#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19482811	19482811	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:19482811G>A	ENST00000375254.3	-	42	6053	c.6026C>T	c.(6025-6027)cCt>cTt	p.P2009L	UBR4_ENST00000375226.2_Missense_Mutation_p.P2009L|UBR4_ENST00000375267.2_Missense_Mutation_p.P2009L|UBR4_ENST00000375217.2_Missense_Mutation_p.P2009L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2009					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGTGAACCAGGTAACCACAC	0.438																																					p.P2009L		.											.	UBR4-612	0			c.C6026T						.						139.0	122.0	128.0					1																	19482811		2203	4300	6503	SO:0001583	missense	23352	exon42			GAACCAGGTAACC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6026C>T	1.37:g.19482811G>A	ENSP00000364403:p.Pro2009Leu	474	1		418	155	NM_020765	0	0	6	9	3	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	34	5.380190	0.95945	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;2.69	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.63402	0.2508	M	0.87827	2.91	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.68800	-0.5313	10	0.87932	D	0	.	19.3843	0.94550	0.0:0.0:1.0:0.0	.	2009	Q5T4S7	UBR4_HUMAN	L	2009;2009;2009;2009;719;1225	ENSP00000364403:P2009L;ENSP00000364416:P2009L;ENSP00000364365:P2009L;ENSP00000364374:P2009L;ENSP00000404897:P719L	ENSP00000364365:P2009L	P	-	2	0	UBR4	19355398	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.969000	0.93411	2.814000	0.96858	0.591000	0.81541	CCT	.		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
ADPRHL2	54936	broad.mit.edu	37	1	36557328	36557328	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:36557328C>T	ENST00000373178.4	+	3	448	c.418C>T	c.(418-420)Cgg>Tgg	p.R140W		NM_017825.2	NP_060295.1	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	140						mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(ADP-ribose) glycohydrolase activity (GO:0004649)			cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|pancreas(1)	8		Myeloproliferative disorder(586;0.0393)				TGAGCCTGCCCGGGCCCAGTT	0.562																																					p.R140W													.	ADPRHL2-91	0			c.C418T						.						78.0	82.0	81.0					1																	36557328		2203	4300	6503	SO:0001583	missense	54936	exon3			CCTGCCCGGGCCC	AJ427295	CCDS402.1	1p34.3	2008-02-05			ENSG00000116863	ENSG00000116863			21304	protein-coding gene	gene with protein product		610624				12070318, 16278211	Standard	NM_017825		Approved	ARH3, FLJ20446	uc001bzt.3	Q9NX46	OTTHUMG00000007628	ENST00000373178.4:c.418C>T	1.37:g.36557328C>T	ENSP00000362273:p.Arg140Trp	111	1		104	5	NM_017825	0	0	20	20	0	Q53G94|Q6IAB8|Q9BY47	Missense_Mutation	SNP	ENST00000373178.4	37	CCDS402.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703805	0.68501	.	.	ENSG00000116863	ENST00000373178;ENST00000540867	T	0.31247	1.5	5.35	3.38	0.38709	.	0.105277	0.64402	D	0.000009	T	0.52306	0.1726	M	0.71296	2.17	0.33910	D	0.639556	D	0.89917	1.0	D	0.75484	0.986	T	0.65158	-0.6236	10	0.46703	T	0.11	-17.9963	13.2367	0.59972	0.5987:0.4013:0.0:0.0	.	140	Q9NX46	ARHL2_HUMAN	W	140;60	ENSP00000362273:R140W	ENSP00000362273:R140W	R	+	1	2	ADPRHL2	36329915	0.841000	0.29509	0.996000	0.52242	0.970000	0.65996	1.654000	0.37334	0.544000	0.28883	0.563000	0.77884	CGG	.		0.562	ADPRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020199.1	NM_017825	
STK40	83931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36820910	36820910	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:36820910A>T	ENST00000373129.3	-	6	873	c.467T>A	c.(466-468)cTc>cAc	p.L156H	STK40_ENST00000373132.3_Missense_Mutation_p.L156H|STK40_ENST00000373130.3_Missense_Mutation_p.L161H|STK40_ENST00000359297.2_Missense_Mutation_p.L156H|STK40_ENST00000482458.1_5'UTR	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	156	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CAGGTTGATGAGGTCAGCGGT	0.557																																					p.L156H		.											.	STK40-83	0			c.T467A						.						278.0	239.0	252.0					1																	36820910		2203	4300	6503	SO:0001583	missense	83931	exon6			TTGATGAGGTCAG	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.467T>A	1.37:g.36820910A>T	ENSP00000362221:p.Leu156His	215	0		187	66	NM_032017	0	0	6	7	1	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	37	CCDS407.1	.	.	.	.	.	.	.	.	.	.	A	29.4	5.006207	0.93287	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	T;T;T;T	0.69175	-0.38;1.96;1.96;-0.38	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.064019	0.64402	D	0.000004	D	0.87200	0.6118	H	0.95043	3.615	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.958;0.975	D	0.90870	0.4745	10	0.87932	D	0	-15.2233	15.5237	0.75885	1.0:0.0:0.0:0.0	.	156;161;156	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	H	156;156;161;156	ENSP00000362221:L156H;ENSP00000352245:L156H;ENSP00000362222:L161H;ENSP00000362224:L156H	ENSP00000352245:L156H	L	-	2	0	STK40	36593497	1.000000	0.71417	0.999000	0.59377	0.926000	0.56050	8.857000	0.92250	2.263000	0.75096	0.379000	0.24179	CTC	.		0.557	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017	
KIAA0754	643314	broad.mit.edu	37	1	39880152	39880152	+	Silent	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:39880152A>T	ENST00000530275.1	+	1	4002	c.3807A>T	c.(3805-3807)gtA>gtT	p.V1269V	MACF1_ENST00000564288.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	1269										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGATGAGGTAATTGTCCATT	0.443																																					p.V1405V													.	.	0			c.A4215T						.						78.0	80.0	79.0					1																	39880152		1941	4140	6081	SO:0001819	synonymous_variant	643314	exon1			TGAGGTAATTGTC			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.3807A>T	1.37:g.39880152A>T		67	2		89	22	NM_015038	0	0	0	0	0	E9PMC2|Q6ZSB2	Silent	SNP	ENST00000530275.1	37																																																																																				.		0.443	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
HSPB11	51668	broad.mit.edu;bcgsc.ca	37	1	54395757	54395757	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:54395757G>A	ENST00000194214.5	-	3	549	c.160C>T	c.(160-162)Cac>Tac	p.H54Y	HSPB11_ENST00000371377.3_Missense_Mutation_p.H54Y|HSPB11_ENST00000489675.1_5'Flank|HSPB11_ENST00000371376.1_Missense_Mutation_p.H54Y|HSPB11_ENST00000371378.2_Missense_Mutation_p.H54Y	NM_016126.2	NP_057210.2	Q9Y547	IFT25_HUMAN	heat shock protein family B (small), member 11	54					cell adhesion (GO:0007155)|heart development (GO:0007507)|left/right axis specification (GO:0070986)|lung development (GO:0030324)|protein transport (GO:0015031)|response to stress (GO:0006950)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle B (GO:0030992)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	9						ACATGTTTGTGGAAACAAATA	0.318																																					p.H54Y													.	HSPB11-90	0			c.C160T						.						91.0	86.0	88.0					1																	54395757		1801	4066	5867	SO:0001583	missense	51668	exon3			GTTTGTGGAAACA	AF100747	CCDS41341.1	1p32	2014-02-21	2008-06-24	2008-06-24	ENSG00000081870	ENSG00000081870		"""Intraflagellar transport homologs"", ""Heat shock proteins / HSPB"""	25019	protein-coding gene	gene with protein product	"""intraflagellar transport 25 homolog (Chlamydomonas)"""		"""chromosome 1 open reading frame 41"""	C1orf41		11042152, 19253336	Standard	NM_016126		Approved	HSPCO34, PP25, IFT25	uc001cwh.3	Q9Y547	OTTHUMG00000008408	ENST00000194214.5:c.160C>T	1.37:g.54395757G>A	ENSP00000194214:p.His54Tyr	73	0		132	5	NM_016126	0	0	10	10	0	A6NG57|D3DQ45|Q9Y684	Missense_Mutation	SNP	ENST00000194214.5	37	CCDS41341.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723851	0.68959	.	.	ENSG00000081870	ENST00000194214;ENST00000371378;ENST00000371377;ENST00000371376	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.96	5.96	0.96718	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.284349	0.38959	N	0.001502	D	0.98286	0.9432	L	0.51422	1.61	0.37457	D	0.915078	P;P	0.52463	0.953;0.871	D;P	0.63793	0.918;0.538	D	0.99932	1.1332	10	0.59425	D	0.04	-15.3098	15.9014	0.79380	0.0:0.0:1.0:0.0	.	54;54	A6NIR2;Q9Y547	.;HSB11_HUMAN	Y	54	ENSP00000194214:H54Y;ENSP00000360429:H54Y;ENSP00000360428:H54Y;ENSP00000360427:H54Y	ENSP00000194214:H54Y	H	-	1	0	HSPB11	54168345	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.202000	0.51067	2.833000	0.97629	0.591000	0.81541	CAC	.		0.318	HSPB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023114.1	NM_016126	
DNAJC6	9829	broad.mit.edu	37	1	65775557	65775557	+	Intron	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:65775557C>T	ENST00000395325.3	+	1	179				DNAJC6_ENST00000371069.4_Silent_p.A43A|DNAJC6_ENST00000263441.7_Intron	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6						cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GAGTGAACGCCGGGGCAGCGG	0.667																																					p.A43A													.	DNAJC6-272	0			c.C129T						.																																			SO:0001627	intron_variant	9829	exon1			GAACGCCGGGGCA	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.22+44942C>T	1.37:g.65775557C>T		47	0		53	20	NM_001256864	0	0	0	0	0	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	ENST00000395325.3	37	CCDS30739.1																																																																																			.		0.667	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109807154	109807154	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:109807154G>A	ENST00000271332.3	+	11	5429	c.5368G>A	c.(5368-5370)Ggc>Agc	p.G1790S		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1790	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGTGGAGCAAGGCTGTAGCCT	0.587																																					p.G1790S	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.G5368A						.						190.0	170.0	177.0					1																	109807154		2203	4300	6503	SO:0001583	missense	1952	exon11			GAGCAAGGCTGTA	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5368G>A	1.37:g.109807154G>A	ENSP00000271332:p.Gly1790Ser	135	0		126	50	NM_001408	0	0	6	10	4	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643501	0.87859	.	.	ENSG00000143126	ENST00000271332	D	0.87179	-2.22	4.79	4.79	0.61399	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	D	0.93190	0.7831	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93620	0.6947	9	0.62326	D	0.03	.	18.0161	0.89241	0.0:0.0:1.0:0.0	.	1790	Q9HCU4	CELR2_HUMAN	S	1790	ENSP00000271332:G1790S	ENSP00000271332:G1790S	G	+	1	0	CELSR2	109608677	1.000000	0.71417	0.996000	0.52242	0.712000	0.41017	9.202000	0.95026	2.504000	0.84457	0.561000	0.74099	GGC	.		0.587	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150531493	150531493	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:150531493G>T	ENST00000369038.2	+	14	2816	c.2615G>T	c.(2614-2616)aGt>aTt	p.S872I	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.S895I|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.S872I|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	872	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGCCTTGGGAGTGGGGCAGCC	0.692																																					p.S872I		.											.	ADAMTSL4-92	0			c.G2615T						.						15.0	19.0	18.0					1																	150531493		2201	4296	6497	SO:0001583	missense	54507	exon16			TTGGGAGTGGGGC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2615G>T	1.37:g.150531493G>T	ENSP00000358034:p.Ser872Ile	21	0		29	19	NM_019032	0	0	2	5	3	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525215	0.64747	.	.	ENSG00000143382	ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T	0.60797	0.16;0.16;0.16	5.63	5.63	0.86233	.	.	.	.	.	T	0.66973	0.2844	L	0.53617	1.68	0.46564	D	0.999104	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.74674	0.981;0.984;0.973	T	0.68315	-0.5441	9	0.62326	D	0.03	.	17.1708	0.86830	0.0:0.0:1.0:0.0	.	833;895;872	B7ZMJ3;F8WAD0;Q6UY14	.;.;ATL4_HUMAN	I	872;410;895;872	ENSP00000271643:S872I;ENSP00000358035:S895I;ENSP00000358034:S872I	ENSP00000271643:S872I	S	+	2	0	ADAMTSL4	148798117	0.765000	0.28485	0.987000	0.45799	0.293000	0.27360	2.637000	0.46553	2.655000	0.90218	0.462000	0.41574	AGT	.		0.692	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
TCHHL1	126637	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152059687	152059687	+	Silent	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:152059687C>T	ENST00000368806.1	-	3	535	c.471G>A	c.(469-471)gtG>gtA	p.V157V		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	157							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCCATGGGTCCACTCTGTTAT	0.453																																					p.V157V													.	TCHHL1-92	0			c.G471A						.						131.0	118.0	122.0					1																	152059687		2203	4300	6503	SO:0001819	synonymous_variant	126637	exon3			TGGGTCCACTCTG		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.471G>A	1.37:g.152059687C>T		180	1		175	54	NM_001008536	0	0	0	0	0	B2RPK8|Q5VTJ9	Silent	SNP	ENST00000368806.1	37	CCDS30857.1																																																																																			.		0.453	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104	
KCNN3	3782	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154744543	154744543	+	Silent	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:154744543C>T	ENST00000271915.4	-	3	1671	c.1356G>A	c.(1354-1356)aaG>aaA	p.K452K	KCNN3_ENST00000358505.2_Silent_p.K139K|KCNN3_ENST00000361147.4_Silent_p.K147K	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	457					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	TCATGAGCGTCTTCATGACAA	0.562																																					p.K452K													.	KCNN3-91	0			c.G1356A						.						141.0	105.0	117.0					1																	154744543		2203	4300	6503	SO:0001819	synonymous_variant	3782	exon3			GAGCGTCTTCATG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1356G>A	1.37:g.154744543C>T		167	1		122	50	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.562	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
ELK4	2005	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	205588957	205588957	+	Intron	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:205588957C>G	ENST00000357992.4	-	3	1420				ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Nonstop_Mutation_p.*406S	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)						cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GGGTAACTTTCACATGACAGT	0.289			T	SLC45A3	prostate																																p.X406S		.		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	ELK4-658	0			c.G1217C						.						48.0	48.0	48.0					1																	205588957		2203	4300	6503	SO:0001627	intron_variant	2005	exon3			AACTTTCACATGA	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.1080+136G>C	1.37:g.205588957C>G		58	0		75	27	NM_021795	0	0	1	1	0	P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	37	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744796	0.30865	.	.	ENSG00000158711	ENST00000289703	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5541	0.61749	0.0:1.0:0.0:0.0	.	.	.	.	S	406	.	.	X	-	2	2	ELK4	203855580	0.000000	0.05858	0.860000	0.33809	0.233000	0.25261	0.118000	0.15605	2.344000	0.79699	0.655000	0.94253	TGA	.		0.289	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
PRKCQ	5588	broad.mit.edu	37	10	6557067	6557067	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:6557067T>G	ENST00000263125.5	-	2	130	c.31A>C	c.(31-33)Aac>Cac	p.N11H	PRKCQ_ENST00000397176.2_Missense_Mutation_p.N11H|PRKCQ_ENST00000539722.1_5'UTR	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	11	C2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CAGTCAAAGTTGGACAAGCCA	0.488																																					p.N11H	Ovarian(50;572 1126 10530 25349 30594)												.	PRKCQ-1380	0			c.A31C						.						54.0	56.0	55.0					10																	6557067		2203	4300	6503	SO:0001583	missense	5588	exon2			CAAAGTTGGACAA	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.31A>C	10.37:g.6557067T>G	ENSP00000263125:p.Asn11His	95	3		106	9	NM_006257	0	0	2	2	0	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742344	0.49151	.	.	ENSG00000065675	ENST00000263125;ENST00000397176	T;T	0.68331	-0.32;-0.26	5.2	3.99	0.46301	C2 calcium/lipid-binding domain, CaLB (1);	0.240987	0.44097	D	0.000499	T	0.52025	0.1709	N	0.22421	0.69	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.11329	0.006;0.003	T	0.52668	-0.8545	10	0.49607	T	0.09	.	12.6635	0.56828	0.0:0.0:0.1369:0.8631	.	11;11	Q04759-2;Q04759	.;KPCT_HUMAN	H	11	ENSP00000263125:N11H;ENSP00000380361:N11H	ENSP00000263125:N11H	N	-	1	0	PRKCQ	6597073	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.294000	0.59043	2.090000	0.63153	0.460000	0.39030	AAC	.		0.488	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
PCDH15	65217	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	55600213	55600213	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:55600213C>A	ENST00000320301.6	-	29	4244	c.3850G>T	c.(3850-3852)Gtc>Ttc	p.V1284F	PCDH15_ENST00000437009.1_Missense_Mutation_p.V1213F|PCDH15_ENST00000395433.1_Missense_Mutation_p.V1262F|PCDH15_ENST00000395432.2_Missense_Mutation_p.V1247F|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000409834.1_Missense_Mutation_p.V895F|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.V1284F|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.V1284F|PCDH15_ENST00000373965.2_Missense_Mutation_p.V1291F|PCDH15_ENST00000414778.1_Missense_Mutation_p.V1289F|PCDH15_ENST00000395445.1_Missense_Mutation_p.V1291F|PCDH15_ENST00000361849.3_Missense_Mutation_p.V1284F	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1284					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCCACTACGACCTTGGCACCA	0.448										HNSCC(58;0.16)																											p.V1289F													.	PCDH15-193	0			c.G3865T						.						100.0	90.0	93.0					10																	55600213		2203	4300	6503	SO:0001583	missense	65217	exon30			CTACGACCTTGGC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3850G>T	10.37:g.55600213C>A	ENSP00000322604:p.Val1284Phe	180	1		109	44	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130044	0.77549	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.65732	0.07;0.11;-0.01;0.01;0.02;-0.12;-0.14;-0.09;-0.14;-0.16;-0.17	5.43	5.43	0.79202	.	.	.	.	.	T	0.73321	0.3572	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;0.999;0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.999;0.999;0.999;0.998;0.998;0.999;0.999;0.998;0.999;0.999	T	0.75431	-0.3320	9	0.87932	D	0	.	19.1946	0.93682	0.0:1.0:0.0:0.0	.	1262;1284;1284;1289;1213;1247;1284;1284;1291;1291;1284;1289;1284	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	F	1291;1289;1284;1284;895;1291;1247;1284;1262;1284;1284;1289;1213	ENSP00000363076:V1291F;ENSP00000410304:V1289F;ENSP00000378826:V1284F;ENSP00000386693:V895F;ENSP00000378832:V1291F;ENSP00000378820:V1247F;ENSP00000354950:V1284F;ENSP00000378821:V1262F;ENSP00000322604:V1284F;ENSP00000378818:V1284F;ENSP00000412628:V1213F	ENSP00000322604:V1284F	V	-	1	0	PCDH15	55270219	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	4.762000	0.62250	2.703000	0.92315	0.579000	0.79373	GTC	.		0.448	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
NRG3	10718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	83635808	83635808	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:83635808T>C	ENST00000404547.1	+	1	712	c.712T>C	c.(712-714)Tct>Cct	p.S238P	NRG3_ENST00000404576.2_5'Flank|NRG3_ENST00000372142.2_5'Flank|NRG3_ENST00000556918.1_5'Flank|NRG3_ENST00000372141.2_Missense_Mutation_p.S238P			P56975	NRG3_HUMAN	neuregulin 3	238	Ser/Thr-rich.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CCTTCACGATTCTACTCCCTC	0.602																																					p.S238P		.											.	NRG3-522	0			c.T712C						.						100.0	74.0	83.0					10																	83635808		2203	4300	6503	SO:0001583	missense	10718	exon1			CACGATTCTACTC	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.712T>C	10.37:g.83635808T>C	ENSP00000384796:p.Ser238Pro	125	0		150	62	NM_001165972	0	0	0	0	0	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.288753	0.59976	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287	T;T	0.32515	1.45;1.46	4.14	4.14	0.48551	.	0.174325	0.27831	N	0.017667	T	0.35913	0.0948	L	0.36672	1.1	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.54759	0.76;0.76	T	0.13282	-1.0515	10	0.59425	D	0.04	-18.5043	11.474	0.50286	0.0:0.0:0.0:1.0	.	238;238	B9EGV5;P56975-4	.;.	P	238	ENSP00000361214:S238P;ENSP00000384796:S238P	ENSP00000361214:S238P	S	+	1	0	NRG3	83625788	0.998000	0.40836	0.059000	0.19551	0.993000	0.82548	5.633000	0.67825	1.879000	0.54435	0.529000	0.55759	TCT	.		0.602	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
KIF11	3832	bcgsc.ca	37	10	94373230	94373230	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:94373230G>A	ENST00000260731.3	+	8	976	c.886G>A	c.(886-888)Gga>Aga	p.G296R		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	296	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTTGACTTTGGGAAGGGTCAT	0.438																																					p.G296R	Colon(47;212 1003 2764 4062 8431)												.	KIF11-227	0			c.G886A						.						96.0	96.0	96.0					10																	94373230		2203	4300	6503	SO:0001583	missense	3832	exon8			ACTTTGGGAAGGG	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.886G>A	10.37:g.94373230G>A	ENSP00000260731:p.Gly296Arg	61	0		66	4	NM_004523	0	0	0	0	0	A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	ENST00000260731.3	37	CCDS7422.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984191	0.93044	.	.	ENSG00000138160	ENST00000260731	D	0.88201	-2.35	5.58	5.58	0.84498	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.96090	0.8726	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96656	0.9485	10	0.87932	D	0	.	19.579	0.95458	0.0:0.0:1.0:0.0	.	296	P52732	KIF11_HUMAN	R	296	ENSP00000260731:G296R	ENSP00000260731:G296R	G	+	1	0	KIF11	94363210	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.732000	0.98816	2.617000	0.88574	0.591000	0.81541	GGA	.		0.438	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
CYP2C8	1558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	96818110	96818110	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:96818110G>C	ENST00000371270.3	-	5	895	c.801C>G	c.(799-801)ttC>ttG	p.F267L	CYP2C8_ENST00000535898.1_Missense_Mutation_p.F165L|CYP2C8_ENST00000539050.1_Missense_Mutation_p.F181L	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	267					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	TTTTGATCAGGAAGCAATCGA	0.353																																					p.F267L		.											.	CYP2C8-90	0			c.C801G						.						163.0	145.0	151.0					10																	96818110		2203	4300	6503	SO:0001583	missense	1558	exon5			GATCAGGAAGCAA	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.801C>G	10.37:g.96818110G>C	ENSP00000360317:p.Phe267Leu	68	0		121	48	NM_000770	0	0	0	0	0	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	37	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557052	0.27827	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.06687	3.27;3.27;3.27	4.17	-0.451	0.12214	.	0.000000	0.85682	U	0.000000	T	0.07638	0.0192	L	0.29908	0.895	0.29573	N	0.849721	P;P;P;P	0.50617	0.922;0.937;0.779;0.937	P;P;P;P	0.50109	0.459;0.594;0.631;0.49	T	0.16424	-1.0403	10	0.49607	T	0.09	.	4.5328	0.12013	0.2874:0.0:0.5591:0.1535	.	181;165;235;267	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	L	267;234;165;181	ENSP00000360317:F267L;ENSP00000445062:F165L;ENSP00000442343:F181L	ENSP00000360317:F267L	F	-	3	2	CYP2C8	96808100	0.998000	0.40836	0.741000	0.31004	0.173000	0.22820	0.270000	0.18607	0.011000	0.14865	0.305000	0.20034	TTC	.		0.353	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
SORBS1	10580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	97096528	97096528	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:97096528T>G	ENST00000361941.3	-	28	3415	c.3389A>C	c.(3388-3390)aAa>aCa	p.K1130T	SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371227.4_Missense_Mutation_p.K1084T|SORBS1_ENST00000277982.5_Missense_Mutation_p.K989T|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.K989T|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371247.2_Missense_Mutation_p.K1130T	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		CCTCTCTGCTTTCCTCTCATA	0.552																																					p.K1130T		.											.	SORBS1-155	0			c.A3389C						.						74.0	71.0	72.0					10																	97096528		2203	4300	6503	SO:0001583	missense	10580	exon28			TCTGCTTTCCTCT	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3389A>C	10.37:g.97096528T>G	ENSP00000355136:p.Lys1130Thr	93	0		116	50	NM_001034954	0	0	0	0	0		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.813778	0.32053	.	.	ENSG00000095637	ENST00000371247;ENST00000371227;ENST00000371246;ENST00000361941;ENST00000277982	T;T;T;T;T	0.08984	3.09;3.03;3.38;3.09;3.38	5.58	3.22	0.36961	.	0.488362	0.17388	N	0.176042	T	0.04815	0.0130	N	0.19112	0.55	0.80722	D	1	B;B;B	0.30281	0.275;0.079;0.275	B;B;B	0.27076	0.076;0.035;0.076	T	0.46331	-0.9199	10	0.15499	T	0.54	-0.5924	7.5752	0.27931	0.0:0.1794:0.0:0.8206	.	1084;1130;989	Q9BX66-11;Q9BX66;Q9BX66-2	.;SRBS1_HUMAN;.	T	1130;1084;989;1130;989	ENSP00000360293:K1130T;ENSP00000360271:K1084T;ENSP00000360292:K989T;ENSP00000355136:K1130T;ENSP00000277982:K989T	ENSP00000277982:K989T	K	-	2	0	SORBS1	97086518	0.873000	0.30073	0.996000	0.52242	0.854000	0.48673	0.144000	0.16135	0.406000	0.25560	0.459000	0.35465	AAA	.		0.552	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
MARK2	2011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63671476	63671476	+	Silent	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:63671476C>G	ENST00000509502.2	+	15	1894	c.1431C>G	c.(1429-1431)tcC>tcG	p.S477S	MARK2_ENST00000408948.3_Intron|MARK2_ENST00000350490.7_Intron|MARK2_ENST00000402010.2_Silent_p.S511S|MARK2_ENST00000425897.2_Intron|MARK2_ENST00000508192.1_Intron|MARK2_ENST00000377810.3_Intron|MARK2_ENST00000377809.4_Silent_p.S511S|MARK2_ENST00000502399.3_Silent_p.S510S|MARK2_ENST00000315032.8_Silent_p.S511S|MARK2_ENST00000361128.5_Intron|MARK2_ENST00000513765.2_Silent_p.S478S|MARK2_ENST00000413835.2_Intron	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						TGCCAGGGTCCCGGGCCTCCA	0.652																																					p.S511S		.											.	MARK2-766	0			c.C1533G						.						39.0	41.0	40.0					11																	63671476		1818	4074	5892	SO:0001819	synonymous_variant	2011	exon15			AGGGTCCCGGGCC	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.1431C>G	11.37:g.63671476C>G		24	0		38	13	NM_001039469	0	0	1	3	2		Silent	SNP	ENST00000509502.2	37	CCDS41665.1																																																																																			.		0.652	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	
DPF2	5977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65107956	65107956	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:65107956C>G	ENST00000528416.1	+	2	266	c.133C>G	c.(133-135)Cag>Gag	p.Q45E	DPF2_ENST00000415073.2_Missense_Mutation_p.Q45E|DPF2_ENST00000252268.4_Missense_Mutation_p.Q45E|DPF2_ENST00000532264.1_Intron	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	45					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						CTTGGACTCACAGACCGGAGT	0.562																																					p.Q45E		.											.	DPF2-91	0			c.C133G						.						102.0	103.0	103.0					11																	65107956		2201	4297	6498	SO:0001583	missense	5977	exon2			GACTCACAGACCG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.133C>G	11.37:g.65107956C>G	ENSP00000436901:p.Gln45Glu	165	0		137	53	NM_006268	0	0	9	13	4	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118519	0.94385	.	.	ENSG00000133884	ENST00000528416;ENST00000415073;ENST00000252268	D;D;D	0.92647	-3.06;-3.06;-3.08	5.52	5.52	0.82312	.	0.000000	0.35870	N	0.002937	D	0.96269	0.8783	M	0.83953	2.67	0.80722	D	1	D;D;D	0.76494	0.963;0.999;0.963	D;D;D	0.91635	0.973;0.999;0.973	D	0.96656	0.9485	10	0.87932	D	0	-25.3906	16.9414	0.86219	0.0:1.0:0.0:0.0	.	45;45;45	B4DT58;E9PN04;Q92785	.;.;REQU_HUMAN	E	45	ENSP00000436901:Q45E;ENSP00000399714:Q45E;ENSP00000252268:Q45E	ENSP00000252268:Q45E	Q	+	1	0	DPF2	64864532	1.000000	0.71417	0.968000	0.41197	0.994000	0.84299	7.818000	0.86416	2.588000	0.87417	0.655000	0.94253	CAG	.		0.562	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
ADRBK1	156	bcgsc.ca	37	11	67048958	67048958	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:67048958C>T	ENST00000308595.5	+	9	966	c.676C>T	c.(676-678)Cgc>Tgc	p.R226C	ADRBK1_ENST00000526285.1_Missense_Mutation_p.R226C	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	GGACAAAAAGCGCATCAAGAT	0.657																																					p.R226C													.	ADRBK1-521	0			c.C676T						.						76.0	69.0	71.0					11																	67048958		2200	4295	6495	SO:0001583	missense	156	exon9			AAAAAGCGCATCA	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.676C>T	11.37:g.67048958C>T	ENSP00000312262:p.Arg226Cys	45	0		62	4	NM_001619	0	0	13	13	0	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.716682	0.48622	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	T;T	0.66815	-0.23;-0.23	5.0	4.08	0.47627	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	T	0.79667	0.4485	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.81805	-0.0764	10	0.87932	D	0	-13.2398	12.8248	0.57714	0.2975:0.7025:0.0:0.0	.	226;226	P25098;E9PRV7	ARBK1_HUMAN;.	C	226	ENSP00000312262:R226C;ENSP00000434126:R226C	ENSP00000312262:R226C	R	+	1	0	ADRBK1	66805534	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	2.696000	0.47052	1.225000	0.43566	-0.282000	0.10007	CGC	.		0.657	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	92599961	92599961	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:92599961T>A	ENST00000298047.6	+	21	11730	c.11713T>A	c.(11713-11715)Ttg>Atg	p.L3905M	FAT3_ENST00000525166.1_Missense_Mutation_p.L3755M|FAT3_ENST00000409404.2_Missense_Mutation_p.L3905M|FAT3_ENST00000533797.1_Missense_Mutation_p.L240M			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3905	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCCTGGAATCTTGGGCATCTC	0.592										TCGA Ovarian(4;0.039)																											p.L3905M		.											.	FAT3-73	0			c.T11713A						.						29.0	34.0	32.0					11																	92599961		2046	4196	6242	SO:0001583	missense	120114	exon21			GGAATCTTGGGCA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11713T>A	11.37:g.92599961T>A	ENSP00000298047:p.Leu3905Met	88	0		102	43	NM_001008781	0	0	0	0	0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	14.78	2.638068	0.47153	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	5.77	-6.79	0.01715	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.65688	0.2715	L	0.35414	1.06	0.80722	D	1	P;P	0.39601	0.68;0.645	B;B	0.43194	0.249;0.411	T	0.61367	-0.7077	9	0.49607	T	0.09	.	24.6348	0.99991	0.0:0.8789:0.0:0.1211	.	3905;3905	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	M	3905;3905;3755;240	ENSP00000298047:L3905M;ENSP00000387040:L3905M;ENSP00000432586:L3755M;ENSP00000436399:L240M	ENSP00000298047:L3905M	L	+	1	2	FAT3	92239609	0.086000	0.21541	0.260000	0.24451	0.815000	0.46073	-0.484000	0.06528	-1.317000	0.02292	-0.379000	0.06801	TTG	.		0.592	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ALKBH8	91801	ucsc.edu	37	11	107423870	107423870	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:107423870T>C	ENST00000428149.2	-	5	710	c.559A>G	c.(559-561)Aac>Gac	p.N187D	ALKBH8_ENST00000429370.1_Missense_Mutation_p.N187D|ALKBH8_ENST00000417449.2_Missense_Mutation_p.N190D|ALKBH8_ENST00000389568.3_Missense_Mutation_p.N187D|ALKBH8_ENST00000530933.1_5'Flank	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	187					cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)			breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		ACATTGTTGTTCTCATAGTGG	0.294																																					p.N187D													.	ALKBH8-68	0			c.A559G						.						143.0	131.0	135.0					11																	107423870		2200	4294	6494	SO:0001583	missense	91801	exon5			TGTTGTTCTCATA	AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.559A>G	11.37:g.107423870T>C	ENSP00000415885:p.Asn187Asp	15	0		38	4	NM_138775	0	0	1	1	0	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	T	20.3	3.961973	0.74016	.	.	ENSG00000137760	ENST00000428149;ENST00000429370;ENST00000389568;ENST00000417449	T;T;T;T	0.30448	2.81;1.53;2.81;2.81	5.52	4.4	0.53042	.	0.097141	0.64402	D	0.000002	T	0.42154	0.1190	M	0.67953	2.075	0.36045	D	0.84038	P	0.45283	0.855	P	0.51582	0.674	T	0.50866	-0.8777	10	0.37606	T	0.19	-14.8904	10.7841	0.46395	0.0:0.0748:0.0:0.9252	.	187	Q96BT7	ALKB8_HUMAN	D	187;187;187;190	ENSP00000415885:N187D;ENSP00000391225:N187D;ENSP00000374219:N187D;ENSP00000397673:N190D	ENSP00000260318:N187D	N	-	1	0	ALKBH8	106929080	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.671000	0.68095	0.922000	0.37019	-0.376000	0.06991	AAC	.		0.294	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775	
CCDC15	80071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	124847425	124847425	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:124847425G>C	ENST00000344762.5	+	6	941	c.682G>C	c.(682-684)Gga>Cga	p.G228R	CCDC15_ENST00000529051.1_Missense_Mutation_p.G228R	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	228						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		AGGAATAAGAGGAGAGTTGCC	0.378																																					p.G228R		.											.	CCDC15-69	0			c.G682C						.						67.0	65.0	66.0					11																	124847425		1828	4076	5904	SO:0001583	missense	80071	exon6			ATAAGAGGAGAGT	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.682G>C	11.37:g.124847425G>C	ENSP00000341684:p.Gly228Arg	24	0		57	19	NM_025004	0	0	0	0	0	Q9H8U7	Missense_Mutation	SNP	ENST00000344762.5	37	CCDS44756.1	.	.	.	.	.	.	.	.	.	.	G	2.444	-0.327892	0.05314	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.31510	1.49;1.57	3.57	0.63	0.17693	.	.	.	.	.	T	0.20455	0.0492	L	0.31926	0.97	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.22591	-1.0212	9	0.46703	T	0.11	-1.5802	5.3366	0.15961	0.3864:0.0:0.6136:0.0	.	228	Q0P6D6	CCD15_HUMAN	R	228	ENSP00000435403:G228R;ENSP00000341684:G228R	ENSP00000341684:G228R	G	+	1	0	CCDC15	124352635	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	0.169000	0.16641	0.314000	0.23086	-0.363000	0.07495	GGA	.		0.378	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004	
STT3A	3703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	125478106	125478106	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:125478106T>G	ENST00000529196.1	+	10	1089	c.883T>G	c.(883-885)Ttt>Gtt	p.F295V	STT3A_ENST00000392708.4_Missense_Mutation_p.F295V|STT3A_ENST00000531491.1_Missense_Mutation_p.F203V			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	295					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TCCACAACAATTTGAAGTTCT	0.507																																					p.F295V		.											.	STT3A-90	0			c.T883G						.						145.0	136.0	139.0					11																	125478106		2201	4299	6500	SO:0001583	missense	3703	exon9			CAACAATTTGAAG	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.883T>G	11.37:g.125478106T>G	ENSP00000436962:p.Phe295Val	105	0		96	43	NM_152713	0	0	6	21	15	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	37	CCDS8458.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	34|34	5.361297|5.361297	0.95877|0.95877	.|.	.|.	ENSG00000134910|ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491|ENST00000526726	.|.	.|.	.|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84561|0.84561	0.5499|0.5499	M|M	0.91818|0.91818	3.245|3.245	0.80722|0.80722	D|D	1|1	P;P;D|.	0.53151|.	0.923;0.925;0.958|.	P;P;P|.	0.59012|.	0.622;0.85;0.85|.	D|D	0.88159|0.88159	0.2856|0.2856	9|5	0.66056|.	D|.	0.02|.	-19.0074|-19.0074	15.5287|15.5287	0.75932|0.75932	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	203;203;295|.	B4DJ24;E9PNQ1;P46977|.	.;.;STT3A_HUMAN|.	V|K	295;295;203|52	.|.	ENSP00000376472:F295V|.	F|N	+|+	1|3	0|2	STT3A|STT3A	124983316|124983316	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	8.040000|8.040000	0.89188|0.89188	2.148000|2.148000	0.66965|0.66965	0.533000|0.533000	0.62120|0.62120	TTT|AAT	.		0.507	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
IQSEC3	440073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	275007	275007	+	Silent	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:275007G>A	ENST00000538872.1	+	11	3040	c.2922G>A	c.(2920-2922)ctG>ctA	p.L974L	IQSEC3_ENST00000382841.2_Silent_p.L671L|IQSEC3_ENST00000326261.4_Silent_p.L974L|RP11-598F7.6_ENST00000537295.1_lincRNA|RP11-598F7.5_ENST00000540136.1_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	974	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TGGAGGACCTGAAGGAGTCCA	0.602																																					p.L974L		.											.	IQSEC3-560	0			c.G2922A						.						80.0	76.0	77.0					12																	275007		2203	4300	6503	SO:0001819	synonymous_variant	440073	exon11			GGACCTGAAGGAG	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2922G>A	12.37:g.275007G>A		143	0		195	100	NM_001170738	0	0	0	0	0	A6NIF2|A6NKV9|Q8TB43	Silent	SNP	ENST00000538872.1	37	CCDS53728.1																																																																																			.		0.602	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
CD163L1	283316	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7527336	7527336	+	Silent	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:7527336G>T	ENST00000313599.3	-	13	3168	c.3111C>A	c.(3109-3111)cgC>cgA	p.R1037R	CD163L1_ENST00000416109.2_Silent_p.R1047R|CD163L1_ENST00000396630.1_Silent_p.R1037R|CD163L1_ENST00000544331.1_5'Flank			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1037	SRCR 10. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CATCCACTAGGCGGAGCCGTT	0.522											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1037R													.	CD163L1-100	0			c.C3111A						.						32.0	30.0	31.0					12																	7527336		2203	4300	6503	SO:0001819	synonymous_variant	283316	exon13			CACTAGGCGGAGC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3111C>A	12.37:g.7527336G>T		142	1	642	183	53	NM_174941	0	0	0	0	0	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	37	CCDS8577.1																																																																																			.		0.522	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
SCAF11	9169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46342224	46342224	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:46342224T>C	ENST00000369367.3	-	5	627	c.394A>G	c.(394-396)Ata>Gta	p.I132V	SCAF11_ENST00000419565.2_Missense_Mutation_p.I132V	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	132					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						ACTAACCTTATACAGCTTTTA	0.308																																					p.I132V		.											.	SCAF11-93	0			c.A394G						.						116.0	104.0	108.0					12																	46342224		1804	4076	5880	SO:0001583	missense	9169	exon5			ACCTTATACAGCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.394A>G	12.37:g.46342224T>C	ENSP00000358374:p.Ile132Val	25	0		25	13	NM_004719	0	0	0	0	0	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	0.096	-1.159474	0.01686	.	.	ENSG00000139218	ENST00000369367;ENST00000419565;ENST00000547018	T;T;T	0.40756	1.02;1.02;1.02	5.76	2.03	0.26663	.	2.058940	0.02882	U	0.132917	T	0.21103	0.0508	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21895	-1.0232	10	0.10377	T	0.69	.	7.6398	0.28288	0.0:0.2476:0.0:0.7524	.	132	Q99590	SCAFB_HUMAN	V	132;132;72	ENSP00000358374:I132V;ENSP00000413036:I132V;ENSP00000446746:I72V	ENSP00000358374:I132V	I	-	1	0	SCAF11	44628491	0.005000	0.15991	0.024000	0.17045	0.748000	0.42578	-0.080000	0.11339	0.095000	0.17434	0.460000	0.39030	ATA	.		0.308	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
MTERF2	80298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	107371368	107371368	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:107371368A>C	ENST00000552029.1	-	2	3193	c.1125T>G	c.(1123-1125)ttT>ttG	p.F375L	C12orf23_ENST00000551237.1_Intron|MTERFD3_ENST00000240050.4_Missense_Mutation_p.F375L|MTERFD3_ENST00000392830.2_Missense_Mutation_p.F375L			Q49AM1	MTEF2_HUMAN		375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						CCACAGGGTTAAATAATGGCC	0.353																																					p.F375L		.											.	MTERFD3-68	0			c.T1125G						.						114.0	112.0	113.0					12																	107371368		2202	4300	6502	SO:0001583	missense	80298	exon3			AGGGTTAAATAAT																												ENST00000552029.1:c.1125T>G	12.37:g.107371368A>C	ENSP00000447651:p.Phe375Leu	54	0		124	68	NM_001033050	0	0	6	8	2	Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	ENST00000552029.1	37	CCDS9111.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167376	0.78339	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029	T;T;T	0.26373	1.74;1.74;1.74	5.95	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.33614	0.0869	M	0.63843	1.955	0.58432	D	0.999997	P	0.48503	0.911	P	0.49387	0.609	T	0.11867	-1.0570	10	0.87932	D	0	7.5321	8.7341	0.34516	0.859:0.0:0.141:0.0	.	375	Q49AM1	MTER3_HUMAN	L	375	ENSP00000376575:F375L;ENSP00000240050:F375L;ENSP00000447651:F375L	ENSP00000240050:F375L	F	-	3	2	MTERFD3	105895498	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.017000	0.64047	2.272000	0.75746	0.460000	0.39030	TTT	.		0.353	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406835.1		
DIABLO	56616	bcgsc.ca	37	12	122710521	122710521	+	Missense_Mutation	SNP	G	G	A	rs373013757		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:122710521G>A	ENST00000443649.3	-	2	858	c.41C>T	c.(40-42)tCa>tTa	p.S14L	DIABLO_ENST00000413918.1_Missense_Mutation_p.S14L|DIABLO_ENST00000464942.2_5'UTR|RP11-512M8.5_ENST00000535844.1_Intron|DIABLO_ENST00000475784.1_5'Flank|DIABLO_ENST00000353548.6_Missense_Mutation_p.S14L|DIABLO_ENST00000267169.6_5'UTR	NM_019887.4	NP_063940.1	Q9NR28	DBLOH_HUMAN	diablo, IAP-binding mitochondrial protein	14					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)				breast(1)|endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	7	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		CCTGAAGAATGAAGTTACGCT	0.682													g|||	1	0.000199681	0.0008	0.0	5008	,	,		11936	0.0		0.0	False		,,,				2504	0.0				p.S14L													.	DIABLO-659	0			c.C41T						.		LEU/SER,LEU/SER	1,4399		0,1,2199	19.0	17.0	18.0		41,41	1.8	0.0	12		18	0,8578		0,0,4289	no	missense,missense	DIABLO	NM_138929.3,NM_019887.4	145,145	0,1,6488	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	14/196,14/240	122710521	1,12977	2200	4289	6489	SO:0001583	missense	56616	exon2			AAGAATGAAGTTA	AF262240	CCDS9228.1, CCDS9229.1, CCDS73541.1	12q24.31	2011-08-02	2011-03-11		ENSG00000184047	ENSG00000184047			21528	protein-coding gene	gene with protein product	"""second mitochondria-derived activator of caspase"""	605219				12749848, 17237824, 21722859	Standard	NM_019887		Approved	SMAC, DIABLO-S, FLJ25049, FLJ10537, DFNA64	uc010tab.2	Q9NR28	OTTHUMG00000157014	ENST00000443649.3:c.41C>T	12.37:g.122710521G>A	ENSP00000398495:p.Ser14Leu	33	0		52	4	NM_138929	0	0	1	1	0	B2RDQ0|Q6W3F3|Q96LV0|Q9BT11|Q9HAV6	Missense_Mutation	SNP	ENST00000443649.3	37	CCDS9228.1	.	.	.	.	.	.	.	.	.	.	g	8.145	0.786089	0.16189	2.27E-4	0.0	ENSG00000184047	ENST00000413918;ENST00000443649;ENST00000353548	T;T;T	0.74947	-0.89;-0.89;-0.89	4.66	1.81	0.25067	.	0.737030	0.13496	N	0.383642	T	0.61578	0.2358	L	0.44542	1.39	0.09310	N	1	B;B	0.34103	0.437;0.053	B;B	0.27608	0.074;0.081	T	0.53301	-0.8458	10	0.87932	D	0	2.2226	7.2325	0.26051	0.2852:0.0:0.7148:0.0	.	14;14	Q6W3F3;Q9NR28	.;DBLOH_HUMAN	L	14	ENSP00000411638:S14L;ENSP00000398495:S14L;ENSP00000320343:S14L	ENSP00000339963:S14L	S	-	2	0	DIABLO	121276474	0.024000	0.19004	0.000000	0.03702	0.001000	0.01503	0.692000	0.25482	0.201000	0.20466	-0.342000	0.07992	TCA	.		0.682	DIABLO-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347102.2	NM_019887	
MMP17	4326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132334421	132334421	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr12:132334421C>T	ENST00000360564.1	+	9	1381	c.1279C>T	c.(1279-1281)Ccg>Tcg	p.P427S	MMP17_ENST00000535291.1_Missense_Mutation_p.P343S|MMP17_ENST00000535004.1_Intron	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	427					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CTTCAGCCTCCCGCCTGGCGG	0.587																																					p.P427S		.											.	MMP17-226	0			c.C1279T						.						105.0	109.0	108.0					12																	132334421		2203	4300	6503	SO:0001583	missense	4326	exon9			AGCCTCCCGCCTG	X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.1279C>T	12.37:g.132334421C>T	ENSP00000353767:p.Pro427Ser	217	0		270	85	NM_016155	0	0	0	0	0	Q14850	Missense_Mutation	SNP	ENST00000360564.1	37	CCDS31927.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629492	0.87660	.	.	ENSG00000198598	ENST00000360564;ENST00000535291;ENST00000534865;ENST00000542648	T;T;T;T	0.04603	3.59;3.59;3.59;3.59	4.48	4.48	0.54585	Hemopexin/matrixin (2);	0.064020	0.64402	D	0.000006	T	0.23492	0.0568	M	0.83483	2.645	0.80722	D	1	D	0.65815	0.995	D	0.68039	0.955	T	0.04509	-1.0946	10	0.72032	D	0.01	.	17.1756	0.86841	0.0:1.0:0.0:0.0	.	427	Q9ULZ9	MMP17_HUMAN	S	427;343;268;57	ENSP00000353767:P427S;ENSP00000441106:P343S;ENSP00000442104:P268S;ENSP00000439542:P57S	ENSP00000353767:P427S	P	+	1	0	MMP17	130900374	1.000000	0.71417	0.995000	0.50966	0.701000	0.40568	7.727000	0.84838	2.054000	0.61138	0.471000	0.43371	CCG	.		0.587	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397757.1	NM_016155	
SUCLA2	8803	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	48571053	48571053	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr13:48571053C>G	ENST00000378654.3	-	2	252	c.196G>C	c.(196-198)Gaa>Caa	p.E66Q	SUCLA2_ENST00000534875.1_Missense_Mutation_p.E8Q|SUCLA2_ENST00000497202.1_5'UTR|SUCLA2_ENST00000543413.1_Missense_Mutation_p.E8Q|SUCLA2_ENST00000544100.1_5'UTR	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	66	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	ACACCAGCTTCTTGCAATAAT	0.393																																					p.E66Q													.	SUCLA2-226	0			c.G196C						.						126.0	114.0	118.0					13																	48571053		2203	4300	6503	SO:0001583	missense	8803	exon2			CAGCTTCTTGCAA	AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.196G>C	13.37:g.48571053C>G	ENSP00000367923:p.Glu66Gln	115	1		187	55	NM_003850	0	0	6	10	4	B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Missense_Mutation	SNP	ENST00000378654.3	37	CCDS9406.1	.	.	.	.	.	.	.	.	.	.	c	13.38	2.219646	0.39201	.	.	ENSG00000136143	ENST00000378654;ENST00000378645;ENST00000534875;ENST00000543413	T;T;T	0.71817	-0.6;-0.6;-0.6	5.63	5.63	0.86233	ATP-grasp fold (1);ATP-grasp fold, succinyl-CoA synthetase-type (1);	0.109463	0.64402	D	0.000002	T	0.56819	0.2011	N	0.17872	0.535	0.80722	D	1	B;B	0.22276	0.067;0.031	B;B	0.29267	0.1;0.1	T	0.52719	-0.8538	10	0.27785	T	0.31	-27.7135	12.0435	0.53466	0.0:0.9215:0.0:0.0785	.	66;66	E5KS55;Q9P2R7	.;SUCB1_HUMAN	Q	66;44;8;8	ENSP00000367923:E66Q;ENSP00000438182:E8Q;ENSP00000441056:E8Q	ENSP00000367912:E44Q	E	-	1	0	SUCLA2	47469054	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.665000	0.68052	2.656000	0.90262	0.591000	0.81541	GAA	.		0.393	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1		
STK24	8428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99127511	99127511	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr13:99127511G>T	ENST00000376547.3	-	4	613	c.468C>A	c.(466-468)gaC>gaA	p.D156E	STK24_ENST00000397517.2_Missense_Mutation_p.D144E|STK24_ENST00000539966.1_Missense_Mutation_p.D125E	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	156	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TACCTTTAATGTCTCTGTGGA	0.443																																					p.D156E		.											.	STK24-979	0			c.C468A						.						108.0	99.0	102.0					13																	99127511		2203	4300	6503	SO:0001583	missense	8428	exon4			TTTAATGTCTCTG	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.468C>A	13.37:g.99127511G>T	ENSP00000365730:p.Asp156Glu	119	0		123	25	NM_003576	0	0	0	0	0	O14840|Q5JV92	Missense_Mutation	SNP	ENST00000376547.3	37	CCDS9488.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.964958|3.964958	0.74131|0.74131	.|.	.|.	ENSG00000102572|ENSG00000102572	ENST00000397517;ENST00000376547;ENST00000539966;ENST00000376533;ENST00000543110|ENST00000444574	D;D;D|.	0.92911|.	-3.13;-3.13;-3.13|.	4.93|4.93	-3.84|-3.84	0.04256|0.04256	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.64402|.	U|.	0.000020|.	D|D	0.84361|0.84361	0.5455|0.5455	H|H	0.97340|0.97340	3.985|3.985	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	D|D	0.85372|0.85372	0.1114|0.1114	10|5	0.87932|.	D|.	0|.	.|.	11.1814|11.1814	0.48631|0.48631	0.5388:0.0:0.4612:0.0|0.5388:0.0:0.4612:0.0	.|.	125;144;156|.	B4DR80;Q5U0E6;Q9Y6E0|.	.;.;STK24_HUMAN|.	E|N	144;156;125;132;144|62	ENSP00000380651:D144E;ENSP00000365730:D156E;ENSP00000442539:D125E|.	ENSP00000365716:D132E|.	D|H	-|-	3|1	2|0	STK24|STK24	97925512|97925512	0.972000|0.972000	0.33761|0.33761	0.957000|0.957000	0.39632|0.39632	0.955000|0.955000	0.61496|0.61496	0.333000|0.333000	0.19768|0.19768	-0.885000|-0.885000	0.03971|0.03971	-0.390000|-0.390000	0.06520|0.06520	GAC|CAT	.		0.443	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576	
CIDEB	27141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24775587	24775587	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:24775587G>C	ENST00000336557.5	-	6	1631	c.329C>G	c.(328-330)cCt>cGt	p.P110R	CIDEB_ENST00000554411.1_Missense_Mutation_p.P110R|LTB4R2_ENST00000528054.1_5'Flank|CIDEB_ENST00000258807.5_Missense_Mutation_p.P110R|NOP9_ENST00000267425.3_3'UTR			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	110	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		TACCCTTGTAGGGCTCCAGCT	0.562																																					p.P110R		.											.	CIDEB-90	0			c.C329G						.						140.0	111.0	121.0					14																	24775587		2203	4300	6503	SO:0001583	missense	27141	exon5			CTTGTAGGGCTCC	AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.329C>G	14.37:g.24775587G>C	ENSP00000337731:p.Pro110Arg	139	0		150	51	NM_014430	0	0	4	6	2	D3DS73|Q546V8|Q9NNW9	Missense_Mutation	SNP	ENST00000336557.5	37	CCDS32056.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541298	0.45280	.	.	ENSG00000136305	ENST00000554411;ENST00000336557;ENST00000258807;ENST00000541830	T;T;T	0.48522	0.81;0.81;0.81	4.43	4.43	0.53597	Caspase-activated nuclease CIDE-N (2);	0.163888	0.56097	D	0.000036	T	0.67468	0.2896	M	0.87827	2.91	0.80722	D	1	P	0.37038	0.579	P	0.53224	0.721	T	0.72371	-0.4314	10	0.72032	D	0.01	-12.5195	11.7635	0.51918	0.0:0.0:0.8233:0.1767	.	110	Q9UHD4	CIDEB_HUMAN	R	110	ENSP00000451089:P110R;ENSP00000337731:P110R;ENSP00000258807:P110R	ENSP00000258807:P110R	P	-	2	0	CIDEB	23845427	0.995000	0.38212	0.513000	0.27749	0.217000	0.24651	2.732000	0.47352	2.307000	0.77673	0.561000	0.74099	CCT	.		0.562	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1		
ACTR10	55860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	58680398	58680398	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:58680398G>C	ENST00000254286.4	+	6	580	c.500G>C	c.(499-501)gGa>gCa	p.G167A		NM_018477.2	NP_060947.1	Q9NZ32	ARP10_HUMAN	actin-related protein 10 homolog (S. cerevisiae)	167					microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|dynactin complex (GO:0005869)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	13						CTACCCCTAGGAGGAAAAGCT	0.363																																					p.G167A		.											.	ACTR10-90	0			c.G500C						.						68.0	66.0	67.0					14																	58680398		2203	4300	6503	SO:0001583	missense	55860	exon6			CCCTAGGAGGAAA	AF220190	CCDS32090.1	14q23.1	2014-08-08			ENSG00000131966	ENSG00000131966			17372	protein-coding gene	gene with protein product						12857853	Standard	NM_018477		Approved	HARP11, ACTR11, Arp11	uc001xdf.3	Q9NZ32	OTTHUMG00000171049	ENST00000254286.4:c.500G>C	14.37:g.58680398G>C	ENSP00000254286:p.Gly167Ala	34	0		27	16	NM_018477	0	0	10	20	10	Q9H9Y5|Q9NWY2	Missense_Mutation	SNP	ENST00000254286.4	37	CCDS32090.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201439	0.58234	.	.	ENSG00000131966	ENST00000543474;ENST00000254286	D	0.94497	-3.44	5.8	5.8	0.92144	.	0.101891	0.64402	D	0.000002	D	0.88066	0.6337	N	0.13003	0.285	0.80722	D	1	B	0.27166	0.17	B	0.30716	0.119	D	0.83755	0.0211	10	0.02654	T	1	-16.7897	17.2104	0.86929	0.0:0.0:1.0:0.0	.	167	Q9NZ32	ARP10_HUMAN	A	167	ENSP00000254286:G167A	ENSP00000254286:G167A	G	+	2	0	ACTR10	57750151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.523000	0.81856	2.748000	0.94277	0.655000	0.94253	GGA	.		0.363	ACTR10-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411405.1		
SPTLC2	9517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	78036838	78036838	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:78036838C>A	ENST00000216484.2	-	5	838	c.645G>T	c.(643-645)aaG>aaT	p.K215N		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	215					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	GTTCTTCATGCTTGTCCAGGT	0.368																																					p.K215N		.											.	SPTLC2-92	0			c.G645T						.						128.0	115.0	119.0					14																	78036838		2203	4300	6503	SO:0001583	missense	9517	exon5			TTCATGCTTGTCC	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.645G>T	14.37:g.78036838C>A	ENSP00000216484:p.Lys215Asn	64	0		75	34	NM_004863	0	0	0	0	0	Q16685	Missense_Mutation	SNP	ENST00000216484.2	37	CCDS9865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.04|12.04	1.817411|1.817411	0.32145|0.32145	.|.	.|.	ENSG00000100596|ENSG00000100596	ENST00000554901|ENST00000216484	.|D	.|0.90444	.|-2.67	5.49|5.49	1.55|1.55	0.23275|0.23275	.|Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.169622	.|0.56097	.|D	.|0.000039	D|D	0.82559|0.82559	0.5063|0.5063	L|L	0.27053|0.27053	0.805|0.805	0.54753|0.54753	D|D	0.999983|0.999983	.|B	.|0.17038	.|0.02	.|B	.|0.20577	.|0.03	T|T	0.71119|0.71119	-0.4685|-0.4685	5|10	.|0.34782	.|T	.|0.22	-25.2504|-25.2504	10.0683|10.0683	0.42317|0.42317	0.0:0.4966:0.0:0.5034|0.0:0.4966:0.0:0.5034	.|.	.|215	.|O15270	.|SPTC2_HUMAN	S|N	152|215	.|ENSP00000216484:K215N	.|ENSP00000216484:K215N	A|K	-|-	1|3	0|2	SPTLC2|SPTLC2	77106591|77106591	0.942000|0.942000	0.31987|0.31987	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	0.022000|0.022000	0.13511|0.13511	0.071000|0.071000	0.16664|0.16664	-0.137000|-0.137000	0.14449|0.14449	GCA|AAG	.		0.368	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863	
C14orf159	80017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	91681816	91681816	+	Silent	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:91681816C>T	ENST00000523771.1	+	13	2220	c.1617C>T	c.(1615-1617)caC>caT	p.H539H	C14orf159_ENST00000520328.1_Silent_p.H487H|C14orf159_ENST00000523816.1_Silent_p.H539H|C14orf159_ENST00000256324.10_Silent_p.H544H|C14orf159_ENST00000518868.1_Silent_p.H544H|C14orf159_ENST00000521077.2_Silent_p.H504H|C14orf159_ENST00000428926.2_Silent_p.H539H|C14orf159_ENST00000525393.2_Silent_p.H415H|C14orf159_ENST00000412671.2_Silent_p.H544H|C14orf159_ENST00000522322.1_Silent_p.H539H			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	539						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		GTGCTGTCCACAGTCAGTACC	0.552																																					p.H544H		.											.	C14orf159-92	0			c.C1632T						.						117.0	103.0	108.0					14																	91681816		2203	4300	6503	SO:0001819	synonymous_variant	80017	exon13			TGTCCACAGTCAG	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.1617C>T	14.37:g.91681816C>T		117	0		95	39	NM_001102368	0	0	18	42	24	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Silent	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	C	3.836	-0.034789	0.07543	.	.	ENSG00000133943	ENST00000522816	.	.	.	5.34	-3.48	0.04739	.	.	.	.	.	T	0.28466	0.0704	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.34900	-0.9810	4	.	.	.	.	7.4016	0.26967	0.0:0.1871:0.1388:0.6741	.	.	.	.	I	140	.	.	T	+	2	0	C14orf159	90751569	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.541000	0.06099	-0.508000	0.06540	-0.175000	0.13238	ACA	.		0.552	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
AHNAK2	113146	broad.mit.edu	37	14	105406110	105406110	+	Silent	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:105406110A>C	ENST00000333244.5	-	7	15797	c.15678T>G	c.(15676-15678)ggT>ggG	p.G5226G	AHNAK2_ENST00000557457.1_Silent_p.G224G	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5226						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGCTGCTTCACCCCCTGTTG	0.572																																					p.G5226G													.	AHNAK2-47	0			c.T15678G						.						250.0	268.0	262.0					14																	105406110		2031	4186	6217	SO:0001819	synonymous_variant	113146	exon7			TGCTTCACCCCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.15678T>G	14.37:g.105406110A>C		91	9		95	23	NM_138420	0	0	32	32	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.572	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MGA	23269	bcgsc.ca	37	15	42057124	42057124	+	Silent	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr15:42057124C>T	ENST00000570161.1	+	22	7785	c.7785C>T	c.(7783-7785)aaC>aaT	p.N2595N	MGA_ENST00000545763.1_Silent_p.N2386N|MGA_ENST00000389936.4_Silent_p.N2556N|MGA_ENST00000219905.7_Silent_p.N2595N|MGA_ENST00000566586.1_Silent_p.N2386N			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTCTGCCAACCTTGTGATGA	0.453																																					p.N2595N													.	MGA-522	0			c.C7785T						.						108.0	110.0	110.0					15																	42057124		2018	4179	6197	SO:0001819	synonymous_variant	23269	exon23			TGCCAACCTTGTG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7785C>T	15.37:g.42057124C>T		157	0		135	5	NM_001164273	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	CCDS55959.1																																																																																			.		0.453	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
ELL3	80237	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44066413	44066413	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr15:44066413A>C	ENST00000319359.3	-	9	1646	c.1005T>G	c.(1003-1005)atT>atG	p.I335M	SERF2_ENST00000381359.1_5'Flank|ELL3_ENST00000497465.1_5'UTR|RP11-296A16.1_ENST00000417761.2_3'UTR	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	335					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		GAACTCTTTTAATCTCTGCTC	0.512																																					p.I335M													.	ELL3-91	0			c.T1005G						.						97.0	91.0	93.0					15																	44066413		2198	4298	6496	SO:0001583	missense	80237	exon9			TCTTTTAATCTCT	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.1005T>G	15.37:g.44066413A>C	ENSP00000320346:p.Ile335Met	160	1		144	58	NM_025165	0	0	0	1	1	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	ENST00000319359.3	37	CCDS10102.1	.	.	.	.	.	.	.	.	.	.	A	9.435	1.086448	0.20390	.	.	ENSG00000128886	ENST00000319359	T	0.21543	2.0	5.92	0.357	0.16079	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.091491	0.48286	D	0.000192	T	0.08088	0.0202	N	0.04132	-0.27	0.43994	D	0.996697	B;B;P	0.35050	0.334;0.334;0.482	B;B;B	0.35655	0.15;0.15;0.207	T	0.26326	-1.0106	10	0.34782	T	0.22	-19.7297	6.1561	0.20338	0.2417:0.3845:0.3738:0.0	.	335;335;289	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	M	335	ENSP00000320346:I335M	ENSP00000320346:I335M	I	-	3	3	ELL3	41853705	0.993000	0.37304	1.000000	0.80357	0.829000	0.46940	0.127000	0.15790	0.374000	0.24650	-0.479000	0.04858	ATT	.		0.512	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133236.2	NM_025165	
FAM63B	54629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	59139573	59139573	+	Silent	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr15:59139573A>T	ENST00000559228.1	+	7	1528	c.1446A>T	c.(1444-1446)gtA>gtT	p.V482V	FAM63B_ENST00000450403.2_Silent_p.V482V			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	482										central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						TACACAACGTAGATGGTGATG	0.388																																					p.V482V		.											.	FAM63B-90	0			c.A1446T						.						143.0	132.0	135.0					15																	59139573		1828	4082	5910	SO:0001819	synonymous_variant	54629	exon7			CAACGTAGATGGT	AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.1446A>T	15.37:g.59139573A>T		37	0		48	17	NM_001040450	0	0	3	4	1	B2RTT8|Q9ULQ6	Silent	SNP	ENST00000559228.1	37	CCDS42046.1																																																																																			.		0.388	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416230.1	NM_019092	
DAPK2	23604	broad.mit.edu;ucsc.edu	37	15	64200745	64200745	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr15:64200745G>A	ENST00000457488.1	-	12	1117	c.1087C>T	c.(1087-1089)Cca>Tca	p.P363S	DAPK2_ENST00000261891.3_Missense_Mutation_p.P363S	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	363					anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CTCCTCCGTGGGTGGAGGGCT	0.602																																					p.P363S													.	DAPK2-333	0			c.C1087T						.						54.0	39.0	44.0					15																	64200745		2202	4299	6501	SO:0001583	missense	23604	exon12			TCCGTGGGTGGAG	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.1087C>T	15.37:g.64200745G>A	ENSP00000408277:p.Pro363Ser	60	1		48	10	NM_014326	0	0	0	0	0	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	37	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788395	0.31685	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.66638	-0.22;-0.22	5.26	4.34	0.51931	.	0.242826	0.26048	N	0.026647	T	0.52306	0.1726	L	0.36672	1.1	0.38280	D	0.942401	B	0.19331	0.035	B	0.15052	0.012	T	0.48387	-0.9040	10	0.13853	T	0.58	.	11.0466	0.47863	0.087:0.0:0.913:0.0	.	363	Q9UIK4	DAPK2_HUMAN	S	363	ENSP00000261891:P363S;ENSP00000408277:P363S	ENSP00000261891:P363S	P	-	1	0	DAPK2	61987798	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.491000	0.35583	1.217000	0.43442	0.655000	0.94253	CCA	.		0.602	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
ACAN	176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	89400337	89400337	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr15:89400337T>A	ENST00000561243.1	+	11	4521	c.4521T>A	c.(4519-4521)agT>agA	p.S1507R	ACAN_ENST00000352105.7_Missense_Mutation_p.S1507R|ACAN_ENST00000559004.1_Missense_Mutation_p.S1507R|ACAN_ENST00000439576.2_Missense_Mutation_p.S1507R			P16112	PGCA_HUMAN	aggrecan	1508	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGATGTCAGTGAACTTCCTT	0.493																																					p.S1507R		.											.	ACAN-25	0			c.T4521A						.						69.0	70.0	70.0					15																	89400337		1870	4099	5969	SO:0001583	missense	176	exon12			TGTCAGTGAACTT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4521T>A	15.37:g.89400337T>A	ENSP00000453342:p.Ser1507Arg	39	0		50	13	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503317	0.44558	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.97016	-4.21;-4.21	3.27	0.774	0.18521	.	.	.	.	.	D	0.97309	0.9120	M	0.79926	2.475	0.09310	N	1	D;D	0.76494	0.999;0.998	D;D	0.72982	0.979;0.953	D	0.91248	0.5027	9	0.56958	D	0.05	.	6.8295	0.23902	0.0:0.3522:0.0:0.6478	.	1507;1507	E7ENV9;E7EX88	.;.	R	1507;1507;1393	ENSP00000387356:S1507R;ENSP00000341615:S1507R	ENSP00000268134:S1393R	S	+	3	2	ACAN	87201341	0.000000	0.05858	0.002000	0.10522	0.944000	0.59088	-0.304000	0.08199	0.050000	0.15949	0.260000	0.18958	AGT	.		0.493	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
RBBP6	5930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24581079	24581079	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr16:24581079A>T	ENST00000319715.4	+	17	3500	c.3068A>T	c.(3067-3069)aAt>aTt	p.N1023I	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.N989I	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1023	Interaction with RB1. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AAACGGAAGAATGATGGATCT	0.383																																					p.N1023I		.											.	RBBP6-230	0			c.A3068T						.						89.0	93.0	92.0					16																	24581079		2197	4300	6497	SO:0001583	missense	5930	exon17			GGAAGAATGATGG		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3068A>T	16.37:g.24581079A>T	ENSP00000317872:p.Asn1023Ile	37	0		80	28	NM_006910	0	0	0	1	1	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.597918	0.46318	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.14516	2.5;2.5	5.66	1.57	0.23409	.	0.405156	0.23413	N	0.048451	T	0.06280	0.0162	N	0.19112	0.55	0.23724	N	0.997013	B;B	0.22983	0.078;0.047	B;B	0.21151	0.033;0.014	T	0.31971	-0.9924	10	0.28530	T	0.3	-9.0723	1.0512	0.01580	0.2899:0.3403:0.1901:0.1797	.	989;1023	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	I	1023;989	ENSP00000317872:N1023I;ENSP00000316291:N989I	ENSP00000317872:N1023I	N	+	2	0	RBBP6	24488580	0.343000	0.24818	0.990000	0.47175	0.994000	0.84299	0.309000	0.19332	-0.006000	0.14370	0.533000	0.62120	AAT	.		0.383	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
CHST6	4166	bcgsc.ca	37	16	75513372	75513372	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr16:75513372C>T	ENST00000332272.4	-	3	534	c.355G>A	c.(355-357)Gac>Aac	p.D119N	CHST6_ENST00000390664.2_Missense_Mutation_p.D119N|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	119					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TGGAAGAGGTCGGACAGGTTG	0.657																																					p.D119N													.	CHST6-90	0			c.G355A						.						48.0	43.0	45.0					16																	75513372		2198	4298	6496	SO:0001583	missense	4166	exon3			AGAGGTCGGACAG	AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.355G>A	16.37:g.75513372C>T	ENSP00000328983:p.Asp119Asn	32	1		95	61	NM_021615	0	0	0	0	0	D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	37	CCDS10918.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.368045	0.24771	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.96491	-4.03;-4.03	4.56	4.56	0.56223	Sulfotransferase domain (1);	0.298026	0.35378	N	0.003256	D	0.91835	0.7416	N	0.25380	0.74	0.35691	D	0.814828	B	0.15719	0.014	B	0.16289	0.015	D	0.90235	0.4282	10	0.15499	T	0.54	.	14.8296	0.70137	0.0:1.0:0.0:0.0	.	119	Q9GZX3	CHST6_HUMAN	N	119	ENSP00000328983:D119N;ENSP00000375079:D119N	ENSP00000328983:D119N	D	-	1	0	CHST6	74070873	0.877000	0.30153	0.985000	0.45067	0.943000	0.58893	1.700000	0.37815	2.078000	0.62432	0.591000	0.81541	GAC	.		0.657	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615	
ARHGEF15	22899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8215790	8215790	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:8215790T>G	ENST00000361926.3	+	2	543	c.433T>G	c.(433-435)Tca>Gca	p.S145A	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.S145A	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	145					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TGGCTCTGCCTCAGCTCCTGG	0.672																																					p.S145A		.											.	ARHGEF15-230	0			c.T433G						.						54.0	54.0	54.0					17																	8215790		2203	4300	6503	SO:0001583	missense	22899	exon2			TCTGCCTCAGCTC	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.433T>G	17.37:g.8215790T>G	ENSP00000355026:p.Ser145Ala	54	0		74	35	NM_025014	0	0	1	1	0	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	37	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574696	0.28092	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.74632	-0.86;-0.86	5.12	4.03	0.46877	.	1.787260	0.03046	N	0.153884	T	0.79569	0.4468	L	0.29908	0.895	0.24301	N	0.99513	D;D;P	0.58268	0.982;0.982;0.884	D;D;B	0.67548	0.952;0.952;0.262	T	0.62053	-0.6935	10	0.45353	T	0.12	-10.5299	7.7269	0.28765	0.0:0.0947:0.0:0.9053	.	145;145;46	D3DTR7;O94989;B4DTR5	.;ARHGF_HUMAN;.	A	145;46;145	ENSP00000355026:S145A;ENSP00000412505:S145A	ENSP00000355026:S145A	S	+	1	0	ARHGEF15	8156515	0.954000	0.32549	0.913000	0.36048	0.921000	0.55340	1.645000	0.37238	0.969000	0.38237	0.454000	0.30748	TCA	.		0.672	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	175	11		402	33	NM_145301	0	0	3	20	17	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
FBXO47	494188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37099134	37099134	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:37099134A>G	ENST00000378079.2	-	9	1179	c.980T>C	c.(979-981)cTc>cCc	p.L327P		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	327										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						TAGCATTAGGAGACGTGCATT	0.403																																					p.L327P		.											.	FBXO47-90	0			c.T980C						.						98.0	91.0	93.0					17																	37099134		2203	4300	6503	SO:0001583	missense	494188	exon9			ATTAGGAGACGTG		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.980T>C	17.37:g.37099134A>G	ENSP00000367319:p.Leu327Pro	86	0		101	34	NM_001008777	0	0	0	0	0	B2RTZ4	Missense_Mutation	SNP	ENST00000378079.2	37	CCDS32639.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.378341	0.61735	.	.	ENSG00000204952	ENST00000378079	T	0.61158	0.13	5.9	4.8	0.61643	.	0.254055	0.40385	N	0.001113	T	0.71626	0.3362	M	0.66939	2.045	0.58432	D	0.999995	D	0.76494	0.999	D	0.67231	0.95	T	0.73902	-0.3836	10	0.87932	D	0	-13.2646	12.1337	0.53957	0.8566:0.1434:0.0:0.0	.	327	Q5MNV8	FBX47_HUMAN	P	327	ENSP00000367319:L327P	ENSP00000367319:L327P	L	-	2	0	FBXO47	34352660	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.161000	0.77505	1.013000	0.39391	0.482000	0.46254	CTC	.		0.403	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	NM_001008777	
COPZ2	51226	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	46103806	46103806	+	Silent	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:46103806C>G	ENST00000006101.4	-	10	614	c.615G>C	c.(613-615)tcG>tcC	p.S205S	COPZ2_ENST00000584666.1_5'UTR	NM_016429.2	NP_057513.1	Q9P299	COPZ2_HUMAN	coatomer protein complex, subunit zeta 2	207					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)				lung(3)|upper_aerodigestive_tract(1)	4						ATTTCAATAACGACCATTTAA	0.507											OREG0024510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	.	0			.						.						71.0	79.0	77.0					17																	46103806		1868	4095	5963	SO:0001819	synonymous_variant	51226	.			CAATAACGACCAT	AB037938	CCDS74092.1	17q21.2	2008-07-18				ENSG00000005243			19356	protein-coding gene	gene with protein product	"""nonclathrin coat protein zeta-COP"", ""zeta2-COP"", ""zeta-2 coat protein"""	615526				11056392	Standard	NM_016429		Approved	MGC23008	uc002imy.3	Q9P299		ENST00000006101.4:c.615G>C	17.37:g.46103806C>G		36	0	936	60	16	.	0	0	12	20	8		Silent	SNP	ENST00000006101.4	37																																																																																				.		0.507	COPZ2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_016429	
AMZ2	51321	hgsc.bcm.edu;bcgsc.ca	37	17	66246341	66246341	+	Missense_Mutation	SNP	C	C	T	rs532820909		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:66246341C>T	ENST00000359904.3	+	2	1145	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	AMZ2_ENST00000577866.1_Missense_Mutation_p.R5W|AMZ2_ENST00000577985.1_Missense_Mutation_p.R5W|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000359783.4_Missense_Mutation_p.R5W|AMZ2_ENST00000392720.2_Missense_Mutation_p.R5W|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000580753.1_Missense_Mutation_p.R5W|AMZ2_ENST00000577273.1_Missense_Mutation_p.R5W	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	5							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAAATAATACGGCACTCCGA	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		20400	0.0		0.0	False		,,,				2504	0.001				p.R5W		.											.	AMZ2-22	0			c.C13T						.						75.0	79.0	78.0					17																	66246341		2203	4300	6503	SO:0001583	missense	51321	exon2			ATAATACGGCACT	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.13C>T	17.37:g.66246341C>T	ENSP00000352976:p.Arg5Trp	30	0		59	5	NM_001033574	0	0	0	0	0	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	ENST00000359904.3	37	CCDS11674.1	.	.	.	.	.	.	.	.	.	.	C	0.090	-1.168251	0.01660	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.19938	2.11;2.11;2.11	3.71	1.58	0.23477	.	0.721746	0.11673	N	0.540610	T	0.21718	0.0523	L	0.57536	1.79	0.09310	N	1	D;D	0.61697	0.978;0.99	B;B	0.43623	0.425;0.425	T	0.14090	-1.0485	10	0.87932	D	0	-32.5953	7.065	0.25147	0.1861:0.451:0.3629:0.0	.	5;5	A6NLD9;Q86W34	.;AMZ2_HUMAN	W	5	ENSP00000352976:R5W;ENSP00000352831:R5W;ENSP00000376481:R5W	ENSP00000352831:R5W	R	+	1	2	AMZ2	63757936	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.302000	0.19192	0.320000	0.23234	0.456000	0.33151	CGG	.		0.343	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	NM_016627	
C17orf70	80233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79518169	79518169	+	Silent	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr17:79518169A>G	ENST00000327787.8	-	3	397	c.351T>C	c.(349-351)ccT>ccC	p.P117P	C17orf70_ENST00000425898.2_5'Flank|C17orf70_ENST00000537152.1_5'UTR			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	117					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CGGGGTCCACAGGGATCACGG	0.647																																					p.P117P		.											.	C17orf70-92	0			c.T351C						.						6.0	8.0	7.0					17																	79518169		1251	2219	3470	SO:0001819	synonymous_variant	80233	exon3			GTCCACAGGGATC	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.351T>C	17.37:g.79518169A>G		446	1		559	133	NM_025161	0	0	15	19	4	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Silent	SNP	ENST00000327787.8	37	CCDS32765.2																																																																																			.		0.647	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
DLGAP1	9229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	3508641	3508641	+	Missense_Mutation	SNP	G	G	A	rs538990113		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr18:3508641G>A	ENST00000315677.3	-	11	3093	c.2498C>T	c.(2497-2499)aCc>aTc	p.T833I	DLGAP1_ENST00000400145.2_Missense_Mutation_p.T531I|DLGAP1_ENST00000400147.2_Missense_Mutation_p.T531I|DLGAP1_ENST00000584874.1_Missense_Mutation_p.T833I|DLGAP1_ENST00000534970.1_Missense_Mutation_p.T517I|DLGAP1_ENST00000400150.3_Missense_Mutation_p.T549I|DLGAP1_ENST00000400149.3_Missense_Mutation_p.T523I|DLGAP1_ENST00000515196.2_Missense_Mutation_p.T833I|DLGAP1_ENST00000539435.1_Missense_Mutation_p.T541I|DLGAP1_ENST00000581527.1_Missense_Mutation_p.T833I|DLGAP1_ENST00000400155.1_Missense_Mutation_p.T539I|DLGAP1_ENST00000581699.1_Missense_Mutation_p.T539I	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	833					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GCCCACTGCGGTTCGGATTTT	0.413																																					p.T833I		.											.	DLGAP1-229	0			c.C2498T						.						64.0	58.0	60.0					18																	3508641		2203	4300	6503	SO:0001583	missense	9229	exon11			ACTGCGGTTCGGA	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2498C>T	18.37:g.3508641G>A	ENSP00000316377:p.Thr833Ile	66	0		70	24	NM_001242761	0	0	1	1	0	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008210	0.75046	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.66	4.74	0.60224	.	0.160479	0.56097	D	0.000030	T	0.24812	0.0602	L	0.48362	1.52	0.44908	D	0.997921	D;P;P;P;P;D;P;P	0.54397	0.966;0.939;0.758;0.662;0.758;0.958;0.758;0.714	P;P;P;B;P;B;P;B	0.47705	0.522;0.522;0.555;0.398;0.555;0.387;0.555;0.419	T	0.00885	-1.1527	10	0.87932	D	0	-22.5862	11.1457	0.48430	0.0:0.1378:0.7192:0.1429	.	833;517;529;539;541;531;833;531	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490-3;O14490;O14490-2	.;.;.;.;.;.;DLGP1_HUMAN;.	I	833;531;549;523;539;517;541;531;833	ENSP00000316377:T833I;ENSP00000383011:T531I;ENSP00000383014:T549I;ENSP00000383013:T523I;ENSP00000383019:T539I;ENSP00000437817:T517I;ENSP00000446312:T541I;ENSP00000383010:T531I;ENSP00000445973:T833I	ENSP00000316377:T833I	T	-	2	0	DLGAP1	3498641	1.000000	0.71417	0.969000	0.41365	0.997000	0.91878	4.878000	0.63093	2.656000	0.90262	0.655000	0.94253	ACC	.		0.413	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		
RALBP1	10928	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	9524704	9524704	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr18:9524704C>G	ENST00000019317.4	+	5	1389	c.1166C>G	c.(1165-1167)cCc>cGc	p.P389R	RALBP1_ENST00000383432.3_Missense_Mutation_p.P389R			Q15311	RBP1_HUMAN	ralA binding protein 1	389					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	GCCACGATGCCCACGCTGCCA	0.537																																					p.P389R													.	RALBP1-522	0			c.C1166G						.						51.0	44.0	46.0					18																	9524704		2203	4300	6503	SO:0001583	missense	10928	exon5			CGATGCCCACGCT	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1166C>G	18.37:g.9524704C>G	ENSP00000019317:p.Pro389Arg	130	1		124	48	NM_006788	0	0	13	26	13	D3DUI0	Missense_Mutation	SNP	ENST00000019317.4	37	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900504	0.92035	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.11169	2.8;2.8	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.00899	-1.1522	10	0.66056	D	0.02	-11.5257	19.7818	0.96418	0.0:1.0:0.0:0.0	.	389	Q15311	RBP1_HUMAN	R	389	ENSP00000019317:P389R;ENSP00000372924:P389R	ENSP00000019317:P389R	P	+	2	0	RALBP1	9514704	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.629000	0.83207	2.736000	0.93811	0.655000	0.94253	CCC	.		0.537	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
DSG4	147409	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	28966661	28966661	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr18:28966661T>A	ENST00000308128.4	+	3	230	c.95T>A	c.(94-96)tTt>tAt	p.F32Y	RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.F32Y|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	32					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTGAAGGAATTTGACATTGAA	0.393																																					p.F32Y													.	DSG4-177	0			c.T95A						.						83.0	81.0	82.0					18																	28966661		2203	4300	6503	SO:0001583	missense	147409	exon3			AGGAATTTGACAT	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.95T>A	18.37:g.28966661T>A	ENSP00000311859:p.Phe32Tyr	131	2		160	65	NM_001134453	0	0	0	0	0	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	T	4.207	0.037227	0.08148	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.58940	0.36;0.3	5.32	4.07	0.47477	.	0.332353	0.16946	N	0.193117	T	0.21962	0.0529	N	0.01576	-0.805	0.20821	N	0.999849	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.31779	-0.9931	10	0.02654	T	1	.	6.1963	0.20552	0.137:0.0:0.218:0.645	.	32;32	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	Y	32	ENSP00000311859:F32Y;ENSP00000352785:F32Y	ENSP00000311859:F32Y	F	+	2	0	DSG4	27220659	0.997000	0.39634	0.997000	0.53966	0.919000	0.55068	1.382000	0.34374	2.137000	0.66172	0.528000	0.53228	TTT	.		0.393	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
DSG2	1829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	29116286	29116286	+	Silent	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr18:29116286T>C	ENST00000261590.8	+	11	1754	c.1545T>C	c.(1543-1545)gtT>gtC	p.V515V		NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	515			V -> I (in dbSNP:rs2230235).		apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			ATGTGAATGTTACTGCAGAGG	0.483																																					p.V515V		.											.	DSG2-563	0			c.T1545C						.						94.0	89.0	90.0					18																	29116286		1963	4174	6137	SO:0001819	synonymous_variant	1829	exon11			GAATGTTACTGCA	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1545T>C	18.37:g.29116286T>C		118	0		109	35	NM_001943	0	0	18	29	11	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																			.		0.483	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
UBXN6	80700	ucsc.edu	37	19	4453972	4453972	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr19:4453972A>G	ENST00000301281.6	-	2	326	c.202T>C	c.(202-204)Tcc>Ccc	p.S68P	CTB-50L17.9_ENST00000592034.1_RNA|UBXN6_ENST00000394765.3_Missense_Mutation_p.S15P	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	68						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						CAGGCCCGGGACTGCTTCTGC	0.692																																					p.S68P													.	UBXN6-90	0			c.T202C						.						71.0	82.0	78.0					19																	4453972		2203	4300	6503	SO:0001583	missense	80700	exon2			CCCGGGACTGCTT	AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.202T>C	19.37:g.4453972A>G	ENSP00000301281:p.Ser68Pro	13	0		12	4	NM_025241	0	0	39	73	34	D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	ENST00000301281.6	37	CCDS12129.1	.	.	.	.	.	.	.	.	.	.	A	8.094	0.775072	0.16051	.	.	ENSG00000167671	ENST00000301281;ENST00000394765	T;T	0.45668	1.94;0.89	4.24	3.2	0.36748	.	0.377447	0.27048	N	0.021186	T	0.08846	0.0219	N	0.00237	-1.79	0.22292	N	0.999225	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33059	-0.9883	10	0.07325	T	0.83	-14.2173	5.506	0.16854	0.1175:0.2038:0.6787:0.0	.	15;68	Q9BZV1-2;Q9BZV1	.;UBXN6_HUMAN	P	68;15	ENSP00000301281:S68P;ENSP00000378246:S15P	ENSP00000301281:S68P	S	-	1	0	UBXN6	4404972	1.000000	0.71417	0.667000	0.29798	0.762000	0.43233	2.474000	0.45154	0.747000	0.32809	-0.415000	0.06103	TCC	.		0.692	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458447.3	NM_025241	
LRRC8E	80131	broad.mit.edu	37	19	7964010	7964010	+	Silent	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr19:7964010T>G	ENST00000306708.6	+	3	704	c.603T>G	c.(601-603)ggT>ggG	p.G201G	AC010336.1_ENST00000539278.1_3'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	201					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						CAGGGGAGGGTGAGAAGGAGA	0.642																																					p.G201G													.	LRRC8E-92	0			c.T603G						.						42.0	48.0	46.0					19																	7964010		2203	4300	6503	SO:0001819	synonymous_variant	80131	exon4			GGAGGGTGAGAAG		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.603T>G	19.37:g.7964010T>G		81	16		93	28	NM_001268284	0	0	1	1	0	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	ENST00000306708.6	37	CCDS12189.1																																																																																			.		0.642	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
ZNF799	90576	ucsc.edu;bcgsc.ca	37	19	12502160	12502160	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr19:12502160G>T	ENST00000430385.3	-	4	1252	c.1052C>A	c.(1051-1053)tCa>tAa	p.S351*	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Nonsense_Mutation_p.S319*	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						ACTTTTCAGTGAACTAGGACA	0.413																																					p.S351X													.	ZNF799-74	0			c.C1052A						.						161.0	157.0	158.0					19																	12502160		2203	4300	6503	SO:0001587	stop_gained	90576	exon4			TTCAGTGAACTAG	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1052C>A	19.37:g.12502160G>T	ENSP00000411084:p.Ser351*	80	2		91	35	NM_001080821	0	0	1	4	3		Nonsense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	G	38	7.279860	0.98182	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	.	.	.	1.31	-1.62	0.08372	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.5092	0.04652	0.1876:0.0:0.3077:0.5047	.	.	.	.	X	319;351	.	ENSP00000415278:S319X	S	-	2	0	ZNF799	12363160	0.000000	0.05858	0.001000	0.08648	0.117000	0.20001	-0.475000	0.06599	-0.373000	0.07979	0.430000	0.28490	TCA	.		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
RDH13	112724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55570627	55570627	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr19:55570627C>A	ENST00000415061.3	-	2	225	c.82G>T	c.(82-84)Ggg>Tgg	p.G28W	RDH13_ENST00000396247.3_5'UTR	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)	28					eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GGGCAAGCCCCACCGGTGACA	0.632																																					p.G28W		.											.	RDH13-92	0			c.G82T						.						28.0	27.0	27.0					19																	55570627		1567	3580	5147	SO:0001583	missense	112724	exon2			AAGCCCCACCGGT		CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.82G>T	19.37:g.55570627C>A	ENSP00000391121:p.Gly28Trp	69	0		87	37	NM_001145971	0	0	7	12	5	Q6UX79|Q96G88	Missense_Mutation	SNP	ENST00000415061.3	37	CCDS54320.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395156	0.83011	.	.	ENSG00000160439	ENST00000415061;ENST00000291892	D;D	0.83673	-1.75;-1.63	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.88930	0.6571	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89139	0.3515	10	0.59425	D	0.04	.	14.7528	0.69540	0.0:1.0:0.0:0.0	.	28	Q8NBN7	RDH13_HUMAN	W	28	ENSP00000391121:G28W;ENSP00000291892:G28W	ENSP00000291892:G28W	G	-	1	0	RDH13	60262439	0.988000	0.35896	0.311000	0.25182	0.164000	0.22412	3.974000	0.56852	2.635000	0.89317	0.650000	0.86243	GGG	.		0.632	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451470.1	NM_138412	
GEN1	348654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	17962535	17962535	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:17962535C>G	ENST00000381254.2	+	14	2270	c.2056C>G	c.(2056-2058)Cag>Gag	p.Q686E	GEN1_ENST00000317402.7_Missense_Mutation_p.Q686E|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	686					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATCATATCCTCAGGATAATCT	0.348								Homologous recombination																													p.Q686E		.											.	GEN1-359	0			c.C2056G						.						75.0	82.0	79.0					2																	17962535		2203	4300	6503	SO:0001583	missense	348654	exon14			TATCCTCAGGATA	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.2056C>G	2.37:g.17962535C>G	ENSP00000370653:p.Gln686Glu	32	0		108	54	NM_182625	0	0	1	1	0	Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	37	CCDS1691.1	.	.	.	.	.	.	.	.	.	.	C	2.631	-0.286254	0.05605	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000536097	T;T	0.24723	1.84;1.84	5.41	2.48	0.30137	.	0.967756	0.08453	N	0.943658	T	0.25494	0.0620	M	0.62723	1.935	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.31888	-0.9927	10	0.59425	D	0.04	0.3588	4.3539	0.11169	0.1364:0.6005:0.1325:0.1307	.	686	Q17RS7	GEN_HUMAN	E	686;686;323	ENSP00000318977:Q686E;ENSP00000370653:Q686E	ENSP00000318977:Q686E	Q	+	1	0	GEN1	17826016	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.195000	0.17155	0.717000	0.32145	0.655000	0.94253	CAG	.		0.348	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625	
ITSN2	50618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	24469667	24469667	+	Splice_Site	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:24469667A>G	ENST00000355123.4	-	28	3827	c.3384T>C	c.(3382-3384)ccT>ccC	p.P1128P	ITSN2_ENST00000361999.3_Splice_Site_p.P1101P|ITSN2_ENST00000406921.3_Splice_Site_p.P1128P	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1128	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCCATACCAGGATGAAAGG	0.383																																					p.P1128P		.											.	ITSN2-539	0			c.T3384C						.						87.0	87.0	87.0					2																	24469667		2203	4300	6503	SO:0001630	splice_region_variant	50618	exon28			CATACCAGGATGA	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.3385+1T>C	2.37:g.24469667A>G		28	0		71	35	NM_147152	0	0	0	0	0	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683791	0.29872	.	.	ENSG00000198399	ENST00000416160	.	.	.	5.59	-2.45	0.06481	.	.	.	.	.	T	0.43122	0.1233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35624	-0.9781	4	.	.	.	.	4.57	0.12205	0.3227:0.0:0.2426:0.4346	.	.	.	.	P	56	.	.	L	-	2	0	ITSN2	24323171	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	1.158000	0.31737	-0.097000	0.12307	0.383000	0.25322	CTG	.		0.383	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	Silent
NRBP1	29959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27660178	27660178	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:27660178A>T	ENST00000233557.3	+	11	1686	c.854A>T	c.(853-855)cAg>cTg	p.Q285L	NRBP1_ENST00000379852.3_Missense_Mutation_p.Q285L|NRBP1_ENST00000379863.3_Missense_Mutation_p.Q293L			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	285	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					TATGTGCCACAGGAAGCCATC	0.463																																					p.Q285L		.											.	NRBP1-334	0			c.A854T						.						78.0	72.0	74.0					2																	27660178		2203	4300	6503	SO:0001583	missense	29959	exon10			TGCCACAGGAAGC	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.854A>T	2.37:g.27660178A>T	ENSP00000233557:p.Gln285Leu	381	2		415	233	NM_013392	0	0	19	57	38	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	A	16.36	3.100500	0.56183	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.32272	1.46;1.46;1.46	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.28928	0.0718	L	0.28014	0.82	0.80722	D	1	B;B;B	0.32862	0.387;0.049;0.06	B;B;B	0.40256	0.324;0.039;0.021	T	0.08513	-1.0718	10	0.40728	T	0.16	-13.0877	14.6481	0.68774	1.0:0.0:0.0:0.0	.	265;293;285	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	L	285;265;285;293	ENSP00000233557:Q285L;ENSP00000369181:Q285L;ENSP00000369192:Q293L	ENSP00000233557:Q285L	Q	+	2	0	NRBP1	27513682	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.394000	0.79862	2.138000	0.66242	0.533000	0.62120	CAG	.		0.463	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
RFX8	731220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102014128	102014128	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:102014128G>T	ENST00000376826.2	-	15	1642	c.1643C>A	c.(1642-1644)cCt>cAt	p.P548H	RFX8_ENST00000428343.1_Missense_Mutation_p.P435H			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						TTGTCCCATAGGAAGGCTGAG	0.403																																					p.P435H		.											.	.	0			c.C1304A						.						247.0	197.0	212.0					2																	102014128		692	1591	2283	SO:0001583	missense	731220	exon12			CCCATAGGAAGGC	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1643C>A	2.37:g.102014128G>T	ENSP00000366022:p.Pro548His	138	0		176	50	NM_001145664	0	0	0	0	0	B4DQ32	Missense_Mutation	SNP	ENST00000376826.2	37		.	.	.	.	.	.	.	.	.	.	G	17.97	3.518375	0.64634	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	D;T	0.85702	-2.02;0.03	5.16	5.16	0.70880	.	0.000000	0.48767	D	0.000161	D	0.86896	0.6043	L	0.32530	0.975	0.29342	N	0.865924	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81863	-0.0737	10	0.87932	D	0	-11.8239	9.5598	0.39362	0.0932:0.0:0.9068:0.0	.	435;548	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	H	548;435	ENSP00000366022:P548H;ENSP00000401536:P435H	ENSP00000366022:P548H	P	-	2	0	RFX8	101380560	0.999000	0.42202	0.996000	0.52242	0.937000	0.57800	4.888000	0.63164	2.686000	0.91538	0.603000	0.83216	CCT	.		0.403	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
NPHP1	4867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	110922202	110922202	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:110922202A>T	ENST00000393272.3	-	8	931	c.834T>A	c.(832-834)aaT>aaA	p.N278K	NPHP1_ENST00000445609.2_Intron|NPHP1_ENST00000355301.4_Intron|NPHP1_ENST00000417665.1_Intron|NPHP1_ENST00000316534.4_Missense_Mutation_p.N278K	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	278					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						TCTCCATCCTATTTCGCATCA	0.463																																					p.N278K		.											.	NPHP1-92	0			c.T834A						.						185.0	182.0	183.0					2																	110922202		2203	4300	6503	SO:0001583	missense	4867	exon8			CATCCTATTTCGC	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.834T>A	2.37:g.110922202A>T	ENSP00000376953:p.Asn278Lys	88	0		130	38	NM_207181	0	0	0	2	2	O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510348	0.27036	.	.	ENSG00000144061	ENST00000316534;ENST00000393272	T;T	0.60171	0.21;0.21	4.36	-3.69	0.04450	.	1.449030	0.04895	U	0.450299	T	0.35038	0.0918	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.09335	-1.0679	10	0.23302	T	0.38	-2.1995	1.7177	0.02905	0.4617:0.1409:0.2537:0.1437	.	278;278	O15259;O15259-4	NPHP1_HUMAN;.	K	278	ENSP00000313169:N278K;ENSP00000376953:N278K	ENSP00000313169:N278K	N	-	3	2	NPHP1	110279491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.481000	0.06552	-0.376000	0.07943	-1.092000	0.02172	AAT	.		0.463	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	122161975	122161975	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:122161975G>C	ENST00000263710.4	-	26	3094	c.2705C>G	c.(2704-2706)aCt>aGt	p.T902S	CLASP1_ENST00000409078.3_Missense_Mutation_p.T874S|CLASP1_ENST00000541377.1_Missense_Mutation_p.T880S|CLASP1_ENST00000455322.2_Missense_Mutation_p.T874S|CLASP1_ENST00000541859.1_Missense_Mutation_p.T635S|CLASP1_ENST00000545861.1_Missense_Mutation_p.T649S|CLASP1_ENST00000397587.3_Missense_Mutation_p.T882S	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	902					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AAACATCCGAGTGAAGATCTC	0.408																																					p.T902S		.											.	CLASP1-91	0			c.C2705G						.						102.0	99.0	100.0					2																	122161975		1978	4156	6134	SO:0001583	missense	23332	exon26			ATCCGAGTGAAGA	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.2705C>G	2.37:g.122161975G>C	ENSP00000263710:p.Thr902Ser	154	0		160	44	NM_015282	0	0	5	8	3	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	G	29.9	5.041443	0.93685	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.045519	0.85682	D	0.000000	T	0.76615	0.4012	L	0.55481	1.735	0.58432	D	0.999999	D;D;P;P	0.76494	0.999;0.999;0.865;0.74	D;D;P;P	0.79108	0.992;0.968;0.604;0.617	T	0.77496	-0.2566	10	0.59425	D	0.04	-15.1313	19.1123	0.93321	0.0:0.0:1.0:0.0	.	874;882;880;902	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	S	902;874;882;880;635;874;649	ENSP00000263710:T902S;ENSP00000389372:T874S;ENSP00000380717:T882S;ENSP00000441625:T880S;ENSP00000441770:T635S;ENSP00000386442:T874S;ENSP00000438620:T649S	ENSP00000263710:T902S	T	-	2	0	CLASP1	121878445	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.496000	0.97967	2.518000	0.84900	0.563000	0.77884	ACT	.		0.408	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
KIF1A	547	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	241725900	241725900	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:241725900C>T	ENST00000320389.7	-	6	618	c.460G>A	c.(460-462)Gtc>Atc	p.V154I	KIF1A_ENST00000498729.2_Missense_Mutation_p.V154I	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	154	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		AGGTCACGGACGCGCTCACAG	0.652																																					p.V154I		.											.	KIF1A-91	0			c.G460A						.						112.0	117.0	115.0					2																	241725900		2085	4227	6312	SO:0001583	missense	547	exon6			CACGGACGCGCTC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.460G>A	2.37:g.241725900C>T	ENSP00000322791:p.Val154Ile	203	0		238	22	NM_001244008	0	0	0	0	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399825	0.83120	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.74315	-0.83;-0.83;-0.83	4.55	4.55	0.56014	Kinesin, motor domain (4);	0.000000	0.64402	U	0.000001	T	0.80681	0.4669	L	0.35414	1.06	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.983;0.996	D	0.83722	0.0193	10	0.87932	D	0	.	17.3339	0.87274	0.0:1.0:0.0:0.0	.	154;154;154	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	I	154	ENSP00000322791:V154I;ENSP00000438388:V154I;ENSP00000384231:V154I	ENSP00000322791:V154I	V	-	1	0	KIF1A	241374573	1.000000	0.71417	0.911000	0.35937	0.436000	0.31835	5.859000	0.69539	2.087000	0.62958	0.643000	0.83706	GTC	.		0.652	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	46254225	46254225	+	Splice_Site	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr20:46254225G>A	ENST00000371998.3	+	5	548	c.357G>A	c.(355-357)caG>caA	p.Q119Q	NCOA3_ENST00000341724.6_Splice_Site_p.Q119Q|NCOA3_ENST00000372004.3_Splice_Site_p.Q119Q|NCOA3_ENST00000371997.3_Splice_Site_p.Q119Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	119	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TTTTACTTCAGGCAAGTATAA	0.343																																					p.Q119Q		.											.	NCOA3-229	0			c.G357A						.						76.0	71.0	73.0					20																	46254225		2203	4300	6503	SO:0001630	splice_region_variant	8202	exon5			ACTTCAGGCAAGT	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.357+1G>A	20.37:g.46254225G>A		18	0		42	15	NM_181659	0	0	0	0	0	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.343	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	Silent
ADNP	23394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49509272	49509272	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr20:49509272A>G	ENST00000396029.3	-	5	2546	c.1979T>C	c.(1978-1980)cTc>cCc	p.L660P	ADNP_ENST00000396032.3_Missense_Mutation_p.L660P|ADNP_ENST00000349014.3_Missense_Mutation_p.L660P|ADNP_ENST00000371602.4_Missense_Mutation_p.L660P	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	660					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TTTGTAGGTGAGCTTTTTCTC	0.458																																					p.L660P		.											.	ADNP-92	0			c.T1979C						.						168.0	159.0	162.0					20																	49509272		2203	4300	6503	SO:0001583	missense	23394	exon5			TAGGTGAGCTTTT	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1979T>C	20.37:g.49509272A>G	ENSP00000379346:p.Leu660Pro	220	0		233	102	NM_015339	0	0	7	17	10	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.907002	0.33628	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.45276	0.1334	N	0.17082	0.46	0.80722	D	1	B	0.25486	0.127	B	0.25140	0.058	T	0.40720	-0.9548	9	0.54805	T	0.06	-14.7154	16.4177	0.83748	1.0:0.0:0.0:0.0	.	660	Q9H2P0	ADNP_HUMAN	P	660	.	ENSP00000342905:L660P	L	-	2	0	ADNP	48942679	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.941000	0.92964	2.267000	0.75376	0.528000	0.53228	CTC	.		0.458	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
LIPI	149998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	15561570	15561570	+	Nonsense_Mutation	SNP	G	G	A	rs569460311		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr21:15561570G>A	ENST00000536861.1	-	2	216	c.217C>T	c.(217-219)Caa>Taa	p.Q73*	LIPI_ENST00000344577.2_Nonsense_Mutation_p.Q94*			Q6XZB0	LIPI_HUMAN	lipase, member I	73					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		GTTTTCTTTTGTGTGTTGAAA	0.378																																					p.Q94X		.											.	LIPI-70	0			c.C280T						.						140.0	125.0	130.0					21																	15561570		2203	4300	6503	SO:0001587	stop_gained	149998	exon2			TCTTTTGTGTGTT	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.217C>T	21.37:g.15561570G>A	ENSP00000440381:p.Gln73*	94	0		155	46	NM_198996	0	0	0	0	0	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Nonsense_Mutation	SNP	ENST00000536861.1	37		.	.	.	.	.	.	.	.	.	.	G	25.4	4.631384	0.87660	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	.	.	.	5.3	-2.36	0.06663	.	1.079770	0.06983	N	0.820308	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	1.3793	0.02227	0.1755:0.2196:0.1309:0.474	.	.	.	.	X	94;73	.	ENSP00000343331:Q94X	Q	-	1	0	LIPI	14483441	0.000000	0.05858	0.001000	0.08648	0.986000	0.74619	0.242000	0.18087	-0.342000	0.08363	-0.152000	0.13540	CAA	.		0.378	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
HLCS	3141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	38309141	38309141	+	Missense_Mutation	SNP	C	C	G	rs148324626		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr21:38309141C>G	ENST00000399120.1	-	5	1834	c.604G>C	c.(604-606)Gag>Cag	p.E202Q	HLCS_ENST00000336648.4_Missense_Mutation_p.E202Q	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	202					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	GCACTGTCCTCCAGCAGGTGG	0.582																																					p.E202Q		.											.	HLCS-157	0			c.G604C						.	C	GLN/GLU,GLN/GLU,GLN/GLU	1,4405	2.1+/-5.4	0,1,2202	70.0	73.0	72.0		604,604,604	3.0	0.0	21	dbSNP_134	72	0,8600		0,0,4300	no	missense,missense,missense	HLCS	NM_000411.6,NM_001242784.1,NM_001242785.1	29,29,29	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign,benign,benign	202/727,202/727,202/727	38309141	1,13005	2203	4300	6503	SO:0001583	missense	3141	exon5			TGTCCTCCAGCAG		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.604G>C	21.37:g.38309141C>G	ENSP00000382071:p.Glu202Gln	184	0		154	54	NM_000411	0	0	3	3	0	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	37	CCDS13647.1	.	.	.	.	.	.	.	.	.	.	C	9.293	1.051089	0.19827	2.27E-4	0.0	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.98164	-4.76;-4.76	5.91	2.99	0.34606	.	0.383875	0.32258	N	0.006346	D	0.94745	0.8304	L	0.35723	1.085	0.09310	N	1	B;B	0.13145	0.007;0.003	B;B	0.09377	0.004;0.004	D	0.84732	0.0746	10	0.15952	T	0.53	.	10.2355	0.43280	0.0:0.6608:0.2659:0.0733	.	202;202	B2RAH1;P50747	.;BPL1_HUMAN	Q	202	ENSP00000382071:E202Q;ENSP00000338387:E202Q	ENSP00000338387:E202Q	E	-	1	0	HLCS	37231011	0.279000	0.24239	0.001000	0.08648	0.283000	0.27025	1.771000	0.38542	0.335000	0.23614	0.655000	0.94253	GAG	C|1.000;G|0.000		0.582	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
TSPEAR	54084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45949793	45949793	+	Silent	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr21:45949793G>A	ENST00000323084.4	-	5	743	c.678C>T	c.(676-678)acC>acT	p.T226T	TSPEAR_ENST00000397916.1_Silent_p.T158T	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	226	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						ACAGCCTTGGGGTGGCGTCTG	0.662																																					p.T226T		.											.	TSPEAR-244	0			c.C678T						.						35.0	39.0	37.0					21																	45949793		2203	4300	6503	SO:0001819	synonymous_variant	54084	exon5			CCTTGGGGTGGCG	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.678C>T	21.37:g.45949793G>A		23	0		28	12	NM_144991	0	0	0	0	0		Silent	SNP	ENST00000323084.4	37	CCDS13712.1																																																																																			.		0.662	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
IL17RA	23765	hgsc.bcm.edu	37	22	17566096	17566096	+	Silent	SNP	C	C	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr22:17566096C>A	ENST00000319363.6	+	1	248	c.115C>A	c.(115-117)Cgg>Agg	p.R39R	IL17RA_ENST00000477874.1_3'UTR	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	39					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		CCTGGACCACCGGGCGCTGGT	0.766																																					p.R39R		.											.	IL17RA-92	0			c.C115A						.						2.0	2.0	2.0					22																	17566096		1628	3503	5131	SO:0001819	synonymous_variant	23765	exon1			GACCACCGGGCGC	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.115C>A	22.37:g.17566096C>A		1	0		8	8	NM_014339	0	0	0	1	1	O43844|Q20WK1	Silent	SNP	ENST00000319363.6	37	CCDS13739.1																																																																																			.		0.766	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
HIC2	23119	ucsc.edu	37	22	21800382	21800382	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr22:21800382G>A	ENST00000443632.2	+	2	1570	c.1198G>A	c.(1198-1200)Gag>Aag	p.E400K	HIC2_ENST00000407598.2_Missense_Mutation_p.E400K|HIC2_ENST00000407464.2_Missense_Mutation_p.E400K			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	400					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GGAGGAGGAGGAGAACGGCAA	0.672																																					p.E400K	NSCLC(23;437 858 2282 27947 40366)												.	HIC2-703	0			c.G1198A						.						24.0	23.0	23.0					22																	21800382		2192	4281	6473	SO:0001583	missense	23119	exon3			GAGGAGGAGAACG	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1198G>A	22.37:g.21800382G>A	ENSP00000387757:p.Glu400Lys	10	0		21	4	NM_015094	0	0	0	0	0	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	ENST00000443632.2	37	CCDS13789.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790874	0.50102	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	T;T;T	0.11821	2.74;2.74;2.74	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	M	0.65498	2.005	0.49130	D	0.999756	B	0.34200	0.441	B	0.32465	0.146	T	0.03818	-1.1001	10	0.02654	T	1	.	16.225	0.82285	0.0:0.0:1.0:0.0	.	400	Q96JB3	HIC2_HUMAN	K	400	ENSP00000385319:E400K;ENSP00000384889:E400K;ENSP00000387757:E400K	ENSP00000385319:E400K	E	+	1	0	HIC2	20130382	1.000000	0.71417	0.990000	0.47175	0.380000	0.30137	6.248000	0.72418	2.694000	0.91930	0.655000	0.94253	GAG	.		0.672	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
CSNK1E	1454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38690131	38690131	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr22:38690131C>T	ENST00000396832.1	-	9	1462	c.1202G>A	c.(1201-1203)cGg>cAg	p.R401Q	CSNK1E_ENST00000359867.3_Missense_Mutation_p.R401Q|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Missense_Mutation_p.R401Q|CSNK1E_ENST00000403904.1_Missense_Mutation_p.R401Q	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	401					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GGCTGGGATCCGGGAGACCTC	0.662																																					p.R401Q	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	.											.	CSNK1E-1193	0			c.G1202A						.						26.0	27.0	27.0					22																	38690131		2201	4300	6501	SO:0001583	missense	1454	exon9			GGGATCCGGGAGA		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.1202G>A	22.37:g.38690131C>T	ENSP00000380044:p.Arg401Gln	51	0		53	14	NM_001894	0	0	8	10	2		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.600758|4.600758	0.87055|0.87055	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000366216|ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904	.|T;T;T;T	.|0.57436	.|0.4;0.4;0.4;0.4	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.055638	.|0.64402	.|D	.|0.000001	T|T	0.59211|0.59211	0.2177|0.2177	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	T|T	0.65175|0.65175	-0.6232|-0.6232	5|10	.|0.56958	.|D	.|0.05	.|.	20.063|20.063	0.97692|0.97692	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|401	.|P49674	.|KC1E_HUMAN	R|Q	104|401	.|ENSP00000352929:R401Q;ENSP00000380044:R401Q;ENSP00000383067:R401Q;ENSP00000384074:R401Q	.|ENSP00000352929:R401Q	G|R	-|-	1|2	0|0	CSNK1E|CSNK1E	37020077|37020077	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.254000|0.254000	0.26022|0.26022	7.482000|7.482000	0.81143|0.81143	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GGA|CGG	.		0.662	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	51160300	51160300	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr22:51160300C>G	ENST00000414786.2	+	21	4224	c.3997C>G	c.(3997-3999)Cct>Gct	p.P1333A	SHANK3_ENST00000262795.3_Missense_Mutation_p.P1363A|SHANK3_ENST00000445220.2_Missense_Mutation_p.P1349A			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1347	Pro-rich.		V -> G. {ECO:0000269|PubMed:20385823}.		adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TGAGCCACCCCCTGCCCCTGA	0.711																																					p.P1333A		.											.	SHANK3-69	0			c.C3997G						.						8.0	10.0	9.0					22																	51160300		1900	4008	5908	SO:0001583	missense	85358	exon21			CCACCCCCTGCCC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3997C>G	22.37:g.51160300C>G	ENSP00000464552:p.Pro1333Ala	34	0		36	10	NM_033517	0	0	0	0	0	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	C	15.71	2.913103	0.52439	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.18960	2.18;2.18	5.11	5.11	0.69529	.	0.073236	0.56097	D	0.000028	T	0.28167	0.0695	M	0.78456	2.415	0.28658	N	0.906287	B;B;B	0.28512	0.176;0.096;0.214	B;B;B	0.25884	0.064;0.036;0.052	T	0.13683	-1.0500	10	0.34782	T	0.22	.	16.0382	0.80645	0.0:1.0:0.0:0.0	.	1347;1348;1363	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	A	1363;1349	ENSP00000442518:P1363A;ENSP00000446078:P1349A	ENSP00000442518:P1363A	P	+	1	0	SHANK3	49507166	0.230000	0.23740	0.974000	0.42286	0.986000	0.74619	1.882000	0.39648	2.381000	0.81170	0.462000	0.41574	CCT	.		0.711	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
FYCO1	79443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	46009857	46009857	+	Missense_Mutation	SNP	C	C	A	rs372875711		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:46009857C>A	ENST00000296137.2	-	8	1174	c.969G>T	c.(967-969)gaG>gaT	p.E323D	FYCO1_ENST00000535325.1_Missense_Mutation_p.E323D	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	323					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CTGCTCCTAGCTCCAGGCCCT	0.627																																					p.E323D		.											.	FYCO1-91	0			c.G969T						.						71.0	64.0	66.0					3																	46009857		2203	4300	6503	SO:0001583	missense	79443	exon8			TCCTAGCTCCAGG	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.969G>T	3.37:g.46009857C>A	ENSP00000296137:p.Glu323Asp	79	0		47	11	NM_024513	0	0	5	9	4	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822936	0.71028	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.28454	1.61;1.69	5.66	5.66	0.87406	.	0.237259	0.43260	D	0.000588	T	0.42539	0.1207	M	0.67953	2.075	0.34032	D	0.653899	D;P	0.63880	0.993;0.932	P;B	0.56127	0.792;0.362	T	0.54390	-0.8301	10	0.28530	T	0.3	-23.5428	8.7704	0.34728	0.0:0.8728:0.0:0.1272	.	323;323	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	D	323	ENSP00000296137:E323D;ENSP00000441178:E323D	ENSP00000296137:E323D	E	-	3	2	FYCO1	45984861	0.931000	0.31567	0.984000	0.44739	0.507000	0.33981	1.633000	0.37113	2.671000	0.90904	0.655000	0.94253	GAG	.		0.627	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
RBM5	10181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50155814	50155814	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:50155814T>A	ENST00000347869.3	+	25	2548	c.2373T>A	c.(2371-2373)taT>taA	p.Y791*	RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	791	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCAGCGCATATGGTTTGTCGG	0.557																																					p.Y791X		.											.	RBM5-278	0			c.T2373A						.						93.0	81.0	85.0					3																	50155814		2203	4300	6503	SO:0001587	stop_gained	10181	exon25			CGCATATGGTTTG	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.2373T>A	3.37:g.50155814T>A	ENSP00000343054:p.Tyr791*	172	0		150	63	NM_005778	0	0	28	43	15	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Nonsense_Mutation	SNP	ENST00000347869.3	37	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	T	35	5.436728	0.96168	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	.	.	.	5.56	0.508	0.16972	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.522	10.6385	0.45579	0.0:0.4157:0.0:0.5843	.	.	.	.	X	791;790;481	.	ENSP00000343054:Y791X	Y	+	3	2	RBM5	50130818	0.435000	0.25577	0.988000	0.46212	0.413000	0.31143	-0.355000	0.07671	0.075000	0.16796	0.528000	0.53228	TAT	.		0.557	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
KIAA1524	57650	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108288411	108288411	+	Missense_Mutation	SNP	C	C	T	rs375108755		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:108288411C>T	ENST00000295746.8	-	9	1014	c.938G>A	c.(937-939)cGc>cAc	p.R313H	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.R154H	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	313					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GAGCATATGGCGCAGCTGAGT	0.418																																					p.R313H													.	KIAA1524-92	0			c.G938A						.	C	HIS/ARG	0,4406		0,0,2203	59.0	56.0	57.0		938	5.8	1.0	3		57	1,8597	1.2+/-3.3	0,1,4298	no	missense	KIAA1524	NM_020890.2	29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	313/906	108288411	1,13003	2203	4299	6502	SO:0001583	missense	57650	exon9			ATATGGCGCAGCT	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.938G>A	3.37:g.108288411C>T	ENSP00000295746:p.Arg313His	195	2		276	111	NM_020890	0	0	0	0	0	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	33	5.255797	0.95336	0.0	1.16E-4	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.14391	2.51;2.65	5.85	5.85	0.93711	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.38719	0.1051	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04103	-1.0977	10	0.87932	D	0	-5.9074	18.3439	0.90314	0.0:1.0:0.0:0.0	.	313	Q8TCG1	CIP2A_HUMAN	H	154;313	ENSP00000419487:R154H;ENSP00000295746:R313H	ENSP00000295746:R313H	R	-	2	0	KIAA1524	109771101	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.424000	0.73366	2.773000	0.95371	0.655000	0.94253	CGC	.		0.418	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	
CFAP44	55779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113120585	113120585	+	Splice_Site	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:113120585A>C	ENST00000295868.2	-	10	1334	c.1172T>G	c.(1171-1173)aTa>aGa	p.I391R	WDR52-AS1_ENST00000498480.1_RNA|WDR52_ENST00000393845.2_Splice_Site_p.I391R|WDR52-AS1_ENST00000473329.1_RNA	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						AAAATCCCATATCTTGTAAAA	0.308																																					p.I391R		.											.	WDR52-90	0			c.T1172G						.						60.0	60.0	60.0					3																	113120585		2203	4298	6501	SO:0001630	splice_region_variant	55779	exon10			TCCCATATCTTGT																												ENST00000295868.2:c.1171-1T>G	3.37:g.113120585A>C		38	0		81	36	NM_001164496	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295868.2	37	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	A	19.49	3.838251	0.71373	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.70631	-0.5;3.01	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.79446	0.4447	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	P	0.59012	0.85	T	0.81839	-0.0748	9	0.87932	D	0	.	15.8341	0.78787	1.0:0.0:0.0:0.0	.	391	Q96MT7	WDR52_HUMAN	R	391	ENSP00000377428:I391R;ENSP00000295868:I391R	ENSP00000295868:I391R	I	-	2	0	WDR52	114603275	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.300000	0.59079	2.144000	0.66660	0.533000	0.62120	ATA	.		0.308	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		Missense_Mutation
KALRN	8997	broad.mit.edu	37	3	124209630	124209630	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:124209630C>T	ENST00000240874.3	+	30	4637	c.4480C>T	c.(4480-4482)Cgg>Tgg	p.R1494W	KALRN_ENST00000360013.3_Missense_Mutation_p.R1494W|KALRN_ENST00000460856.1_Missense_Mutation_p.R1485W	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1494	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCGGAAGGGGCGGGAGCGGCA	0.488																																					p.R1494W													.	KALRN-738	0			c.C4480T						.						74.0	82.0	79.0					3																	124209630		2203	4300	6503	SO:0001583	missense	8997	exon30			AAGGGGCGGGAGC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4480C>T	3.37:g.124209630C>T	ENSP00000240874:p.Arg1494Trp	77	0		80	5	NM_003947	0	0	0	0	0	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974277	0.74246	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.12147	2.71;2.71;2.71	5.28	5.28	0.74379	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.47838	0.1467	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.987;1.0	T	0.56739	-0.7929	10	0.87932	D	0	.	19.1106	0.93315	0.0:1.0:0.0:0.0	.	1485;1494;1494	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	W	1485;1494;1494	ENSP00000418611:R1485W;ENSP00000240874:R1494W;ENSP00000353109:R1494W	ENSP00000240874:R1494W	R	+	1	2	KALRN	125692320	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	3.539000	0.53604	2.763000	0.94921	0.650000	0.86243	CGG	.		0.488	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
ACKR4	51554	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132319273	132319273	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:132319273A>C	ENST00000249887.2	+	2	128	c.32A>C	c.(31-33)tAt>tCt	p.Y11S	ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000545291.1_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	11					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										TCAACAGATTATTATTATGAG	0.343																																					p.Y11S													.	CCRL1-658	0			c.A32C						.						26.0	27.0	27.0					3																	132319273		2200	4297	6497	SO:0001583	missense	51554	exon1			CAGATTATTATTA	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.32A>C	3.37:g.132319273A>C	ENSP00000249887:p.Tyr11Ser	196	1		231	84	NM_178445	0	0	0	1	1	B2R9U7	Missense_Mutation	SNP	ENST00000249887.2	37	CCDS3075.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.190302	0.38707	.	.	ENSG00000129048	ENST00000249887;ENST00000424114	T	0.35048	1.33	5.22	5.22	0.72569	.	0.306400	0.31949	N	0.006803	T	0.26085	0.0636	L	0.43152	1.355	0.48511	D	0.999662	P	0.39480	0.675	B	0.33121	0.158	T	0.05257	-1.0896	10	0.21540	T	0.41	.	10.5061	0.44834	0.8378:0.1622:0.0:0.0	.	11	Q9NPB9	CCRL1_HUMAN	S	11	ENSP00000249887:Y11S	ENSP00000249887:Y11S	Y	+	2	0	CCRL1	133801963	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.519000	0.67074	1.970000	0.57323	0.482000	0.46254	TAT	.		0.343	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
MYNN	55892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	169496621	169496621	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:169496621G>A	ENST00000349841.5	+	3	995	c.332G>A	c.(331-333)tGc>tAc	p.C111Y	MYNN_ENST00000544106.1_Missense_Mutation_p.C111Y|RP11-362K14.5_ENST00000602342.1_RNA|MYNN_ENST00000392733.1_Missense_Mutation_p.C111Y|MYNN_ENST00000356716.4_Missense_Mutation_p.C111Y	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			GTCACTAAATGCAAAATAAAG	0.348																																					p.C111Y		.											.	MYNN-91	0			c.G332A						.						92.0	98.0	96.0					3																	169496621		2203	4300	6503	SO:0001583	missense	55892	exon4			CTAAATGCAAAAT	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.332G>A	3.37:g.169496621G>A	ENSP00000326240:p.Cys111Tyr	75	0		81	32	NM_001185118	0	0	0	2	2	B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Missense_Mutation	SNP	ENST00000349841.5	37	CCDS3207.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352343	0.61293	.	.	ENSG00000085274	ENST00000356716;ENST00000349841;ENST00000392733;ENST00000544106	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.54	5.54	0.83059	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	H	0.98802	4.335	0.49915	D	0.999837	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.992	D	0.95900	0.8914	10	0.87932	D	0	.	19.4966	0.95075	0.0:0.0:1.0:0.0	.	111;111	Q9NPC7-2;Q9NPC7	.;MYNN_HUMAN	Y	111	ENSP00000349150:C111Y;ENSP00000326240:C111Y;ENSP00000376492:C111Y;ENSP00000440637:C111Y	ENSP00000326240:C111Y	C	+	2	0	MYNN	170979315	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.825000	0.69286	2.616000	0.88540	0.650000	0.86243	TGC	.		0.348	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657	
KNG1	3827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	186435425	186435425	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:186435425G>T	ENST00000265023.4	+	1	306	c.94G>T	c.(94-96)Gat>Tat	p.D32Y	RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000287611.2_Missense_Mutation_p.D32Y|KNG1_ENST00000447445.1_Missense_Mutation_p.D32Y	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	32	Cystatin kininogen-type 1. {ECO:0000255|PROSITE-ProRule:PRU00979}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		CAATGACAAGGATTTATTTAA	0.393																																					p.D32Y		.											.	KNG1-92	0			c.G94T						.						119.0	121.0	121.0					3																	186435425		2203	4299	6502	SO:0001583	missense	3827	exon1			GACAAGGATTTAT		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.94G>T	3.37:g.186435425G>T	ENSP00000265023:p.Asp32Tyr	129	0		157	37	NM_000893	0	0	0	0	0	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	37	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192786	0.38707	.	.	ENSG00000113889	ENST00000287611;ENST00000265023;ENST00000447445;ENST00000432028	T;T;T	0.29655	1.56;1.56;1.56	5.2	4.31	0.51392	Proteinase inhibitor I25, cystatin (2);	0.603229	0.15391	N	0.264803	T	0.51805	0.1696	M	0.71581	2.175	0.22017	N	0.999412	D;D	0.89917	0.994;1.0	D;D	0.72075	0.976;0.975	T	0.39014	-0.9634	10	0.51188	T	0.08	-6.5792	10.4191	0.44340	0.0929:0.0:0.9071:0.0	.	32;32	P01042;P01042-2	KNG1_HUMAN;.	Y	32;32;32;20	ENSP00000287611:D32Y;ENSP00000265023:D32Y;ENSP00000396025:D32Y	ENSP00000265023:D32Y	D	+	1	0	KNG1	187918119	0.221000	0.23642	0.035000	0.18076	0.403000	0.30841	2.124000	0.42006	1.302000	0.44855	0.455000	0.32223	GAT	.		0.393	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
CPZ	8532	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	8607801	8607801	+	Silent	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr4:8607801G>C	ENST00000360986.4	+	5	969	c.795G>C	c.(793-795)ctG>ctC	p.L265L	CPZ_ENST00000382480.2_Silent_p.L128L|CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_Silent_p.L254L	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	265					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCCAGTACCTGTGCTCTGAGT	0.607																																					p.L265L													.	CPZ-93	0			c.G795C						.						147.0	112.0	124.0					4																	8607801		2203	4300	6503	SO:0001819	synonymous_variant	8532	exon5			GTACCTGTGCTCT	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.795G>C	4.37:g.8607801G>C		175	1		206	71	NM_001014447	0	0	0	0	0	O00520|Q96MX2	Silent	SNP	ENST00000360986.4	37	CCDS33953.1																																																																																			.		0.607	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
TBC1D19	55296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	26585819	26585819	+	Silent	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr4:26585819T>C	ENST00000264866.4	+	1	282	c.4T>C	c.(4-6)Ttg>Ctg	p.L2L	TBC1D19_ENST00000511789.1_Silent_p.L2L	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	2							Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				AGGGGAAATGTTGCAGGAGGA	0.627																																					p.L2L		.											.	TBC1D19-153	0			c.T4C						.						44.0	45.0	45.0					4																	26585819		2203	4298	6501	SO:0001819	synonymous_variant	55296	exon1			GAAATGTTGCAGG	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.4T>C	4.37:g.26585819T>C		54	0		70	29	NM_018317	0	0	1	2	1	B9A6M0|Q9NUX1	Silent	SNP	ENST00000264866.4	37	CCDS3439.1																																																																																			.		0.627	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	
N4BP2	55728	ucsc.edu	37	4	40122111	40122111	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr4:40122111G>A	ENST00000261435.6	+	9	2796	c.2380G>A	c.(2380-2382)Gat>Aat	p.D794N		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	794					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CTGGCCAGTTGATAAGACTAT	0.363																																					p.D794N													.	N4BP2-602	0			c.G2380A						.						49.0	50.0	50.0					4																	40122111		2203	4299	6502	SO:0001583	missense	55728	exon9			CCAGTTGATAAGA	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2380G>A	4.37:g.40122111G>A	ENSP00000261435:p.Asp794Asn	26	0		45	4	NM_018177	0	0	0	0	0	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067078	0.76301	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.20881	2.04	5.64	5.64	0.86602	.	0.119478	0.53938	D	0.000057	T	0.31949	0.0813	L	0.56769	1.78	0.39414	D	0.966804	P;P	0.46142	0.873;0.799	P;B	0.47346	0.544;0.343	T	0.06075	-1.0847	10	0.72032	D	0.01	-15.067	16.7169	0.85399	0.0:0.1289:0.8711:0.0	.	794;794	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	N	794;714	ENSP00000261435:D794N	ENSP00000261435:D794N	D	+	1	0	N4BP2	39798506	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.227000	0.58612	2.681000	0.91329	0.561000	0.74099	GAT	.		0.363	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
GRSF1	2926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71702003	71702003	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr4:71702003A>G	ENST00000254799.6	-	2	503	c.386T>C	c.(385-387)cTt>cCt	p.L129P	GRSF1_ENST00000439371.1_5'UTR|GRSF1_ENST00000545193.1_Missense_Mutation_p.L11P|GRSF1_ENST00000508091.1_5'UTR|GRSF1_ENST00000502323.1_5'UTR	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	129	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GGGTGGTGGAAGGTCTTCCAG	0.413																																					p.L129P		.											.	.	0			c.T386C						.						82.0	84.0	83.0					4																	71702003		1848	4089	5937	SO:0001583	missense	2926	exon2			GGTGGAAGGTCTT	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.386T>C	4.37:g.71702003A>G	ENSP00000254799:p.Leu129Pro	141	0		154	46	NM_002092	0	0	15	30	15	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.72|14.72	2.619082|2.619082	0.46736|0.46736	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000514161|ENST00000254799;ENST00000540657;ENST00000499044;ENST00000545193	.|T;T;T	.|0.21734	.|2.05;2.03;1.99	4.51|4.51	4.51|4.51	0.55191|0.55191	.|RNA recognition motif domain (1);	.|0.718315	.|0.12425	.|N	.|0.470117	T|T	0.15998|0.15998	0.0385|0.0385	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P;P	.|0.47350	.|0.79;0.894	.|B;P	.|0.45037	.|0.202;0.467	T|T	0.02917|0.02917	-1.1094|-1.1094	5|10	.|0.45353	.|T	.|0.12	-2.599|-2.599	5.3313|5.3313	0.15934|0.15934	0.6438:0.1816:0.0:0.1746|0.6438:0.1816:0.0:0.1746	.|.	.|42;129	.|B7Z5F9;Q12849	.|.;GRSF1_HUMAN	L|P	66|129;61;102;11	.|ENSP00000254799:L129P;ENSP00000427354:L102P;ENSP00000443380:L11P	.|ENSP00000254799:L129P	F|L	-|-	1|2	0|0	GRSF1|GRSF1	71920867|71920867	0.827000|0.827000	0.29292|0.29292	0.959000|0.959000	0.39883|0.39883	0.674000|0.674000	0.39518|0.39518	3.964000|3.964000	0.56780|0.56780	1.881000|1.881000	0.54492|0.54492	0.533000|0.533000	0.62120|0.62120	TTC|CTT	.		0.413	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
TBC1D9	23158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	141600812	141600812	+	Silent	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr4:141600812G>A	ENST00000442267.2	-	4	620	c.546C>T	c.(544-546)agC>agT	p.S182S		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	182	GRAM 1.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				GGTGGTTAATGCTGAGGTACA	0.448																																					p.S182S		.											.	TBC1D9-23	0			c.C546T						.						69.0	67.0	67.0					4																	141600812		1837	4092	5929	SO:0001819	synonymous_variant	23158	exon4			GTTAATGCTGAGG	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.546C>T	4.37:g.141600812G>A		61	0		82	30	NM_015130	0	0	1	3	2	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	37	CCDS47136.1																																																																																			.		0.448	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38418272	38418272	+	Silent	SNP	C	C	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr5:38418272C>A	ENST00000354891.3	+	12	1945	c.1599C>A	c.(1597-1599)ggC>ggA	p.G533G	EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Silent_p.G299G|EGFLAM_ENST00000322350.5_Silent_p.G533G	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	533	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GCTTTCAAGGCTGTGTGCAGT	0.542																																					p.G533G	Colon(62;485 1295 3347 17454)	.											.	EGFLAM-187	0			c.C1599A						.						96.0	100.0	98.0					5																	38418272		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon12			TCAAGGCTGTGTG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1599C>A	5.37:g.38418272C>A		153	0		120	35	NM_001205301	0	0	0	0	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.542	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
DAB2	1601	broad.mit.edu	37	5	39383200	39383200	+	Silent	SNP	A	A	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr5:39383200A>G	ENST00000320816.6	-	10	1328	c.861T>C	c.(859-861)ttT>ttC	p.F287F	DAB2_ENST00000339788.6_Intron|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000545653.1_Silent_p.F266F|DAB2_ENST00000509337.1_Silent_p.F266F	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	287	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TAGGGGTGGGAAAGAAGTTGA	0.473																																					p.F287F													.	DAB2-227	0			c.T861C						.						143.0	150.0	148.0					5																	39383200		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon10			GGTGGGAAAGAAG	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.861T>C	5.37:g.39383200A>G		182	0		183	6	NM_001343	0	0	27	28	1	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																			.		0.473	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	89979468	89979468	+	Silent	SNP	T	T	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr5:89979468T>C	ENST00000405460.2	+	28	5826	c.5730T>C	c.(5728-5730)gaT>gaC	p.D1910D		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1910	Calx-beta 13. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTGATCCTGATGGTGATCTCG	0.418																																					p.D1910D		.											.	GPR98-103	0			c.T5730C						.						69.0	70.0	70.0					5																	89979468		1951	4141	6092	SO:0001819	synonymous_variant	84059	exon28			TCCTGATGGTGAT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5730T>C	5.37:g.89979468T>C		97	0		108	38	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1																																																																																			.		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
STK10	6793	hgsc.bcm.edu	37	5	171471934	171471934	+	Silent	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr5:171471934T>G	ENST00000176763.5	-	19	3202	c.2859A>C	c.(2857-2859)ccA>ccC	p.P953P		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	953					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CGGCCTTGCTTGGGGTGGAGG	0.607																																					p.P953P		.											.	STK10-1022	0			c.A2859C						.						83.0	77.0	79.0					5																	171471934		2203	4300	6503	SO:0001819	synonymous_variant	6793	exon19			CTTGCTTGGGGTG	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2859A>C	5.37:g.171471934T>G		95	0		98	5	NM_005990	0	0	8	8	0	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	CCDS34290.1																																																																																			.		0.607	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32038155	32038155	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:32038155C>T	ENST00000375244.3	-	14	5228	c.5027G>A	c.(5026-5028)cGc>cAc	p.R1676H	TNXB_ENST00000375247.2_Missense_Mutation_p.R1676H			P22105	TENX_HUMAN	tenascin XB	1758	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTCCCCAAGGCGGGGTGGGGC	0.597																																					p.R1676H		.											.	TNXB-90	0			c.G5027A						.						14.0	16.0	15.0					6																	32038155		1903	4094	5997	SO:0001583	missense	7148	exon14			CCAAGGCGGGGTG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5027G>A	6.37:g.32038155C>T	ENSP00000364393:p.Arg1676His	49	0		82	27	NM_019105	0	0	1	1	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	11.28	1.593489	0.28357	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04603	3.59;3.59	4.34	0.318	0.15867	.	0.470849	0.16112	N	0.229047	T	0.03263	0.0095	M	0.88241	2.94	0.23773	N	0.996888	B	0.26775	0.159	B	0.23716	0.048	T	0.22173	-1.0224	10	0.49607	T	0.09	.	8.1222	0.30978	0.0:0.6178:0.0:0.3822	.	1676	P22105-3	.	H	1676	ENSP00000364393:R1676H;ENSP00000364396:R1676H	ENSP00000364393:R1676H	R	-	2	0	TNXB	32146133	0.991000	0.36638	0.989000	0.46669	0.365000	0.29674	0.675000	0.25232	0.160000	0.19432	-0.302000	0.09304	CGC	.		0.597	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51768400	51768400	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:51768400T>G	ENST00000371117.3	-	43	7266	c.6991A>C	c.(6991-6993)Ata>Cta	p.I2331L	PKHD1_ENST00000340994.4_Missense_Mutation_p.I2331L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2331			I -> K (in ARPKD). {ECO:0000269|PubMed:11919560, ECO:0000269|PubMed:12506140}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTTACCTCTATAACATTGGTG	0.478																																					p.I2331L		.											.	PKHD1-603	0			c.A6991C						.						173.0	163.0	167.0					6																	51768400		2203	4300	6503	SO:0001583	missense	5314	exon43			CCTCTATAACATT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6991A>C	6.37:g.51768400T>G	ENSP00000360158:p.Ile2331Leu	97	0		118	41	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	7.897	0.733493	0.15574	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.82803	-1.65;-1.65	5.87	-2.49	0.06403	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.766468	0.11605	N	0.547353	T	0.44074	0.1276	N	0.12182	0.205	0.09310	N	1	B;B;B	0.15141	0.012;0.006;0.012	B;B;B	0.17722	0.008;0.007;0.019	T	0.39440	-0.9614	10	0.44086	T	0.13	.	6.1429	0.20269	0.0:0.2716:0.2385:0.4899	.	2331;2331;2331	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	L	2331	ENSP00000360158:I2331L;ENSP00000341097:I2331L	ENSP00000341097:I2331L	I	-	1	0	PKHD1	51876359	0.002000	0.14202	0.004000	0.12327	0.326000	0.28443	-0.160000	0.10041	-0.465000	0.06953	0.528000	0.53228	ATA	.		0.478	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
MDN1	23195	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90459294	90459294	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:90459294G>A	ENST00000369393.3	-	25	3698	c.3583C>T	c.(3583-3585)Caa>Taa	p.Q1195*	MDN1_ENST00000428876.1_Nonsense_Mutation_p.Q1195*			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1195					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGGGGATTTTGGGTGGCAAAA	0.413																																					p.Q1195X													.	MDN1-100	0			c.C3583T						.						157.0	170.0	166.0					6																	90459294		2203	4300	6503	SO:0001587	stop_gained	23195	exon25			GATTTTGGGTGGC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3583C>T	6.37:g.90459294G>A	ENSP00000358400:p.Gln1195*	138	1		138	70	NM_014611	0	0	0	0	0	O15019|Q5T794	Nonsense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	41	9.048239	0.99048	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.1649	0.98147	0.0:0.0:1.0:0.0	.	.	.	.	X	1195;1195;1122	.	ENSP00000358400:Q1195X	Q	-	1	0	MDN1	90516015	1.000000	0.71417	0.939000	0.37840	0.819000	0.46315	9.378000	0.97191	2.753000	0.94483	0.655000	0.94253	CAA	.		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
BBS9	27241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	33380559	33380559	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr7:33380559G>C	ENST00000242067.6	+	11	1770	c.1249G>C	c.(1249-1251)Gtt>Ctt	p.V417L	BBS9_ENST00000355070.2_Missense_Mutation_p.V417L|BBS9_ENST00000350941.3_Missense_Mutation_p.V417L|BBS9_ENST00000354265.4_Missense_Mutation_p.V417L|BBS9_ENST00000396127.2_Missense_Mutation_p.V417L	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	417					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TTCTGTCGTGGTTTCTCCTAA	0.338									Bardet-Biedl syndrome																												p.V417L		.											.	BBS9-230	0			c.G1249C						.						187.0	175.0	179.0					7																	33380559		2203	4300	6503	SO:0001583	missense	27241	exon11	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	GTCGTGGTTTCTC		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1249G>C	7.37:g.33380559G>C	ENSP00000242067:p.Val417Leu	19	0		94	34	NM_014451	0	0	4	9	5	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515586	0.44763	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000537775	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.62723	1.935	0.80722	D	1	P;P;B;P	0.34864	0.473;0.473;0.245;0.473	B;B;B;B	0.42112	0.133;0.376;0.169;0.376	T	0.82524	-0.0414	10	0.31617	T	0.26	-21.4487	12.2466	0.54574	0.0859:0.0:0.9141:0.0	.	417;417;417;417	Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;PTHB1_HUMAN	L	417;417;417;417;417;417;417;295	ENSP00000242067:V417L;ENSP00000313122:V417L;ENSP00000379433:V417L;ENSP00000347182:V417L;ENSP00000346214:V417L	ENSP00000242067:V417L	V	+	1	0	BBS9	33347084	0.998000	0.40836	0.341000	0.25589	0.957000	0.61999	3.026000	0.49689	2.433000	0.82419	0.650000	0.86243	GTT	.		0.338	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
GBAS	2631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	56046042	56046042	+	Splice_Site	SNP	G	G	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr7:56046042G>C	ENST00000322090.3	+	3	261		c.e3-1		GBAS_ENST00000487370.1_Splice_Site|GBAS_ENST00000446778.1_Intron	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence						ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTTTGTTTCAGTTCACAATGT	0.323																																					.		.											.	GBAS-514	0			c.233-1G>C						.						178.0	160.0	166.0					7																	56046042		2203	4300	6503	SO:0001630	splice_region_variant	2631	exon3			GTTTCAGTTCACA	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.233-1G>C	7.37:g.56046042G>C		102	0		213	89	NM_001483	0	0	0	0	0	C9IYJ3|O43801|Q53X96	Splice_Site	SNP	ENST00000322090.3	37	CCDS5521.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279038	0.80692	.	.	ENSG00000146729	ENST00000322090	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0588	0.93078	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GBAS	56013536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.510000	0.98004	2.744000	0.94065	0.655000	0.94253	.	.		0.323	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483	Intron
SLC13A4	26266	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	135370357	135370357	+	Silent	SNP	C	C	A	rs375873088	byFrequency	TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr7:135370357C>A	ENST00000354042.4	-	14	2207	c.1518G>T	c.(1516-1518)ctG>ctT	p.L506L	C7orf73_ENST00000422968.1_Intron|SLC13A4_ENST00000491630.1_5'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	506					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TGCATGCCAGCAGGGTGACAG	0.552																																					p.L506L													.	SLC13A4-90	0			c.G1518T						.						200.0	174.0	183.0					7																	135370357		2203	4300	6503	SO:0001819	synonymous_variant	26266	exon14			TGCCAGCAGGGTG	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1518G>T	7.37:g.135370357C>A		157	1		243	88	NM_012450	0	0	0	0	0	A4D1Q4|Q8N631	Silent	SNP	ENST00000354042.4	37	CCDS5840.1																																																																																			.		0.552	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
KMT2C	58508	broad.mit.edu	37	7	151921114	151921114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr7:151921114A>T	ENST00000262189.6	-	20	3527	c.3309T>A	c.(3307-3309)tgT>tgA	p.C1103*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C1103*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1103					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C1103*(10)									CACATTGTCTACATTGCAGAA	0.338																																					p.C1103X													.	MLL3-1398	10	Substitution - Nonsense(10)	kidney(6)|endometrium(4)	c.T3309A						.						56.0	51.0	52.0					7																	151921114		2203	4300	6503	SO:0001587	stop_gained	58508	exon20			TTGTCTACATTGC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3309T>A	7.37:g.151921114A>T	ENSP00000262189:p.Cys1103*	239	1		450	9	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	41	8.814636	0.98964	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.39	-2.79	0.05841	.	0.000000	0.50627	D	0.000105	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2367	0.59972	0.4373:0.0:0.5627:0.0	rs4024337	.	.	.	X	1103	.	ENSP00000262189:C1103X	C	-	3	2	MLL3	151552047	0.735000	0.28153	0.983000	0.44433	0.992000	0.81027	-0.154000	0.10130	-0.431000	0.07307	0.528000	0.53228	TGT	.		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ANK1	286	broad.mit.edu;bcgsc.ca	37	8	41582026	41582026	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr8:41582026T>G	ENST00000347528.4	-	7	742	c.659A>C	c.(658-660)aAc>aCc	p.N220T	ANK1_ENST00000396945.1_Missense_Mutation_p.N220T|ANK1_ENST00000396942.1_Missense_Mutation_p.N220T|ANK1_ENST00000352337.4_Missense_Mutation_p.N220T|ANK1_ENST00000289734.7_Missense_Mutation_p.N220T|ANK1_ENST00000265709.8_Missense_Mutation_p.N253T|ANK1_ENST00000379758.2_Missense_Mutation_p.N220T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	220	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGGGCCACGTTGAGGTTCTC	0.572																																					p.N253T													.	ANK1-716	0			c.A758C						.						37.0	34.0	35.0					8																	41582026		2203	4300	6503	SO:0001583	missense	286	exon7			GCCACGTTGAGGT	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.659A>C	8.37:g.41582026T>G	ENSP00000339620:p.Asn220Thr	54	0		42	7	NM_001142446	0	0	0	0	0	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.989986	0.74589	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.52	3.08	0.35506	Ankyrin repeat-containing domain (3);	0.145630	0.64402	D	0.000018	T	0.53965	0.1829	N	0.25094	0.71	0.80722	D	1	P;P;P;P;P	0.44690	0.586;0.841;0.699;0.651;0.538	P;P;B;P;P	0.49561	0.615;0.615;0.358;0.582;0.492	T	0.53620	-0.8413	10	0.72032	D	0.01	.	8.5499	0.33444	0.0:0.257:0.0:0.743	.	253;220;220;220;220	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	T	220;220;220;220;220;220;253;220	ENSP00000339620:N220T;ENSP00000289734:N220T;ENSP00000369082:N220T;ENSP00000380149:N220T;ENSP00000380147:N220T;ENSP00000309131:N220T;ENSP00000265709:N253T	ENSP00000265709:N253T	N	-	2	0	ANK1	41701183	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	2.870000	0.48451	0.361000	0.24292	-0.417000	0.06048	AAC	.		0.572	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
TRPM6	140803	broad.mit.edu	37	9	77448994	77448994	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr9:77448994G>A	ENST00000360774.1	-	6	826	c.589C>T	c.(589-591)Cat>Tat	p.H197Y	TRPM6_ENST00000361255.3_Missense_Mutation_p.H192Y|TRPM6_ENST00000449912.2_Missense_Mutation_p.H192Y|TRPM6_ENST00000451710.3_Missense_Mutation_p.H197Y|TRPM6_ENST00000376871.3_Missense_Mutation_p.H197Y|TRPM6_ENST00000376864.4_Missense_Mutation_p.H197Y|TRPM6_ENST00000359047.2_Missense_Mutation_p.H197Y|TRPM6_ENST00000376872.3_Missense_Mutation_p.H197Y|TRPM6_ENST00000483186.1_5'Flank	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	197					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CTCAAGGAATGAGAGGAATGG	0.408																																					p.H197Y													.	TRPM6-335	0			c.C589T						.						134.0	124.0	127.0					9																	77448994		2203	4300	6503	SO:0001583	missense	140803	exon6			AGGAATGAGAGGA	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.589C>T	9.37:g.77448994G>A	ENSP00000354006:p.His197Tyr	134	0		175	5	NM_017662	0	0	0	0	0	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592060	0.28357	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864;ENST00000359047	T;T;T;T;T;T;T;T	0.02974	4.09;4.09;4.09;4.09;4.09;4.09;4.09;4.09	5.84	4.9	0.64082	.	0.532611	0.23708	N	0.045358	T	0.03136	0.0092	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;P	0.35600	0.037;0.037;0.011;0.027;0.323;0.511	B;B;B;B;B;B	0.36464	0.058;0.01;0.006;0.015;0.162;0.225	T	0.39078	-0.9631	10	0.72032	D	0.01	.	14.2191	0.65812	0.0:0.0:0.8037:0.1963	.	197;197;197;197;197;192	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q96LV9;Q9BX84;Q9BX84-3	.;.;.;.;TRPM6_HUMAN;.	Y	197;197;197;197;192;192;196;197;197	ENSP00000354006:H197Y;ENSP00000407341:H197Y;ENSP00000366068:H197Y;ENSP00000366067:H197Y;ENSP00000396672:H192Y;ENSP00000354962:H192Y;ENSP00000366060:H197Y;ENSP00000351942:H197Y	ENSP00000351942:H197Y	H	-	1	0	TRPM6	76638814	0.546000	0.26457	0.283000	0.24790	0.960000	0.62799	3.317000	0.51968	1.325000	0.45301	0.491000	0.48974	CAT	.		0.408	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
GOLGA2	2801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131021446	131021446	+	Splice_Site	SNP	C	C	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr9:131021446C>T	ENST00000421699.2	-	19	2028	c.2016G>A	c.(2014-2016)caG>caA	p.Q672Q	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Splice_Site_p.Q660Q	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	672					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						ACTCCCTCACCTGGGTTTCCT	0.632																																					p.Q672Q		.											.	GOLGA2-91	0			c.G2016A						.						42.0	46.0	45.0					9																	131021446		2203	4300	6503	SO:0001630	splice_region_variant	2801	exon19			CCTCACCTGGGTT	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2016+1G>A	9.37:g.131021446C>T		73	0		61	22	NM_004486	0	0	0	1	1	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	CCDS6896.2																																																																																			.		0.632	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	Silent
C9orf78	51759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132593305	132593305	+	Silent	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr9:132593305G>T	ENST00000372447.3	-	6	440	c.387C>A	c.(385-387)atC>atA	p.I129I	C9orf78_ENST00000461762.1_5'UTR	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78	129						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				CATGTTCCACGATCCCTTTCC	0.478																																					p.I129I													.	C9orf78-90	0			c.C387A						.						180.0	159.0	166.0					9																	132593305		2203	4300	6503	SO:0001819	synonymous_variant	51759	exon6			TTCCACGATCCCT	BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.387C>A	9.37:g.132593305G>T		151	0		123	45	NM_016520	0	0	13	30	17	B3KPX8|Q8WVU6|Q9NT39	Silent	SNP	ENST00000372447.3	37	CCDS6931.1																																																																																			.		0.478	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054625.1	NM_016520	
WWC3	55841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	10066562	10066562	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chrX:10066562A>C	ENST00000380861.4	+	8	1065	c.674A>C	c.(673-675)aAa>aCa	p.K225T	WWC3_ENST00000454666.1_Missense_Mutation_p.K225T	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	225					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TTTGATGATAAAACAAGACTT	0.353																																					p.K225T		.											.	WWC3-134	0			c.A674C						.						78.0	73.0	75.0					X																	10066562		2203	4300	6503	SO:0001583	missense	55841	exon8			ATGATAAAACAAG	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.674A>C	X.37:g.10066562A>C	ENSP00000370242:p.Lys225Thr	25	0		38	27	NM_015691	0	0	0	6	6	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155337	0.57259	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.05199	3.48;3.48	5.49	5.49	0.81192	.	0.217302	0.48286	D	0.000185	T	0.07954	0.0199	L	0.51422	1.61	0.39975	D	0.974846	P	0.39424	0.673	B	0.37144	0.242	T	0.38845	-0.9642	10	0.19590	T	0.45	-27.9526	14.6222	0.68594	1.0:0.0:0.0:0.0	.	225	Q9ULE0	WWC3_HUMAN	T	225	ENSP00000370242:K225T;ENSP00000399584:K225T	ENSP00000370242:K225T	K	+	2	0	WWC3	10026562	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.309000	0.51903	1.834000	0.53371	0.339000	0.21740	AAA	.		0.353	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
SSX5	6758	broad.mit.edu	37	X	48054486	48054486	+	Intron	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chrX:48054486G>T	ENST00000376923.1	-	2	69				SSX5_ENST00000347757.1_Intron|SSX5_ENST00000311798.1_Missense_Mutation_p.A50D			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						AATGCTGCTGGCTGGCTCTCT	0.522																																					p.A50D													.	SSX5-90	0			c.C149A						.						68.0	59.0	62.0					X																	48054486		2203	4299	6502	SO:0001627	intron_variant	6758	exon3			CTGCTGGCTGGCT	BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.70-196C>A	X.37:g.48054486G>T		236	1		260	6	NM_021015	0	0	0	0	0	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	37	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	7.535	0.659410	0.14645	.	.	ENSG00000165583	ENST00000311798	T	0.10288	2.89	1.18	0.234	0.15390	.	.	.	.	.	T	0.04724	0.0128	.	.	.	0.09310	N	1	B	0.23540	0.087	B	0.20384	0.029	T	0.45411	-0.9263	8	0.15066	T	0.55	.	3.1437	0.06464	0.3293:0.0:0.6707:0.0	.	50	O60225-2	.	D	50	ENSP00000312415:A50D	ENSP00000312415:A50D	A	-	2	0	SSX5	47939430	0.000000	0.05858	0.001000	0.08648	0.150000	0.21749	-0.180000	0.09754	0.017000	0.15025	0.171000	0.16805	GCC	.		0.522	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015	
RLIM	51132	broad.mit.edu	37	X	73811995	73811995	+	Silent	SNP	G	G	T			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chrX:73811995G>T	ENST00000332687.6	-	4	1373	c.1155C>A	c.(1153-1155)ccC>ccA	p.P385P	RLIM_ENST00000349225.2_Silent_p.P385P	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	385					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCTACGAATGGGAATTCTGA	0.413																																					p.P385P	Esophageal Squamous(169;1899 1923 14997 18818 32118)												.	RLIM-228	0			c.C1155A						.						109.0	98.0	102.0					X																	73811995		2203	4300	6503	SO:0001819	synonymous_variant	51132	exon5			ACGAATGGGAATT	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1155C>A	X.37:g.73811995G>T		104	0		79	4	NM_183353	0	0	1	1	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																			.		0.413	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
XIAP	331	bcgsc.ca	37	X	123020210	123020210	+	Missense_Mutation	SNP	G	G	T	rs368511826		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chrX:123020210G>T	ENST00000371199.3	+	2	997	c.698G>T	c.(697-699)cGg>cTg	p.R233L	XIAP_ENST00000468691.1_Intron|XIAP_ENST00000434753.3_Missense_Mutation_p.R233L|XIAP_ENST00000355640.3_Missense_Mutation_p.R233L	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	233					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R233Q(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GTTTTGGGCCGGAATCTTAAT	0.403									X-linked Lymphoproliferative syndrome																												p.R233L													.	XIAP-1084	1	Substitution - Missense(1)	endometrium(1)	c.G698T						.						110.0	102.0	104.0					X																	123020210		2203	4300	6503	SO:0001583	missense	331	exon2	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	TGGGCCGGAATCT	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.698G>T	X.37:g.123020210G>T	ENSP00000360242:p.Arg233Leu	46	2		41	23	NM_001204401	0	0	0	0	0	D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853544	0.51270	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.70986	-0.53;-0.53;-0.53	5.81	5.81	0.92471	Baculoviral inhibition of apoptosis protein repeat (1);	0.000000	0.64402	D	0.000003	T	0.80523	0.4639	M	0.66939	2.045	0.45354	D	0.998347	D	0.71674	0.998	D	0.63597	0.916	T	0.80448	-0.1378	9	.	.	.	-30.5957	13.2865	0.60245	0.0768:0.0:0.9232:0.0	.	233	P98170	XIAP_HUMAN	L	233	ENSP00000395230:R233L;ENSP00000360242:R233L;ENSP00000347858:R233L	.	R	+	2	0	XIAP	122847891	1.000000	0.71417	0.997000	0.53966	0.604000	0.37047	3.016000	0.49607	2.461000	0.83175	0.508000	0.49915	CGG	.		0.403	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167	
PNCK	139728	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	152938463	152938463	+	Splice_Site	SNP	C	C	G			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chrX:152938463C>G	ENST00000370150.1	-	2	247		c.e2+1		PNCK_ENST00000475172.1_Splice_Site|PNCK_ENST00000370142.1_Splice_Site|PNCK_ENST00000447676.2_Splice_Site|PNCK_ENST00000370145.4_Splice_Site|PNCK_ENST00000340888.3_Splice_Site|PNCK_ENST00000393831.2_Splice_Site			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					cgcacactcacGAGCCGAGCC	0.592																																					.													.	PNCK-207	0			c.119+1G>C						.						47.0	32.0	37.0					X																	152938463		2201	4288	6489	SO:0001630	splice_region_variant	139728	exon3			CACTCACGAGCCG	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.68+1G>C	X.37:g.152938463C>G		112	6		91	66	NM_001135740	0	0	0	0	0	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Splice_Site	SNP	ENST00000370150.1	37																																																																																				.		0.592	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	Intron
LAMTOR2	28956	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156027791	156027791	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:156027791delG	ENST00000368305.4	+	3	392	c.254delG	c.(253-255)cgafs	p.R85fs	LAMTOR2_ENST00000368302.3_Frame_Shift_Del_p.R85fs|LAMTOR2_ENST00000368304.5_Intron	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2	85					activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						GCCATCACCCGAGTGGCCAAC	0.577																																					p.R85fs		.											.	LAMTOR2-523	0			c.254delG						.						205.0	152.0	170.0					1																	156027791		2203	4300	6503	SO:0001589	frameshift_variant	28956	exon3			.	BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.254delG	1.37:g.156027791delG	ENSP00000357288:p.Arg85fs	311	0		315	118	NM_014017	0	0	0	0	0	Q5VY97|Q5VY98|Q5VY99	Frame_Shift_Del	DEL	ENST00000368305.4	37	CCDS1128.1																																																																																			.		0.577	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046197.1	NM_014017	
GPR123	84435	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	134912186	134912187	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr10:134912186_134912187delTT	ENST00000392607.3	+	4	610_611	c.174_175delTT	c.(172-177)aatttcfs	p.F59fs	GPR123_ENST00000607359.1_Frame_Shift_Del_p.F779fs	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	59					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CGCTCCTGAATTTCTGCTTCCA	0.658																																					p.58_59del		.											.	GPR123-90	0			c.174_175del						.																																			SO:0001589	frameshift_variant	84435	exon4			.	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.174_175delTT	10.37:g.134912186_134912187delTT	ENSP00000376384:p.Phe59fs	45	0		55	18	NM_001083909	0	0	0	0	0	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Frame_Shift_Del	DEL	ENST00000392607.3	37	CCDS41580.1																																																																																			.		0.658	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
C2CD2L	9854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118984691	118984704	+	Splice_Site	DEL	TTTCCAAGGTAACA	TTTCCAAGGTAACA	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	TTTCCAAGGTAACA	TTTCCAAGGTAACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr11:118984691_118984704delTTTCCAAGGTAACA	ENST00000528586.1	+	8	930_937	c.860_867delTTTCCAAGGTAACA	c.(859-867)gtttccaag>g	p.VSK287fs	C2CD2L_ENST00000336702.3_Splice_Site_p.VSK540fs			O14523	C2C2L_HUMAN	C2CD2-like	539						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						ATCTCTGGTGTTTCCAAGGTAACAGGGCTCTGGG	0.598																																					p.540_542del		.											.	C2CD2L-68	0			c.1619_1626del						.																																			SO:0001630	splice_region_variant	9854	exon12			.	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.867+1TTTCCAAGGTAACA>-	11.37:g.118984691_118984704delTTTCCAAGGTAACA		141	0		126	30	NM_014807	0	0	0	0	0	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Frame_Shift_Del	DEL	ENST00000528586.1	37																																																																																				.		0.598	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	NM_014807	Frame_Shift_Del
MARK3	4140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	103969341	103969341	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr14:103969341delG	ENST00000429436.2	+	18	2549	c.2039delG	c.(2038-2040)cgcfs	p.R680fs	MARK3_ENST00000561071.1_3'UTR|MARK3_ENST00000416682.2_Frame_Shift_Del_p.R679fs|MARK3_ENST00000440884.3_Frame_Shift_Del_p.R586fs|MARK3_ENST00000553942.1_Frame_Shift_Del_p.R671fs|MARK3_ENST00000303622.9_Frame_Shift_Del_p.R656fs|MARK3_ENST00000335102.5_Frame_Shift_Del_p.R703fs|MARK3_ENST00000216288.7_Frame_Shift_Del_p.R640fs	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	680						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I639_K641del(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			CGGGAAATCCGCAAAGTGTTG	0.532																																					p.R680fs		.											.	MARK3-360	2	Deletion - In frame(2)	central_nervous_system(2)	c.2039delG						.						69.0	71.0	71.0					14																	103969341		2055	4220	6275	SO:0001589	frameshift_variant	4140	exon18			.	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.2039delG	14.37:g.103969341delG	ENSP00000411397:p.Arg680fs	303	0		203	69	NM_001128918	0	0	0	0	0	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Frame_Shift_Del	DEL	ENST00000429436.2	37	CCDS45165.1																																																																																			.		0.532	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
SLC5A6	8884	hgsc.bcm.edu;bcgsc.ca	37	2	27428892	27428892	+	Splice_Site	DEL	A	A	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:27428892delA	ENST00000310574.3	-	6	1053		c.e6+1		SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Splice_Site	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6						biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	TACTGCACTTACCAGAGCTGT	0.502																																					.		.											.	SLC5A6-92	0			c.579+2T>-						.						87.0	75.0	79.0					2																	27428892		2203	4300	6503	SO:0001630	splice_region_variant	8884	exon7			.	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.579+1T>-	2.37:g.27428892delA		453	0		512	109	NM_021095	0	0	0	0	0	B2RB85|D6W549|Q969Y5	Splice_Site	DEL	ENST00000310574.3	37	CCDS1740.1																																																																																			.		0.502	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	Intron
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	109380179	109380179	+	Frame_Shift_Del	DEL	A	A	-	rs201854838		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:109380179delA	ENST00000283195.6	+	20	3310	c.3184delA	c.(3184-3186)aacfs	p.N1062fs		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1062					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AGCTTACAGTAACAGTGAAAG	0.443																																					p.N1062fs		.											.	RANBP2-675	0			c.3184delA						.						74.0	77.0	76.0					2																	109380179		2203	4300	6503	SO:0001589	frameshift_variant	5903	exon20			.	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3184delA	2.37:g.109380179delA	ENSP00000283195:p.Asn1062fs	88	0		110	53	NM_006267	0	0	0	0	0	Q13074|Q15280|Q53TE2|Q59FH7	Frame_Shift_Del	DEL	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.443	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SLC32A1	140679	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	37353586	37353607	+	Frame_Shift_Del	DEL	GGGCGCTGAAGCGCCCGTCGAG	GGGCGCTGAAGCGCCCGTCGAG	-	rs148951877		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	GGGCGCTGAAGCGCCCGTCGAG	GGGCGCTGAAGCGCCCGTCGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr20:37353586_37353607delGGGCGCTGAAGCGCCCGTCGAG	ENST00000217420.1	+	1	482_503	c.219_240delGGGCGCTGAAGCGCCCGTCGAG	c.(217-240)gagggcgctgaagcgcccgtcgagfs	p.EGAEAPVE73fs		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	73					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	GCGGGGACGAGGGCGCTGAAGCGCCCGTCGAGGGAGACATCC	0.671																																					p.73_80del		.											.	SLC32A1-90	0			c.219_240del						.																																			SO:0001589	frameshift_variant	140679	exon1			.	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.219_240delGGGCGCTGAAGCGCCCGTCGAG	20.37:g.37353586_37353607delGGGCGCTGAAGCGCCCGTCGAG	ENSP00000217420:p.Glu73fs	30	0		111	42	NM_080552	0	0	0	0	0	Q8N489	Frame_Shift_Del	DEL	ENST00000217420.1	37	CCDS13307.1																																																																																			.		0.671	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
IFT122	55764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	129214436	129214436	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:129214436delT	ENST00000348417.2	+	18	2271	c.2194delT	c.(2194-2196)tttfs	p.F732fs	IFT122_ENST00000504021.1_Frame_Shift_Del_p.F608fs|IFT122_ENST00000347300.2_Frame_Shift_Del_p.F673fs|IFT122_ENST00000440957.2_Frame_Shift_Del_p.F523fs|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000431818.2_Frame_Shift_Del_p.F582fs|IFT122_ENST00000296266.3_Frame_Shift_Del_p.F783fs|IFT122_ENST00000507564.1_Frame_Shift_Del_p.F724fs|IFT122_ENST00000349441.2_Frame_Shift_Del_p.F621fs	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	732					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						CCTCTGCATGTTTGAGTATGC	0.537																																					p.F783fs		.											.	IFT122-92	0			c.2347delT						.						118.0	106.0	110.0					3																	129214436		2203	4300	6503	SO:0001589	frameshift_variant	55764	exon19			.	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2194delT	3.37:g.129214436delT	ENSP00000324005:p.Phe732fs	294	0		251	114	NM_052985	0	0	0	0	0	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Frame_Shift_Del	DEL	ENST00000348417.2	37	CCDS3061.1																																																																																			.		0.537	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
ATP11B	23200	broad.mit.edu	37	3	182607235	182607235	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr3:182607235delT	ENST00000323116.5	+	25	3141	c.2881delT	c.(2881-2883)tttfs	p.F961fs		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	961					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TATTAAAACATTTCTTTATTG	0.328																																					p.F961fs													.	ATP11B-93	0			c.2881delT						.						78.0	79.0	79.0					3																	182607235		2201	4299	6500	SO:0001589	frameshift_variant	23200	exon25			AAAACATTTCTTT	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.2881delT	3.37:g.182607235delT	ENSP00000321195:p.Phe961fs	10	0		17	9	NM_014616	0	0	0	0	0	Q96FN1|Q9UKK7	Frame_Shift_Del	DEL	ENST00000323116.5	37	CCDS33896.1																																																																																			.		0.328	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176709581	176709584	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr5:176709581_176709584delAAGT	ENST00000439151.2	+	19	6053_6054	c.6008_6009delAAGT	c.(6007-6009)aaa>a	p.K2003fs	NSD1_ENST00000347982.4_Splice_Site_p.K1734fs|NSD1_ENST00000354179.4_Splice_Site_p.K1734fs|NSD1_ENST00000361032.4_Splice_Site_p.K1900fs	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2003	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ACCCTAGACAAAGTAAGTAATGGG	0.397			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.2003_2003del		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.6008_6009del						.																																			SO:0001630	splice_region_variant	64324	exon19	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	.	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6009+1AAGT>-	5.37:g.176709585_176709588delAAGT		101	0		83	24	NM_022455	0	0	0	0	0	Q96PD8|Q96RN7	Frame_Shift_Del	DEL	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.397	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	Frame_Shift_Del
KCNK5	8645	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	39159405	39159412	+	Frame_Shift_Del	DEL	TTGTGGAC	TTGTGGAC	-	rs13208158	byFrequency	TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	TTGTGGAC	TTGTGGAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:39159405_39159412delTTGTGGAC	ENST00000359534.3	-	5	1092_1099	c.754_761delGTCCACAA	c.(754-762)gtccacaaafs	p.VHK252fs		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	252					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						CTTAATGGCTTTGTGGACTTCCACAAAC	0.591																																					p.252_254del		.											.	KCNK5-227	0			c.754_761del						.																																			SO:0001589	frameshift_variant	8645	exon5			.	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.754_761delGTCCACAA	6.37:g.39159405_39159412delTTGTGGAC	ENSP00000352527:p.Val252fs	169	0		95	20	NM_003740	0	0	0	0	0	B2RAQ6|B5TJL2|Q5VV76	Frame_Shift_Del	DEL	ENST00000359534.3	37	CCDS4841.1																																																																																			.		0.591	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
AKAP12	9590	hgsc.bcm.edu;bcgsc.ca	37	6	151671659	151671659	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:151671659delC	ENST00000253332.1	+	3	2322	c.2133delC	c.(2131-2133)cacfs	p.H711fs	AKAP12_ENST00000359755.5_Frame_Shift_Del_p.H606fs|AKAP12_ENST00000354675.6_Frame_Shift_Del_p.H613fs|AKAP12_ENST00000402676.2_Frame_Shift_Del_p.H711fs			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	711					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAGGAGACCACCAGAAAGCTG	0.532																																					p.H711fs	Melanoma(141;1616 1805 10049 24534 51979)	.											.	AKAP12-293	0			c.2133delC						.						96.0	106.0	103.0					6																	151671659		2203	4300	6503	SO:0001589	frameshift_variant	9590	exon4			.	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.2133delC	6.37:g.151671659delC	ENSP00000253332:p.His711fs	155	0		142	50	NM_005100	0	0	0	0	0	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Frame_Shift_Del	DEL	ENST00000253332.1	37	CCDS5229.1																																																																																			.		0.532	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
ZBTB2	57621	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	151686673	151686676	+	Frame_Shift_Del	DEL	TTTC	TTTC	-	rs143773461		TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	TTTC	TTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:151686673_151686676delTTTC	ENST00000325144.4	-	3	1665_1668	c.1525_1528delGAAA	c.(1525-1530)gaaaccfs	p.ET509fs		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E509K(2)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		AGTAAGACGGTTTCTTGTTCCTTT	0.446																																					p.509_510del		.											.	ZBTB2-91	2	Substitution - Missense(2)	lung(1)|skin(1)	c.1525_1528del						.																																			SO:0001589	frameshift_variant	57621	exon3			.	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.1525_1528delGAAA	6.37:g.151686673_151686676delTTTC	ENSP00000323183:p.Glu509fs	137	0		127	39	NM_020861	0	0	0	0	0	A8K7C7|Q5SZ81|Q9P245	Frame_Shift_Del	DEL	ENST00000325144.4	37	CCDS5231.1																																																																																			.		0.446	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
TAF6	6878	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99711723	99711723	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr7:99711723delT	ENST00000344095.4	-	2	635	c.110delA	c.(109-111)cagfs	p.Q37fs	TAF6_ENST00000497233.1_5'Flank|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000418432.2_5'UTR|TAF6_ENST00000437822.2_Frame_Shift_Del_p.Q74fs|TAF6_ENST00000472509.1_Frame_Shift_Del_p.Q94fs|TAF6_ENST00000452041.1_Frame_Shift_Del_p.Q37fs|TAF6_ENST00000453269.2_Frame_Shift_Del_p.Q37fs	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	37					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGTTAGCAGCTGGCAGGTCTC	0.582																																					p.Q74fs		.											.	TAF6-91	0			c.221delA						.						140.0	126.0	130.0					7																	99711723		2203	4300	6503	SO:0001589	frameshift_variant	6878	exon2			.		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.110delA	7.37:g.99711723delT	ENSP00000344537:p.Gln37fs	276	0		421	177	NM_001190415	0	0	0	0	0	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Frame_Shift_Del	DEL	ENST00000344095.4	37	CCDS5686.1																																																																																			.		0.582	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
GCM1	8521	hgsc.bcm.edu;bcgsc.ca	37	6	52993368	52993369	+	In_Frame_Ins	INS	-	-	AAA			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr6:52993368_52993369insAAA	ENST00000259803.7	-	6	1157_1158	c.946_947insTTT	c.(946-948)tat>tTTTat	p.315_316insF	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	315					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					AGGAAAAGGATAATTGGAATAA	0.48																																					p.Y316delinsFY		.											.	GCM1-90	0			c.947_948insTTT						.																																			SO:0001652	inframe_insertion	8521	exon6			.	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.946_947insTTT	6.37:g.52993368_52993369insAAA	ENSP00000259803:p.Asn315_Tyr316insPhe	140	0		112	22	NM_003643	0	0	0	0	0	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	In_Frame_Ins	INS	ENST00000259803.7	37	CCDS4950.1																																																																																			.		0.480	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1		
OR13G1	441933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247836182	247836183	+	Missense_Mutation	DNP	CG	CG	AA	rs200763482	byFrequency	TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr1:247836182_247836183CG>AA	ENST00000359688.2	-	1	182_183	c.161_162CG>TT	c.(160-162)aCG>aTT	p.T54I	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T54M(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CATACATGGGCGTATGCAAGGT	0.421																																					p.T54I		.											.	OR13G1-69	1	Substitution - Missense(1)	endometrium(1)	c.C161T						.																																			SO:0001583	missense	441933	exon1			ATGGGCGTATGCA	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.161_162delinsAA	1.37:g.247836182_247836183delinsAA	ENSP00000352717:p.Thr54Ile	131.0	0.0		155.0	51.0	NM_001005487	0	0	0	0	0	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	DNP	ENST00000359688.2	37	CCDS31094.1																																																																																			G|0.999;A|0.000		0.421	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487	
ADCY3	109	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25051028	25051029	+	Splice_Site	DNP	GA	GA	AC			TCGA-MH-A55W-01A-11D-A26P-10	TCGA-MH-A55W-10A-01D-A26P-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2425a532-f562-423a-88f5-228642f53875	38fa8b8f-1a31-4331-9acc-15e845c9a9b8	g.chr2:25051028_25051029GA>AC	ENST00000260600.5	-	13	3025_3026	c.2174_2175TC>GT	c.(2173-2175)cTC>cGT	p.L725R	RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000405392.1_Intron|ADCY3_ENST00000450524.1_5'UTR	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	725					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GGAGACAGCTGAGCTGGAGGCC	0.604											OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L725R													.	ADCY3-94	0			c.T2174G						.																																			SO:0001630	splice_region_variant	109	exon13			CAGCTGAGCTGGA	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2174_2175delinsAC	2.37:g.25051028_25051029delinsAC		92	1	776	142	82	NM_004036	0	0	0	0	0	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	DNP	ENST00000260600.5	37	CCDS1715.1																																																																																			.		0.604	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		Missense_Mutation
