#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP5F1	515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	112002161	112002161	+	Missense_Mutation	SNP	A	A	G	rs201457142		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:112002161A>G	ENST00000369722.3	+	6	1202	c.596A>G	c.(595-597)tAt>tGt	p.Y199C	ATP5F1_ENST00000483994.1_Missense_Mutation_p.Y138C|ATP5F1_ENST00000369721.4_3'UTR	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	199					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGCCTGGACTATCATATATCT	0.418													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19484	0.0		0.0	False		,,,				2504	0.0				p.Y199C		.											.	ATP5F1-90	0			c.A596G						.	A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	79.0	85.0	83.0		596	4.8	1.0	1		83	1,8599		0,1,4299	no	missense	ATP5F1	NM_001688.4	194	0,2,6501	GG,GA,AA		0.0116,0.0227,0.0154	probably-damaging	199/257	112002161	2,13004	2203	4300	6503	SO:0001583	missense	515	exon6			TGGACTATCATAT	X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.596A>G	1.37:g.112002161A>G	ENSP00000358737:p.Tyr199Cys	73	0		50	7	NM_001688	0	0	171	276	105	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	ENST00000369722.3	37	CCDS836.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.189998	0.58017	2.27E-4	1.16E-4	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.38887	1.11;1.11	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71178	-0.4669	10	0.59425	D	0.04	.	14.394	0.66999	1.0:0.0:0.0:0.0	.	199;199	Q08ET0;P24539	.;AT5F1_HUMAN	C	199;138	ENSP00000358737:Y199C;ENSP00000420366:Y138C	ENSP00000358737:Y199C	Y	+	2	0	ATP5F1	111803684	1.000000	0.71417	0.998000	0.56505	0.208000	0.24298	8.489000	0.90461	1.956000	0.56807	0.383000	0.25322	TAT	A|0.999;G|0.001		0.418	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032455.1	NM_001688	
SLC16A1	6566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113460277	113460277	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:113460277G>A	ENST00000538576.1	-	4	1582	c.751C>T	c.(751-753)Cag>Tag	p.Q251*	SLC16A1_ENST00000433570.4_Nonsense_Mutation_p.Q251*|SLC16A1_ENST00000369626.3_Nonsense_Mutation_p.Q251*	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	251					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TCCAGGAACTGATTAATTGTT	0.388																																					p.Q251X		.											.	SLC16A1-514	0			c.C751T						.						101.0	103.0	103.0					1																	113460277		2203	4300	6503	SO:0001587	stop_gained	6566	exon4			GGAACTGATTAAT	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.751C>T	1.37:g.113460277G>A	ENSP00000441065:p.Gln251*	156	0		86	17	NM_001166496	0	0	9	14	5	Q49A45|Q5T8R6|Q9NSJ9	Nonsense_Mutation	SNP	ENST00000538576.1	37	CCDS858.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639199	0.67244	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580	.	.	.	5.74	-3.2	0.05156	.	0.477590	0.27223	N	0.020353	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6817	0.91548	0.0:0.0:0.6596:0.3404	.	.	.	.	X	251	.	ENSP00000358640:Q251X	Q	-	1	0	SLC16A1	113261800	0.997000	0.39634	0.183000	0.23137	0.253000	0.25986	1.851000	0.39338	-0.739000	0.04809	-0.457000	0.05445	CAG	.		0.388	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051	
SNAPIN	23557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153631989	153631989	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:153631989C>G	ENST00000368685.5	+	3	346	c.256C>G	c.(256-258)Ctt>Gtt	p.L86V	ILF2_ENST00000480213.1_5'Flank|SNAPIN_ENST00000478558.1_3'UTR	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	86	Interaction with TOR1A.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAAGAAGCTACTTAATGCCCG	0.443																																					p.L86V		.											.	SNAPIN-68	0			c.C256G						.						147.0	146.0	146.0					1																	153631989		2203	4300	6503	SO:0001583	missense	23557	exon3			AAGCTACTTAATG	AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.256C>G	1.37:g.153631989C>G	ENSP00000357674:p.Leu86Val	148	0		95	14	NM_012437	0	0	36	51	15	D3DV56|Q5SXU8	Missense_Mutation	SNP	ENST00000368685.5	37	CCDS1049.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734669	0.48939	.	.	ENSG00000143553	ENST00000368685	T	0.46451	0.87	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.19685	0.0473	L	0.39245	1.2	0.49582	D	0.999803	B	0.28998	0.23	B	0.20955	0.032	T	0.03364	-1.1044	10	0.15066	T	0.55	-16.4091	17.2626	0.87075	0.0:1.0:0.0:0.0	.	86	O95295	SNAPN_HUMAN	V	86	ENSP00000357674:L86V	ENSP00000357674:L86V	L	+	1	0	SNAPIN	151898613	0.999000	0.42202	0.961000	0.40146	0.986000	0.74619	4.168000	0.58216	2.941000	0.99782	0.655000	0.94253	CTT	.		0.443	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090036.1	NM_012437	
FRMPD2	143162	hgsc.bcm.edu	37	10	49365382	49365382	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr10:49365382A>G	ENST00000374201.3	-	29	4215	c.3913T>C	c.(3913-3915)Tcg>Ccg	p.S1305P	FRMPD2_ENST00000407470.4_Missense_Mutation_p.S1273P|FRMPD2_ENST00000305531.3_Missense_Mutation_p.S1280P|FRMPD2_ENST00000463706.1_5'Flank|RP11-13E1.5_ENST00000429307.1_RNA|FRMPD2_ENST00000474573.1_Missense_Mutation_p.S257P	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	1305					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ATATCTGTCGAAAGTCTGGTT	0.433																																					p.S1305P		.											.	FRMPD2-153	0			c.T3913C						.						1.0	1.0	1.0					10																	49365382		249	629	878	SO:0001583	missense	143162	exon29			CTGTCGAAAGTCT	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3913T>C	10.37:g.49365382A>G	ENSP00000363317:p.Ser1305Pro	195	0		180	23	NM_001018071	0	0	0	1	1	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	A	11.91	1.780390	0.31502	.	.	ENSG00000170324	ENST00000474573;ENST00000374201;ENST00000305531;ENST00000407470	T;T;T;T	0.67345	3.3;-0.23;-0.26;-0.26	4.25	-3.06	0.05379	.	.	.	.	.	T	0.46678	0.1405	N	0.24115	0.695	0.09310	N	1	B;B;B;P	0.40476	0.002;0.001;0.002;0.718	B;B;B;B	0.41036	0.004;0.002;0.004;0.346	T	0.41538	-0.9503	9	0.72032	D	0.01	.	2.4491	0.04514	0.1971:0.3749:0.3097:0.1183	.	1280;1305;1273;316	Q68DX3-2;Q68DX3;F8WCT2;Q68DX3-4	.;FRPD2_HUMAN;.;.	P	257;1305;1280;1273	ENSP00000422446:S257P;ENSP00000363317:S1305P;ENSP00000307079:S1280P;ENSP00000384339:S1273P	ENSP00000307079:S1280P	S	-	1	0	FRMPD2	49035388	0.021000	0.18746	0.000000	0.03702	0.873000	0.50193	-0.185000	0.09684	-0.595000	0.05828	0.529000	0.55759	TCG	.		0.433	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
C10orf71	118461	hgsc.bcm.edu	37	10	50532033	50532033	+	Silent	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr10:50532033G>A	ENST00000374144.3	+	3	1731	c.1443G>A	c.(1441-1443)aaG>aaA	p.K481K	C10orf71_ENST00000323868.4_Silent_p.K481K			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	481										endometrium(1)	1						ACCAAGAGAAGGAGCCCAGTG	0.562																																					p.K481K		.											.	C10orf71-90	0			c.G1443A						.						32.0	35.0	34.0					10																	50532033		2071	4207	6278	SO:0001819	synonymous_variant	118461	exon3			AGAGAAGGAGCCC	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1443G>A	10.37:g.50532033G>A		48	0		39	3	NM_001135196	0	0	0	0	0	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1																																																																																			.		0.562	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
CCAR1	55749	hgsc.bcm.edu	37	10	70547739	70547739	+	Nonsense_Mutation	SNP	T	T	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr10:70547739T>G	ENST00000265872.6	+	22	3055	c.2936T>G	c.(2935-2937)tTa>tGa	p.L979*	CCAR1_ENST00000543719.1_Nonsense_Mutation_p.L964*|CCAR1_ENST00000535016.1_Nonsense_Mutation_p.L964*	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	979					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TACCGGAAATTAACAGACACC	0.333																																					p.L979X		.											.	CCAR1-159	0			c.T2936G						.						74.0	77.0	76.0					10																	70547739		2203	4300	6503	SO:0001587	stop_gained	55749	exon22			GGAAATTAACAGA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2936T>G	10.37:g.70547739T>G	ENSP00000265872:p.Leu979*	51	0		40	2	NM_018237	0	0	50	50	0	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Nonsense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	41|41	8.925078|8.925078	0.99004|0.99004	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000543706|ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.64402	.|D	.|0.000004	T|.	0.37652|.	0.1011|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35151|.	-0.9800|.	3|.	.|0.02654	.|T	.|1	-7.0371|-7.0371	15.4296|15.4296	0.75081|0.75081	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	M|X	268|979;964;964;964	.|.	.|ENSP00000265872:L979X	I|L	+|+	3|2	3|0	CCAR1|CCAR1	70217745|70217745	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.668000|7.668000	0.83897|0.83897	2.035000|2.035000	0.60131|0.60131	0.460000|0.460000	0.39030|0.39030	ATT|TTA	.		0.333	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
PAPSS2	9060	bcgsc.ca	37	10	89474790	89474790	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr10:89474790C>T	ENST00000361175.4	+	6	1057	c.688C>T	c.(688-690)Ccg>Tcg	p.P230S	PAPSS2_ENST00000456849.1_Missense_Mutation_p.P230S|PAPSS2_ENST00000427144.2_Missense_Mutation_p.P234S	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	230					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		ACTCTTTGTGCCGGAAAACAA	0.383																																					p.P230S													.	PAPSS2-493	0			c.C688T						.						85.0	79.0	81.0					10																	89474790		2203	4300	6503	SO:0001583	missense	9060	exon6			TTTGTGCCGGAAA	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.688C>T	10.37:g.89474790C>T	ENSP00000354436:p.Pro230Ser	81	0		70	5	NM_001015880	0	0	26	26	0	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	37	CCDS7385.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626170	0.28978	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.21543	2.0;2.0;2.0	6.06	6.06	0.98353	Sulphate adenylyltransferase (1);PUA-like domain (1);	0.147545	0.64402	D	0.000008	T	0.27559	0.0677	L	0.56396	1.775	0.51767	D	0.999933	B;B	0.15141	0.005;0.012	B;B	0.16722	0.011;0.016	T	0.02450	-1.1157	10	0.31617	T	0.26	-14.4668	20.6208	0.99490	0.0:1.0:0.0:0.0	.	230;230	O95340;O95340-2	PAPS2_HUMAN;.	S	230;230;234;229	ENSP00000354436:P230S;ENSP00000406157:P230S;ENSP00000397123:P234S	ENSP00000354436:P230S	P	+	1	0	PAPSS2	89464770	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	2.986000	0.49370	2.882000	0.98803	0.655000	0.94253	CCG	.		0.383	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
HELLS	3070	hgsc.bcm.edu	37	10	96356840	96356840	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr10:96356840G>T	ENST00000348459.5	+	21	2499	c.2394G>T	c.(2392-2394)gaG>gaT	p.E798D	HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394036.1_3'UTR|HELLS_ENST00000371332.4_Missense_Mutation_p.E844D|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000394045.1_Missense_Mutation_p.E700D	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		AAGATCTAGAGTTGTTGTTAG	0.294																																					p.E798D		.											.	HELLS-92	0			c.G2394T						.						139.0	137.0	138.0					10																	96356840		2203	4299	6502	SO:0001583	missense	3070	exon21			TCTAGAGTTGTTG	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.2394G>T	10.37:g.96356840G>T	ENSP00000239027:p.Glu798Asp	59	0		29	2	NM_018063	0	0	0	0	0		Missense_Mutation	SNP	ENST00000348459.5	37	CCDS7434.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.083952	0.36758	.	.	ENSG00000119969	ENST00000348459;ENST00000394045;ENST00000371332;ENST00000371327	D;D;D;D	0.89343	-2.35;-1.98;-2.5;-1.65	6.02	-3.23	0.05109	.	0.203022	0.51477	D	0.000090	T	0.73329	0.3573	N	0.12182	0.205	0.80722	D	1	B;B;B;B;B	0.31241	0.012;0.011;0.041;0.2;0.315	B;B;B;B;B	0.24155	0.023;0.013;0.032;0.051;0.029	T	0.57195	-0.7853	10	0.27785	T	0.31	-16.0318	13.003	0.58687	0.5469:0.0:0.4531:0.0	.	782;769;668;700;798	Q9NRZ9-2;Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;.;HELLS_HUMAN	D	798;700;844;235	ENSP00000239027:E798D;ENSP00000377609:E700D;ENSP00000360383:E844D;ENSP00000360378:E235D	ENSP00000239027:E798D	E	+	3	2	HELLS	96346830	0.794000	0.28838	0.958000	0.39756	0.963000	0.63663	-0.100000	0.10990	-0.481000	0.06792	-0.982000	0.02568	GAG	.		0.294	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
CAPRIN2	65981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	30888129	30888129	+	Silent	SNP	C	C	T	rs145888176		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:30888129C>T	ENST00000395805.2	-	4	1129	c.582G>A	c.(580-582)gcG>gcA	p.A194A	CAPRIN2_ENST00000417045.1_Silent_p.A194A|CAPRIN2_ENST00000251071.5_Silent_p.A194A|CAPRIN2_ENST00000308433.5_5'UTR|CAPRIN2_ENST00000298892.5_Silent_p.A194A|CAPRIN2_ENST00000538387.1_5'Flank	NM_001206856.1	NP_001193785.1			caprin family member 2									p.A194A(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CCTTCTTTTGCGCTTTTAGTA	0.378																																					p.A194A		.											.	CAPRIN2-92	1	Substitution - coding silent(1)	lung(1)	c.G582A						.	C	,,,	0,4406		0,0,2203	127.0	123.0	125.0		582,582,582,582	-5.3	1.0	12	dbSNP_134	125	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CAPRIN2	NM_001002259.1,NM_001206856.1,NM_023925.3,NM_032156.3	,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,	194/1128,194/906,194/1078,194/961	30888129	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	65981	exon4			CTTTTGCGCTTTT	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.582G>A	12.37:g.30888129C>T		171	0		91	5	NM_023925	0	0	0	0	0		Silent	SNP	ENST00000395805.2	37	CCDS55816.1																																																																																			C|1.000;T|0.000		0.378	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
RAN	5901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	131359114	131359114	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:131359114G>A	ENST00000543796.1	+	5	529	c.271G>A	c.(271-273)Gat>Aat	p.D91N	RAN_ENST00000392369.2_Missense_Mutation_p.D91N|RAN_ENST00000392367.3_Missense_Mutation_p.D108N|RAN_ENST00000254675.3_Missense_Mutation_p.D3N|RAN_ENST00000541630.1_Missense_Mutation_p.D3N			P62826	RAN_HUMAN	RAN, member RAS oncogene family	91					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		CATAATGTTTGATGTAACATC	0.413																																					p.D91N		.											.	RAN-847	0			c.G271A						.						122.0	103.0	109.0					12																	131359114		2203	4300	6503	SO:0001583	missense	5901	exon5			ATGTTTGATGTAA	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.271G>A	12.37:g.131359114G>A	ENSP00000446215:p.Asp91Asn	95	0		50	9	NM_006325	0	0	95	140	45	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Missense_Mutation	SNP	ENST00000543796.1	37	CCDS9271.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769269	0.90020	.	.	ENSG00000132341	ENST00000543796;ENST00000448750;ENST00000541630;ENST00000392369;ENST00000254675;ENST00000535090;ENST00000392367	D;D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	3.93	3.93	0.45458	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95465	0.8527	H	0.96720	3.87	0.80722	D	1	D;D	0.55800	0.973;0.973	D;D	0.68192	0.956;0.956	D	0.97181	0.9851	10	0.87932	D	0	-17.8637	15.3182	0.74099	0.0:0.0:1.0:0.0	.	91;91	A8K3Z8;P62826	.;RAN_HUMAN	N	91;109;3;91;3;87;108	ENSP00000446215:D91N;ENSP00000396127:D109N;ENSP00000441210:D3N;ENSP00000376176:D91N;ENSP00000254675:D3N;ENSP00000444042:D87N;ENSP00000376174:D108N	ENSP00000254675:D3N	D	+	1	0	RAN	129925067	1.000000	0.71417	0.974000	0.42286	0.827000	0.46813	9.335000	0.96500	1.906000	0.55180	0.561000	0.74099	GAT	.		0.413	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
EP400	57634	hgsc.bcm.edu	37	12	132547147	132547147	+	Silent	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:132547147G>A	ENST00000333577.4	+	48	8452	c.8343G>A	c.(8341-8343)caG>caA	p.Q2781Q	EP400_ENST00000389561.2_Silent_p.Q2745Q|EP400_ENST00000332482.4_Silent_p.Q2708Q|EP400_ENST00000389562.2_Silent_p.Q2744Q|EP400_ENST00000330386.6_Silent_p.Q2664Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2781	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		aacagcagcagcagcaacagA	0.612																																					p.Q2745Q		.											.	EP400-520	0			c.G8235A						.						61.0	48.0	52.0					12																	132547147		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8343G>A	12.37:g.132547147G>A		90	1		132	7	NM_015409	0	0	9	9	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.612	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
PCNX	22990	broad.mit.edu	37	14	71476434	71476434	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr14:71476434A>G	ENST00000304743.2	+	9	3159	c.2713A>G	c.(2713-2715)Aat>Gat	p.N905D	PCNX_ENST00000238570.5_Missense_Mutation_p.N905D|PCNX_ENST00000439984.3_Missense_Mutation_p.N799D	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	905						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AAGAGCATCCAATATCTGGTA	0.338																																					p.N905D													.	PCNX-91	0			c.A2713G						.						115.0	94.0	101.0					14																	71476434		2203	4300	6503	SO:0001583	missense	22990	exon9			GCATCCAATATCT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2713A>G	14.37:g.71476434A>G	ENSP00000304192:p.Asn905Asp	72	0		43	4	NM_014982	0	0	0	0	0	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465591	0.63513	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.21361	2.01;2.01;2.86	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.38295	0.1035	L	0.53249	1.67	0.45995	D	0.998805	B;D	0.63880	0.039;0.993	B;D	0.70935	0.016;0.971	T	0.07849	-1.0751	10	0.20046	T	0.44	.	14.5438	0.68015	1.0:0.0:0.0:0.0	.	799;905	B2RTR6;Q96RV3	.;PCX1_HUMAN	D	905;905;799	ENSP00000304192:N905D;ENSP00000238570:N905D;ENSP00000396617:N799D	ENSP00000238570:N905D	N	+	1	0	PCNX	70546187	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.084000	0.89516	1.904000	0.55121	0.477000	0.44152	AAT	.		0.338	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
POMT2	29954	hgsc.bcm.edu;broad.mit.edu	37	14	77765102	77765102	+	Silent	SNP	G	G	A	rs186690580	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr14:77765102G>A	ENST00000261534.4	-	8	1138	c.936C>T	c.(934-936)gaC>gaT	p.D312D		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	312						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TGAAGAAACCGTCACCAGGGC	0.532													G|||	2	0.000399361	0.0	0.0	5008	,	,		20776	0.001		0.0	False		,,,				2504	0.001				p.D312D		.											.	POMT2-91	0			c.C936T						.	G		0,4406		0,0,2203	65.0	59.0	61.0		936	1.6	1.0	14		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	POMT2	NM_013382.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		312/751	77765102	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	29954	exon8			GAAACCGTCACCA	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.936C>T	14.37:g.77765102G>A		34	0		36	7	NM_013382	0	0	0	0	0	Q9NSG6|Q9P1W0|Q9P1W2	Silent	SNP	ENST00000261534.4	37	CCDS9857.1																																																																																			G|0.999;A|0.000		0.532	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	30008820	30008820	+	Silent	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:30008820A>G	ENST00000346128.6	-	23	4671	c.4197T>C	c.(4195-4197)tcT>tcC	p.S1399S	TJP1_ENST00000400011.2_Silent_p.S1323S|TJP1_ENST00000545208.2_Silent_p.S1319S|TJP1_ENST00000356107.6_Silent_p.S1399S	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1399					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CTTACTTTGAAGAATAACTAG	0.368																																					p.S1399S	Melanoma(77;681 1843 6309 6570)	.											.	TJP1-95	0			c.T4197C						.						60.0	61.0	61.0					15																	30008820		1812	4085	5897	SO:0001819	synonymous_variant	7082	exon23			CTTTGAAGAATAA		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4197T>C	15.37:g.30008820A>G		81	0		54	7	NM_003257	0	0	0	0	0	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	37	CCDS42007.1																																																																																			.		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	30065529	30065529	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:30065529G>T	ENST00000346128.6	-	3	590	c.116C>A	c.(115-117)tCt>tAt	p.S39Y	TJP1_ENST00000400011.2_Missense_Mutation_p.S43Y|TJP1_ENST00000495972.2_Missense_Mutation_p.S39Y|TJP1_ENST00000545208.2_Missense_Mutation_p.S39Y|TJP1_ENST00000356107.6_Missense_Mutation_p.S39Y	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	39	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCGTCCACCAGATATTGCAAT	0.363																																					p.S39Y	Melanoma(77;681 1843 6309 6570)	.											.	TJP1-95	0			c.C116A						.						136.0	121.0	126.0					15																	30065529		1874	4102	5976	SO:0001583	missense	7082	exon3			CCACCAGATATTG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.116C>A	15.37:g.30065529G>T	ENSP00000281537:p.Ser39Tyr	148	0		108	19	NM_175610	0	0	0	2	2	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859179	0.71834	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.5	5.5	0.81552	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.66509	0.2796	M	0.92026	3.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.73291	-0.4029	9	.	.	.	.	19.7625	0.96325	0.0:0.0:1.0:0.0	.	32;39;39;43	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	Y	39;43;39;39;39	ENSP00000281537:S39Y;ENSP00000382890:S43Y;ENSP00000441202:S39Y;ENSP00000348416:S39Y	.	S	-	2	0	TJP1	27852821	1.000000	0.71417	0.999000	0.59377	0.256000	0.26092	9.715000	0.98748	2.749000	0.94314	0.585000	0.79938	TCT	.		0.363	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
PRTG	283659	broad.mit.edu	37	15	55931963	55931963	+	Missense_Mutation	SNP	G	G	A	rs373584731		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:55931963G>A	ENST00000389286.4	-	13	2248	c.2201C>T	c.(2200-2202)aCc>aTc	p.T734I		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GGAAGATGAGGTGTTAGCCTT	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20157	0.0		0.0	False		,,,				2504	0.0				p.T734I													.	PRTG-92	0			c.C2201T						.	G	ILE/THR	2,4126		0,2,2062	165.0	181.0	176.0		2201	1.6	1.0	15		176	0,8394		0,0,4197	no	missense	PRTG	NM_173814.4	89	0,2,6259	AA,AG,GG		0.0,0.0484,0.016	possibly-damaging	734/1151	55931963	2,12520	2064	4197	6261	SO:0001583	missense	283659	exon13			GATGAGGTGTTAG	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.2201C>T	15.37:g.55931963G>A	ENSP00000373937:p.Thr734Ile	134	0		157	5	NM_173814	0	0	0	0	0		Missense_Mutation	SNP	ENST00000389286.4	37	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038427	0.55003	4.84E-4	0.0	ENSG00000166450	ENST00000389286	T	0.60920	0.15	5.81	1.56	0.23342	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.490245	0.22272	N	0.062255	T	0.58438	0.2122	L	0.52011	1.625	0.80722	D	1	B	0.27316	0.175	B	0.35770	0.21	T	0.61108	-0.7129	10	0.72032	D	0.01	-4.8253	18.3429	0.90312	0.0:0.6101:0.3899:0.0	.	734	Q2VWP7	PRTG_HUMAN	I	734	ENSP00000373937:T734I	ENSP00000373937:T734I	T	-	2	0	PRTG	53719255	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	1.843000	0.39259	0.036000	0.15547	0.655000	0.94253	ACC	.		0.488	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79058944	79058944	+	Silent	SNP	A	A	T	rs529497330	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:79058944A>T	ENST00000388820.4	-	19	3519	c.3309T>A	c.(3307-3309)gcT>gcA	p.A1103A	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1103					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGAGGGCGCAGCAGGATGGC	0.672													a|||	254	0.0507188	0.1619	0.0231	5008	,	,		10839	0.0169		0.005	False		,,,				2504	0.002				p.A1103A		.											.	ADAMTS7-226	0			c.T3309A						.						11.0	18.0	16.0					15																	79058944		2079	4266	6345	SO:0001819	synonymous_variant	11173	exon19			GGGCGCAGCAGGA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3309T>A	15.37:g.79058944A>T		12	0		39	2	NM_014272	0	0	2	2	0	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			A|1.000;T|0.000		0.672	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		3	3	NM_178167	0	0	0	1	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
ZNF594	84622	hgsc.bcm.edu	37	17	5085361	5085361	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr17:5085361C>T	ENST00000399604.4	-	1	2331	c.2191G>A	c.(2191-2193)Gct>Act	p.A731T	ZNF594_ENST00000575779.1_Missense_Mutation_p.A731T			Q96JF6	ZN594_HUMAN	zinc finger protein 594	731					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTCTCTCCAGCATGCAGTCTC	0.428																																					p.A731T		.											.	ZNF594-71	0			c.G2191A						.						168.0	177.0	174.0					17																	5085361		2125	4259	6384	SO:0001583	missense	84622	exon2			CTCCAGCATGCAG	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.2191G>A	17.37:g.5085361C>T	ENSP00000382513:p.Ala731Thr	168	2		160	8	NM_032530	0	0	13	13	0	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	37	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.773005	0.00640	.	.	ENSG00000180626	ENST00000399604;ENST00000389222	T	0.08720	3.06	1.17	-1.83	0.07833	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02012	0.0063	N	0.01446	-0.86	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44065	-0.9352	9	0.02654	T	1	.	5.162	0.15066	0.0:0.4347:0.0:0.5653	.	731	Q96JF6	ZN594_HUMAN	T	731;298	ENSP00000382513:A731T	ENSP00000373874:A298T	A	-	1	0	ZNF594	5026085	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.382000	0.07408	-0.478000	0.06823	-0.396000	0.06452	GCT	.		0.428	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
EFCAB3	146779	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	60484528	60484528	+	Silent	SNP	T	T	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr17:60484528T>C	ENST00000305286.3	+	8	900	c.822T>C	c.(820-822)caT>caC	p.H274H	EFCAB3_ENST00000450662.2_Silent_p.H326H	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	274							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AGCCTTTGCATTTCTTTGAGG	0.358																																					p.H326H		.											.	EFCAB3-227	0			c.T978C						.						80.0	82.0	81.0					17																	60484528		2203	4300	6503	SO:0001819	synonymous_variant	146779	exon10			TTTGCATTTCTTT	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.822T>C	17.37:g.60484528T>C		92	0		74	7	NM_001144933	0	0	0	0	0	J3KQM8	Silent	SNP	ENST00000305286.3	37	CCDS11632.1																																																																																			.		0.358	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	
C17orf80	55028	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	71231747	71231747	+	Nonsense_Mutation	SNP	T	T	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr17:71231747T>G	ENST00000535032.2	+	2	239	c.126T>G	c.(124-126)taT>taG	p.Y42*	C17orf80_ENST00000577615.1_Nonsense_Mutation_p.Y42*|C17orf80_ENST00000255557.4_Nonsense_Mutation_p.Y42*|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Nonsense_Mutation_p.Y42*|C17orf80_ENST00000426147.2_Nonsense_Mutation_p.Y42*|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000359042.2_Nonsense_Mutation_p.Y42*			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	42						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			AAAAAGTTTATCAGTCCAAGC	0.378																																					p.Y42X													.	C17orf80-91	0			c.T126G						.						64.0	56.0	59.0					17																	71231747		2203	4300	6503	SO:0001587	stop_gained	55028	exon3			AGTTTATCAGTCC	AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.126T>G	17.37:g.71231747T>G	ENSP00000440551:p.Tyr42*	59	0		47	7	NM_001100621	0	0	12	16	4	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Nonsense_Mutation	SNP	ENST00000535032.2	37	CCDS11694.1	.	.	.	.	.	.	.	.	.	.	T	34	5.308460	0.95629	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	.	.	.	5.55	3.32	0.38043	.	1.540210	0.03731	N	0.253448	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0107	5.6005	0.17351	0.0:0.0906:0.1918:0.7176	.	.	.	.	X	42	.	ENSP00000255557:Y42X	Y	+	3	2	C17orf80	68743342	0.003000	0.15002	0.001000	0.08648	0.079000	0.17450	1.233000	0.32648	0.398000	0.25338	0.459000	0.35465	TAT	.		0.378	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1	NM_017941	
KLHL14	57565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	30350134	30350134	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr18:30350134A>C	ENST00000359358.4	-	2	859	c.421T>G	c.(421-423)Tac>Gac	p.Y141D	AC012123.1_ENST00000426194.1_Intron|KLHL14_ENST00000358095.4_Missense_Mutation_p.Y141D	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	141	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTGTAGAGGTACTCGAGCACC	0.642																																					p.Y141D		.											.	KLHL14-91	0			c.T421G						.						99.0	99.0	99.0					18																	30350134		2203	4300	6503	SO:0001583	missense	57565	exon2			AGAGGTACTCGAG	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.421T>G	18.37:g.30350134A>C	ENSP00000352314:p.Tyr141Asp	216	0		268	50	NM_020805	0	0	0	0	0	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	A	9.978	1.227338	0.22542	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.71222	-0.55;-0.55	4.34	4.34	0.51931	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.134366	0.51477	D	0.000081	T	0.78660	0.4318	L	0.48362	1.52	0.80722	D	1	D	0.63880	0.993	D	0.81914	0.995	T	0.80876	-0.1186	10	0.87932	D	0	.	13.0081	0.58717	1.0:0.0:0.0:0.0	.	141	Q9P2G3	KLH14_HUMAN	D	141	ENSP00000352314:Y141D;ENSP00000350808:Y141D	ENSP00000350808:Y141D	Y	-	1	0	KLHL14	28604132	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.006000	0.70724	1.738000	0.51689	0.377000	0.23210	TAC	.		0.642	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
ATP5A1	498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	43671697	43671697	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr18:43671697A>G	ENST00000398752.6	-	3	381	c.260T>C	c.(259-261)cTg>cCg	p.L87P	ATP5A1_ENST00000593152.2_Missense_Mutation_p.L37P|ATP5A1_ENST00000591267.1_5'Flank|ATP5A1_ENST00000590665.1_Missense_Mutation_p.L87P|ATP5A1_ENST00000282050.2_Missense_Mutation_p.L87P	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	87					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						AACATTCCTCAGCCCATGTAC	0.388																																					p.L87P		.											.	ATP5A1-90	0			c.T260C						.						100.0	98.0	98.0					18																	43671697		2203	4300	6503	SO:0001583	missense	498	exon3			TTCCTCAGCCCAT	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.260T>C	18.37:g.43671697A>G	ENSP00000381736:p.Leu87Pro	134	0		103	25	NM_004046	0	0	124	243	119	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	37	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527021	0.85706	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.88354	-2.37;-2.37	5.24	5.24	0.73138	ATPase, F1/A1 complex, alpha subunit, N-terminal (1);ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);ATPase, F1/A1 complex, alpha/beta subunit, N-terminal (1);	0.147149	0.47852	D	0.000217	D	0.96873	0.8979	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.98545	1.0634	10	0.87932	D	0	-17.4309	15.1468	0.72662	1.0:0.0:0.0:0.0	.	87	P25705	ATPA_HUMAN	P	87;87;37	ENSP00000282050:L87P;ENSP00000381736:L87P	ENSP00000282050:L87P	L	-	2	0	ATP5A1	41925695	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.176000	0.94839	1.975000	0.57531	0.533000	0.62120	CTG	.		0.388	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	
EPOR	2057	hgsc.bcm.edu	37	19	11491644	11491644	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:11491644A>C	ENST00000222139.6	-	6	847	c.743T>G	c.(742-744)cTg>cGg	p.L248R	EPOR_ENST00000592375.2_Missense_Mutation_p.L248R	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	248					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GAGGGGGTCCAGGTCTAAGAG	0.682											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L248R		.											.	EPOR-523	0			c.T743G						.						43.0	30.0	35.0					19																	11491644		2129	4182	6311	SO:0001583	missense	2057	exon6			GGGTCCAGGTCTA	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.743T>G	19.37:g.11491644A>C	ENSP00000222139:p.Leu248Arg	7	1	672	8	5	NM_000121	0	0	2	3	1	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	ENST00000222139.6	37	CCDS12260.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684759	0.88639	.	.	ENSG00000187266	ENST00000222139	D	0.82526	-1.62	5.76	5.76	0.90799	.	0.172266	0.39544	N	0.001323	D	0.89167	0.6638	M	0.66939	2.045	0.49483	D	0.999798	D	0.89917	1.0	D	0.85130	0.997	D	0.87554	0.2467	10	0.30078	T	0.28	-15.7654	13.6048	0.62041	1.0:0.0:0.0:0.0	.	248	P19235	EPOR_HUMAN	R	248	ENSP00000222139:L248R	ENSP00000222139:L248R	L	-	2	0	EPOR	11352644	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	5.997000	0.70646	2.211000	0.71520	0.454000	0.30748	CTG	.		0.682	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
TSHZ3	57616	hgsc.bcm.edu	37	19	31770237	31770237	+	Silent	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:31770237A>G	ENST00000240587.4	-	2	789	c.462T>C	c.(460-462)agT>agC	p.S154S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	154	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					tgctgctgctactgctgctgc	0.607																																					p.S154S		.											.	TSHZ3-232	0			c.T462C						.						39.0	44.0	42.0					19																	31770237		2184	4294	6478	SO:0001819	synonymous_variant	57616	exon2			GCTGCTACTGCTG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.462T>C	19.37:g.31770237A>G		51	0		54	3	NM_020856	2	3	14	2020	2001	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.		0.607	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ANKRD27	84079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	33132944	33132944	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:33132944G>A	ENST00000306065.4	-	10	1048	c.890C>T	c.(889-891)tCt>tTt	p.S297F	ANKRD27_ENST00000587352.1_Missense_Mutation_p.S297F	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	297	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CTGGCTTGGAGACTGTGTAAT	0.493																																					p.S297F		.											.	ANKRD27-95	0			c.C890T						.						149.0	138.0	142.0					19																	33132944		2203	4300	6503	SO:0001583	missense	84079	exon10			CTTGGAGACTGTG	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.890C>T	19.37:g.33132944G>A	ENSP00000304292:p.Ser297Phe	214	0		199	53	NM_032139	0	0	0	0	0	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016485	0.19355	.	.	ENSG00000105186	ENST00000306065	T	0.31247	1.5	5.43	5.43	0.79202	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.64402	D	0.000017	T	0.40222	0.1108	M	0.72118	2.19	0.53005	D	0.999961	B	0.23058	0.079	B	0.28638	0.092	T	0.23904	-1.0175	10	0.44086	T	0.13	-22.3055	19.253	0.93933	0.0:0.0:1.0:0.0	.	297	Q96NW4	ANR27_HUMAN	F	297	ENSP00000304292:S297F	ENSP00000304292:S297F	S	-	2	0	ANKRD27	37824784	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	5.388000	0.66249	2.551000	0.86045	0.563000	0.77884	TCT	.		0.493	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
CAPN12	147968	hgsc.bcm.edu	37	19	39226899	39226899	+	Silent	SNP	G	G	A	rs574197181	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:39226899G>A	ENST00000328867.4	-	12	1742	c.1434C>T	c.(1432-1434)gcC>gcT	p.A478A	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Silent_p.A329A	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	478	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GCGAGCGGTCGGCGCGCAGCA	0.771													g|||	54	0.0107827	0.0408	0.0	5008	,	,		3282	0.0		0.0	False		,,,				2504	0.0				p.A478A		.											.	CAPN12-91	0			c.C1434T						.						2.0	3.0	3.0					19																	39226899		1176	2318	3494	SO:0001819	synonymous_variant	147968	exon12			GCGGTCGGCGCGC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1434C>T	19.37:g.39226899G>A		0	0		3	3	NM_144691	0	0	0	3	3		Silent	SNP	ENST00000328867.4	37	CCDS12519.1																																																																																			.		0.771	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
LILRB3	11025	hgsc.bcm.edu	37	19	54725773	54725773	+	Silent	SNP	T	T	C	rs559292350	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:54725773T>C	ENST00000391750.1	-	5	721	c.585A>G	c.(583-585)acA>acG	p.T195T	LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000346401.6_Silent_p.T195T|LILRB3_ENST00000424807.1_Silent_p.T195T|LILRB3_ENST00000407860.2_Silent_p.T195T|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000469273.1_5'Flank|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000245620.9_Silent_p.T195T			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	195	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGTAATAGCATGTGAACCTCC	0.622													.|||	121	0.0241613	0.0893	0.0043	5008	,	,		7962	0.0		0.0	False		,,,				2504	0.0				p.T195T		.											.	LILRB3-93	0			c.A585G						.						15.0	30.0	25.0					19																	54725773		1380	3348	4728	SO:0001819	synonymous_variant	11025	exon4			ATAGCATGTGAAC	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.585A>G	19.37:g.54725773T>C		12	2		20	7	NM_006864	0	0	2	4	2	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			.		0.622	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
LILRA5	353514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54819027	54819027	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:54819027G>A	ENST00000301219.3	-	6	838	c.719C>T	c.(718-720)gCt>gTt	p.A240V	AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000346508.3_Missense_Mutation_p.A228V	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	240					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGGTTATCAGCTGCTCCTGA	0.517																																					p.A240V		.											.	LILRA5-91	0			c.C719T						.						83.0	76.0	78.0					19																	54819027		2203	4300	6503	SO:0001583	missense	353514	exon6			TTATCAGCTGCTC	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.719C>T	19.37:g.54819027G>A	ENSP00000301219:p.Ala240Val	69	0		66	13	NM_021250	0	0	0	0	0	A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	37	CCDS12888.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383828	0.25031	.	.	ENSG00000187116	ENST00000301219;ENST00000346508	T;T	0.00502	7.02;6.95	2.31	2.31	0.28768	.	.	.	.	.	T	0.00608	0.0020	M	0.62154	1.92	0.21386	N	0.999702	B;B	0.25048	0.117;0.014	B;B	0.31946	0.138;0.01	T	0.37103	-0.9720	9	0.38643	T	0.18	.	8.1667	0.31230	0.0:0.0:1.0:0.0	.	228;240	A6NI73-2;A6NI73	.;LIRA5_HUMAN	V	240;228	ENSP00000301219:A240V;ENSP00000302948:A228V	ENSP00000301219:A240V	A	-	2	0	LILRA5	59510839	0.000000	0.05858	0.004000	0.12327	0.073000	0.16967	0.233000	0.17911	1.603000	0.50134	0.536000	0.68110	GCT	.		0.517	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
TLX2	3196	hgsc.bcm.edu	37	2	74742182	74742182	+	Silent	SNP	C	C	G	rs115897631	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:74742182C>G	ENST00000233638.7	+	1	572	c.249C>G	c.(247-249)gtC>gtG	p.V83V	TLX2_ENST00000497238.1_3'UTR	NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	83	Gly-rich.				enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|ovary(1)	2						TGATCCGCGTCCCTGCGCACC	0.771													C|||	73	0.0145767	0.0537	0.0029	5008	,	,		10293	0.0		0.0	False		,,,				2504	0.0				p.V83V	Esophageal Squamous(7;240 533 18610 24312)	.											.	TLX2-90	0			c.C249G						.	C		90,3398		0,90,1654	5.0	4.0	4.0		249	3.3	1.0	2	dbSNP_132	4	1,6837		0,1,3418	no	coding-synonymous	TLX2	NM_016170.4		0,91,5072	GG,GC,CC		0.0146,2.5803,0.8813		83/285	74742182	91,10235	1744	3419	5163	SO:0001819	synonymous_variant	3196	exon1			CCGCGTCCCTGCG	AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.249C>G	2.37:g.74742182C>G		1	1		6	5	NM_016170	0	0	0	0	0	Q9UD56|Q9UQ48	Silent	SNP	ENST00000233638.7	37	CCDS1947.1																																																																																			C|0.992;G|0.008		0.771	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252224.3		
SLC20A1	6574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	113418129	113418129	+	Silent	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:113418129G>A	ENST00000272542.3	+	9	2312	c.1773G>A	c.(1771-1773)ctG>ctA	p.L591L		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	591					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						GGAAGGATCTGACACCGATCA	0.448																																					p.L591L		.											.	SLC20A1-92	0			c.G1773A						.						114.0	103.0	107.0					2																	113418129		2203	4300	6503	SO:0001819	synonymous_variant	6574	exon9			GGATCTGACACCG		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1773G>A	2.37:g.113418129G>A		105	0		66	16	NM_005415	0	0	12	17	5	Q08344|Q6DHX8|Q9UQ82	Silent	SNP	ENST00000272542.3	37	CCDS2099.1																																																																																			.		0.448	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
HAT1	8520	hgsc.bcm.edu	37	2	172848182	172848182	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:172848182C>A	ENST00000264108.4	+	11	1212	c.1176C>A	c.(1174-1176)agC>agA	p.S392R	SLC25A12_ENST00000472748.1_Intron|HAT1_ENST00000392584.1_Missense_Mutation_p.S307R	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	392					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TAGAAATAAGCATGCAACATG	0.388																																					p.S392R		.											.	HAT1-290	0			c.C1176A						.						112.0	112.0	112.0					2																	172848182		2203	4300	6503	SO:0001583	missense	8520	exon11			AATAAGCATGCAA	AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.1176C>A	2.37:g.172848182C>A	ENSP00000264108:p.Ser392Arg	77	0		55	3	NM_003642	0	0	34	34	0	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Missense_Mutation	SNP	ENST00000264108.4	37	CCDS2245.1	.	.	.	.	.	.	.	.	.	.	C	3.309	-0.141123	0.06669	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	5.94	3.11	0.35812	.	0.224777	0.53938	D	0.000049	T	0.40423	0.1116	L	0.38175	1.15	0.32521	N	0.536232	B	0.02656	0.0	B	0.04013	0.001	T	0.45220	-0.9276	9	0.87932	D	0	-6.6111	8.5772	0.33605	0.0:0.7345:0.127:0.1386	.	392	O14929	HAT1_HUMAN	R	307;392	.	ENSP00000264108:S392R	S	+	3	2	HAT1	172556428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.923000	0.28757	0.370000	0.24538	0.591000	0.81541	AGC	.		0.388	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255377.1	NM_003642	
ZNF142	7701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219510938	219510938	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:219510938C>A	ENST00000449707.1	-	7	1828	c.1407G>T	c.(1405-1407)aaG>aaT	p.K469N	ZNF142_ENST00000411696.2_Missense_Mutation_p.K469N	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGAGGTAGTGCTTCCACTTGG	0.517																																					p.K469N	Colon(170;867 1942 8995 15834 18053)	.											.	ZNF142-137	0			c.G1407T						.						226.0	220.0	222.0					2																	219510938		2153	4245	6398	SO:0001583	missense	7701	exon7			GTAGTGCTTCCAC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1407G>T	2.37:g.219510938C>A	ENSP00000408643:p.Lys469Asn	134	0		139	32	NM_001105537	0	0	0	1	1	Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188772	0.78789	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.54071	0.59;0.59	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.62684	0.2448	L	0.41906	1.305	0.42919	D	0.994282	D;D	0.89917	1.0;0.999	D;D	0.85130	0.996;0.997	T	0.62978	-0.6739	10	0.54805	T	0.06	-14.9575	12.26	0.54645	0.0:0.9228:0.0:0.0772	.	469;306	P52746;A8MWU9	ZN142_HUMAN;.	N	469	ENSP00000408643:K469N;ENSP00000398798:K469N	ENSP00000398798:K469N	K	-	3	2	ZNF142	219219182	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.173000	0.50839	2.709000	0.92574	0.561000	0.74099	AAG	.		0.517	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
AP1S3	130340	hgsc.bcm.edu	37	2	224640715	224640715	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:224640715A>G	ENST00000446015.2	-	3	227	c.194T>C	c.(193-195)tTa>tCa	p.L65S	AP1S3_ENST00000396654.2_Missense_Mutation_p.L65S|AP1S3_ENST00000409375.1_Missense_Mutation_p.L65S|AP1S3_ENST00000443700.1_Missense_Mutation_p.L65S|AP1S3_ENST00000396653.2_Intron|AP1S3_ENST00000423110.1_Missense_Mutation_p.L65S			Q96PC3	AP1S3_HUMAN	adaptor-related protein complex 1, sigma 3 subunit	65					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane coat (GO:0030117)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			NS(1)|breast(1)|lung(2)	4		Renal(207;0.0112)|Lung NSC(271;0.0186)|all_lung(227;0.0272)		Epithelial(121;7.6e-10)|all cancers(144;3.62e-07)|Lung(261;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCAAAAATATAAACTAGCATA	0.373																																					p.L65S		.											.	AP1S3-90	0			c.T194C						.						71.0	63.0	65.0					2																	224640715		1873	4111	5984	SO:0001583	missense	130340	exon3			AAATATAAACTAG	AF393369	CCDS42827.1	2q36.3	2008-02-05			ENSG00000152056	ENSG00000152056			18971	protein-coding gene	gene with protein product		615781					Standard	NR_110905		Approved		uc002vnn.3	Q96PC3	OTTHUMG00000133165	ENST00000446015.2:c.194T>C	2.37:g.224640715A>G	ENSP00000388738:p.Leu65Ser	33	0		38	2	NM_001039569	0	0	0	0	0	B4DQZ1|Q8WTY1|Q96DD1	Missense_Mutation	SNP	ENST00000446015.2	37		.	.	.	.	.	.	.	.	.	.	A	26.4	4.730571	0.89390	.	.	ENSG00000152056	ENST00000443700;ENST00000396654;ENST00000446015;ENST00000409375;ENST00000423110	.	.	.	6.17	6.17	0.99709	Clathrin adaptor complex, small chain (1);Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.91054	0.7185	H	0.98849	4.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94471	0.7685	9	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	65;65	Q96PC3;Q96PC3-4	AP1S3_HUMAN;.	S	65	.	ENSP00000379891:L65S	L	-	2	0	AP1S3	224348959	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.890000	0.92477	2.371000	0.80710	0.533000	0.62120	TTA	.		0.373	AP1S3-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000383293.1		
USP40	55230	hgsc.bcm.edu	37	2	234399860	234399860	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:234399860C>G	ENST00000427112.2	-	25	2997	c.2962G>C	c.(2962-2964)Gac>Cac	p.D988H	USP40_ENST00000496298.1_5'Flank|USP40_ENST00000450966.1_Missense_Mutation_p.D1000H|USP40_ENST00000251722.6_Missense_Mutation_p.D988H			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	988					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		ATCTCTATGTCTCCCAAGTAG	0.483																																					p.D1000H		.											.	USP40-455	0			c.G2998C						.						46.0	46.0	46.0					2																	234399860		1900	4127	6027	SO:0001583	missense	55230	exon25			CTATGTCTCCCAA	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2962G>C	2.37:g.234399860C>G	ENSP00000387898:p.Asp988His	29	0		27	2	NM_018218	0	0	27	27	0	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.69|12.69	2.014480|2.014480	0.35511|0.35511	.|.	.|.	ENSG00000085982|ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112|ENST00000430158	T;T;T|.	0.05580|.	3.42;3.42;3.42|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	2.234570|.	0.01674|.	N|.	0.025743|.	T|T	0.54481|0.54481	0.1861|0.1861	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	1|1	D;P|.	0.65815|.	0.995;0.942|.	P;P|.	0.60609|.	0.877;0.573|.	T|T	0.50423|0.50423	-0.8830|-0.8830	10|5	0.59425|.	D|.	0.04|.	.|.	10.9828|10.9828	0.47506|0.47506	0.0:0.9073:0.0:0.0927|0.0:0.9073:0.0:0.0927	.|.	1000;648|.	Q9NVE5-3;B4DN96|.	.;.|.	H|D	1000;988;988|163	ENSP00000415434:D1000H;ENSP00000251722:D988H;ENSP00000387898:D988H|.	ENSP00000251722:D988H|.	D|E	-|-	1|3	0|2	USP40|USP40	234064599|234064599	0.816000|0.816000	0.29132|0.29132	0.546000|0.546000	0.28166|0.28166	0.175000|0.175000	0.22909|0.22909	1.821000|1.821000	0.39041|0.39041	2.455000|2.455000	0.83008|0.83008	0.655000|0.655000	0.94253|0.94253	GAC|GAG	.		0.483	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
RBPJL	11317	hgsc.bcm.edu	37	20	43940524	43940524	+	Missense_Mutation	SNP	G	G	T	rs35472429	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr20:43940524G>T	ENST00000343694.3	+	5	446	c.374G>T	c.(373-375)gGa>gTa	p.G125V	RBPJL_ENST00000372741.3_Missense_Mutation_p.G125V|RBPJL_ENST00000372743.1_Missense_Mutation_p.G125V	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	125					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				GGTTACATGGGACTGGACAGC	0.662											OREG0025979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	20	0.00399361	0.0136	0.0029	5008	,	,		17313	0.0		0.0	False		,,,				2504	0.0				p.G125V		.											.	RBPJL-227	0			c.G374T						.	G	VAL/GLY	17,4097		0,17,2040	10.0	8.0	8.0		374	5.4	1.0	20	dbSNP_126	8	0,8032		0,0,4016	yes	missense	RBPJL	NM_014276.2	109	0,17,6056	TT,TG,GG		0.0,0.4132,0.14	probably-damaging	125/518	43940524	17,12129	2057	4016	6073	SO:0001583	missense	11317	exon5			ACATGGGACTGGA	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.374G>T	20.37:g.43940524G>T	ENSP00000341243:p.Gly125Val	1	1	920	9	4	NM_014276	0	0	0	0	0	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	ENST00000343694.3	37	CCDS13349.1	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	G	31	5.088237	0.94100	0.004132	0.0	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	D;D;D	0.87412	-2.25;-2.25;-2.25	5.38	5.38	0.77491	LAG1, DNA binding (2);p53-like transcription factor, DNA-binding (1);	0.143198	0.48767	D	0.000172	D	0.88683	0.6503	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.90545	0.4505	10	0.87932	D	0	-13.1573	16.2671	0.82593	0.0:0.0:1.0:0.0	rs35472429	125;125	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	V	125	ENSP00000361828:G125V;ENSP00000361826:G125V;ENSP00000341243:G125V	ENSP00000341243:G125V	G	+	2	0	RBPJL	43373938	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.904000	0.87408	2.512000	0.84698	0.561000	0.74099	GGA	G|0.996;T|0.004		0.662	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276	
PTH1R	5745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	46944260	46944260	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:46944260T>C	ENST00000313049.5	+	13	1578	c.1375T>C	c.(1375-1377)Tac>Cac	p.Y459H	PTH1R_ENST00000449590.1_Missense_Mutation_p.Y459H|PTH1R_ENST00000418619.1_Missense_Mutation_p.Y459H|PTH1R_ENST00000430002.2_Missense_Mutation_p.Y459H			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	459					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	CGCAATCATATACTGTTTCTG	0.582																																					p.Y459H		.											.	PTH1R-522	0			c.T1375C						.						111.0	119.0	116.0					3																	46944260		2203	4300	6503	SO:0001583	missense	5745	exon14			ATCATATACTGTT		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.1375T>C	3.37:g.46944260T>C	ENSP00000321999:p.Tyr459His	162	1		165	14	NM_001184744	0	0	0	0	0	Q2M1U3	Missense_Mutation	SNP	ENST00000313049.5	37	CCDS2747.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.558192	0.86231	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063;ENST00000422115	T;T;T;T;T;T	0.75050	0.07;0.07;0.07;0.07;0.07;-0.9	4.86	4.86	0.63082	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	.	.	.	.	D	0.85168	0.5635	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87180	0.2227	9	0.87932	D	0	.	13.9612	0.64180	0.0:0.0:0.0:1.0	.	459	Q03431	PTH1R_HUMAN	H	459;459;459;459;459;764;31	ENSP00000402723:Y459H;ENSP00000411424:Y459H;ENSP00000400977:Y459H;ENSP00000413774:Y459H;ENSP00000321999:Y459H;ENSP00000396176:Y31H	ENSP00000321999:Y459H	Y	+	1	0	PTH1R	46919264	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.294000	0.72738	1.941000	0.56285	0.533000	0.62120	TAC	.		0.582	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316	
CCDC66	285331	hgsc.bcm.edu	37	3	56627106	56627106	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:56627106G>C	ENST00000394672.3	+	8	1115	c.1045G>C	c.(1045-1047)Gag>Cag	p.E349Q	CCDC66_ENST00000436465.2_Missense_Mutation_p.E349Q|CCDC66_ENST00000326595.7_Missense_Mutation_p.E315Q	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	349					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AAGAAAAATAGAGGAAAAAAT	0.303																																					p.E349Q		.											.	CCDC66-135	0			c.G1045C						.						43.0	48.0	46.0					3																	56627106		2197	4299	6496	SO:0001583	missense	285331	exon8			AAAATAGAGGAAA	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1045G>C	3.37:g.56627106G>C	ENSP00000378167:p.Glu349Gln	80	0		56	3	NM_001141947	0	0	4	4	0	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	37	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088605	0.55968	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.24350	1.87;1.86;1.87	5.82	3.95	0.45737	.	0.207425	0.42420	D	0.000714	T	0.33933	0.0880	M	0.67953	2.075	0.80722	D	1	D	0.56521	0.976	P	0.50049	0.629	T	0.03240	-1.1057	10	0.44086	T	0.13	-7.3571	10.5988	0.45354	0.0742:0.1342:0.7916:0.0	.	349	A2RUB6	CCD66_HUMAN	Q	349;315;349	ENSP00000378167:E349Q;ENSP00000326050:E315Q;ENSP00000404320:E349Q	ENSP00000326050:E315Q	E	+	1	0	CCDC66	56602146	0.974000	0.33945	0.674000	0.29902	0.712000	0.41017	1.726000	0.38085	2.745000	0.94114	0.655000	0.94253	GAG	.		0.303	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
CCDC66	285331	hgsc.bcm.edu	37	3	56651517	56651517	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:56651517T>G	ENST00000394672.3	+	14	2291	c.2221T>G	c.(2221-2223)Ttg>Gtg	p.L741V	CCDC66_ENST00000436465.2_Missense_Mutation_p.L741V|CCDC66_ENST00000326595.7_Missense_Mutation_p.L707V	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	741					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		ATTGCTTCATTTGGTAGAAAA	0.388																																					p.L741V		.											.	CCDC66-135	0			c.T2221G						.						51.0	53.0	52.0					3																	56651517		2203	4299	6502	SO:0001583	missense	285331	exon14			CTTCATTTGGTAG	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.2221T>G	3.37:g.56651517T>G	ENSP00000378167:p.Leu741Val	51	0		38	2	NM_001141947	0	0	1	1	0	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	37	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.474208	0.63737	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.35048	1.33;1.34;1.33	5.68	2.95	0.34219	.	0.091880	0.44688	N	0.000436	T	0.54838	0.1883	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.56517	-0.7966	10	0.72032	D	0.01	-6.3152	9.4116	0.38496	0.0:0.2208:0.0:0.7792	.	741	A2RUB6	CCD66_HUMAN	V	741;707;741	ENSP00000378167:L741V;ENSP00000326050:L707V;ENSP00000404320:L741V	ENSP00000326050:L707V	L	+	1	2	CCDC66	56626557	0.099000	0.21834	0.996000	0.52242	0.982000	0.71751	-0.033000	0.12246	0.971000	0.38288	0.460000	0.39030	TTG	.		0.388	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
MINA	84864	hgsc.bcm.edu	37	3	97673274	97673274	+	Silent	SNP	G	G	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:97673274G>T	ENST00000333396.7	-	5	1329	c.747C>A	c.(745-747)gcC>gcA	p.A249A	MINA_ENST00000360258.4_Silent_p.A249A|MINA_ENST00000394198.2_Silent_p.A249A|MINA_ENST00000330299.2_Silent_p.A249A	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						GAGTAGAGTGGGCCAGCCCCG	0.532																																					p.A249A		.											.	MINA-91	0			c.C747A						.						118.0	103.0	108.0					3																	97673274		2203	4300	6503	SO:0001819	synonymous_variant	84864	exon5			AGAGTGGGCCAGC	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.747C>A	3.37:g.97673274G>T		50	1		68	8	NM_001261829	0	0	0	0	0		Silent	SNP	ENST00000333396.7	37	CCDS43114.1																																																																																			.		0.532	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778	
RNF13	11342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	149678840	149678840	+	Silent	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:149678840C>T	ENST00000344229.3	+	11	1797	c.1095C>T	c.(1093-1095)gtC>gtT	p.V365V	RNF13_ENST00000392894.3_Silent_p.V365V|RNF13_ENST00000361785.6_Silent_p.V246V	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	365					protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATGTCGTGGTCCAGTTGCAGC	0.358																																					p.V365V		.											.	RNF13-227	0			c.C1095T						.						104.0	101.0	102.0					3																	149678840		2203	4300	6503	SO:0001819	synonymous_variant	11342	exon11			CGTGGTCCAGTTG	AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.1095C>T	3.37:g.149678840C>T		122	1		90	19	NM_007282	0	0	51	76	25	A6NC87|B3KR12|Q05D66|Q6IBJ9	Silent	SNP	ENST00000344229.3	37	CCDS3146.1	.	.	.	.	.	.	.	.	.	.	C	3.702	-0.061365	0.07317	.	.	ENSG00000082996	ENST00000468289	.	.	.	5.83	4.94	0.65067	.	.	.	.	.	T	0.59155	0.2173	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57505	-0.7800	4	.	.	.	-22.4106	8.2513	0.31724	0.0:0.7328:0.132:0.1353	.	.	.	.	S	167	.	.	P	+	1	0	RNF13	151161530	0.987000	0.35691	1.000000	0.80357	0.648000	0.38561	0.188000	0.17018	1.419000	0.47118	0.655000	0.94253	CCA	.		0.358	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	NM_183384	
EXOC1	55763	hgsc.bcm.edu	37	4	56765984	56765984	+	Silent	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr4:56765984A>G	ENST00000381295.2	+	17	2619	c.2271A>G	c.(2269-2271)caA>caG	p.Q757Q	EXOC1_ENST00000349598.6_Silent_p.Q742Q|EXOC1_ENST00000346134.7_Silent_p.Q757Q	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	757					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					AAGCCAAACAAAAATACACAG	0.318																																					p.Q757Q		.											.	EXOC1-950	0			c.A2271G						.						79.0	88.0	85.0					4																	56765984		2203	4300	6503	SO:0001819	synonymous_variant	55763	exon17			CAAACAAAAATAC	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.2271A>G	4.37:g.56765984A>G		90	0		50	5	NM_018261	0	0	36	36	0	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Silent	SNP	ENST00000381295.2	37	CCDS3502.1																																																																																			.		0.318	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
INPP4B	8821	hgsc.bcm.edu	37	4	143044565	143044565	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr4:143044565C>A	ENST00000513000.1	-	21	2330	c.1897G>T	c.(1897-1899)Gct>Tct	p.A633S	INPP4B_ENST00000508116.1_Missense_Mutation_p.A633S|INPP4B_ENST00000509777.1_Missense_Mutation_p.A633S|INPP4B_ENST00000262992.4_Missense_Mutation_p.A633S|INPP4B_ENST00000308502.4_Missense_Mutation_p.A633S	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	633					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ACCAATCCAGCAAGCTGAAAA	0.353																																					p.A633S		.											.	INPP4B-228	0			c.G1897T						.						68.0	66.0	67.0					4																	143044565		2203	4300	6503	SO:0001583	missense	8821	exon21			ATCCAGCAAGCTG	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1897G>T	4.37:g.143044565C>A	ENSP00000425487:p.Ala633Ser	63	0		46	3	NM_003866	0	0	0	0	0	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144850	0.37825	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12	6.03	5.19	0.71726	.	0.111768	0.64402	D	0.000012	T	0.22205	0.0535	N	0.05467	-0.045	0.47584	D	0.999464	B;B	0.26195	0.141;0.144	B;B	0.26614	0.034;0.071	T	0.09662	-1.0664	10	0.22706	T	0.39	.	10.3798	0.44104	0.1324:0.7999:0.0:0.0677	.	504;633	B7Z6T2;O15327	.;INP4B_HUMAN	S	633;633;633;504;633;633;448;448;633;504	ENSP00000425487:A633S;ENSP00000262992:A633S;ENSP00000308441:A633S;ENSP00000423954:A633S;ENSP00000422793:A633S;ENSP00000426207:A448S;ENSP00000427250:A633S;ENSP00000421065:A504S	ENSP00000262992:A633S	A	-	1	0	INPP4B	143264015	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.615000	0.46368	2.868000	0.98415	0.557000	0.71058	GCT	.		0.353	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
ZDHHC11	79844	hgsc.bcm.edu;broad.mit.edu	37	5	837562	837562	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr5:837562A>C	ENST00000283441.8	-	6	1201	c.818T>G	c.(817-819)aTt>aGt	p.I273S	ZDHHC11_ENST00000503758.2_5'UTR|ZDHHC11_ENST00000424784.2_Missense_Mutation_p.I273S	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	273						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCGGTTATTAATGAGATACTC	0.493																																					p.I273S		.											.	ZDHHC11-92	0			c.T818G						.						174.0	202.0	192.0					5																	837562		2203	4300	6503	SO:0001583	missense	79844	exon6			TTATTAATGAGAT	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.818T>G	5.37:g.837562A>C	ENSP00000283441:p.Ile273Ser	145	0		109	12	NM_024786	0	0	0	0	0	Q6UWR9	Missense_Mutation	SNP	ENST00000283441.8	37	CCDS3857.1	.	.	.	.	.	.	.	.	.	.	a	9.260	1.043028	0.19748	.	.	ENSG00000188818	ENST00000424784;ENST00000283441;ENST00000511193	T;T;T	0.50813	1.93;1.93;0.73	1.51	-3.03	0.05429	.	.	.	.	.	T	0.30070	0.0753	N	0.17379	0.485	0.09310	N	1	P	0.39624	0.681	B	0.43052	0.406	T	0.21008	-1.0258	9	0.54805	T	0.06	-23.2267	4.2626	0.10747	0.3762:0.1778:0.4459:0.0	.	273	Q9H8X9	ZDH11_HUMAN	S	273;273;48	ENSP00000397719:I273S;ENSP00000283441:I273S;ENSP00000426873:I48S	ENSP00000283441:I273S	I	-	2	0	ZDHHC11	890562	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.756000	0.01813	-1.924000	0.01064	0.315000	0.21342	ATT	.		0.493	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206681.3	NM_024786	
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5235247	5235247	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr5:5235247C>G	ENST00000274181.7	+	13	2109	c.1971C>G	c.(1969-1971)agC>agG	p.S657R	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	657	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AGCACAACAGCAGACGATTCA	0.512																																					p.S657R		.											.	ADAMTS16-275	0			c.C1971G						.						76.0	80.0	79.0					5																	5235247		1950	4152	6102	SO:0001583	missense	170690	exon13			CAACAGCAGACGA	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1971C>G	5.37:g.5235247C>G	ENSP00000274181:p.Ser657Arg	97	0		124	16	NM_139056	0	0	3	4	1	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302320	0.23736	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.63580	-0.05	4.57	3.68	0.42216	.	0.198340	0.50627	D	0.000116	T	0.56702	0.2003	M	0.62016	1.91	0.80722	D	1	P;B	0.50710	0.938;0.296	B;B	0.41860	0.368;0.292	T	0.58825	-0.7568	10	0.33940	T	0.23	.	11.2853	0.49218	0.0:0.908:0.0:0.092	.	657;657	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	657	ENSP00000274181:S657R	ENSP00000274181:S657R	S	+	3	2	ADAMTS16	5288247	1.000000	0.71417	0.100000	0.21137	0.015000	0.08874	2.587000	0.46128	2.270000	0.75569	0.655000	0.94253	AGC	.		0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82850838	82850838	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr5:82850838G>A	ENST00000265077.3	+	12	10281	c.9716G>A	c.(9715-9717)tGg>tAg	p.W3239*	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000502527.2_Nonsense_Mutation_p.W498*|VCAN_ENST00000342785.4_Nonsense_Mutation_p.W1485*|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Nonsense_Mutation_p.W1437*|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Nonsense_Mutation_p.W2252*	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3239	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.W3239S(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GACTTCCGTTGGACTGATGGC	0.443																																					p.W3239X		.											.	VCAN-238	1	Substitution - Missense(1)	lung(1)	c.G9716A						.						236.0	192.0	207.0					5																	82850838		2203	4300	6503	SO:0001587	stop_gained	1462	exon12			TCCGTTGGACTGA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9716G>A	5.37:g.82850838G>A	ENSP00000265077:p.Trp3239*	89	0		79	13	NM_004385	0	0	170	187	17	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	48	13.927085	0.99770	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	.	.	.	5.81	5.81	0.92471	.	0.000000	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.089	0.97809	0.0:0.0:1.0:0.0	.	.	.	.	X	3239;2252;1485;1437;498	.	ENSP00000265077:W3239X	W	+	2	0	VCAN	82886594	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.756000	0.98918	2.752000	0.94435	0.557000	0.71058	TGG	.		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
HIST1H4B	8366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26027471	26027471	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:26027471G>C	ENST00000377364.3	-	1	9	c.10C>G	c.(10-12)Cgc>Ggc	p.R4G		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	4					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						CCTTTGCCGCGACCAGACATG	0.512																																					p.R4G		.											.	HIST1H4B-70	0			c.C10G						.						49.0	47.0	47.0					6																	26027471		2203	4300	6503	SO:0001583	missense	8366	exon1			TGCCGCGACCAGA	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.10C>G	6.37:g.26027471G>C	ENSP00000366581:p.Arg4Gly	95	0		104	16	NM_003544	0	0	0	0	0	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	g	12.98	2.099423	0.37048	.	.	ENSG00000124529	ENST00000377364	.	.	.	4.56	3.6	0.41247	.	0.000000	0.47852	U	0.000206	T	0.42988	0.1227	.	.	.	0.29320	N	0.867408	.	.	.	.	.	.	T	0.30592	-0.9973	6	0.72032	D	0.01	.	13.1415	0.59438	0.0:0.0:0.7636:0.2364	.	.	.	.	G	4	.	ENSP00000366581:R4G	R	-	1	0	HIST1H4B	26135450	0.573000	0.26676	0.167000	0.22817	0.033000	0.12548	0.731000	0.26058	2.454000	0.82982	0.563000	0.77884	CGC	.		0.512	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51924820	51924820	+	Missense_Mutation	SNP	A	A	C	rs143341567		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:51924820A>C	ENST00000371117.3	-	15	1414	c.1139T>G	c.(1138-1140)tTt>tGt	p.F380C	PKHD1_ENST00000340994.4_Missense_Mutation_p.F380C|AL590391.1_ENST00000408630.2_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	380					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGGAGCCACAAAGAACCCACT	0.443																																					p.F380C		.											.	PKHD1-603	0			c.T1139G						.						85.0	77.0	80.0					6																	51924820		2203	4300	6503	SO:0001583	missense	5314	exon15			GCCACAAAGAACC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1139T>G	6.37:g.51924820A>C	ENSP00000360158:p.Phe380Cys	121	0		67	18	NM_170724	0	0	1	1	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110642	0.77210	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.76968	-1.06;-1.06	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	D	0.85617	0.5738	M	0.78049	2.395	0.38168	D	0.939231	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.88299	0.2948	10	0.87932	D	0	.	15.0065	0.71516	1.0:0.0:0.0:0.0	.	380;380	P08F94-2;P08F94	.;PKHD1_HUMAN	C	380	ENSP00000360158:F380C;ENSP00000341097:F380C	ENSP00000341097:F380C	F	-	2	0	PKHD1	52032779	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.103000	0.71492	2.195000	0.70347	0.528000	0.53228	TTT	A|1.000;G|0.000		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
KCNQ5	56479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	73905126	73905126	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:73905126A>G	ENST00000370398.1	+	14	2897	c.2788A>G	c.(2788-2790)Aaa>Gaa	p.K930E	KCNQ5_ENST00000402622.2_Missense_Mutation_p.K940E|KCNQ5_ENST00000342056.2_Missense_Mutation_p.K949E|KCNQ5_ENST00000414165.2_Missense_Mutation_p.K820E|KCNQ5_ENST00000403813.2_Missense_Mutation_p.K921E|KCNQ5_ENST00000355635.3_Missense_Mutation_p.K931E|KCNQ5_ENST00000355194.4_Missense_Mutation_p.K930E	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	930					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GCCTCATGTCAAACTGAAATA	0.408																																					p.K949E	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5-158	0			c.A2845G						.						64.0	65.0	65.0					6																	73905126		2203	4300	6503	SO:0001583	missense	56479	exon15			CATGTCAAACTGA	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2788A>G	6.37:g.73905126A>G	ENSP00000359425:p.Lys930Glu	122	0		112	17	NM_001160133	0	0	0	0	0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587561	0.46110	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99429	-5.66;-5.66;-5.66;-5.66;-5.67;-5.7;-5.89	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.98698	0.9563	N	0.24115	0.695	0.24539	N	0.994073	D;P;B;P;B	0.61697	0.99;0.792;0.017;0.525;0.435	D;B;B;B;B	0.72982	0.979;0.254;0.021;0.117;0.078	D	0.96550	0.9407	10	0.62326	D	0.03	.	16.4622	0.84064	1.0:0.0:0.0:0.0	.	820;940;949;921;930	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	E	949;949;930;930;940;931;921;820	ENSP00000345055:K949E;ENSP00000347326:K930E;ENSP00000359425:K930E;ENSP00000385501:K940E;ENSP00000347853:K931E;ENSP00000384453:K921E;ENSP00000409861:K820E	ENSP00000345055:K949E	K	+	1	0	KCNQ5	73961847	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.654000	0.67974	2.289000	0.77006	0.533000	0.62120	AAA	.		0.408	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
FAM46A	55603	hgsc.bcm.edu	37	6	82461775	82461775	+	Silent	SNP	G	G	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:82461775G>T	ENST00000320172.6	-	2	398	c.84C>A	c.(82-84)ggC>ggA	p.G28G	FAM46A_ENST00000369756.3_Silent_p.G109G|FAM46A_ENST00000369754.3_Silent_p.G47G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	28					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		agtcgccgccgccgaagtcgc	0.692																																					p.G28G		.											.	FAM46A-90	0			c.C84A						.						3.0	5.0	4.0					6																	82461775		1351	3152	4503	SO:0001819	synonymous_variant	55603	exon2			GCCGCCGCCGAAG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.84C>A	6.37:g.82461775G>T		22	1		35	2	NM_017633	0	0	1	1	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.692	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
RARS2	57038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	88231239	88231239	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:88231239A>T	ENST00000369536.5	-	12	1023	c.978T>A	c.(976-978)gaT>gaA	p.D326E	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	326					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CAGCTGCAAGATCTCTGAAAC	0.323																																					p.D326E		.											.	RARS2-92	0			c.T978A						.						83.0	83.0	83.0					6																	88231239		2203	4300	6503	SO:0001583	missense	57038	exon12			TGCAAGATCTCTG	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.978T>A	6.37:g.88231239A>T	ENSP00000358549:p.Asp326Glu	64	0		33	8	NM_020320	0	0	0	0	0	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	CCDS5011.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219539	0.79464	.	.	ENSG00000146282	ENST00000369536	D	0.82081	-1.57	5.83	-1.0	0.10196	Arginyl-tRNA synthetase, class Ia, core (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.90335	0.6976	H	0.95712	3.71	0.58432	D	0.999996	D	0.71674	0.998	D	0.80764	0.994	D	0.90743	0.4651	10	0.87932	D	0	.	11.7636	0.51918	0.557:0.0:0.443:0.0	.	326	Q5T160	SYRM_HUMAN	E	326	ENSP00000358549:D326E	ENSP00000358549:D326E	D	-	3	2	RARS2	88287958	0.984000	0.35163	0.987000	0.45799	0.993000	0.82548	0.740000	0.26188	-0.395000	0.07715	0.533000	0.62120	GAT	.		0.323	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
SEC63	11231	hgsc.bcm.edu	37	6	108227977	108227977	+	Silent	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:108227977A>G	ENST00000369002.4	-	9	917	c.738T>C	c.(736-738)ctT>ctC	p.L246L		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	246	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		AAACCATGATAAGACCTAACA	0.348																																					p.L246L		.											.	SEC63-227	0			c.T738C						.						95.0	95.0	95.0					6																	108227977		2203	4300	6503	SO:0001819	synonymous_variant	11231	exon9			CATGATAAGACCT	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.738T>C	6.37:g.108227977A>G		111	0		57	3	NM_007214	0	0	0	0	0	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Silent	SNP	ENST00000369002.4	37	CCDS5061.1																																																																																			.		0.348	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
CYP51A1	1595	bcgsc.ca	37	7	91753108	91753108	+	Missense_Mutation	SNP	C	C	A	rs140702410		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:91753108C>A	ENST00000003100.8	-	6	995	c.830G>T	c.(829-831)cGc>cTc	p.R277L	CYP51A1_ENST00000450723.1_Missense_Mutation_p.R172L|LRRD1_ENST00000422722.1_5'UTR	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	271					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	AGACTGTCTGCGTTTCTGGAT	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		18889	0.001		0.0	False		,,,				2504	0.0				p.R277L	GBM(70;1100 1190 11592 25836 51397)												.	CYP51A1-90	0			c.G830T						.						114.0	109.0	111.0					7																	91753108		2203	4299	6502	SO:0001583	missense	1595	exon6			TGTCTGCGTTTCT	U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.830G>T	7.37:g.91753108C>A	ENSP00000003100:p.Arg277Leu	83	0		33	9	NM_000786	0	0	5	5	0	A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	ENST00000003100.8	37	CCDS5623.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	36	5.825382	0.96996	.	.	ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723	D;D	0.87571	-2.27;-2.27	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.95389	0.8503	M	0.93763	3.455	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.68621	0.904;0.959	D	0.95988	0.8983	10	0.87932	D	0	.	19.8632	0.96793	0.0:1.0:0.0:0.0	.	217;271	B3KRC6;Q16850	.;CP51A_HUMAN	L	277;217;172	ENSP00000003100:R277L;ENSP00000406757:R172L	ENSP00000003100:R277L	R	-	2	0	CYP51A1	91591044	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.906000	0.69900	2.699000	0.92147	0.655000	0.94253	CGC	C|0.999;A|0.000		0.338	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253812.4		
PPP1R35	221908	hgsc.bcm.edu	37	7	100033305	100033305	+	Silent	SNP	G	G	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:100033305G>C	ENST00000292330.2	-	3	727	c.537C>G	c.(535-537)ctC>ctG	p.L179L	PPP1R35_ENST00000476185.1_Intron|RP11-758P17.2_ENST00000492523.1_RNA|RP11-758P17.3_ENST00000475250.1_RNA	NM_145030.2	NP_659467.1	Q8TAP8	PPR35_HUMAN	protein phosphatase 1, regulatory subunit 35	179					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										ATTTCTCCCTGAGCGCGGCAT	0.667																																					p.L179L		.											.	.	0			c.C537G						.						22.0	24.0	23.0					7																	100033305		2203	4298	6501	SO:0001819	synonymous_variant	221908	exon3			CTCCCTGAGCGCG	BC026269	CCDS5694.1	7q22.1	2012-04-17	2011-10-11	2011-10-11	ENSG00000160813	ENSG00000160813		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28320	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 47"""	C7orf47		12477932	Standard	NM_145030		Approved	MGC22793	uc003uuy.1	Q8TAP8	OTTHUMG00000159540	ENST00000292330.2:c.537C>G	7.37:g.100033305G>C		30	0		37	2	NM_145030	0	0	15	15	0	A4D2C5	Silent	SNP	ENST00000292330.2	37	CCDS5694.1																																																																																			.		0.667	PPP1R35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356095.2	NM_145030	
MTBP	27085	hgsc.bcm.edu	37	8	121528430	121528430	+	Splice_Site	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr8:121528430A>G	ENST00000305949.1	+	18	2290	c.2245A>G	c.(2245-2247)Aga>Gga	p.R749G		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	749	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TCCCAGAAAAAGGTGATATAT	0.313																																					p.R749G		.											.	MTBP-228	0			c.A2245G						.						28.0	28.0	28.0					8																	121528430		2202	4299	6501	SO:0001630	splice_region_variant	27085	exon18			AGAAAAAGGTGAT		CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.2246+1A>G	8.37:g.121528430A>G		24	0		39	2	NM_022045	0	0	0	0	0	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313636	0.81358	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.78953	0.4365	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81066	-0.1101	9	0.87932	D	0	-29.3945	16.4534	0.84003	1.0:0.0:0.0:0.0	.	749	Q96DY7	MTBP_HUMAN	G	749	.	ENSP00000303398:R749G	R	+	1	2	MTBP	121597611	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	8.045000	0.89436	2.285000	0.76669	0.477000	0.44152	AGA	.		0.313	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	Missense_Mutation
EGFL7	51162	hgsc.bcm.edu	37	9	139566442	139566442	+	Missense_Mutation	SNP	C	C	T	rs200483435		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr9:139566442C>T	ENST00000371699.1	+	9	1612	c.701C>T	c.(700-702)cCg>cTg	p.P234L	EGFL7_ENST00000406555.3_Missense_Mutation_p.P234L|EGFL7_ENST00000308874.7_Missense_Mutation_p.P234L|EGFL7_ENST00000371698.3_Missense_Mutation_p.P234L|EGFL7_ENST00000492002.1_3'UTR|MIR126_ENST00000362291.1_RNA			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	234					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CATGGGCTCCCGGACCCCGGC	0.682											OREG0019619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	c|||	1	0.000199681	0.0	0.0	5008	,	,		14601	0.001		0.0	False		,,,				2504	0.0				p.P234L		.											.	EGFL7-523	0			c.C701T						.	C	LEU/PRO,LEU/PRO	5,3897		0,5,1946	7.0	8.0	8.0		701,701	2.1	0.2	9		8	2,7586		0,2,3792	no	missense,missense	EGFL7	NM_016215.4,NM_201446.2	98,98	0,7,5738	TT,TC,CC		0.0264,0.1281,0.0609	benign,benign	234/274,234/274	139566442	7,11483	1951	3794	5745	SO:0001583	missense	51162	exon10			GGCTCCCGGACCC	AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.701C>T	9.37:g.139566442C>T	ENSP00000360764:p.Pro234Leu	2	0	1649	5	2	NM_016215	0	0	4	9	5	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	ENST00000371699.1	37	CCDS7002.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357701	0.24598	0.001281	2.64E-4	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	4.15	2.14	0.27477	.	0.785119	0.11711	N	0.536941	T	0.77805	0.4185	L	0.53249	1.67	0.09310	N	1	P	0.39094	0.659	B	0.22386	0.039	T	0.63148	-0.6702	10	0.59425	D	0.04	-10.7703	10.945	0.47296	0.4098:0.5902:0.0:0.0	.	234	Q9UHF1	EGFL7_HUMAN	L	234	ENSP00000360764:P234L;ENSP00000307843:P234L;ENSP00000385639:P234L;ENSP00000360763:P234L	ENSP00000307843:P234L	P	+	2	0	EGFL7	138686263	0.693000	0.27728	0.150000	0.22450	0.048000	0.14542	1.407000	0.34657	0.138000	0.18790	0.561000	0.74099	CCG	.		0.682	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53589174	53589174	+	Silent	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chrX:53589174C>T	ENST00000342160.3	-	53	7693	c.7236G>A	c.(7234-7236)gaG>gaA	p.E2412E	HUWE1_ENST00000262854.6_Silent_p.E2412E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2412	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.E2275D(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGTGCTCCTCCTCATCCTCAG	0.498																																					p.E2412E		.											.	HUWE1-280	1	Substitution - Missense(1)	breast(1)	c.G7236A						.						138.0	86.0	104.0					X																	53589174		2203	4300	6503	SO:0001819	synonymous_variant	10075	exon54			CTCCTCCTCATCC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7236G>A	X.37:g.53589174C>T		59	0		57	16	NM_031407	0	0	8	32	24	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	2.473	-0.321458	0.05386	.	.	ENSG00000086758	ENST00000427052	.	.	.	4.93	4.05	0.47172	.	.	.	.	.	T	0.57592	0.2064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55082	-0.8196	4	.	.	.	.	8.1437	0.31100	0.0:0.8128:0.0:0.1872	.	.	.	.	R	1446	.	.	G	-	1	0	HUWE1	53605899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.451000	0.35145	2.164000	0.68074	0.513000	0.50165	GGA	.		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
NAP1L3	4675	ucsc.edu	37	X	92927724	92927724	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chrX:92927724C>T	ENST00000373079.3	-	1	843	c.580G>A	c.(580-582)Gaa>Aaa	p.E194K	FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000538690.1_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.E187K|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	194	Glu-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TTAGGGTTTTCTTCTTCCTCA	0.433																																					p.E194K													.	NAP1L3-131	0			c.G580A						.						82.0	81.0	81.0					X																	92927724		2203	4300	6503	SO:0001583	missense	4675	exon1			GGTTTTCTTCTTC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.580G>A	X.37:g.92927724C>T	ENSP00000362171:p.Glu194Lys	151	1		72	3	NM_004538	0	0	9	12	3	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.644848	0.29246	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.27890	1.64	3.78	2.87	0.33458	.	0.747635	0.11017	N	0.608855	T	0.21307	0.0513	L	0.31294	0.92	0.29536	N	0.852442	P	0.38711	0.643	B	0.37346	0.247	T	0.10382	-1.0632	10	0.27082	T	0.32	.	8.0903	0.30797	0.0:0.8654:0.0:0.1346	.	194	Q99457	NP1L3_HUMAN	K	194;187	ENSP00000362171:E194K	ENSP00000362171:E194K	E	-	1	0	NAP1L3	92814380	0.993000	0.37304	0.602000	0.28890	0.428000	0.31595	1.911000	0.39937	0.910000	0.36722	0.529000	0.55759	GAA	.		0.433	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16952767	16952767	+	3'UTR	SNP	C	C	T	rs373089425		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chrY:16952767C>T	ENST00000476359.1	+	0	2621							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A692A(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ACATCTTAGCCTTTGCGGCGC	0.502																																					p.A692A		.											.	.	1	Substitution - coding silent(1)	prostate(1)	c.C2076T						.	C	,	0,571		0,571	53.0	72.0	66.0		1572,2076	-3.8	0.0	Y		66	1,1871		1,1871	no	coding-synonymous,coding-synonymous	NLGN4Y	NM_001206850.1,NM_014893.4	,	1,2442	T,C		0.0534,0.0,0.0409	,	524/649,692/817	16952767	1,2442	974	2291	3265	SO:0001624	3_prime_UTR_variant	22829	exon6			CTTAGCCTTTGCG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2618C>T	Y.37:g.16952767C>T		3	1		5	5	NM_014893	0	0	0	1	1	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Silent	SNP	ENST00000476359.1	37																																																																																				.		0.502	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
S100PBP	64766	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	33292114	33292114	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:33292114delA	ENST00000373475.5	+	3	668	c.414delA	c.(412-414)gtafs	p.V138fs	S100PBP_ENST00000373476.1_Frame_Shift_Del_p.V138fs|S100PBP_ENST00000398243.3_Frame_Shift_Del_p.V138fs|S100PBP_ENST00000356689.3_3'UTR	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				GACGCTCTGTACTAGAAAAGA	0.413																																					p.V138fs		.											.	S100PBP-90	0			c.414delA						.						55.0	56.0	56.0					1																	33292114		2203	4300	6503	SO:0001589	frameshift_variant	64766	exon3			.	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.414delA	1.37:g.33292114delA	ENSP00000362574:p.Val138fs	100	0		70	16	NM_001256121	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000373475.5	37	CCDS30666.1																																																																																			.		0.413	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011266.1	NM_022753	
GIT2	9815	broad.mit.edu;bcgsc.ca	37	12	110385121	110385127	+	Frame_Shift_Del	DEL	TGGGAGA	TGGGAGA	-	rs185965842	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	TGGGAGA	TGGGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:110385121_110385127delTGGGAGA	ENST00000355312.3	-	15	1574_1580	c.1575_1581delTCTCCCA	c.(1573-1581)tatctcccafs	p.YLP525fs	GIT2_ENST00000547815.1_3'UTR|GIT2_ENST00000457474.2_Frame_Shift_Del_p.YLP477fs|GIT2_ENST00000553118.1_Intron|GIT2_ENST00000338373.5_Intron|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000356259.4_Intron|GIT2_ENST00000343646.5_Frame_Shift_Del_p.YLP445fs|GIT2_ENST00000551209.1_Frame_Shift_Del_p.YLP474fs|GIT2_ENST00000354574.4_Frame_Shift_Del_p.YLP477fs|GIT2_ENST00000360185.4_Frame_Shift_Del_p.YLP475fs|GIT2_ENST00000361006.5_Frame_Shift_Del_p.YLP525fs	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	525					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.L526I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						CTTCTCCCATTGGGAGATATGGTTTCT	0.57																																					p.525_527del													.	GIT2-226	1	Substitution - Missense(1)	large_intestine(1)	c.1575_1581del						.																																			SO:0001589	frameshift_variant	9815	exon15			TCCCATTGGGAGA	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1575_1581delTCTCCCA	12.37:g.110385121_110385127delTGGGAGA	ENSP00000347464:p.Tyr525fs	90	0		107	13	NM_001135214	0	0	0	0	0	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Frame_Shift_Del	DEL	ENST00000355312.3	37	CCDS9138.1																																																																																			.		0.570	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
NUP50	10762	broad.mit.edu;bcgsc.ca	37	22	45574449	45574449	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr22:45574449delT	ENST00000347635.4	+	5	1137	c.671delT	c.(670-672)cttfs	p.L224fs	CTA-268H5.12_ENST00000610217.1_RNA|NUP50_ENST00000407019.2_Frame_Shift_Del_p.L196fs|NUP50_ENST00000396096.2_Frame_Shift_Del_p.L196fs|NUP50_ENST00000425733.2_5'UTR	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	224	5 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TCTCCTTCCCTTTTTGGCTCA	0.408																																					p.L224fs													.	NUP50-68	0			c.671delT						.						40.0	41.0	40.0					22																	45574449		2203	4300	6503	SO:0001589	frameshift_variant	10762	exon5			CTTCCCTTTTTGG	AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.671delT	22.37:g.45574449delT	ENSP00000345895:p.Leu224fs	107	0		81	11	NM_007172	0	0	0	0	0	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Frame_Shift_Del	DEL	ENST00000347635.4	37	CCDS14062.1																																																																																			.		0.408	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
MINA	84864	broad.mit.edu	37	3	97673276	97673276	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr3:97673276delC	ENST00000333396.7	-	5	1327	c.745delG	c.(745-747)gccfs	p.A249fs	MINA_ENST00000360258.4_Frame_Shift_Del_p.A249fs|MINA_ENST00000394198.2_Frame_Shift_Del_p.A249fs|MINA_ENST00000330299.2_Frame_Shift_Del_p.A249fs	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						GTAGAGTGGGCCAGCCCCGCA	0.527																																					p.A249fs													.	MINA-91	0			c.745delG						.						117.0	102.0	107.0					3																	97673276		2203	4300	6503	SO:0001589	frameshift_variant	84864	exon5			AGTGGGCCAGCCC	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.745delG	3.37:g.97673276delC	ENSP00000328251:p.Ala249fs	48	0		64	8	NM_001261829	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000333396.7	37	CCDS43114.1																																																																																			.		0.527	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778	
IGFBP1	3484	broad.mit.edu	37	7	45932569	45932569	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:45932569delC	ENST00000275525.3	+	4	955	c.659delC	c.(658-660)tccfs	p.S220fs	IGFBP1_ENST00000457280.1_Frame_Shift_Del_p.S218fs|IGFBP1_ENST00000468955.1_Frame_Shift_Del_p.S177fs	NM_000596.2	NP_000587.1	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	220	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)|tissue regeneration (GO:0042246)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	insulin-like growth factor binding (GO:0005520)			large_intestine(2)|lung(4)	6						TGTGAGACATCCATGGATGGA	0.547																																					p.S220fs													.	IGFBP1-946	0			c.659delC						.						84.0	79.0	81.0					7																	45932569		2203	4300	6503	SO:0001589	frameshift_variant	3484	exon4			AGACATCCATGGA		CCDS5504.1	7p12.3	2014-09-16			ENSG00000146678	ENSG00000146678			5469	protein-coding gene	gene with protein product	"""placental protein 12"", ""amniotic fluid binding protein"", ""alpha-pregnancy-associated endometrial globulin"", ""growth hormone independent-binding protein"", ""binding protein-28"", ""binding protein-26"", ""binding protein-25"", ""IGF-binding protein 1"""	146730		IBP1		2461294	Standard	NM_000596		Approved	IGF-BP25, AFBP, hIGFBP-1, PP12	uc003tnp.3	P08833	OTTHUMG00000152343	ENST00000275525.3:c.659delC	7.37:g.45932569delC	ENSP00000275525:p.Ser220fs	98	0		115	9	NM_000596	0	0	0	0	0	A4D2F4|D3DVL9|Q8IYP5	Frame_Shift_Del	DEL	ENST00000275525.3	37	CCDS5504.1																																																																																			.		0.547	IGFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251355.2	NM_000596	
CYP51A1	1595	broad.mit.edu;bcgsc.ca	37	7	91753101	91753107	+	Frame_Shift_Del	DEL	CTGTCTG	CTGTCTG	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	CTGTCTG	CTGTCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:91753101_91753107delCTGTCTG	ENST00000003100.8	-	6	996_1002	c.831_837delCAGACAG	c.(829-837)cgcagacagfs	p.RRQ277fs	CYP51A1_ENST00000450723.1_Frame_Shift_Del_p.RRQ172fs|LRRD1_ENST00000422722.1_5'UTR	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	271					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	TTTCTTGAGACTGTCTGCGTTTCTGGA	0.338																																					p.277_279del	GBM(70;1100 1190 11592 25836 51397)												.	CYP51A1-90	0			c.831_837del						.																																			SO:0001589	frameshift_variant	1595	exon6			TTGAGACTGTCTG	U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.831_837delCAGACAG	7.37:g.91753101_91753107delCTGTCTG	ENSP00000003100:p.Arg277fs	85	0		35	9	NM_000786	0	0	0	0	0	A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Frame_Shift_Del	DEL	ENST00000003100.8	37	CCDS5623.1																																																																																			.		0.338	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253812.4		
CEP78	84131	broad.mit.edu	37	9	80866948	80866948	+	Frame_Shift_Del	DEL	A	A	-	rs138501486		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr9:80866948delA	ENST00000424347.2	+	9	1483	c.1194delA	c.(1192-1194)gcafs	p.A398fs	CEP78_ENST00000376597.4_Frame_Shift_Del_p.A399fs|CEP78_ENST00000415759.2_Frame_Shift_Del_p.A399fs|CEP78_ENST00000277082.5_Frame_Shift_Del_p.A398fs|CEP78_ENST00000376598.2_Frame_Shift_Del_p.A398fs			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	398					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CAGAACGTGCAAAAAGACACA	0.418																																					p.A399fs													.	CEP78-69	0			c.1197delA						.						33.0	32.0	33.0					9																	80866948		1842	4087	5929	SO:0001589	frameshift_variant	84131	exon9			ACGTGCAAAAAGA	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.1194delA	9.37:g.80866948delA	ENSP00000411284:p.Ala398fs	21	0		29	7	NM_001098802	0	0	0	0	0	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Frame_Shift_Del	DEL	ENST00000424347.2	37																																																																																				.		0.418	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
SRCAP	10847	broad.mit.edu	37	16	30736370	30736371	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr16:30736370_30736371insC	ENST00000262518.4	+	25	6010_6011	c.5625_5626insC	c.(5626-5628)cccfs	p.P1876fs	SRCAP_ENST00000344771.4_Frame_Shift_Ins_p.P1718fs|SRCAP_ENST00000395059.2_Frame_Shift_Ins_p.P1814fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1876	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTCGACGCCAGCCCCCCCCACC	0.569																																					p.Q1875fs													.	SRCAP-94	0			c.5625_5626insC						.																																			SO:0001589	frameshift_variant	10847	exon25			ACGCCAGCCCCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5633dupC	16.37:g.30736378_30736378dupC	ENSP00000262518:p.Pro1876fs	195	0		299	7	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Ins	INS	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.569	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZNF341	84905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	32345059	32345060	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr20:32345059_32345060insC	ENST00000375200.1	+	6	1212_1213	c.847_848insC	c.(847-849)accfs	p.T283fs	ZNF341_ENST00000342427.2_Frame_Shift_Ins_p.T283fs	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CGCCCCCATGACCAGCGCCACC	0.629																																					p.T283fs		.											.	ZNF341-92	0			c.847_848insC						.																																			SO:0001589	frameshift_variant	84905	exon6			.	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.849dupC	20.37:g.32345061_32345061dupC	ENSP00000364346:p.Thr283fs	318	0		414	128	NM_032819	0	0	0	0	0	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Frame_Shift_Ins	INS	ENST00000375200.1	37																																																																																				.		0.629	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
TRIP6	7205	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100465513	100465514	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:100465513_100465514insC	ENST00000200457.4	+	2	500_501	c.140_141insC	c.(139-144)tgccccfs	p.CP47fs		NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	47					focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTCAATTTTTGCCCCCTTCCAT	0.624																																					p.C47fs		.											.	TRIP6-514	0			c.140_141insC						.																																			SO:0001589	frameshift_variant	7205	exon2			.	L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.145dupC	7.37:g.100465518_100465518dupC	ENSP00000200457:p.Cys47fs	265	0		335	81	NM_003302	0	0	0	0	0	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Frame_Shift_Ins	INS	ENST00000200457.4	37	CCDS5708.1																																																																																			.		0.624	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347151.2	NM_003302	
EEA1	8411	hgsc.bcm.edu	37	12	93196321	93196322	+	Missense_Mutation	DNP	TT	TT	AG			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:93196321_93196322TT>AG	ENST00000322349.8	-	19	2792_2793	c.2528_2529AA>CT	c.(2527-2529)aAA>aCT	p.K843T		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	843					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CCATTTTCACTTTTTGTAGTTC	0.297																																					p.K843T		.											.	EEA1	0			c.A2528C						.																																			SO:0001583	missense	8411	exon19			TTCACTTTTTGTA	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2528_2529delinsAG	12.37:g.93196321_93196322delinsAG	ENSP00000317955:p.Lys843Thr	31.0	0.0		16.0	2.0		0	0	0	0	0	Q14221	Missense_Mutation	DNP	ENST00000322349.8	37	CCDS31874.1																																																																																			.		0.297	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
NLRC4	58484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32475306	32475307	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:32475306_32475307GC>CT	ENST00000404025.2	-	5	2114_2115	c.1626_1627GC>AG	c.(1624-1629)gaGCaa>gaAGaa	p.Q543E	NLRC4_ENST00000402280.1_Missense_Mutation_p.Q543E|NLRC4_ENST00000360906.5_Missense_Mutation_p.Q543E|NLRC4_ENST00000342905.6_Intron			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	543					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGAATTTCTTGCTCAGTGGTGT	0.446																																					p.Q543E		.											.	NLRC4	0			c.G1626A						.																																			SO:0001583	missense	58484	exon4			TTCTTGCTCAGTG	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1626_1627delinsCT	2.37:g.32475306_32475307delinsCT	ENSP00000385090:p.Gln543Glu	163.0	0.0		106.0	21.0		0	0	0	0	0	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	DNP	ENST00000404025.2	37	CCDS33174.1																																																																																			.		0.446	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
