser.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GCTTGTGGAGgctgctgctgctg	0.739																																					p.46_46del	GBM(188;775 2993 11256 23072)												.	DLX2-515	0			c.136_138del						.			19,76,3319		3,0,13,8,60,1623						4.5	1.0			15	96,156,6524		10,3,73,15,123,3164	no	codingComplex	DLX2	NM_004405.3		13,3,86,23,183,4787	A1A1,A1A2,A1R,A2A2,A2R,RR		3.719,2.7827,3.4053				115,232,9843				SO:0001651	inframe_deletion	1746	exon1			GTGGAGGCTGCTG	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.136_138delAGC	2.37:g.172967138_172967140delGCT	ENSP00000234198:p.Ser46del	78	0		280	12	NM_004405	0	0	0	0	0	B4DMK4|B7ZA14	In_Frame_Del	DEL	ENST00000234198.4	37	CCDS2248.1																																																																																			.		0.739	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255368.3		
TFPI	7035	broad.mit.edu	37	2	188332481	188332481	+	Splice_Site	DEL	T	T	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:188332481delT	ENST00000233156.3	-	7	1101	c.807delA	c.(805-807)aaa>aa	p.K269fs	AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA|TFPI_ENST00000392365.1_Splice_Site_p.K269fs	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)	269					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	CTTCTATACCTTTTTTACATG	0.308																																					p.K269fs													.	TFPI-91	0			c.807delA						.						140.0	140.0	140.0					2																	188332481		2203	4300	6503	SO:0001630	splice_region_variant	7035	exon7			TATACCTTTTTTA		CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.808+1A>-	2.37:g.188332481delT		118	0		615	9	NM_006287	0	0	0	0	0	O95103|Q53TS4	Frame_Shift_Del	DEL	ENST00000233156.3	37	CCDS2294.1																																																																																			.		0.308	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255881.1	NM_006287	Frame_Shift_Del
FAM117B	150864	broad.mit.edu	37	2	203500041	203500043	+	In_Frame_Del	DEL	AGC	AGC	-	rs567562707	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:203500041_203500043delAGC	ENST00000392238.2	+	1	131_133	c.131_133delAGC	c.(130-135)aagcag>aag	p.Q50del	FAM117B_ENST00000303116.6_5'UTR			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	50	Gly-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						TTCCAGCTGAAGCAGCAGCAGCA	0.749																																					p.44_45del													.	FAM117B-91	0			c.131_133del						.																																			SO:0001651	inframe_deletion	150864	exon1			AGCTGAAGCAGCA	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.131_133delAGC	2.37:g.203500050_203500052delAGC	ENSP00000376071:p.Gln50del	19	0		13	4	NM_173511	0	0	0	0	0	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	In_Frame_Del	DEL	ENST00000392238.2	37	CCDS33362.2																																																																																			.		0.749	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	242	0		114	47	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
ULK4	54986	hgsc.bcm.edu;bcgsc.ca	37	3	41795965	41795965	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:41795965delT	ENST00000301831.4	-	22	2671	c.2209delA	c.(2209-2211)attfs	p.I738fs		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	738					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AAACGGATAATTGTGGAGACA	0.358																																					p.I737fs		.											.	ULK4-297	0			c.2209delA						.						82.0	79.0	80.0					3																	41795965		1820	4081	5901	SO:0001589	frameshift_variant	54986	exon22			.	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2209delA	3.37:g.41795965delT	ENSP00000301831:p.Ile738fs	106	0		123	42	NM_017886	0	0	0	0	0	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Frame_Shift_Del	DEL	ENST00000301831.4	37	CCDS43071.1																																																																																			.		0.358	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
IL17RB	55540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	53886139	53886147	+	In_Frame_Del	DEL	CCCTCTGGT	CCCTCTGGT	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	CCCTCTGGT	CCCTCTGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:53886139_53886147delCCCTCTGGT	ENST00000288167.3	+	4	349_357	c.340_348delCCCTCTGGT	c.(340-348)ccctctggtdel	p.PSG114del		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	114					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		TCAGACCAGACCCTCTGGTGGTAAAGTAA	0.478																																					p.114_116del		.											.	IL17RB-229	0			c.340_348del						.																																			SO:0001651	inframe_deletion	55540	exon4			.	AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.340_348delCCCTCTGGT	3.37:g.53886139_53886147delCCCTCTGGT	ENSP00000288167:p.Pro114_Gly116del	126	0		103	35	NM_018725	0	0	0	0	0	Q9BPZ0|Q9NRL4|Q9NRM5	In_Frame_Del	DEL	ENST00000288167.3	37	CCDS2874.1																																																																																			.		0.478	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350563.1	NM_172234	
PRKCI	5584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	170020905	170020905	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:170020905delA	ENST00000295797.4	+	18	2086	c.1781delA	c.(1780-1782)gaafs	p.E594fs		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	594	AGC-kinase C-terminal.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	TCTGCAGAAGAATGTGTCTGA	0.333																																					p.E594fs		.											.	PRKCI-1378	0			c.1781delA						.						154.0	140.0	145.0					3																	170020905		2203	4300	6503	SO:0001589	frameshift_variant	5584	exon18			.		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1781delA	3.37:g.170020905delA	ENSP00000295797:p.Glu594fs	71	0		86	36	NM_002740	0	0	0	0	0	D3DNQ4|Q8WW06	Frame_Shift_Del	DEL	ENST00000295797.4	37	CCDS3212.2																																																																																			.		0.333	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
CD83	9308	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	14133946	14133946	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:14133946delC	ENST00000379153.3	+	4	620	c.449delC	c.(448-450)gctfs	p.A150fs		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	150					defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				CTGCTGCTGGCTCTGGTTATT	0.383																																					p.A150fs		.											.	CD83-90	0			c.449delC						.						132.0	132.0	132.0					6																	14133946		2203	4300	6503	SO:0001589	frameshift_variant	9308	exon4			.	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.449delC	6.37:g.14133946delC	ENSP00000368450:p.Ala150fs	73	0		107	49	NM_004233	0	0	0	0	0	Q5THX9	Frame_Shift_Del	DEL	ENST00000379153.3	37	CCDS4532.1																																																																																			.		0.383	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
MTSS1	9788	hgsc.bcm.edu;bcgsc.ca	37	8	125570101	125570101	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr8:125570101delA	ENST00000518547.1	-	11	1524	c.1051delT	c.(1051-1053)tctfs	p.S351fs	MTSS1_ENST00000354184.4_Intron|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000378017.3_Intron|MTSS1_ENST00000395508.2_Frame_Shift_Del_p.S125fs|MTSS1_ENST00000524090.1_Frame_Shift_Del_p.S241fs|MTSS1_ENST00000431961.2_Intron|MTSS1_ENST00000325064.5_Frame_Shift_Del_p.S355fs|MTSS1_ENST00000523587.1_5'UTR	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	351	Ser-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTATAGTGAGAAAACCCGTTA	0.498																																					p.S351fs	Esophageal Squamous(160;622 1893 3862 8546 12509)	.											.	MTSS1-91	0			c.1051delT						.						22.0	23.0	23.0					8																	125570101		2196	4297	6493	SO:0001589	frameshift_variant	9788	exon11			.	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1051delT	8.37:g.125570101delA	ENSP00000429064:p.Ser351fs	67	0		56	17	NM_014751	0	0	0	0	0	J3KNK6|Q8TCA2|Q96RX2	Frame_Shift_Del	DEL	ENST00000518547.1	37	CCDS6353.1																																																																																			.		0.498	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
EXOSC2	23404	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	133579154	133579154	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr9:133579154delA	ENST00000372358.5	+	9	946	c.875delA	c.(874-876)gagfs	p.E292fs	EXOSC2_ENST00000372351.3_Frame_Shift_Del_p.E262fs|EXOSC2_ENST00000372352.3_Frame_Shift_Del_p.E284fs|EXOSC2_ENST00000546165.1_Frame_Shift_Del_p.E266fs|EXOSC2_ENST00000467138.1_3'UTR			Q13868	EXOS2_HUMAN	exosome component 2	292					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		TTGGAACAGGAGGGATAAGGA	0.478																																					p.E292fs	Pancreas(134;1683 1824 10118 27928 31640)	.											.	EXOSC2-91	0			c.875delA						.						118.0	127.0	124.0					9																	133579154		2203	4300	6503	SO:0001589	frameshift_variant	23404	exon9			.	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.875delA	9.37:g.133579154delA	ENSP00000361433:p.Glu292fs	67	0		92	46	NM_014285	0	0	0	0	0	A3KFL3|B4DKK6|Q9NUY4	Frame_Shift_Del	DEL	ENST00000372358.5	37	CCDS6935.1																																																																																			.		0.478	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054673.1	NM_014285	
TMEM97	27346	broad.mit.edu	37	17	26653806	26653807	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:26653806_26653807insA	ENST00000226230.6	+	3	663_664	c.518_519insA	c.(517-522)agaaaafs	p.RK173fs	TMEM97_ENST00000583381.1_Frame_Shift_Ins_p.RK66fs|TMEM97_ENST00000336687.6_Frame_Shift_Ins_p.RK66fs	NM_014573.2	NP_055388.2	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	173					cholesterol homeostasis (GO:0042632)|regulation of cell growth (GO:0001558)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)		p.K176fs?(1)		endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	6	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAAGAGAAAAGAAAAAAAAAAT	0.441																																					p.R173fs													.	TMEM97-90	1	Deletion - Frameshift(1)	lung(1)	c.518_519insA						.																																			SO:0001589	frameshift_variant	27346	exon3			AGAAAAGAAAAAA	BC091504	CCDS11226.2	17q11.2	2014-01-28			ENSG00000109084	ENSG00000109084			28106	protein-coding gene	gene with protein product		612912				7694637, 15375745	Standard	NM_014573		Approved	MAC30	uc002hat.3	Q5BJF2	OTTHUMG00000132497	ENST00000226230.6:c.528dupA	17.37:g.26653816_26653816dupA	ENSP00000226230:p.Arg173fs	52	0		87	8	NM_014573	0	0	0	0	0	B4DS02|Q07823	Frame_Shift_Ins	INS	ENST00000226230.6	37	CCDS11226.2																																																																																			.		0.441	TMEM97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255675.2	NM_014573	
AR	367	hgsc.bcm.edu	37	X	66765207	66765208	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrX:66765207_66765208GC>AG	ENST00000374690.3	+	1	743_744	c.219_220GC>AG	c.(217-222)caGCag>caAGag	p.Q74E	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q74E|AR_ENST00000504326.1_Missense_Mutation_p.Q74E	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	74	Gln-rich.|Modulating.|Poly-Gln.		Missing.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcagcagca	0.668									Androgen Insensitivity Syndrome																												p.Q74E		.											.	AR-661	0			c.C220G						.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CAGCAGCAGCAGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	X.37:g.66765207_66765208delinsAG	ENSP00000363822:p.Gln74Glu	97.0	0.0		104.0	8.0	NM_000044	0	0	0	0	0	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	DNP	ENST00000374690.3	37	CCDS14387.1																																																																																			.		0.668	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
