#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HP1BP3	50809	bcgsc.ca	37	1	21071364	21071364	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr1:21071364T>C	ENST00000312239.5	-	13	1727	c.1588A>G	c.(1588-1590)Agt>Ggt	p.S530G	RP5-930J4.4_ENST00000413451.1_RNA|HP1BP3_ENST00000375003.2_Missense_Mutation_p.S378G	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	530	Lys-rich.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TTTCTTGCACTGGTTGCAGGC	0.453																																					p.S530G													.	HP1BP3-91	0			c.A1588G						.						99.0	101.0	101.0					1																	21071364		2203	4300	6503	SO:0001583	missense	50809	exon13			TTGCACTGGTTGC	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1588A>G	1.37:g.21071364T>C	ENSP00000312625:p.Ser530Gly	102	3		75	30	NM_016287	0	0	48	86	38	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Missense_Mutation	SNP	ENST00000312239.5	37	CCDS30621.1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.318001	0.23994	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003	T;T	0.51574	0.7;0.72	5.74	4.61	0.57282	.	0.757026	0.13544	N	0.380000	T	0.35998	0.0951	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13495	-1.0507	10	0.72032	D	0.01	0.037	10.0226	0.42053	0.0:0.0765:0.0:0.9235	.	530	Q5SSJ5	HP1B3_HUMAN	G	530;492;378	ENSP00000312625:S530G;ENSP00000364142:S378G	ENSP00000312625:S530G	S	-	1	0	HP1BP3	20943951	0.651000	0.27340	0.212000	0.23672	0.206000	0.24218	1.784000	0.38674	1.101000	0.41535	0.459000	0.35465	AGT	.		0.453	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2	NM_016287	
DHX9	1660	ucsc.edu;bcgsc.ca	37	1	182856445	182856445	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr1:182856445C>G	ENST00000367549.3	+	28	3799	c.3689C>G	c.(3688-3690)tCt>tGt	p.S1230C	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1230	NTD.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AGAGGCAACTCTGGAGGAGAC	0.582																																					p.S1230C	Colon(69;210 1162 3697 13559 39565)												.	DHX9-92	0			c.C3689G						.						65.0	70.0	68.0					1																	182856445		1877	4097	5974	SO:0001583	missense	1660	exon28			GCAACTCTGGAGG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3689C>G	1.37:g.182856445C>G	ENSP00000356520:p.Ser1230Cys	163	4		110	42	NM_001357	0	0	73	166	93	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173556	0.21704	.	.	ENSG00000135829	ENST00000367549	D	0.82803	-1.65	4.43	2.11	0.27256	.	0.450874	0.19787	N	0.106070	T	0.65291	0.2677	N	0.19112	0.55	0.09310	N	1	B;B	0.28512	0.214;0.07	B;B	0.23852	0.049;0.049	T	0.53899	-0.8373	10	0.40728	T	0.16	.	3.7511	0.08566	0.1804:0.5673:0.0:0.2523	.	509;1230	B3KU66;Q08211	.;DHX9_HUMAN	C	1230	ENSP00000356520:S1230C	ENSP00000356520:S1230C	S	+	2	0	DHX9	181123068	0.000000	0.05858	0.019000	0.16419	0.907000	0.53573	0.262000	0.18460	0.555000	0.29079	0.561000	0.74099	TCT	.		0.582	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
SKIDA1	387640	broad.mit.edu	37	10	21805502	21805502	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr10:21805502T>C	ENST00000449193.2	-	4	3502	c.1250A>G	c.(1249-1251)gAg>gGg	p.E417G	SKIDA1_ENST00000444772.3_Missense_Mutation_p.E338G|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	336						nucleus (GO:0005634)											ctcctctccctcctcctcctc	0.622																																					p.E417G													.	.	0			c.A1250G						.						5.0	6.0	5.0					10																	21805502		1959	4052	6011	SO:0001583	missense	387640	exon4			TCTCCCTCCTCCT	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1250A>G	10.37:g.21805502T>C	ENSP00000410041:p.Glu417Gly	64	1		46	3	NM_207371	0	0	0	0	0	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473065	0.26423	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	4.85	4.85	0.62838	.	0.092390	0.40064	U	0.001195	T	0.34077	0.0885	N	0.12182	0.205	0.36349	D	0.859968	B	0.23540	0.087	B	0.20577	0.03	T	0.35351	-0.9792	9	0.28530	T	0.3	-8.3992	13.4017	0.60887	0.0:0.0:0.0:1.0	.	417	E9PAX1	.	G	417;338	.	ENSP00000442432:E338G	E	-	2	0	C10orf140	21845508	1.000000	0.71417	0.979000	0.43373	0.894000	0.52154	1.575000	0.36493	1.826000	0.53198	0.454000	0.30748	GAG	.		0.622	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
TM7SF2	7108	broad.mit.edu	37	11	64883476	64883476	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr11:64883476A>G	ENST00000279263.7	+	10	1370	c.1208A>G	c.(1207-1209)cAg>cGg	p.Q403R	AP003068.12_ENST00000527789.1_RNA|TM7SF2_ENST00000345348.5_Missense_Mutation_p.Q376R|TM7SF2_ENST00000540748.1_Missense_Mutation_p.Q287R	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	403					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTGGCCTGGCAGGAGTACTGC	0.642																																					p.Q403R													.	TM7SF2-91	0			c.A1208G						.						40.0	45.0	44.0					11																	64883476		2087	4206	6293	SO:0001583	missense	7108	exon10			CCTGGCAGGAGTA	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.1208A>G	11.37:g.64883476A>G	ENSP00000279263:p.Gln403Arg	49	1		28	7	NM_003273	0	0	43	113	70	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	ENST00000279263.7	37	CCDS41669.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.049827	0.36181	.	.	ENSG00000149809	ENST00000279263;ENST00000540748;ENST00000345348	D;D;D	0.97941	-4.62;-4.62;-4.62	5.39	-4.76	0.03229	Sterol reductase, conserved site (1);	1.553580	0.03419	N	0.205992	D	0.90191	0.6934	N	0.03294	-0.36	0.18873	N	0.999987	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	D	0.85001	0.0900	10	0.36615	T	0.2	-9.9488	3.2742	0.06892	0.3929:0.1167:0.3764:0.114	.	287;376;403	F5GYV3;O76062-2;O76062	.;.;ERG24_HUMAN	R	403;287;376	ENSP00000279263:Q403R;ENSP00000441215:Q287R;ENSP00000329520:Q376R	ENSP00000279263:Q403R	Q	+	2	0	TM7SF2	64640052	0.051000	0.20477	0.008000	0.14137	0.836000	0.47400	0.654000	0.24918	-0.739000	0.04809	-0.250000	0.11733	CAG	.		0.642	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
P2RY2	5029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	72945937	72945937	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr11:72945937C>T	ENST00000311131.2	+	3	1200	c.733C>T	c.(733-735)Cgc>Tgc	p.R245C	P2RY2_ENST00000393597.2_Missense_Mutation_p.R245C|P2RY2_ENST00000393596.2_Missense_Mutation_p.R245C	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	245					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CAAGTCCGTGCGCACCATCGC	0.642																																					p.R245C		.											.	P2RY2-503	0			c.C733T						.						101.0	92.0	95.0					11																	72945937		2200	4293	6493	SO:0001583	missense	5029	exon3			TCCGTGCGCACCA	U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.733C>T	11.37:g.72945937C>T	ENSP00000310305:p.Arg245Cys	51	0		33	13	NM_176071	0	0	0	0	0	B2R9W3|Q96EM8	Missense_Mutation	SNP	ENST00000311131.2	37	CCDS8219.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076082	0.55646	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.37411	1.2;1.2;1.2	4.42	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.057192	0.64402	D	0.000005	T	0.60830	0.2299	M	0.88450	2.955	0.52501	D	0.999954	D	0.89917	1.0	D	0.71414	0.973	T	0.66999	-0.5781	10	0.87932	D	0	.	9.3877	0.38354	0.4324:0.5676:0.0:0.0	.	245	P41231	P2RY2_HUMAN	C	245	ENSP00000377222:R245C;ENSP00000310305:R245C;ENSP00000377221:R245C	ENSP00000310305:R245C	R	+	1	0	P2RY2	72623585	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.622000	0.54217	2.170000	0.68504	0.561000	0.74099	CGC	.		0.642	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072	
SMARCC2	6601	broad.mit.edu	37	12	56558430	56558430	+	Silent	SNP	A	A	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr12:56558430A>C	ENST00000267064.4	-	27	3311	c.3225T>G	c.(3223-3225)ggT>ggG	p.G1075G	SMARCC2_ENST00000394023.3_Splice_Site|SMARCC2_ENST00000347471.4_Splice_Site|SMARCC2_ENST00000550164.1_Silent_p.G1106G|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1075	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.G1075G(2)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AAGGAGCATTACCCGCCACGC	0.567																																					p.G1075G													.	SMARCC2-229	2	Substitution - coding silent(2)	kidney(2)	c.T3225G						.						57.0	53.0	55.0					12																	56558430		2203	4300	6503	SO:0001819	synonymous_variant	6601	exon27			AGCATTACCCGCC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3225T>G	12.37:g.56558430A>C		47	17		66	16	NM_003075	0	0	26	28	2	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Silent	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	A	19.51	3.841392	0.71488	.	.	ENSG00000139613	ENST00000394023;ENST00000347471	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7728	0.63036	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMARCC2	54844697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.668000	0.68074	2.045000	0.60652	0.455000	0.32223	.	.		0.567	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
SLITRK5	26050	ucsc.edu;bcgsc.ca	37	13	88327922	88327922	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr13:88327922G>C	ENST00000325089.6	+	2	498	c.279G>C	c.(277-279)ttG>ttC	p.L93F	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	93					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GAAACCTTTTGAACCGTCTCT	0.463																																					p.L93F													.	SLITRK5-94	0			c.G279C						.						159.0	165.0	163.0					13																	88327922		2203	4300	6503	SO:0001583	missense	26050	exon2			CCTTTTGAACCGT	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.279G>C	13.37:g.88327922G>C	ENSP00000366283:p.Leu93Phe	276	3		210	66	NM_015567	0	0	0	0	0	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.201266	0.38905	.	.	ENSG00000165300	ENST00000325089	T	0.60424	0.19	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000003	T	0.70029	0.3177	L	0.58925	1.835	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.68610	-0.5363	9	.	.	.	-7.6811	11.1672	0.48550	0.0829:0.0:0.9171:0.0	.	93	O94991	SLIK5_HUMAN	F	93	ENSP00000366283:L93F	.	L	+	3	2	SLITRK5	87125923	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.494000	0.35616	2.826000	0.97356	0.561000	0.74099	TTG	.		0.463	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
OR4N2	390429	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20296302	20296302	+	Missense_Mutation	SNP	C	C	A	rs567489106		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr14:20296302C>A	ENST00000315947.1	+	1	695	c.695C>A	c.(694-696)gCa>gAa	p.A232E	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCTTCTGAGGCAAAAAACAAG	0.493																																					p.A232E													.	OR4N2-71	0			c.C695A						.						105.0	106.0	106.0					14																	20296302		2203	4300	6503	SO:0001583	missense	390429	exon1			CTGAGGCAAAAAA		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.695C>A	14.37:g.20296302C>A	ENSP00000319601:p.Ala232Glu	172	1		127	21	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	6.956	0.546326	0.13312	.	.	ENSG00000176294	ENST00000315947	T	0.00091	8.74	4.66	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.130056	0.35262	N	0.003337	T	0.00144	0.0004	L	0.28694	0.88	0.09310	N	1	B	0.16802	0.019	B	0.25759	0.063	T	0.32052	-0.9921	10	0.66056	D	0.02	-4.9296	11.5944	0.50964	0.0:0.355:0.645:0.0	.	232	Q8NGD1	OR4N2_HUMAN	E	232	ENSP00000319601:A232E	ENSP00000319601:A232E	A	+	2	0	OR4N2	19366142	0.036000	0.19791	0.988000	0.46212	0.123000	0.20343	0.859000	0.27858	1.313000	0.45069	-0.234000	0.12200	GCA	.		0.493	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
SETD3	84193	bcgsc.ca	37	14	99925507	99925507	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr14:99925507A>T	ENST00000331768.5	-	5	520	c.361T>A	c.(361-363)Tta>Ata	p.L121I	SETD3_ENST00000453938.1_5'UTR|SETD3_ENST00000329331.3_Missense_Mutation_p.L121I|SETD3_ENST00000436070.2_Missense_Mutation_p.L121I	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	121	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				GGAACCCATAAAAACAATTCT	0.358																																					p.L121I													.	SETD3-514	0			c.T361A						.						96.0	102.0	100.0					14																	99925507		2203	4300	6503	SO:0001583	missense	84193	exon5			CCCATAAAAACAA	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.361T>A	14.37:g.99925507A>T	ENSP00000327436:p.Leu121Ile	308	5		244	98	NM_032233	0	0	41	65	24	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273978	0.80580	.	.	ENSG00000183576	ENST00000331768;ENST00000329331;ENST00000436070	T;T;T	0.16897	2.31;2.31;2.31	5.47	1.88	0.25563	SET domain (1);	0.000000	0.64402	D	0.000002	T	0.20495	0.0493	N	0.25647	0.755	0.58432	D	0.999997	B;D;P	0.65815	0.067;0.995;0.505	B;D;P	0.81914	0.152;0.995;0.522	T	0.11641	-1.0579	10	0.15066	T	0.55	-8.4561	6.7996	0.23744	0.5324:0.0:0.4676:0.0	.	121;121;121	Q6NXR6;A0PJU3;Q86TU7	.;.;SETD3_HUMAN	I	121	ENSP00000327436:L121I;ENSP00000327910:L121I;ENSP00000408602:L121I	ENSP00000327910:L121I	L	-	1	2	SETD3	98995260	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.416000	0.59815	0.463000	0.27118	0.455000	0.32223	TTA	.		0.358	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
EXOC3L4	91828	broad.mit.edu	37	14	103570687	103570687	+	Silent	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr14:103570687G>A	ENST00000380069.3	+	4	1321	c.1245G>A	c.(1243-1245)caG>caA	p.Q415Q		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	415					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						AGGTGCTGCAGGGCCTCTACC	0.667																																					p.Q415Q													.	EXOC3L4-23	0			c.G1245A						.						11.0	12.0	12.0					14																	103570687		2194	4287	6481	SO:0001819	synonymous_variant	91828	exon4			GCTGCAGGGCCTC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1245G>A	14.37:g.103570687G>A		97	0		59	3	NM_001077594	0	0	16	16	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			.		0.667	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
KIF26A	26153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	104639376	104639376	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr14:104639376G>A	ENST00000423312.2	+	8	1483	c.1483G>A	c.(1483-1485)Gcc>Acc	p.A495T	KIF26A_ENST00000315264.7_Missense_Mutation_p.A356T	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	495	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CGTGCCCTGCGCCATCTCCTG	0.682																																					p.A495T		.											.	KIF26A-24	0			c.G1483A						.						21.0	27.0	25.0					14																	104639376		2117	4214	6331	SO:0001583	missense	26153	exon8			CCCTGCGCCATCT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1483G>A	14.37:g.104639376G>A	ENSP00000388241:p.Ala495Thr	84	0		76	6	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	37	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	35	5.536616	0.96460	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.48522	0.81;0.81	4.84	4.84	0.62591	Kinesin, motor domain (4);	.	.	.	.	T	0.65616	0.2708	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68891	-0.5289	9	0.66056	D	0.02	.	17.9375	0.89017	0.0:0.0:1.0:0.0	.	495	Q9ULI4	KI26A_HUMAN	T	495;356	ENSP00000388241:A495T;ENSP00000325452:A356T	ENSP00000325452:A356T	A	+	1	0	KIF26A	103709129	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	7.702000	0.84576	2.223000	0.72356	0.462000	0.41574	GCC	.		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
CNOT1	23019	broad.mit.edu	37	16	58566190	58566190	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr16:58566190T>C	ENST00000317147.5	-	41	6337	c.6005A>G	c.(6004-6006)aAt>aGt	p.N2002S	CNOT1_ENST00000245138.4_Missense_Mutation_p.N853S|CNOT1_ENST00000569240.1_Missense_Mutation_p.N1997S	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2002					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CTCAGGTGCATTGAGTTCCAA	0.398																																					p.N2002S													.	CNOT1-95	0			c.A6005G						.						95.0	89.0	91.0					16																	58566190		2198	4300	6498	SO:0001583	missense	23019	exon41			GGTGCATTGAGTT	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.6005A>G	16.37:g.58566190T>C	ENSP00000320949:p.Asn2002Ser	159	0		141	5	NM_016284	0	0	69	72	3	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.110146	0.37242	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000546037;ENST00000245138;ENST00000394200	T	0.44482	0.92	5.85	5.85	0.93711	CCR4-Not complex component, Not1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	N	0.21508	0.67	0.80722	D	1	B;B;B	0.29341	0.065;0.242;0.235	B;B;B	0.29353	0.028;0.101;0.069	T	0.09509	-1.0671	10	0.07644	T	0.81	.	16.2355	0.82371	0.0:0.0:0.0:1.0	.	853;2002;1997	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	S	2002;696;7;853;1997	ENSP00000320949:N2002S	ENSP00000245138:N853S	N	-	2	0	CNOT1	57123691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.238000	0.73509	0.533000	0.62120	AAT	.		0.398	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
KRTAP4-11	653240	broad.mit.edu	37	17	39274432	39274432	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr17:39274432C>T	ENST00000391413.2	-	1	174	c.136G>A	c.(136-138)Gtg>Atg	p.V46M		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	46	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTGGACACACAGCAGCTG	0.677																																					p.V46M													.	.	0			c.G136A						.						14.0	18.0	17.0					17																	39274432		690	1591	2281	SO:0001583	missense	653240	exon1			TGGACACACAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.136G>A	17.37:g.39274432C>T	ENSP00000375232:p.Val46Met	77	2		86	5	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	10.56	1.385842	0.25031	.	.	ENSG00000212721	ENST00000391413	T	0.01430	4.9	3.76	-6.69	0.01772	.	0.911881	0.08829	U	0.887602	T	0.03739	0.0106	M	0.84948	2.725	0.09310	N	1	P	0.40266	0.71	P	0.46585	0.521	T	0.02144	-1.1206	10	0.54805	T	0.06	.	8.7851	0.34816	0.0:0.3102:0.5247:0.1651	.	46	Q9BYQ6	KR411_HUMAN	M	46	ENSP00000375232:V46M	ENSP00000375232:V46M	V	-	1	0	KRTAP4-11	36527958	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.396000	0.01052	-0.895000	0.03920	-1.166000	0.01754	GTG	.		0.677	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
TRAPPC8	22878	broad.mit.edu	37	18	29497627	29497627	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr18:29497627G>T	ENST00000283351.4	-	3	691	c.356C>A	c.(355-357)aCt>aAt	p.T119N	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.T65N|TRAPPC8_ENST00000582513.1_Missense_Mutation_p.T119N	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	119					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CCATGGAGTAGTGGCTAAAAT	0.318																																					p.T119N													.	TRAPPC8-159	0			c.C356A						.						110.0	116.0	114.0					18																	29497627		2203	4300	6503	SO:0001583	missense	22878	exon3			GGAGTAGTGGCTA	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.356C>A	18.37:g.29497627G>T	ENSP00000283351:p.Thr119Asn	54	0		60	3	NM_014939	0	0	0	0	0	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073869	0.55646	.	.	ENSG00000153339	ENST00000283351	T	0.08807	3.05	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.09730	0.0239	L	0.31664	0.95	0.80722	D	1	B;B	0.33266	0.404;0.27	B;B	0.34489	0.132;0.184	T	0.30880	-0.9963	10	0.25751	T	0.34	-26.1221	20.8598	0.99761	0.0:0.0:1.0:0.0	.	119;119	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	N	119	ENSP00000283351:T119N	ENSP00000283351:T119N	T	-	2	0	TRAPPC8	27751625	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	ACT	.		0.318	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
MEF2B	100271849	broad.mit.edu	37	19	19258537	19258537	+	Silent	SNP	A	A	C	rs200716984		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:19258537A>C	ENST00000602424.2	-	6	1089	c.363T>G	c.(361-363)ggT>ggG	p.G121G	MEF2BNB-MEF2B_ENST00000444486.3_Silent_p.G121G|MEF2B_ENST00000424583.2_Silent_p.G121G|MEF2B_ENST00000410050.1_Silent_p.G121G|MEF2B_ENST00000409224.1_Silent_p.G124G|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR|MEF2B_ENST00000409447.2_Silent_p.G121G|MEF2B_ENST00000162023.5_Silent_p.G121G|MEF2BNB-MEF2B_ENST00000514819.3_Silent_p.G138G	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	121					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			AGGCCGGATCACCCCCTTCGC	0.627																																					p.G121G													.	MEF2BNB-MEF2B-522	0			c.T363G						.						66.0	67.0	67.0					19																	19258537		2203	4300	6503	SO:0001819	synonymous_variant	4207	exon6			CGGATCACCCCCT	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.363T>G	19.37:g.19258537A>C		48	10		36	12	NM_005919	0	0	10	11	1	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Silent	SNP	ENST00000602424.2	37	CCDS12394.1																																																																																			.		0.627	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_005919	
GRIK5	2901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42525580	42525580	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:42525580G>A	ENST00000262895.3	-	14	1743	c.1744C>T	c.(1744-1746)Cgc>Tgc	p.R582C	GRIK5_ENST00000593562.1_Missense_Mutation_p.R582C|GRIK5_ENST00000301218.4_Missense_Mutation_p.R582C	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	582					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R582C(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ATGTGGGGGCGTGCCCGCAGG	0.652																																					p.R582C		.											.	GRIK5-90	2	Substitution - Missense(2)	prostate(2)	c.C1744T						.						35.0	29.0	31.0					19																	42525580		2203	4300	6503	SO:0001583	missense	2901	exon14			GGGGGCGTGCCCG		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1744C>T	19.37:g.42525580G>A	ENSP00000262895:p.Arg582Cys	54	0		62	16	NM_002088	0	0	0	0	0	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194809	0.58017	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.14022	2.59;2.54	4.51	4.51	0.55191	Ionotropic glutamate receptor (2);	0.153806	0.42821	D	0.000644	T	0.24353	0.0590	L	0.32530	0.975	0.45621	D	0.99855	D	0.89917	1.0	D	0.70016	0.967	T	0.01114	-1.1447	10	0.62326	D	0.03	.	11.8849	0.52596	0.0:0.0:0.8248:0.1752	.	582	Q16478	GRIK5_HUMAN	C	582	ENSP00000262895:R582C;ENSP00000301218:R582C	ENSP00000262895:R582C	R	-	1	0	GRIK5	47217420	0.846000	0.29590	0.903000	0.35520	0.645000	0.38454	1.338000	0.33873	2.055000	0.61198	0.563000	0.77884	CGC	.		0.652	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
CRX	1406	broad.mit.edu	37	19	48343201	48343201	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:48343201G>T	ENST00000221996.7	+	4	1083	c.877G>T	c.(877-879)Gcc>Tcc	p.A293S	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Missense_Mutation_p.A293S	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	293					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GGATCAGAGTGCCTGGAAGTT	0.537																																					p.A293S	Pancreas(57;461 1196 22201 40716 47188)												.	CRX-153	0			c.G877T						.						72.0	74.0	73.0					19																	48343201		2171	4203	6374	SO:0001583	missense	1406	exon4			CAGAGTGCCTGGA	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.877G>T	19.37:g.48343201G>T	ENSP00000221996:p.Ala293Ser	71	0		63	5	NM_000554	0	0	0	0	0	Q0QD45	Missense_Mutation	SNP	ENST00000221996.7	37	CCDS12706.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239964	0.22711	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.85773	-2.03;-2.03	3.88	2.77	0.32553	.	0.069568	0.64402	D	0.000017	T	0.56247	0.1972	N	0.01473	-0.845	0.28983	N	0.88852	B	0.19073	0.033	B	0.10450	0.005	T	0.53669	-0.8406	10	0.02654	T	1	-12.4857	8.1058	0.30885	0.0:0.0:0.6293:0.3707	.	293	O43186	CRX_HUMAN	S	293	ENSP00000221996:A293S;ENSP00000445565:A293S	ENSP00000221996:A293S	A	+	1	0	CRX	53035013	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.817000	0.62650	1.988000	0.58038	0.313000	0.20887	GCC	.		0.537	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409812.4	NM_000554	
ZNF808	388558	broad.mit.edu	37	19	53057180	53057180	+	Silent	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:53057180T>C	ENST00000359798.4	+	5	1191	c.1011T>C	c.(1009-1011)caT>caC	p.H337H		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		AGGCAATTCATACTGGAGAGA	0.393																																					p.H337H													.	.	0			c.T1011C						.						82.0	87.0	85.0					19																	53057180		2203	4300	6503	SO:0001819	synonymous_variant	388558	exon5			AATTCATACTGGA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1011T>C	19.37:g.53057180T>C		135	3		130	5	NM_001039886	0	0	19	19	0	Q68CN7	Silent	SNP	ENST00000359798.4	37	CCDS46167.1																																																																																			.		0.393	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
AGBL5	60509	broad.mit.edu	37	2	27276801	27276801	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr2:27276801G>T	ENST00000360131.4	+	4	584	c.425G>T	c.(424-426)cGt>cTt	p.R142L	AGBL5_ENST00000323064.8_Missense_Mutation_p.R142L|RP11-503P10.1_ENST00000607407.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	142					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGTTCATCGTTTCGTGGAG	0.542																																					p.R142L													.	AGBL5-154	0			c.G425T						.						196.0	173.0	180.0					2																	27276801		2203	4300	6503	SO:0001583	missense	60509	exon4			TTCATCGTTTCGT	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.425G>T	2.37:g.27276801G>T	ENSP00000353249:p.Arg142Leu	135	0		90	3	NM_021831	0	0	33	33	0	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084963	0.76642	.	.	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	T;T	0.16196	2.39;2.36	5.51	4.64	0.57946	.	0.142751	0.64402	D	0.000004	T	0.32793	0.0841	L	0.53617	1.68	0.58432	D	0.999995	D;D;D	0.63880	0.988;0.993;0.993	P;D;D	0.63488	0.825;0.915;0.915	T	0.02109	-1.1212	10	0.32370	T	0.25	-8.9665	13.3669	0.60689	0.0773:0.0:0.9227:0.0	.	142;142;142	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	L	142	ENSP00000323681:R142L;ENSP00000353249:R142L	ENSP00000323681:R142L	R	+	2	0	AGBL5	27130305	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.166000	0.94766	1.331000	0.45412	0.561000	0.74099	CGT	.		0.542	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
SPTBN1	6711	ucsc.edu;bcgsc.ca	37	2	54855278	54855278	+	Silent	SNP	G	G	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr2:54855278G>C	ENST00000356805.4	+	13	1970	c.1689G>C	c.(1687-1689)gtG>gtC	p.V563V	SPTBN1_ENST00000333896.5_Silent_p.V550V	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	563					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TACTTGGTGTGGAAGACCTGT	0.498																																					p.V563V													.	SPTBN1-140	0			c.G1689C						.						187.0	153.0	165.0					2																	54855278		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon13			TGGTGTGGAAGAC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1689G>C	2.37:g.54855278G>C		126	2		105	39	NM_003128	0	0	29	60	31	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1																																																																																			.		0.498	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
ERCC3	2071	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128051174	128051174	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr2:128051174C>G	ENST00000285398.2	-	2	243	c.149G>C	c.(148-150)gGc>gCc	p.G50A	ERCC3_ENST00000493187.2_5'UTR	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	50					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CACTTTGGTGCCTGACTCATC	0.597			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.G50A			yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3-723	0			c.G149C						.						108.0	100.0	103.0					2																	128051174		2203	4300	6503	SO:0001583	missense	2071	exon2	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TTGGTGCCTGACT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.149G>C	2.37:g.128051174C>G	ENSP00000285398:p.Gly50Ala	153	1		86	6	NM_000122	0	0	13	16	3	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	C	3.976	-0.007366	0.07773	.	.	ENSG00000163161	ENST00000285398	T	0.61980	0.06	4.65	3.78	0.43462	.	0.406249	0.29480	N	0.012028	T	0.42630	0.1211	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.23726	-1.0180	10	0.08179	T	0.78	-9.8038	12.7961	0.57560	0.0:0.9206:0.0:0.0794	.	50;50	A8K359;P19447	.;ERCC3_HUMAN	A	50	ENSP00000285398:G50A	ENSP00000285398:G50A	G	-	2	0	ERCC3	127767644	0.959000	0.32827	0.934000	0.37439	0.609000	0.37215	3.327000	0.52045	1.174000	0.42811	-0.136000	0.14681	GGC	.		0.597	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
ANKRD30BL	554226	bcgsc.ca	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A		328	10		261	10	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
OSBPL6	114880	bcgsc.ca	37	2	179255928	179255928	+	Silent	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr2:179255928G>A	ENST00000190611.4	+	22	2806	c.2430G>A	c.(2428-2430)aaG>aaA	p.K810K	OSBPL6_ENST00000315022.2_Silent_p.K814K|OSBPL6_ENST00000409631.1_Silent_p.K774K|OSBPL6_ENST00000392505.2_Silent_p.K835K|OSBPL6_ENST00000409045.3_Silent_p.K779K|OSBPL6_ENST00000359685.3_Silent_p.K774K	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	810					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCTCTGCAAAGTGCATTTGGA	0.537																																					p.K835K													.	OSBPL6-69	0			c.G2505A						.						145.0	128.0	134.0					2																	179255928		2203	4300	6503	SO:0001819	synonymous_variant	114880	exon23			TGCAAAGTGCATT	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2430G>A	2.37:g.179255928G>A		139	3		90	35	NM_001201480	0	0	0	0	0	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Silent	SNP	ENST00000190611.4	37	CCDS2277.1																																																																																			.		0.537	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
FRG1B	284802	bcgsc.ca	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr20:29625875T>C	ENST00000278882.3	+	5	499	c.119T>C	c.(118-120)aTc>aCc	p.I40T	FRG1B_ENST00000358464.4_Missense_Mutation_p.I40T|FRG1B_ENST00000439954.2_Missense_Mutation_p.I45T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	40								p.I40T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGTACAGAATCGCCCTGAAA	0.358																																					.													.	FRG1B-22	4	Substitution - Missense(4)	prostate(4)	.						.																																			SO:0001583	missense	284802	.			ACAGAATCGCCCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.119T>C	20.37:g.29625875T>C	ENSP00000278882:p.Ile40Thr	298	6		268	10	.	0	0	1	1	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	10.51	1.369778	0.24771	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.51071	0.72	1.68	1.68	0.24146	.	0.052751	0.64402	D	0.000001	T	0.59865	0.2225	.	.	.	0.51482	D	0.999924	P	0.49862	0.929	D	0.64687	0.928	T	0.59386	-0.7464	9	0.52906	T	0.07	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	45	F5H5R5	.	T	40;45;40	ENSP00000408863:I45T	ENSP00000278882:I40T	I	+	2	0	FRG1B	28239536	1.000000	0.71417	0.982000	0.44146	0.025000	0.11179	6.565000	0.73974	1.028000	0.39785	0.155000	0.16302	ATC	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TTLL12	23170	ucsc.edu;bcgsc.ca	37	22	43569808	43569808	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr22:43569808G>T	ENST00000216129.6	-	9	1317	c.1254C>A	c.(1252-1254)tgC>tgA	p.C418*	TTLL12_ENST00000484118.1_5'Flank|TTLL12_ENST00000494035.1_5'Flank	NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	418	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				TCCAGGGCTTGCAGATCCAGT	0.687																																					p.C418X													.	TTLL12-90	0			c.C1254A						.						58.0	51.0	53.0					22																	43569808		2203	4300	6503	SO:0001587	stop_gained	23170	exon9			GGGCTTGCAGATC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.1254C>A	22.37:g.43569808G>T	ENSP00000216129:p.Cys418*	32	0		26	4	NM_015140	0	0	37	37	0	Q20WK5|Q9UGU3	Nonsense_Mutation	SNP	ENST00000216129.6	37	CCDS14047.1	.	.	.	.	.	.	.	.	.	.	G	37	6.535621	0.97646	.	.	ENSG00000100304	ENST00000216129;ENST00000423379	.	.	.	4.96	3.94	0.45596	.	0.098590	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.6038	13.2367	0.59972	0.0776:0.0:0.9224:0.0	.	.	.	.	X	418	.	ENSP00000216129:C418X	C	-	3	2	TTLL12	41899752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.967000	0.49216	1.061000	0.40601	0.467000	0.42956	TGC	.		0.687	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
MUC4	4585	broad.mit.edu	37	3	195488976	195488976	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr3:195488976G>A	ENST00000346145.4	-	13	1825	c.1786C>T	c.(1786-1788)Cgc>Tgc	p.R596C	MUC4_ENST00000475231.1_Missense_Mutation_p.R4780C|MUC4_ENST00000349607.4_Missense_Mutation_p.R545C|MUC4_ENST00000463781.3_Missense_Mutation_p.R4832C	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1589					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCCTCCGTGCGGTTCTGGTAC	0.741																																					p.R4832C													.	MUC4-90	0			c.C14494T						.						18.0	19.0	18.0					3																	195488976		2199	4295	6494	SO:0001583	missense	4585	exon14			CCGTGCGGTTCTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.1786C>T	3.37:g.195488976G>A	ENSP00000304207:p.Arg596Cys	50	0		46	3	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	7.202	0.593705	0.13875	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	4.97	4.09	0.47781	.	0.926209	0.09124	N	0.845258	T	0.68604	0.3019	L	0.50333	1.59	0.09310	N	1	D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.994;0.994;0.998	D;P;P;P;P;P	0.68621	0.959;0.738;0.738;0.765;0.765;0.784	T	0.53373	-0.8448	10	0.62326	D	0.03	-4.6337	8.1797	0.31302	0.0:0.1524:0.5328:0.3147	.	4704;545;596;4832;4780;1537	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	C	545;596;4832;4780;1332	ENSP00000338109:R545C;ENSP00000304207:R596C;ENSP00000417498:R4832C;ENSP00000420243:R4780C	ENSP00000304207:R596C	R	-	1	0	MUC4	196974647	0.073000	0.21202	0.017000	0.16124	0.007000	0.05969	0.864000	0.27926	1.065000	0.40693	0.561000	0.74099	CGC	.		0.741	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
DSPP	1834	hgsc.bcm.edu	37	4	88536553	88536553	+	Silent	SNP	C	C	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr4:88536553C>T	ENST00000282478.7	+	4	2772	c.2739C>T	c.(2737-2739)gaC>gaT	p.D913D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D913D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	913	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagtgata	0.478																																					p.D913D		.											.	DSPP-90	0			c.C2739T						.						71.0	95.0	87.0					4																	88536553		1633	2974	4607	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2739C>T	4.37:g.88536553C>T		154	0		114	28	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.478	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
IL6ST	3572	ucsc.edu	37	5	55237518	55237518	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr5:55237518C>T	ENST00000381298.2	-	17	2461	c.2149G>A	c.(2149-2151)Gaa>Aaa	p.E717K	IL6ST_ENST00000381294.3_Missense_Mutation_p.E656K|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000336909.5_Missense_Mutation_p.E717K|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.E717K|IL6ST_ENST00000381287.4_3'UTR	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	717					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TTAATTTTTTCCTTTTTGAAC	0.383			O		hepatocellular ca																																p.E717K				Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST-290	0			c.G2149A						.						141.0	148.0	146.0					5																	55237518		2203	4300	6503	SO:0001583	missense	3572	exon17			TTTTTTCCTTTTT	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2149G>A	5.37:g.55237518C>T	ENSP00000370698:p.Glu717Lys	283	0		294	1	NM_002184	0	0	19	20	1	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911763	0.92178	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.42900	1.25;1.25;0.96	5.4	5.4	0.78164	.	3.018200	0.01740	N	0.029358	T	0.45216	0.1331	N	0.24115	0.695	0.80722	D	1	P;P;P	0.48911	0.862;0.917;0.862	B;P;P	0.48627	0.424;0.584;0.501	T	0.23404	-1.0189	10	0.49607	T	0.09	.	12.8542	0.57876	0.0:0.9252:0.0:0.0748	.	717;656;717	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	K	717;717;656	ENSP00000370698:E717K;ENSP00000338799:E717K;ENSP00000370694:E656K	ENSP00000338799:E717K	E	-	1	0	IL6ST	55273275	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.416000	0.66417	2.687000	0.91594	0.557000	0.71058	GAA	.		0.383	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
NKX2-5	1482	broad.mit.edu	37	5	172659920	172659920	+	Silent	SNP	C	C	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr5:172659920C>G	ENST00000329198.4	-	2	900	c.627G>C	c.(625-627)ccG>ccC	p.P209P	NKX2-5_ENST00000521848.1_3'UTR|NKX2-5_ENST00000424406.2_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	209	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			gcggcggcggcgggggcAGCC	0.701																																					p.P209P	Esophageal Squamous(72;810 1219 2387 13420 44943)												.	NKX2-5-90	0			c.G627C						.						5.0	6.0	6.0					5																	172659920		1935	3790	5725	SO:0001819	synonymous_variant	1482	exon2			CGGCGGCGGGGGC	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.627G>C	5.37:g.172659920C>G		85	2		76	6	NM_004387	0	0	0	0	0	A8K3K0|B4DNB6|E9PBU6	Silent	SNP	ENST00000329198.4	37	CCDS4387.1																																																																																			.		0.701	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
PRIM2	5558	broad.mit.edu;bcgsc.ca	37	6	57393114	57393114	+	Missense_Mutation	SNP	A	A	G	rs551418169		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr6:57393114A>G	ENST00000607273.1	+	9	851	c.764A>G	c.(763-765)cAt>cGt	p.H255R	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	255					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttaaaGTCATTCCTACACT	0.269																																					.													.	PRIM2-227	0			.						.						71.0	63.0	65.0					6																	57393114		1797	4065	5862	SO:0001583	missense	5558	.			AAAGTCATTCCTA		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.764A>G	6.37:g.57393114A>G	ENSP00000475738:p.His255Arg	109	1		96	11	.	0	0	0	0	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37																																																																																				.		0.269	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
PHKG1	5260	ucsc.edu;bcgsc.ca	37	7	56151013	56151013	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:56151013A>C	ENST00000297373.2	-	6	699	c.505T>G	c.(505-507)Ttt>Gtt	p.F169V	PHKG1_ENST00000537360.1_Missense_Mutation_p.F115V|PHKG1_ENST00000452681.2_Missense_Mutation_p.F201V|PHKG1_ENST00000489604.1_5'Flank	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GAAAAGCCAAAGTCTGTGAGC	0.562																																					p.F201V	Melanoma(184;580 2064 5329 24177 35303)												.	PHKG1-424	0			c.T601G						.						83.0	80.0	81.0					7																	56151013		2203	4300	6503	SO:0001583	missense	5260	exon7			AGCCAAAGTCTGT	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.505T>G	7.37:g.56151013A>C	ENSP00000297373:p.Phe169Val	125	3		145	34	NM_001258459	0	0	0	0	0	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	ENST00000297373.2	37	CCDS5525.1	.	.	.	.	.	.	.	.	.	.	A	33	5.223987	0.95139	.	.	ENSG00000164776	ENST00000452681;ENST00000537360;ENST00000297373;ENST00000446428;ENST00000432123	T;T;T;T;T	0.73897	1.58;-0.79;-0.79;-0.04;-0.04	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.92443	0.7601	H	0.99475	4.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.996;1.0	D	0.95527	0.8600	10	0.87932	D	0	-15.785	15.306	0.73992	1.0:0.0:0.0:0.0	.	115;160;201;169	B7Z5U3;B7Z6U2;F5H2S1;Q16816	.;.;.;PHKG1_HUMAN	V	201;115;169;91;91	ENSP00000445440:F201V;ENSP00000441528:F115V;ENSP00000297373:F169V;ENSP00000389721:F91V;ENSP00000397193:F91V	ENSP00000297373:F169V	F	-	1	0	PHKG1	56118507	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.256000	0.95535	2.275000	0.75901	0.528000	0.53228	TTT	.		0.562	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251587.1	NM_006213	
SBDS	51119	ucsc.edu;bcgsc.ca	37	7	66456233	66456233	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:66456233A>C	ENST00000246868.2	-	4	698	c.515T>G	c.(514-516)aTg>aGg	p.M172R		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	172					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						CCGAAGCCTCATGTGAGCACG	0.388			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																												p.M172R			yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	.	SBDS-523	0			c.T515G						.						131.0	111.0	118.0					7																	66456233		2203	4300	6503	SO:0001583	missense	51119	exon4	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	AGCCTCATGTGAG	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.515T>G	7.37:g.66456233A>C	ENSP00000246868:p.Met172Arg	164	3		170	95	NM_016038	0	0	59	158	99	A8K0P4|Q96FX0|Q9NV53	Missense_Mutation	SNP	ENST00000246868.2	37	CCDS5537.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590324	0.66105	.	.	ENSG00000126524	ENST00000246868	D	0.97430	-4.38	5.04	3.87	0.44632	Ribosome maturation protein SBDS, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98476	1.0603	10	0.54805	T	0.06	-39.0865	10.1837	0.42984	0.8322:0.1678:0.0:0.0	.	172	Q9Y3A5	SBDS_HUMAN	R	172	ENSP00000246868:M172R	ENSP00000246868:M172R	M	-	2	0	SBDS	66093668	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	8.335000	0.90031	0.935000	0.37341	0.454000	0.30748	ATG	.		0.388	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038	
CACNA2D1	781	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	81588631	81588631	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:81588631T>G	ENST00000356253.5	-	38	3410	c.3155A>C	c.(3154-3156)tAc>tCc	p.Y1052S	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.Y252S|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.Y1040S			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	1052					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CCCTTTTCGGTATCTGGGTTG	0.358																																					p.Y1040S													.	CACNA2D1-96	0			c.A3119C						.						114.0	104.0	107.0					7																	81588631		2203	4300	6503	SO:0001583	missense	781	exon38			TTTCGGTATCTGG	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.3155A>C	7.37:g.81588631T>G	ENSP00000348589:p.Tyr1052Ser	124	1		167	40	NM_000722	0	0	1	2	1	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	T	24.8	4.566128	0.86439	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.68479	-0.33;-0.33;-0.33	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.82568	0.5065	M	0.82517	2.595	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.82476	-0.0438	10	0.35671	T	0.21	-11.6328	16.2135	0.82186	0.0:0.0:0.0:1.0	.	252;1040	B7Z658;P54289-2	.;.	S	1040;1059;1052;252	ENSP00000349320:Y1040S;ENSP00000348589:Y1052S;ENSP00000443124:Y252S	ENSP00000284088:Y1059S	Y	-	2	0	CACNA2D1	81426567	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.492000	0.81482	2.227000	0.72691	0.460000	0.39030	TAC	.		0.358	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
LMOD2	442721	broad.mit.edu	37	7	123302918	123302918	+	Silent	SNP	T	T	C			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:123302918T>C	ENST00000458573.2	+	2	1435	c.1278T>C	c.(1276-1278)ccT>ccC	p.P426P	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	426	Pro-rich.					cytoskeleton (GO:0005856)											ctcctccccctcctcctcctc	0.592																																					p.P426P													.	LMOD2-68	0			c.T1278C						.						17.0	18.0	18.0					7																	123302918		1917	4112	6029	SO:0001819	synonymous_variant	442721	exon2			TCCCCCTCCTCCT	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1278T>C	7.37:g.123302918T>C		62	10		61	16	NM_207163	0	0	0	0	0	A4D0W9|A4D0Y2|Q8WVJ8	Silent	SNP	ENST00000458573.2	37	CCDS47693.1																																																																																			.		0.592	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
TSPAN33	340348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128804350	128804350	+	Silent	SNP	C	C	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:128804350C>A	ENST00000289407.4	+	5	508	c.399C>A	c.(397-399)gcC>gcA	p.A133A	Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	133					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						TCAACAATGCCATTGTGCACT	0.498											OREG0018304	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A133A		.											.	TSPAN33-91	0			c.C399A						.						211.0	180.0	190.0					7																	128804350		2203	4300	6503	SO:0001819	synonymous_variant	340348	exon5			CAATGCCATTGTG		CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.399C>A	7.37:g.128804350C>A		54	0	1567	76	48	NM_178562	0	0	94	253	159		Silent	SNP	ENST00000289407.4	37	CCDS5810.1																																																																																			.		0.498	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562	
MAFA	389692	broad.mit.edu	37	8	144511742	144511742	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr8:144511742G>A	ENST00000333480.2	-	1	834	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W	MAFA_ENST00000528185.1_5'UTR	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	279	Basic motif.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			AGAATGTGCCGCTGCTGCACC	0.642										HNSCC(29;0.082)																											p.R279W													.	MAFA-278	0			c.C835T						.						17.0	18.0	17.0					8																	144511742		2195	4291	6486	SO:0001583	missense	389692	exon1			TGTGCCGCTGCTG	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.835C>T	8.37:g.144511742G>A	ENSP00000328364:p.Arg279Trp	43	0		32	3	NM_201589	0	0	0	0	0		Missense_Mutation	SNP	ENST00000333480.2	37	CCDS34955.1	.	.	.	.	.	.	.	.	.	.	g	18.54	3.645833	0.67358	.	.	ENSG00000182759	ENST00000333480	D	0.92199	-2.99	2.95	1.98	0.26296	Basic-leucine zipper (bZIP) transcription factor (2);Maf transcription factor (1);	0.000000	0.64402	U	0.000008	D	0.94122	0.8115	M	0.68952	2.095	0.48288	D	0.999623	D	0.89917	1.0	D	0.81914	0.995	D	0.93186	0.6579	10	0.59425	D	0.04	.	9.6689	0.40000	0.0:0.0:0.7917:0.2082	.	279	Q8NHW3	MAFA_HUMAN	W	279	ENSP00000328364:R279W	ENSP00000328364:R279W	R	-	1	2	MAFA	144582885	0.990000	0.36364	1.000000	0.80357	0.978000	0.69477	0.007000	0.13174	1.183000	0.42943	0.282000	0.19409	CGG	.		0.642	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381511.2	NM_201589	
INPP5E	56623	ucsc.edu	37	9	139327715	139327715	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr9:139327715G>T	ENST00000371712.3	-	4	1453	c.1051C>A	c.(1051-1053)Cgt>Agt	p.R351S		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TCCTGCAGACGAGTCTCCCAC	0.682																																					p.R351S													.	INPP5E-227	0			c.C1051A						.						16.0	17.0	16.0					9																	139327715		2183	4289	6472	SO:0001583	missense	56623	exon4			GCAGACGAGTCTC	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1051C>A	9.37:g.139327715G>T	ENSP00000360777:p.Arg351Ser	17	0		23	4	NM_019892	0	0	7	7	0	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371712.3	37	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611634	0.66558	.	.	ENSG00000148384	ENST00000371712	T	0.79352	-1.26	4.87	2.97	0.34412	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.061110	0.64402	D	0.000005	T	0.72358	0.3450	L	0.48877	1.53	0.58432	D	0.999997	P	0.44578	0.838	P	0.46049	0.502	T	0.67205	-0.5729	10	0.39692	T	0.17	-23.2799	8.3299	0.32180	0.0822:0.0:0.7625:0.1553	.	351	Q9NRR6	INP5E_HUMAN	S	351	ENSP00000360777:R351S	ENSP00000360777:R351S	R	-	1	0	INPP5E	138447536	1.000000	0.71417	0.194000	0.23346	0.845000	0.48019	2.512000	0.45485	0.445000	0.26639	0.561000	0.74099	CGT	.		0.682	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1	NM_019892	
RBM3	5935	broad.mit.edu	37	X	48434994	48434994	+	Splice_Site	SNP	T	T	G			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chrX:48434994T>G	ENST00000376759.3	+	5	476		c.e5+2		RBM3_ENST00000354480.2_Splice_Site|RBM3_ENST00000430348.2_Splice_Site|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000376755.1_Splice_Site|RBM3_ENST00000466764.1_Splice_Site	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)	p.?(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TAATGGCAGGTGGGTAGCCAA	0.517																																					.													.	RBM3-131	1	Unknown(1)	ovary(1)	c.413+2T>G						.						59.0	56.0	57.0					X																	48434994		2193	4272	6465	SO:0001630	splice_region_variant	5935	exon5			GGCAGGTGGGTAG	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.413+2T>G	X.37:g.48434994T>G		31	5		27	5	NM_006743	0	0	0	0	0		Splice_Site	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	t	11.97	1.798592	0.31777	.	.	ENSG00000102317	ENST00000376759;ENST00000430348;ENST00000376755;ENST00000354480	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3004	0.43648	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM3	48319938	1.000000	0.71417	0.999000	0.59377	0.387000	0.30353	2.025000	0.41059	1.792000	0.52537	0.481000	0.45027	.	.		0.517	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	Intron
MCAM	4162	broad.mit.edu	37	11	119187759	119187761	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr11:119187759_119187761delCAG	ENST00000264036.4	-	1	65_67	c.51_53delCTG	c.(49-54)tgctgt>tgt	p.17_18CC>C	MCAM_ENST00000392814.1_5'Flank|MCAM_ENST00000530144.2_Intron	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	17					anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GACGCGAGGACAGCAGCAGCAGG	0.744																																					p.17_18del													.	MCAM-137	0			c.51_53del						.			6,3438		0,6,1716						1.2	1.0			7	14,6786		2,10,3388	no	coding	MCAM	NM_006500.2		2,16,5104	A1A1,A1R,RR		0.2059,0.1742,0.1952				20,10224				SO:0001651	inframe_deletion	4162	exon1			CGAGGACAGCAGC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.51_53delCTG	11.37:g.119187768_119187770delCAG	ENSP00000264036:p.Cys18del	10	0		7	2	NM_006500	0	0	0	0	0	O95812|Q59E86|Q6PHR3|Q6ZTR2	In_Frame_Del	DEL	ENST00000264036.4	37	CCDS31690.1																																																																																			.		0.744	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
ADAMTS7	11173	hgsc.bcm.edu	37	15	79058942	79058944	+	In_Frame_Del	DEL	GCA	GCA	-	rs529497330|rs201562030|rs543268667	byFrequency	TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	GCA	GCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr15:79058942_79058944delGCA	ENST00000388820.4	-	19	3519_3521	c.3309_3311delTGC	c.(3307-3312)gctgcg>gcg	p.1103_1104AA>A	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1103					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGTGGAGGGCGCAGCAGGATGGC	0.675																																					p.1103_1104del		.											.	ADAMTS7-226	0			c.3309_3311del						.																																			SO:0001651	inframe_deletion	11173	exon19			.	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3309_3311delTGC	15.37:g.79058945_79058947delGCA	ENSP00000373472:p.Ala1104del	40	0		39	23	NM_014272	0	0	0	0	0	Q14F51|Q6P7J9	In_Frame_Del	DEL	ENST00000388820.4	37	CCDS32303.1																																																																																			.		0.675	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
BPTF	2186	broad.mit.edu	37	17	65905759	65905759	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr17:65905759delA	ENST00000321892.4	+	12	3313	c.3252delA	c.(3250-3252)ccafs	p.P1084fs	BPTF_ENST00000335221.5_Frame_Shift_Del_p.P1084fs|BPTF_ENST00000306378.6_Frame_Shift_Del_p.P958fs|BPTF_ENST00000424123.3_Frame_Shift_Del_p.P945fs			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1084					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CACGAAGTCCAAAAAAAATAA	0.308																																					p.P1084fs													.	BPTF-94	0			c.3252delA						.		,	38,4214		0,38,2088	38.0	40.0	39.0		,	5.6	1.0	17		40	45,8205		3,39,4083	no	frameshift,frameshift	BPTF	NM_182641.3,NM_004459.6	,	3,77,6171	A1A1,A1R,RR		0.5455,0.8937,0.6639	,	,	65905759	83,12419	2202	4299	6501	SO:0001589	frameshift_variant	2186	exon12			AAGTCCAAAAAAA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3252delA	17.37:g.65905759delA	ENSP00000315454:p.Pro1084fs	170	0		248	8	NM_004459	0	0	0	0	0	Q6NX67|Q7Z7D6|Q9UIG2	Frame_Shift_Del	DEL	ENST00000321892.4	37																																																																																				.		0.308	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
PIK3R4	30849	broad.mit.edu;bcgsc.ca	37	3	130425829	130425831	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr3:130425829_130425831delGAG	ENST00000356763.3	-	11	3239_3241	c.2682_2684delCTC	c.(2680-2685)tcctct>tct	p.894_895SS>S		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	894					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AATGCCAGCAGAGGACTCGGAAC	0.502																																					p.894_895del													.	PIK3R4-1471	0			c.2682_2684del						.																																			SO:0001651	inframe_deletion	30849	exon11			CCAGCAGAGGACT	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2682_2684delCTC	3.37:g.130425829_130425831delGAG	ENSP00000349205:p.Ser895del	151	0		114	12	NM_014602	0	0	0	0	0	Q2TBF4	In_Frame_Del	DEL	ENST00000356763.3	37	CCDS3067.1																																																																																			.		0.502	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
COPS4	51138	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	83996480	83996480	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr4:83996480delA	ENST00000264389.2	+	10	1253	c.1118delA	c.(1117-1119)cagfs	p.Q373fs	COPS4_ENST00000503682.1_Frame_Shift_Del_p.Q405fs|COPS4_ENST00000511653.1_3'UTR|COPS4_ENST00000509093.1_Frame_Shift_Del_p.R345fs	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	373					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TGGGATAAGCAGATCCAATCA	0.403																																					p.Q373fs		.											.	COPS4-226	0			c.1118delA						.						87.0	85.0	86.0					4																	83996480		2203	4300	6503	SO:0001589	frameshift_variant	51138	exon10			.	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.1118delA	4.37:g.83996480delA	ENSP00000264389:p.Gln373fs	79	0		71	15	NM_016129	0	0	0	0	0	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Frame_Shift_Del	DEL	ENST00000264389.2	37	CCDS3600.1																																																																																			.		0.403	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
TNRC18	84629	broad.mit.edu	37	7	5352666	5352668	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:5352666_5352668delGAG	ENST00000430969.1	-	27	8202_8204	c.7854_7856delCTC	c.(7852-7857)tcctca>tca	p.2618_2619SS>S	TNRC18_ENST00000399537.4_In_Frame_Del_p.2618_2619SS>S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2618	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		ggaggaggatgaggaggaggagg	0.66																																					p.2618_2619del													.	TNRC18-46	0			c.7854_7856del						.																																			SO:0001651	inframe_deletion	84629	exon27			GAGGATGAGGAGG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7854_7856delCTC	7.37:g.5352675_5352677delGAG	ENSP00000395538:p.Ser2671del	4	0		6	1	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	In_Frame_Del	DEL	ENST00000430969.1	37	CCDS47534.1																																																																																			.		0.660	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
Unknown	0	broad.mit.edu	37	1	144615250	144615251	+	IGR	INS	-	-	AA	rs202042060|rs10625215	byFrequency	TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr1:144615250_144615251insAA								RP11-640M9.2 (9359 upstream) : NBPF9 (196492 downstream)																							ACCTCAAAGAGATGTTTTCTAA	0.46														497	0.0992412	0.0076	0.1009	5008	,	,		14193	0.2589		0.0606	False		,,,				2504	0.0971				.													.	.	0			.						.																																			SO:0001628	intergenic_variant	400818	.			CAAAGAGATGTTT																													1.37:g.144615250_144615251insAA		5	0		8	3	.	0	0	0	0	0		Frame_Shift_Ins	INS		37																																																																																				-|0.759;AA|0.241	0	0.460								
LAMB1	3912	broad.mit.edu	37	7	107569606	107569607	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:107569606_107569607TC>AA	ENST00000222399.6	-	31	5019_5020	c.4789_4790GA>TT	c.(4789-4791)GAa>TTa	p.E1597L	LAMB1_ENST00000393561.1_Missense_Mutation_p.E1621L|LAMB1_ENST00000474380.1_5'Flank	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1597	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TTCCAGAGCTTCCTTTACCATA	0.401																																					p.E1621L													.	LAMB1-97	0			c.G4789T						.																																			SO:0001583	missense	3912	exon31			GAGCTTCCTTTAC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4789_4790delinsAA	7.37:g.107569606_107569607delinsAA	ENSP00000222399:p.Glu1597Leu	208	1		254	7	NM_002291	0	0	0	0	0	Q14D91	Missense_Mutation	DNP	ENST00000222399.6	37	CCDS5750.1																																																																																			.		0.401	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
