#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	broad.mit.edu	37	1	6610594	6610594	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:6610594G>A	ENST00000377705.5	-	2	510	c.478C>T	c.(478-480)Cag>Tag	p.Q160*		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	160					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGCAGGCTGGCCTTGGCTG	0.473																																					p.Q160X													.	NOL9-515	0			c.C478T						.						118.0	118.0	118.0					1																	6610594		2203	4300	6503	SO:0001587	stop_gained	79707	exon2			CAGGCTGGCCTTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.478C>T	1.37:g.6610594G>A	ENSP00000366934:p.Gln160*	88	0		67	4	NM_024654	0	0	1	1	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Nonsense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389690	0.82902	.	.	ENSG00000162408	ENST00000377705	.	.	.	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-21.4105	16.6621	0.85243	0.0:0.0:1.0:0.0	.	.	.	.	X	160	.	ENSP00000366934:Q160X	Q	-	1	0	NOL9	6533181	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	7.800000	0.85949	2.788000	0.95919	0.650000	0.86243	CAG	.		0.473	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
RBP7	116362	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	10068242	10068242	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:10068242C>G	ENST00000294435.7	+	3	307	c.264C>G	c.(262-264)atC>atG	p.I88M		NM_052960.2	NP_443192.1	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular	88						cytoplasm (GO:0005737)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(1)	2		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	GTTTGGTTATCTGGGACAATG	0.468																																					p.I88M		.											.	RBP7-90	0			c.C264G						.						112.0	104.0	107.0					1																	10068242		2203	4300	6503	SO:0001583	missense	116362	exon3			GGTTATCTGGGAC	AF399927	CCDS109.1	1p36.22	2013-03-01			ENSG00000162444	ENSG00000162444		"""Fatty acid binding protein family"""	30316	protein-coding gene	gene with protein product		608604				12177003	Standard	NM_052960		Approved	CRBPIV	uc001aqq.3	Q96R05	OTTHUMG00000001798	ENST00000294435.7:c.264C>G	1.37:g.10068242C>G	ENSP00000294435:p.Ile88Met	194	0		148	15	NM_052960	0	0	0	0	0	B2R517|Q5SWJ4	Missense_Mutation	SNP	ENST00000294435.7	37	CCDS109.1	.	.	.	.	.	.	.	.	.	.	C	6.871	0.529995	0.13127	.	.	ENSG00000162444	ENST00000315901;ENST00000294435	T	0.07688	3.17	4.07	0.988	0.19796	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.599344	0.15592	N	0.254321	T	0.07143	0.0181	N	0.19112	0.55	0.09310	N	0.99999	B	0.23650	0.089	B	0.37601	0.254	T	0.37526	-0.9702	10	0.87932	D	0	.	6.2468	0.20823	0.1332:0.6539:0.1302:0.0827	.	88	Q96R05	RET7_HUMAN	M	135;88	ENSP00000294435:I88M	ENSP00000294435:I88M	I	+	3	3	RBP7	9990829	0.000000	0.05858	0.746000	0.31095	0.291000	0.27294	-1.010000	0.03656	0.945000	0.37605	0.644000	0.83932	ATC	.		0.468	RBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005027.2	NM_052960	
PRDM2	7799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	14108836	14108836	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:14108836C>T	ENST00000235372.7	+	8	5402	c.4546C>T	c.(4546-4548)Cgg>Tgg	p.R1516W	PRDM2_ENST00000413440.1_Missense_Mutation_p.R1315W|PRDM2_ENST00000343137.4_Missense_Mutation_p.R1315W|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.R1516W|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CCACCGCAGACGGACAGCGGA	0.512																																					p.R1516W		.											.	PRDM2-116	0			c.C4546T						.						72.0	82.0	79.0					1																	14108836		2203	4300	6503	SO:0001583	missense	7799	exon8			CGCAGACGGACAG	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4546C>T	1.37:g.14108836C>T	ENSP00000235372:p.Arg1516Trp	121	0		107	39	NM_015866	0	0	3	7	4	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127315	0.56721	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.02032	4.6;4.49;4.49;4.49	5.98	4.06	0.47325	.	0.060868	0.64402	D	0.000003	T	0.09598	0.0236	M	0.69823	2.125	0.49051	D	0.999741	D;B;B	0.89917	1.0;0.14;0.445	D;B;B	0.73708	0.981;0.015;0.034	T	0.00638	-1.1632	10	0.87932	D	0	.	8.67	0.34145	0.1498:0.7733:0.0:0.0769	.	1374;1516;1516	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	W	1516;1516;1516;1315;1315	ENSP00000235372:R1516W;ENSP00000312352:R1516W;ENSP00000411103:R1315W;ENSP00000341621:R1315W	ENSP00000235372:R1516W	R	+	1	2	PRDM2	13981423	0.364000	0.24997	0.793000	0.32043	0.983000	0.72400	0.980000	0.29513	0.815000	0.34398	0.591000	0.81541	CGG	.		0.512	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PLEKHM2	23207	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16054269	16054269	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:16054269T>G	ENST00000375799.3	+	9	1929	c.1702T>G	c.(1702-1704)Tct>Gct	p.S568A	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.S548A|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	568					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CGCTGAGGATTCTGGGGTGGA	0.622																																					p.S568A													.	PLEKHM2-23	0			c.T1702G						.						13.0	15.0	14.0					1																	16054269		2067	4198	6265	SO:0001583	missense	23207	exon9			GAGGATTCTGGGG	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1702T>G	1.37:g.16054269T>G	ENSP00000364956:p.Ser568Ala	276	2		191	53	NM_015164	0	0	22	44	22	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	ENST00000375799.3	37	CCDS44063.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882074	0.72294	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.59502	0.33;0.26	5.55	5.55	0.83447	.	0.139273	0.51477	D	0.000089	T	0.48333	0.1494	L	0.29908	0.895	0.39619	D	0.970004	P	0.45396	0.857	B	0.41332	0.354	T	0.52689	-0.8542	10	0.41790	T	0.15	-13.0585	15.6894	0.77439	0.0:0.0:0.0:1.0	.	568	Q8IWE5	PKHM2_HUMAN	A	568;548	ENSP00000364956:S568A;ENSP00000364950:S548A	ENSP00000364950:S548A	S	+	1	0	PLEKHM2	15926856	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	5.910000	0.69931	2.106000	0.64143	0.533000	0.62120	TCT	.		0.622	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
E2F2	1870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	23848337	23848337	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:23848337G>C	ENST00000361729.2	-	3	996	c.570C>G	c.(568-570)atC>atG	p.I190M	E2F2_ENST00000487237.1_5'Flank	NM_004091.3	NP_004082.1	Q14209	E2F2_HUMAN	E2F transcription factor 2	190					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|large_intestine(2)|lung(1)|ovary(3)|skin(2)|urinary_tract(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)		ACACCCACTGGATGTTGTTCT	0.612																																					p.I190M		.											.	E2F2-417	0			c.C570G						.						123.0	104.0	110.0					1																	23848337		2203	4300	6503	SO:0001583	missense	1870	exon3			CCACTGGATGTTG	L22846	CCDS236.1	1p36	2008-02-05			ENSG00000007968	ENSG00000007968			3114	protein-coding gene	gene with protein product		600426				8246995, 8246996	Standard	NM_004091		Approved	E2F-2	uc001bhe.2	Q14209	OTTHUMG00000003223	ENST00000361729.2:c.570C>G	1.37:g.23848337G>C	ENSP00000355249:p.Ile190Met	156	0		118	45	NM_004091	0	0	0	0	0	B2R9W1|Q7Z6H1	Missense_Mutation	SNP	ENST00000361729.2	37	CCDS236.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382364	0.61845	.	.	ENSG00000007968	ENST00000361729	T	0.15256	2.44	5.35	4.42	0.53409	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.058637	0.64402	D	0.000003	T	0.48840	0.1522	M	0.93241	3.395	0.58432	D	0.999998	D	0.56968	0.978	D	0.65323	0.934	T	0.60865	-0.7178	10	0.87932	D	0	-24.1713	11.9214	0.52793	0.0:0.0:0.6839:0.3161	.	190	Q14209	E2F2_HUMAN	M	190	ENSP00000355249:I190M	ENSP00000355249:I190M	I	-	3	3	E2F2	23720924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.406000	0.44557	1.212000	0.43366	0.591000	0.81541	ATC	.		0.612	E2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008885.1	NM_004091	
CD52	1043	hgsc.bcm.edu;bcgsc.ca	37	1	26646661	26646661	+	Splice_Site	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:26646661G>T	ENST00000374213.2	+	2	115		c.e2-1		UBXN11_ENST00000374217.2_5'Flank|UBXN11_ENST00000374222.1_5'Flank	NM_001803.2	NP_001794.2	P31358	CD52_HUMAN	CD52 molecule						positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory burst (GO:0045730)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				large_intestine(1)	1		all_cancers(24;5.02e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.56e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0137)|READ - Rectum adenocarcinoma(331;0.0649)	Alemtuzumab(DB00087)	TCCTCCTACAGATACAAACTG	0.488																																					.		.											.	CD52-90	0			c.55-1G>T						.						108.0	108.0	108.0					1																	26646661		2203	4300	6503	SO:0001630	splice_region_variant	1043	exon2			CCTACAGATACAA		CCDS30647.1	1p36	2008-02-05	2006-03-28	2005-02-07	ENSG00000169442	ENSG00000169442		"""CD molecules"""	1804	protein-coding gene	gene with protein product		114280	"""CD52 antigen (CAMPATH-1 antigen)"""	CDW52		1711975	Standard	NM_001803		Approved		uc001bmc.3	P31358	OTTHUMG00000003491	ENST00000374213.2:c.55-1G>T	1.37:g.26646661G>T		52	0		42	6	NM_001803	0	0	0	0	0	Q5T138|Q9BW46	Splice_Site	SNP	ENST00000374213.2	37	CCDS30647.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299548	0.40694	.	.	ENSG00000169442	ENST00000374213	.	.	.	3.6	3.6	0.41247	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.042	0.47835	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD52	26519248	0.969000	0.33509	0.935000	0.37517	0.213000	0.24496	3.220000	0.51207	2.312000	0.78011	0.655000	0.94253	.	.		0.488	CD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009704.1	NM_001803	Intron
COL8A2	1296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36564106	36564106	+	Silent	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:36564106A>G	ENST00000397799.1	-	4	1400	c.1176T>C	c.(1174-1176)atT>atC	p.I392I	COL8A2_ENST00000303143.4_Silent_p.I392I|COL8A2_ENST00000481785.1_Silent_p.I327I			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	392	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGTCACCTCGAATGCCAGGCA	0.692																																					p.I392I		.											.	COL8A2-90	0			c.T1176C						.						9.0	10.0	10.0					1																	36564106		2188	4274	6462	SO:0001819	synonymous_variant	1296	exon2			ACCTCGAATGCCA	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.1176T>C	1.37:g.36564106A>G		187	0		108	32	NM_005202	0	0	1	2	1	Q5JV31|Q8TEJ5	Silent	SNP	ENST00000397799.1	37	CCDS403.1																																																																																			.		0.692	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
CDC20	991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	43826814	43826814	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:43826814G>C	ENST00000372462.1	+	8	1304	c.1101G>C	c.(1099-1101)caG>caC	p.Q367H	CDC20_ENST00000310955.6_Missense_Mutation_p.Q367H|RP1-92O14.3_ENST00000424948.1_RNA|ELOVL1_ENST00000470769.1_5'Flank			Q12834	CDC20_HUMAN	cell division cycle 20	367					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTCCCTGGCAGTCCAATGTCC	0.572																																					p.Q367H	Esophageal Squamous(137;1154 1759 10362 10401 46925)	.											.	CDC20-227	0			c.G1101C						.						85.0	76.0	79.0					1																	43826814		2203	4300	6503	SO:0001583	missense	991	exon9			CTGGCAGTCCAAT	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.1101G>C	1.37:g.43826814G>C	ENSP00000361540:p.Gln367His	118	0		82	32	NM_001255	0	0	1	1	0	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	ENST00000372462.1	37	CCDS484.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886198	0.51908	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.29397	1.57;1.57	5.73	0.649	0.17806	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	L	0.33668	1.02	0.58432	D	0.999997	P	0.38992	0.653	P	0.45099	0.469	T	0.04481	-1.0948	10	0.62326	D	0.03	-17.7133	9.4478	0.38708	0.4049:0.0:0.5951:0.0	.	367	Q12834	CDC20_HUMAN	H	343;367;367	ENSP00000308450:Q367H;ENSP00000361540:Q367H	ENSP00000308450:Q367H	Q	+	3	2	CDC20	43599401	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.104000	0.50306	0.090000	0.17273	-0.291000	0.09656	CAG	.		0.572	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255	
GPBP1L1	60313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46124748	46124748	+	Silent	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:46124748A>G	ENST00000290795.3	-	3	1233	c.12T>C	c.(10-12)caT>caC	p.H4H	GPBP1L1_ENST00000355105.3_Silent_p.H4H			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	4					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					GAACAAAATCATGCTGCGCCA	0.428																																					p.H4H		.											.	GPBP1L1-91	0			c.T12C						.						146.0	137.0	140.0					1																	46124748		2203	4300	6503	SO:0001819	synonymous_variant	60313	exon4			AAAATCATGCTGC		CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.12T>C	1.37:g.46124748A>G		97	0		89	13	NM_021639	0	0	64	74	10	D3DQ10|Q9H751	Silent	SNP	ENST00000290795.3	37	CCDS528.1																																																																																			.		0.428	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098375.1	NM_021639	
AGBL4	84871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	48999847	48999847	+	Nonstop_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:48999847A>G	ENST00000371839.1	-	14	1626	c.1510T>C	c.(1510-1512)Taa>Caa	p.*504Q	AGBL4_ENST00000334103.7_Nonstop_Mutation_p.*228Q	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	0					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CCGTGTCTTTAAAAAGGGGTT	0.507																																					p.X504Q		.											.	AGBL4-137	0			c.T1510C						.						168.0	152.0	157.0					1																	48999847		692	1591	2283	SO:0001578	stop_lost	84871	exon14			GTCTTTAAAAAGG	AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.1510T>C	1.37:g.48999847A>G	ENSP00000360905:p.*504Gluext*27	179	0		156	20	NM_032785	0	0	0	0	0	B3KT26|B4DG37	Missense_Mutation	SNP	ENST00000371839.1	37	CCDS44137.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.7|21.7	4.181371|4.181371	0.78677|0.78677	.|.	.|.	ENSG00000186094|ENSG00000186094	ENST00000411952|ENST00000371839;ENST00000334103	.|.	.|.	.|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999988|0.999988	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.9|11.9	0.52678|0.52678	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	.|Q	-1|504;228	.|.	.|.	.|X	-|-	.|1	.|0	AGBL4|AGBL4	48772434|48772434	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.851000|0.851000	0.48451|0.48451	3.026000|3.026000	0.49689|0.49689	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	.|TAA	.		0.507	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021346.4	NM_032785	
NFIA	4774	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	61824902	61824902	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:61824902C>A	ENST00000403491.3	+	6	1386	c.902C>A	c.(901-903)cCa>cAa	p.P301Q	NFIA_ENST00000371185.2_Missense_Mutation_p.P279Q|NFIA_ENST00000485903.2_Missense_Mutation_p.P301Q|NFIA_ENST00000371184.2_Intron|NFIA_ENST00000371191.1_Missense_Mutation_p.P324Q|NFIA_ENST00000371189.4_Missense_Mutation_p.P346Q|NFIA_ENST00000479364.1_3'UTR|NFIA_ENST00000371187.3_Missense_Mutation_p.P301Q|NFIA_ENST00000407417.3_Missense_Mutation_p.P293Q	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	301					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						GGGCGCTCCCCAGGAAGTGGC	0.527																																					p.P346Q													.	NFIA-92	0			c.C1037A						.						99.0	97.0	98.0					1																	61824902		2203	4300	6503	SO:0001583	missense	4774	exon7			GCTCCCCAGGAAG	U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.902C>A	1.37:g.61824902C>A	ENSP00000384523:p.Pro301Gln	272	1		271	87	NM_001145512	0	0	2	2	0	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Missense_Mutation	SNP	ENST00000403491.3	37	CCDS44156.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563486	0.86335	.	.	ENSG00000162599	ENST00000371191;ENST00000407417;ENST00000371189;ENST00000403491;ENST00000485903;ENST00000371185;ENST00000371187	T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	6.17	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.79964	0.4537	M	0.80422	2.495	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.85130	0.997;0.997;0.997;0.994	T	0.82226	-0.0562	10	0.54805	T	0.06	.	15.327	0.74172	0.0:0.9337:0.0:0.0663	.	346;324;301;301	F8W8W3;B1AKN8;Q12857;Q12857-2	.;.;NFIA_HUMAN;.	Q	324;293;346;301;301;279;301	ENSP00000360233:P324Q;ENSP00000384680:P293Q;ENSP00000360231:P346Q;ENSP00000384523:P301Q;ENSP00000419785:P301Q;ENSP00000360227:P279Q;ENSP00000360229:P301Q	ENSP00000360227:P279Q	P	+	2	0	NFIA	61597490	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.173000	0.77612	1.620000	0.50308	0.655000	0.94253	CCA	.		0.527	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595	
FNBP1L	54874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	93965136	93965136	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:93965136T>A	ENST00000271234.7	+	2	287	c.136T>A	c.(136-138)Ttg>Atg	p.L46M	FNBP1L_ENST00000370253.2_Missense_Mutation_p.L46M|FNBP1L_ENST00000604705.1_Missense_Mutation_p.L46M|FNBP1L_ENST00000370256.4_Missense_Mutation_p.L46M|FNBP1L_ENST00000260506.8_Missense_Mutation_p.L46M	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	46	F-BAR domain. {ECO:0000250}.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		TGCGAAACAATTGAGGTAAGT	0.308																																					p.L46M		.											.	FNBP1L-227	0			c.T136A						.						46.0	44.0	45.0					1																	93965136		1815	4062	5877	SO:0001583	missense	54874	exon2			AAACAATTGAGGT		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.136T>A	1.37:g.93965136T>A	ENSP00000271234:p.Leu46Met	91	0		97	44	NM_001164473	0	0	0	0	0	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	ENST00000271234.7	37	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	T	18.19	3.568848	0.65765	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.55	2.05	0.26809	.	0.000000	0.85682	D	0.000000	T	0.69223	0.3087	M	0.84326	2.69	0.80722	D	1	D;P	0.54207	0.965;0.938	P;P	0.61328	0.887;0.855	T	0.69847	-0.5034	10	0.54805	T	0.06	-7.6767	6.8376	0.23945	0.0:0.465:0.0:0.535	.	46;46	Q5T0N5-4;Q5T0N5-3	.;.	M	46	ENSP00000359278:L46M;ENSP00000271234:L46M;ENSP00000260506:L46M;ENSP00000359275:L46M	ENSP00000260506:L46M	L	+	1	2	FNBP1L	93737724	0.711000	0.27906	0.997000	0.53966	0.913000	0.54294	0.165000	0.16564	0.401000	0.25424	-0.605000	0.04089	TTG	.		0.308	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737	
AQP10	89872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154296801	154296801	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:154296801G>T	ENST00000324978.3	+	6	791	c.751G>T	c.(751-753)Gtg>Ttg	p.V251L	AQP10_ENST00000484864.1_3'UTR|ATP8B2_ENST00000368487.3_5'Flank	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	251					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGCCCCTCTGGTGGGGGCCAC	0.602											OREG0013832	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V251L		.											.	AQP10-90	0			c.G751T						.						32.0	35.0	34.0					1																	154296801		2201	4290	6491	SO:0001583	missense	89872	exon6			CCTCTGGTGGGGG	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.751G>T	1.37:g.154296801G>T	ENSP00000318355:p.Val251Leu	41	0	1762	33	16	NM_080429	0	0	0	0	0	Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	37	CCDS1065.1	.	.	.	.	.	.	.	.	.	.	G	5.726	0.318459	0.10845	.	.	ENSG00000143595	ENST00000324978	D	0.88124	-2.34	4.46	4.46	0.54185	Aquaporin-like (2);	0.142496	0.45126	D	0.000385	T	0.65688	0.2715	L	0.28608	0.87	0.80722	D	1	B	0.32939	0.391	B	0.34722	0.188	T	0.67345	-0.5694	10	0.02654	T	1	.	12.9205	0.58230	0.0:0.1648:0.8352:0.0	.	251	Q96PS8	AQP10_HUMAN	L	251	ENSP00000318355:V251L	ENSP00000318355:V251L	V	+	1	0	AQP10	152563425	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	1.571000	0.36450	2.510000	0.84645	0.555000	0.69702	GTG	.		0.602	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
CENPL	91687	hgsc.bcm.edu;bcgsc.ca	37	1	173772300	173772300	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:173772300G>T	ENST00000345664.6	-	4	977	c.764C>A	c.(763-765)gCa>gAa	p.A255E	CENPL_ENST00000356198.2_Missense_Mutation_p.A301E|CENPL_ENST00000367710.3_Missense_Mutation_p.A255E	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	255					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						TGGATGTATTGCGAAAGAAAT	0.458																																					p.A301E		.											.	CENPL-90	0			c.C902A						.						95.0	97.0	96.0					1																	173772300		2203	4300	6503	SO:0001583	missense	91687	exon6			TGTATTGCGAAAG	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.764C>A	1.37:g.173772300G>T	ENSP00000323543:p.Ala255Glu	122	0		75	19	NM_001127181	0	0	2	2	0	Q5TEL5|Q96ND4	Missense_Mutation	SNP	ENST00000345664.6	37	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640619	0.67244	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.41758	1.58;0.99;0.99	5.24	5.24	0.73138	.	0.172946	0.50627	D	0.000109	T	0.47691	0.1459	L	0.43152	1.355	0.39487	D	0.967975	D;P	0.69078	0.997;0.896	D;P	0.63283	0.913;0.602	T	0.50882	-0.8775	10	0.72032	D	0.01	-5.8243	17.633	0.88114	0.0:0.0:1.0:0.0	.	301;255	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	E	301;255;255	ENSP00000348527:A301E;ENSP00000323543:A255E;ENSP00000356683:A255E	ENSP00000323543:A255E	A	-	2	0	CENPL	172038923	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.635000	0.67841	2.456000	0.83038	0.655000	0.94253	GCA	.		0.458	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319	
RFWD2	64326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	175996826	175996826	+	Splice_Site	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:175996826T>C	ENST00000367669.3	-	15	2127		c.e15-2		RFWD2_ENST00000308769.8_Splice_Site	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						ACAGCTTCACTAAGGGCAAAG	0.388																																					.	Ovarian(134;1413 1765 5706 35534 51541)	.											.	RFWD2-659	0			c.1613-2A>G						.						63.0	54.0	57.0					1																	175996826		2203	4300	6503	SO:0001630	splice_region_variant	64326	exon16			CTTCACTAAGGGC	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1613-2A>G	1.37:g.175996826T>C		72	0		78	31	NM_022457	0	0	0	0	0	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Splice_Site	SNP	ENST00000367669.3	37	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586435	0.86851	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6701	0.77267	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RFWD2	174263449	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	7.563000	0.82314	2.174000	0.68829	0.528000	0.53228	.	.		0.388	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	Intron
MR1	3140	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181003148	181003148	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:181003148G>T	ENST00000367580.5	+	1	10	c.5G>T	c.(4-6)gGg>gTg	p.G2V	MR1_ENST00000282990.6_Missense_Mutation_p.G2V|MR1_ENST00000367579.3_Missense_Mutation_p.G2V|MR1_ENST00000434571.2_Missense_Mutation_p.G2V|MR1_ENST00000438435.2_3'UTR	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	2					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	AGGACTATGGGGGAACTGATG	0.483																																					p.G2V	Colon(174;1412 1962 45296 46549 47110)												.	MR1-91	0			c.G5T						.						119.0	103.0	108.0					1																	181003148		2203	4300	6503	SO:0001583	missense	3140	exon2			CTATGGGGGAACT	AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.5G>T	1.37:g.181003148G>T	ENSP00000356552:p.Gly2Val	183	1		157	48	NM_001195035	0	0	0	1	1	A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	ENST00000367580.5	37	CCDS1342.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053763	0.36277	.	.	ENSG00000153029	ENST00000434571;ENST00000367580;ENST00000282990;ENST00000367579	T;T;T;T	0.01126	5.89;5.88;5.69;5.3	3.89	-7.77	0.01227	.	3.121780	0.01415	N	0.014161	T	0.00875	0.0029	N	0.24115	0.695	0.24595	N	0.993809	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.002;0.001;0.002	T	0.46275	-0.9203	9	0.87932	D	0	.	0.3097	0.00286	0.3905:0.1981:0.1499:0.2615	.	2;2;2;2;2	B4E3B1;Q95460-3;Q95460-2;Q95460;Q95460-4	.;.;.;HMR1_HUMAN;.	V	2	ENSP00000388504:G2V;ENSP00000356552:G2V;ENSP00000282990:G2V;ENSP00000356551:G2V	ENSP00000282990:G2V	G	+	2	0	MR1	179269771	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.543000	0.06084	-2.077000	0.00874	-0.857000	0.03018	GGG	.		0.483	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085134.2	NM_001531	
CACNA1S	779	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201043744	201043744	+	Missense_Mutation	SNP	G	G	C	rs561722889		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:201043744G>C	ENST00000362061.3	-	14	2179	c.1953C>G	c.(1951-1953)atC>atG	p.I651M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.I651M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	651					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CATTGAGCAGGATGTCTGAGC	0.587																																					p.I651M													.	CACNA1S-94	0			c.C1953G						.						63.0	51.0	55.0					1																	201043744		2203	4300	6503	SO:0001583	missense	779	exon14			GAGCAGGATGTCT	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1953C>G	1.37:g.201043744G>C	ENSP00000355192:p.Ile651Met	170	1		145	50	NM_000069	0	0	0	0	0	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083422	0.55861	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98666	-5.06;-5.06	3.99	3.05	0.35203	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98963	0.9647	M	0.84585	2.705	0.43787	D	0.996323	D	0.76494	0.999	D	0.78314	0.991	D	0.99482	1.0948	10	0.87932	D	0	.	11.1337	0.48362	0.0:0.0:0.6643:0.3357	.	651	Q13698	CAC1S_HUMAN	M	651	ENSP00000355192:I651M;ENSP00000356307:I651M	ENSP00000355192:I651M	I	-	3	3	CACNA1S	199310367	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	4.778000	0.62368	0.773000	0.33404	0.478000	0.44815	ATC	.		0.587	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
ETNK2	55224	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	204101322	204101322	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:204101322A>T	ENST00000367202.4	-	8	1301	c.1151T>A	c.(1150-1152)aTg>aAg	p.M384K	ETNK2_ENST00000367197.1_Missense_Mutation_p.M66K|ETNK2_ENST00000367198.2_Missense_Mutation_p.M206K|ETNK2_ENST00000367201.3_3'UTR|ETNK2_ENST00000367199.2_Missense_Mutation_p.M315K|RP11-74C13.4_ENST00000565388.1_RNA	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	384					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TCACTTTGGCATCTCCAAGGC	0.557																																					p.M384K		.											.	ETNK2-493	0			c.T1151A						.						80.0	77.0	78.0					1																	204101322		1564	3580	5144	SO:0001583	missense	55224	exon8			TTTGGCATCTCCA	AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.1151T>A	1.37:g.204101322A>T	ENSP00000356170:p.Met384Lys	165	0		101	34	NM_018208	0	0	13	13	0	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	ENST00000367202.4	37	CCDS1442.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.99|18.99	3.740600|3.740600	0.69304|0.69304	.|.	.|.	ENSG00000143845|ENSG00000143845	ENST00000422072|ENST00000367202;ENST00000367199;ENST00000455266;ENST00000367198;ENST00000367197	.|T;T;T;T	.|0.64260	.|0.34;-0.02;-0.02;-0.09	5.0|5.0	3.82|3.82	0.43975|0.43975	.|.	.|.	.|.	.|.	.|.	T|T	0.62780|0.62780	0.2456|0.2456	L|L	0.58669|0.58669	1.825|1.825	0.38499|0.38499	D|D	0.948185|0.948185	.|P;P	.|0.46859	.|0.877;0.885	.|P;B	.|0.50754	.|0.649;0.446	T|T	0.62305|0.62305	-0.6882|-0.6882	5|9	.|0.28530	.|T	.|0.3	.|.	8.0791|8.0791	0.30733|0.30733	0.7042:0.0:0.0:0.2958|0.7042:0.0:0.0:0.2958	.|.	.|343;384	.|Q9NVF9-3;Q9NVF9	.|.;EKI2_HUMAN	S|K	147|384;315;250;206;66	.|ENSP00000356170:M384K;ENSP00000356167:M315K;ENSP00000356166:M206K;ENSP00000356165:M66K	.|ENSP00000356165:M66K	C|M	-|-	1|2	0|0	ETNK2|ETNK2	202367945|202367945	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.878000|0.878000	0.50629|0.50629	6.504000|6.504000	0.73704|0.73704	1.880000|1.880000	0.54463|0.54463	0.533000|0.533000	0.62120|0.62120	TGC|ATG	.		0.557	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087893.1	NM_018208	
ETNK2	55224	ucsc.edu;bcgsc.ca	37	1	204101336	204101336	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:204101336C>T	ENST00000367202.4	-	8	1287	c.1137G>A	c.(1135-1137)gcG>gcA	p.A379A	ETNK2_ENST00000367197.1_Silent_p.A61A|ETNK2_ENST00000367198.2_Silent_p.A201A|ETNK2_ENST00000367201.3_3'UTR|ETNK2_ENST00000367199.2_Silent_p.A310A|RP11-74C13.4_ENST00000565388.1_RNA	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	379					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAAGGCTGACGCTTGAGGCT	0.562																																					p.A379A													.	ETNK2-493	0			c.G1137A						.						84.0	80.0	81.0					1																	204101336		1563	3580	5143	SO:0001819	synonymous_variant	55224	exon8			GGCTGACGCTTGA	AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.1137G>A	1.37:g.204101336C>T		182	1		123	45	NM_018208	0	0	20	20	0	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Silent	SNP	ENST00000367202.4	37	CCDS1442.2	.	.	.	.	.	.	.	.	.	.	C	3.487	-0.104679	0.06967	.	.	ENSG00000143845	ENST00000422072	.	.	.	5.11	3.06	0.35304	.	.	.	.	.	T	0.62768	0.2455	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60984	-0.7154	4	.	.	.	.	12.2946	0.54838	0.0:0.6725:0.3275:0.0	.	.	.	.	H	142	.	.	R	-	2	0	ETNK2	202367959	0.991000	0.36638	0.728000	0.30774	0.219000	0.24729	0.564000	0.23563	1.113000	0.41760	0.655000	0.94253	CGT	.		0.562	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087893.1	NM_018208	
DIEXF	27042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	210006562	210006562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:210006562G>T	ENST00000491415.2	+	4	478	c.421G>T	c.(421-423)Gaa>Taa	p.E141*		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	141	Glu-rich.				multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TGAGGGAAAAGAAGATGGGGA	0.398																																					p.E141X		.											.	DIEXF-91	0			c.G421T						.						59.0	56.0	57.0					1																	210006562		2203	4300	6503	SO:0001587	stop_gained	27042	exon4			GGAAAAGAAGATG	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.421G>T	1.37:g.210006562G>T	ENSP00000419005:p.Glu141*	59	0		51	17	NM_014388	0	0	4	4	0	O75992|Q4VY00|Q63HL9	Nonsense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380543	0.82792	.	.	ENSG00000117597	ENST00000491415	.	.	.	0.225	0.225	0.15325	.	1.807870	0.04544	U	0.388703	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	.	.	.	.	.	.	.	X	141	.	ENSP00000419005:E141X	E	+	1	0	DIEXF	208073185	0.949000	0.32298	0.212000	0.23672	0.934000	0.57294	0.364000	0.20325	0.300000	0.22699	0.305000	0.20034	GAA	.		0.398	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
CENPF	1063	broad.mit.edu	37	1	214816102	214816102	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:214816102C>T	ENST00000366955.3	+	12	4589	c.4421C>T	c.(4420-4422)cCa>cTa	p.P1474L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1570	2 X 96 AA approximate tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGGCTCGTTCCATCCCTGTCA	0.473																																					p.P1474L	Colon(80;575 1284 11000 14801 43496)												.	CENPF-567	0			c.C4421T						.						69.0	68.0	68.0					1																	214816102		2203	4300	6503	SO:0001583	missense	1063	exon12			TCGTTCCATCCCT	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4421C>T	1.37:g.214816102C>T	ENSP00000355922:p.Pro1474Leu	98	0		74	3	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	0.283	-0.985033	0.02180	.	.	ENSG00000117724	ENST00000366955	T	0.37915	1.17	4.32	-2.65	0.06095	.	1.289640	0.06172	N	0.677842	T	0.10294	0.0252	N	0.01048	-1.04	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.18745	-1.0327	10	0.25751	T	0.34	.	2.3529	0.04288	0.1187:0.3561:0.1342:0.3911	.	1474	P49454	CENPF_HUMAN	L	1474	ENSP00000355922:P1474L	ENSP00000355922:P1474L	P	+	2	0	CENPF	212882725	0.372000	0.25064	0.000000	0.03702	0.001000	0.01503	1.395000	0.34520	-0.107000	0.12088	-0.150000	0.13652	CCA	.		0.473	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
CENPF	1063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214820696	214820696	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:214820696A>T	ENST00000366955.3	+	13	7951	c.7783A>T	c.(7783-7785)Aat>Tat	p.N2595Y		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2691	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAATCTAGAGAATGAGCTTGA	0.378																																					p.N2595Y	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.A7783T						.						37.0	37.0	37.0					1																	214820696		2203	4300	6503	SO:0001583	missense	1063	exon13			CTAGAGAATGAGC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.7783A>T	1.37:g.214820696A>T	ENSP00000355922:p.Asn2595Tyr	66	0		55	24	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	12.11	1.839067	0.32513	.	.	ENSG00000117724	ENST00000366955	T	0.03301	3.98	5.61	3.16	0.36331	.	0.728326	0.11309	N	0.577293	T	0.03608	0.0103	N	0.19112	0.55	0.25270	N	0.989526	P	0.51653	0.947	P	0.44732	0.459	T	0.45963	-0.9225	10	0.59425	D	0.04	.	7.1052	0.25360	0.777:0.1469:0.0761:0.0	.	2691	P49454	CENPF_HUMAN	Y	2595	ENSP00000355922:N2595Y	ENSP00000355922:N2595Y	N	+	1	0	CENPF	212887319	1.000000	0.71417	0.126000	0.21872	0.167000	0.22549	1.705000	0.37867	0.427000	0.26145	0.496000	0.49642	AAT	.		0.378	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
KIN	22944	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	7822115	7822115	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr10:7822115C>G	ENST00000379562.4	-	4	327	c.280G>C	c.(280-282)Gtc>Ctc	p.V94L	KIN_ENST00000535925.1_Missense_Mutation_p.V94L|KIN_ENST00000543003.1_5'UTR	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein											endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						TCGTTGTAGACAATGTTGTTG	0.403																																					p.V94L													.	KIN-230	0			c.G280C						.						274.0	240.0	252.0					10																	7822115		2203	4300	6503	SO:0001583	missense	22944	exon4			TGTAGACAATGTT	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.280G>C	10.37:g.7822115C>G	ENSP00000368881:p.Val94Leu	202	1		159	60	NM_012311	0	0	7	12	5		Missense_Mutation	SNP	ENST00000379562.4	37	CCDS7080.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225063	0.58668	.	.	ENSG00000151657	ENST00000535925;ENST00000379562	.	.	.	5.92	5.0	0.66597	DNA/RNA-binding protein Kin17, conserved domain (1);	0.122083	0.56097	D	0.000033	T	0.73434	0.3586	M	0.90705	3.14	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.004;0.005	T	0.73729	-0.3891	9	0.66056	D	0.02	-21.4135	14.5956	0.68403	0.1459:0.8541:0.0:0.0	.	94;94	B4DX32;O60870	.;KIN17_HUMAN	L	94	.	ENSP00000368881:V94L	V	-	1	0	KIN	7862121	1.000000	0.71417	0.986000	0.45419	0.959000	0.62525	3.866000	0.56040	1.448000	0.47680	0.655000	0.94253	GTC	.		0.403	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311	
INS	3630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	2181135	2181135	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:2181135G>T	ENST00000397262.1	-	2	512	c.280C>A	c.(280-282)Caa>Aaa	p.Q94K	INS_ENST00000381330.4_Missense_Mutation_p.Q94K|INS-IGF2_ENST00000397270.1_Intron|INS_ENST00000250971.3_Missense_Mutation_p.Q94K|INS_ENST00000512523.1_Missense_Mutation_p.Q82K|INS-IGF2_ENST00000481781.1_5'Flank	NM_001185098.1	NP_001172027.1	P01308	INS_HUMAN	insulin	94					activation of protein kinase B activity (GO:0032148)|acute-phase response (GO:0006953)|alpha-beta T cell activation (GO:0046631)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of fatty acid metabolic process (GO:0045922)|negative regulation of feeding behavior (GO:2000252)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of glycogen catabolic process (GO:0045818)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of protein secretion (GO:0050709)|negative regulation of proteolysis (GO:0045861)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|negative regulation of vasodilation (GO:0045908)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of respiratory burst (GO:0060267)|positive regulation of vasodilation (GO:0045909)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of insulin secretion (GO:0050796)|regulation of protein localization (GO:0032880)|regulation of protein secretion (GO:0050708)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transmembrane transporter activity (GO:0022898)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	endoplasmic reticulum lumen (GO:0005788)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)|identical protein binding (GO:0042802)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protease binding (GO:0002020)			haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	5		Lung NSC(207;8.94e-06)|all_epithelial(84;3.17e-05)|all_lung(207;3.67e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.14)		GTACAGCATTGTTCCACAATG	0.672																																					p.Q94K		.											.	INS-522	0			c.C280A						.						63.0	53.0	57.0					11																	2181135		2187	4293	6480	SO:0001583	missense	3630	exon3			AGCATTGTTCCAC	X70508	CCDS7729.1	11p15.5	2014-02-03			ENSG00000254647	ENSG00000254647			6081	protein-coding gene	gene with protein product		176730	"""insulin-dependent diabetes mellitus 2"""	IDDM2, IDDM1		6243748, 7773291	Standard	NM_000207		Approved			P01308	OTTHUMG00000009558	ENST00000397262.1:c.280C>A	11.37:g.2181135G>T	ENSP00000380432:p.Gln94Lys	73	0		51	18	NM_001185097	0	0	0	0	0	Q5EEX2	Missense_Mutation	SNP	ENST00000397262.1	37	CCDS7729.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445461	0.43429	.	.	ENSG00000254647	ENST00000397262;ENST00000250971;ENST00000381330;ENST00000512523	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	3.68	2.73	0.32206	Insulin-like (4);	.	.	.	.	D	0.94466	0.8219	M	0.89534	3.04	0.52501	D	0.999953	D;B	0.60160	0.987;0.437	D;P	0.69307	0.963;0.511	D	0.94552	0.7754	9	0.72032	D	0.01	.	11.9365	0.52876	0.0:0.1778:0.8222:0.0	.	82;94	A6XGL2;P01308	.;INS_HUMAN	K	94;94;94;82	ENSP00000380432:Q94K;ENSP00000250971:Q94K;ENSP00000370731:Q94K;ENSP00000424008:Q82K	ENSP00000250971:Q94K	Q	-	1	0	INS	2137711	1.000000	0.71417	0.918000	0.36340	0.079000	0.17450	4.878000	0.63093	0.860000	0.35481	0.462000	0.41574	CAA	.		0.672	INS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026395.3	NM_000207	
PDE3B	5140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	14808189	14808189	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:14808189A>T	ENST00000282096.4	+	3	1589	c.1236A>T	c.(1234-1236)gaA>gaT	p.E412D	PDE3B_ENST00000455098.2_Intron	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	412					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CCTGTTCTGAAATAGAGGACC	0.373																																					p.E412D		.											.	PDE3B-90	0			c.A1236T						.						120.0	130.0	126.0					11																	14808189		2200	4294	6494	SO:0001583	missense	5140	exon3			TTCTGAAATAGAG	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.1236A>T	11.37:g.14808189A>T	ENSP00000282096:p.Glu412Asp	169	0		150	59	NM_000922	0	0	0	0	0	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	37	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	a	14.21	2.468783	0.43839	.	.	ENSG00000152270	ENST00000282096	T	0.34275	1.37	5.72	3.42	0.39159	.	0.151781	0.27749	U	0.018012	T	0.36552	0.0971	N	0.20986	0.625	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.22312	-1.0220	10	0.05959	T	0.93	.	9.8395	0.40991	0.8619:0.0:0.1381:0.0	.	412	Q13370	PDE3B_HUMAN	D	412	ENSP00000282096:E412D	ENSP00000282096:E412D	E	+	3	2	PDE3B	14764765	1.000000	0.71417	0.992000	0.48379	0.978000	0.69477	3.979000	0.56888	0.452000	0.26830	0.456000	0.33151	GAA	.		0.373	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922	
CHRM1	1128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62677207	62677207	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:62677207G>A	ENST00000306960.3	-	2	1907	c.1366C>T	c.(1366-1368)Ccc>Tcc	p.P456S	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	456					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	TGGCGGGAGGGAGTGCGGTGC	0.667																																					p.P456S		.											.	CHRM1-90	0			c.C1366T						.						72.0	79.0	77.0					11																	62677207		2201	4298	6499	SO:0001583	missense	1128	exon2			GGGAGGGAGTGCG	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1366C>T	11.37:g.62677207G>A	ENSP00000306490:p.Pro456Ser	86	0		70	15	NM_000738	0	0	0	0	0	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857391	0.51376	.	.	ENSG00000168539	ENST00000306960	T	0.57595	0.39	4.53	3.58	0.41010	.	0.211607	0.23760	N	0.044839	T	0.37892	0.1020	N	0.24115	0.695	0.35793	D	0.822568	B	0.12630	0.006	B	0.14578	0.011	T	0.40289	-0.9571	10	0.42905	T	0.14	-15.4337	11.7385	0.51780	0.0:0.2317:0.7683:0.0	.	456	P11229	ACM1_HUMAN	S	456	ENSP00000306490:P456S	ENSP00000306490:P456S	P	-	1	0	CHRM1	62433783	1.000000	0.71417	0.993000	0.49108	0.930000	0.56654	5.691000	0.68249	0.995000	0.38917	0.561000	0.74099	CCC	.		0.667	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
CHRM1	1128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62677510	62677510	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:62677510A>T	ENST00000306960.3	-	2	1604	c.1063T>A	c.(1063-1065)Ttc>Atc	p.F355I	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	355					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	ACCAGCGAGAAGGTCTTCCGC	0.592																																					p.F355I		.											.	CHRM1-90	0			c.T1063A						.						55.0	53.0	54.0					11																	62677510		2201	4298	6499	SO:0001583	missense	1128	exon2			GCGAGAAGGTCTT	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1063T>A	11.37:g.62677510A>T	ENSP00000306490:p.Phe355Ile	78	0		59	25	NM_000738	0	0	0	0	0	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.696730	0.30142	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.72051	-0.62;-0.62	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.232532	0.26293	N	0.025212	T	0.43634	0.1256	N	0.04275	-0.24	0.36087	D	0.843175	B	0.14805	0.011	B	0.17098	0.017	T	0.45920	-0.9228	10	0.17369	T	0.5	-24.428	7.3553	0.26714	0.8052:0.0:0.0:0.1948	.	355	P11229	ACM1_HUMAN	I	355	ENSP00000306490:F355I;ENSP00000441188:F355I	ENSP00000306490:F355I	F	-	1	0	CHRM1	62434086	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.101000	0.31037	1.870000	0.54199	0.459000	0.35465	TTC	.		0.592	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
SYTL2	54843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	85409045	85409045	+	Missense_Mutation	SNP	A	A	C	rs554484063		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:85409045A>C	ENST00000528231.1	-	16	2707	c.2430T>G	c.(2428-2430)agT>agG	p.S810R	SYTL2_ENST00000529581.1_Missense_Mutation_p.S252R|SYTL2_ENST00000533892.1_Missense_Mutation_p.S212R|SYTL2_ENST00000359152.5_Missense_Mutation_p.S1656R|SYTL2_ENST00000316356.4_Missense_Mutation_p.S811R|SYTL2_ENST00000527523.1_Missense_Mutation_p.S778R|SYTL2_ENST00000524452.1_Missense_Mutation_p.S786R|SYTL2_ENST00000354566.3_Missense_Mutation_p.S1148R|SYTL2_ENST00000389960.4_Missense_Mutation_p.S786R|SYTL2_ENST00000389958.3_Missense_Mutation_p.S241R|SYTL2_ENST00000525423.1_Missense_Mutation_p.S1132R|SYTL2_ENST00000525702.1_Missense_Mutation_p.S252R	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	810	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AATTTAGATGACTTCCCCTTA	0.393																																					p.S1148R		.											.	SYTL2-137	0			c.T3444G						.						96.0	87.0	90.0					11																	85409045		2203	4299	6502	SO:0001583	missense	54843	exon11			TAGATGACTTCCC	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.2430T>G	11.37:g.85409045A>C	ENSP00000431701:p.Ser810Arg	52	0		50	7	NM_206927	0	0	113	132	19	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.679575	0.47886	.	.	ENSG00000137501	ENST00000389960;ENST00000359152;ENST00000354566;ENST00000316356;ENST00000525702;ENST00000525423;ENST00000529581;ENST00000389958;ENST00000530351;ENST00000528231;ENST00000533892;ENST00000527523;ENST00000524452	T;T;T;T;T;T;T;T;T;T;T;T;T	0.08193	3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12;3.12	5.93	4.98	0.66077	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.357017	0.24240	N	0.040262	T	0.09335	0.0230	N	0.12637	0.245	0.30841	N	0.735693	B;B;B;B;B;D;P;D;B;B	0.54047	0.284;0.409;0.154;0.135;0.288;0.964;0.939;0.964;0.137;0.041	B;B;B;B;B;P;P;P;B;B	0.54346	0.091;0.091;0.148;0.091;0.091;0.749;0.681;0.749;0.091;0.023	T	0.10268	-1.0637	9	.	.	.	-1.3853	11.3673	0.49679	0.191:0.0:0.809:0.0	.	778;786;810;811;628;1108;1132;1148;241;212	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15;Q9HCH5-11;Q9HCH5-7;Q9HCH5-8;Q9HCH5-9;Q9HCH5-4	.;.;SYTL2_HUMAN;.;.;.;.;.;.;.	R	786;1656;1148;811;252;1132;252;241;527;810;212;778;786	ENSP00000374610:S786R;ENSP00000352065:S1656R;ENSP00000346576:S1148R;ENSP00000318803:S811R;ENSP00000432996:S252R;ENSP00000432694:S1132R;ENSP00000435855:S252R;ENSP00000374608:S241R;ENSP00000435009:S527R;ENSP00000431701:S810R;ENSP00000432144:S212R;ENSP00000434010:S778R;ENSP00000435238:S786R	.	S	-	3	2	SYTL2	85086693	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.506000	0.45433	1.497000	0.48584	-0.177000	0.13119	AGT	.		0.393	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
ANKRD49	54851	broad.mit.edu	37	11	94231479	94231479	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:94231479C>T	ENST00000544612.1	+	3	998	c.501C>T	c.(499-501)atC>atT	p.I167I	ANKRD49_ENST00000538535.1_3'UTR|ANKRD49_ENST00000544253.1_3'UTR|ANKRD49_ENST00000302755.4_Silent_p.I167I	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49	167					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATGCAGATATCAATGCCCAAA	0.498																																					p.I167I	Melanoma(113;823 1621 4352 9582 22033)												.	ANKRD49-90	0			c.C501T						.						89.0	78.0	82.0					11																	94231479		2201	4298	6499	SO:0001819	synonymous_variant	54851	exon3			AGATATCAATGCC	AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.501C>T	11.37:g.94231479C>T		129	0		99	4	NM_017704	0	0	4	4	0	Q8NDF2|Q96JE5|Q9NXK7	Silent	SNP	ENST00000544612.1	37	CCDS8300.1																																																																																			.		0.498	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396314.2	NM_017704	
NCAPD3	23310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	134063948	134063948	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:134063948C>T	ENST00000534548.2	-	15	1851	c.1787G>A	c.(1786-1788)cGg>cAg	p.R596Q		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	596					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGCCTGCTTCCGGACAGACAC	0.443																																					p.R596Q		.											.	NCAPD3-229	0			c.G1787A						.						70.0	67.0	68.0					11																	134063948		2201	4297	6498	SO:0001583	missense	23310	exon15			TGCTTCCGGACAG	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1787G>A	11.37:g.134063948C>T	ENSP00000433681:p.Arg596Gln	101	0		100	14	NM_015261	0	0	1	1	0	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777630	0.90195	.	.	ENSG00000151503	ENST00000534548	T	0.75938	-0.98	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.110622	0.64402	D	0.000010	D	0.87795	0.6267	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.88588	0.3141	10	0.72032	D	0.01	-26.9521	19.8686	0.96842	0.0:1.0:0.0:0.0	.	596	P42695	CNDD3_HUMAN	Q	596	ENSP00000433681:R596Q	ENSP00000431612:R596Q	R	-	2	0	NCAPD3	133569158	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.278000	0.51662	2.768000	0.95171	0.655000	0.94253	CGG	.		0.443	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
FAM186A	121006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50745132	50745132	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr12:50745132G>T	ENST00000327337.5	-	4	5482	c.5483C>A	c.(5482-5484)tCt>tAt	p.S1828Y	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.S1828Y	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1828	Pro-rich.																AGGGGCCCGAGATATTGGGAG	0.612																																					p.S1828Y	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A-68	0			c.C5483A						.						16.0	19.0	18.0					12																	50745132		692	1591	2283	SO:0001583	missense	121006	exon4			GCCCGAGATATTG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.5483C>A	12.37:g.50745132G>T	ENSP00000329995:p.Ser1828Tyr	89	0		72	33	NM_001145475	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	G	9.695	1.152884	0.21371	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.17528	2.27;2.27	5.01	0.755	0.18415	.	.	.	.	.	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B;B	0.33171	0.4;0.4	B;B	0.33690	0.168;0.168	T	0.36359	-0.9751	9	0.33141	T	0.24	.	7.4753	0.27371	0.2556:0.1227:0.6216:0.0	.	1828;1828	F5GYN0;A6NE01	.;F186A_HUMAN	Y	1828	ENSP00000441337:S1828Y;ENSP00000329995:S1828Y	ENSP00000329995:S1828Y	S	-	2	0	FAM186A	49031399	0.001000	0.12720	0.000000	0.03702	0.027000	0.11550	0.914000	0.28624	-0.269000	0.09298	-1.164000	0.01763	TCT	.		0.612	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
GALNT6	11226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51758021	51758021	+	Silent	SNP	G	G	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr12:51758021G>C	ENST00000543196.2	-	5	1138	c.933C>G	c.(931-933)ccC>ccG	p.P311P	GALNT6_ENST00000356317.3_Silent_p.P311P			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	311					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CCCTCTGGACGGGCTTGGCGA	0.577																																					p.P311P		.											.	GALNT6-92	0			c.C933G						.						97.0	90.0	92.0					12																	51758021		2203	4300	6503	SO:0001819	synonymous_variant	11226	exon6			CTGGACGGGCTTG	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.933C>G	12.37:g.51758021G>C		291	0		270	97	NM_007210	0	0	1	2	1	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	37	CCDS8813.1																																																																																			.		0.577	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120569801	120569801	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr12:120569801C>T	ENST00000300648.6	-	54	7355	c.7343G>A	c.(7342-7344)gGg>gAg	p.G2448E		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2448					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCTAGGCACCCGGCTGAGGA	0.567																																					p.G2448E		.											.	GCN1L1-94	0			c.G7343A						.						58.0	60.0	60.0					12																	120569801		2016	4171	6187	SO:0001583	missense	10985	exon54			AGGCACCCGGCTG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7343G>A	12.37:g.120569801C>T	ENSP00000300648:p.Gly2448Glu	221	0		173	25	NM_006836	0	0	39	46	7	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379586	0.82682	.	.	ENSG00000089154	ENST00000300648	T	0.61040	0.14	4.19	4.19	0.49359	Armadillo-like helical (1);Armadillo-type fold (1);	0.124142	0.53938	D	0.000052	T	0.75184	0.3815	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	T	0.76462	-0.2950	10	0.39692	T	0.17	-19.3318	17.0673	0.86562	0.0:1.0:0.0:0.0	.	2448	Q92616	GCN1L_HUMAN	E	2448	ENSP00000300648:G2448E	ENSP00000300648:G2448E	G	-	2	0	GCN1L1	119054184	1.000000	0.71417	0.969000	0.41365	0.975000	0.68041	6.918000	0.75788	2.330000	0.79161	0.655000	0.94253	GGG	.		0.567	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
PSPC1	55269	broad.mit.edu;bcgsc.ca	37	13	20277500	20277500	+	Splice_Site	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr13:20277500G>A	ENST00000338910.4	-	9	1546	c.1387C>T	c.(1387-1389)Cac>Tac	p.H463Y		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	463	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		CTGTCATTGTGCTATGATACC	0.433																																					p.H463Y													.	PSPC1-135	0			c.C1387T						.						15.0	16.0	16.0					13																	20277500		1803	4037	5840	SO:0001630	splice_region_variant	55269	exon10			CATTGTGCTATGA	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1387-1C>T	13.37:g.20277500G>A		678	1		673	55	NM_001042414	0	0	0	0	0	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795081	0.31777	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	T	0.13901	2.55	5.4	5.4	0.78164	.	0.109676	0.64402	D	0.000006	T	0.10937	0.0267	L	0.36672	1.1	0.43652	D	0.996064	P	0.43826	0.818	B	0.32090	0.14	T	0.20538	-1.0272	10	0.19147	T	0.46	-17.5429	19.1702	0.93574	0.0:0.0:1.0:0.0	.	463	Q8WXF1	PSPC1_HUMAN	Y	463;403	ENSP00000343966:H463Y	ENSP00000343966:H463Y	H	-	1	0	PSPC1	19175500	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.438000	0.80431	2.529000	0.85273	0.484000	0.47621	CAC	.		0.433	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		Missense_Mutation
ATP11A	23250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113526110	113526110	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr13:113526110T>C	ENST00000487903.1	+	26	3141	c.3053T>C	c.(3052-3054)cTa>cCa	p.L1018P	ATP11A_ENST00000375630.2_Missense_Mutation_p.L1018P|ATP11A_ENST00000283558.8_Missense_Mutation_p.L1018P|ATP11A_ENST00000375645.3_Missense_Mutation_p.L1018P			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1018					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ACAGTTACACTAAAGGTAAGT	0.483																																					p.L1018P		.											.	ATP11A-138	0			c.T3053C						.						159.0	151.0	154.0					13																	113526110		2203	4300	6503	SO:0001583	missense	23250	exon26			TTACACTAAAGGT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3053T>C	13.37:g.113526110T>C	ENSP00000420387:p.Leu1018Pro	99	0		77	33	NM_032189	0	0	0	0	0	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.016751	0.54468	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000419631	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	4.15	4.15	0.48705	.	0.410679	0.24585	N	0.037266	T	0.75191	0.3816	H	0.96175	3.78	0.80722	D	1	D;D	0.67145	0.996;0.978	P;P	0.62014	0.897;0.841	D	0.83543	0.0097	10	0.66056	D	0.02	.	13.4786	0.61322	0.0:0.0:0.0:1.0	.	1018;1018	E9PEJ6;P98196	.;AT11A_HUMAN	P	1018;1018;1018;1018;10	ENSP00000420387:L1018P;ENSP00000364781:L1018P;ENSP00000364796:L1018P;ENSP00000283558:L1018P;ENSP00000410824:L10P	ENSP00000283558:L1018P	L	+	2	0	ATP11A	112574111	0.962000	0.33011	0.392000	0.26245	0.244000	0.25665	7.271000	0.78506	1.628000	0.50416	0.379000	0.24179	CTA	.		0.483	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
OR11H12	440153	broad.mit.edu;bcgsc.ca	37	14	19378076	19378076	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr14:19378076A>G	ENST00000550708.1	+	1	555	c.483A>G	c.(481-483)atA>atG	p.I161M		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I161I(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AACTGGTCATACTGTGCTGGG	0.473																																					p.I161M													.	OR11H12-24	1	Substitution - coding silent(1)	lung(1)	c.A483G						.						155.0	168.0	163.0					14																	19378076		2201	4294	6495	SO:0001583	missense	440153	exon1			GGTCATACTGTGC		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.483A>G	14.37:g.19378076A>G	ENSP00000449002:p.Ile161Met	1608	3		1478	104	NM_001013354	0	0	0	0	0		Missense_Mutation	SNP	ENST00000550708.1	37	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	a	1.849	-0.465596	0.04476	.	.	ENSG00000257115	ENST00000550708	T	0.38722	1.12	0.585	-1.17	0.09648	GPCR, rhodopsin-like superfamily (1);	0.551366	0.14814	N	0.296879	T	0.28665	0.0710	L	0.37697	1.125	0.22851	N	0.998651	B	0.28998	0.23	B	0.34346	0.18	T	0.23190	-1.0195	9	0.40728	T	0.16	.	3.7785	0.08671	0.6099:0.0:0.0:0.3901	.	161	B2RN74	O11HC_HUMAN	M	161	ENSP00000449002:I161M	ENSP00000449002:I161M	I	+	3	3	CR383656.1	18448076	0.000000	0.05858	0.739000	0.30968	0.212000	0.24457	-1.607000	0.02070	-0.821000	0.04312	0.055000	0.15244	ATA	.		0.473	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
HOMEZ	57594	hgsc.bcm.edu	37	14	23744820	23744820	+	Missense_Mutation	SNP	A	A	T	rs200818825		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr14:23744820A>T	ENST00000357460.5	-	2	1781	c.1617T>A	c.(1615-1617)gaT>gaA	p.D539E	HOMEZ_ENST00000431326.2_Missense_Mutation_p.D541E|HOMEZ_ENST00000561013.1_Missense_Mutation_p.D541E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	539	Poly-Asp.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcatcatcatcatcttcct	0.468																																					p.D539E		.											.	HOMEZ-22	0			c.T1617A						.						38.0	38.0	38.0					14																	23744820		2192	4245	6437	SO:0001583	missense	57594	exon2			ATCATCATCATCT	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1617T>A	14.37:g.23744820A>T	ENSP00000350049:p.Asp539Glu	161	0		153	39	NM_020834	0	0	3	3	0	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	ENST00000357460.5	37	CCDS45085.1	.	.	.	.	.	.	.	.	.	.	-	0.013	-1.624939	0.00820	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.61742	0.08;0.08	5.83	-11.7	0.00046	Armadillo-like helical (1);	.	.	.	.	T	0.24624	0.0597	N	0.08118	0	0.09310	N	0.999997	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.37572	-0.9700	9	0.33141	T	0.24	-1.9885	2.2937	0.04144	0.2718:0.3133:0.3242:0.0907	.	541;539	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	E	539;541	ENSP00000350049:D539E;ENSP00000406579:D541E	ENSP00000350049:D539E	D	-	3	2	HOMEZ	22814660	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-7.177000	0.00042	-5.316000	0.00017	-1.163000	0.01768	GAT	.		0.468	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	67291218	67291218	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr14:67291218A>C	ENST00000315266.5	+	4	1349	c.228A>C	c.(226-228)gaA>gaC	p.E76D	GPHN_ENST00000305960.9_Intron|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000459628.1_Intron|GPHN_ENST00000543237.1_Missense_Mutation_p.E76D|GPHN_ENST00000478722.1_Missense_Mutation_p.E76D	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	76	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GGTGTGATGAAAAGGAACTTA	0.393			T	MLL	AL																																p.E76D		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN-228	0			c.A228C						.						97.0	92.0	94.0					14																	67291218		2203	4300	6503	SO:0001583	missense	10243	exon4			TGATGAAAAGGAA	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.228A>C	14.37:g.67291218A>C	ENSP00000312771:p.Glu76Asp	94	0		70	19	NM_001024218	0	0	5	10	5	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761655	0.31228	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000555456	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.48	4.33	0.51752	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.046743	0.85682	D	0.000000	T	0.56572	0.1994	N	0.10664	0.02	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.46721	-0.9171	10	0.16896	T	0.51	-9.6865	11.3654	0.49668	0.9283:0.0:0.0717:0.0	.	76;76;76	F5H039;Q9NQX3;Q9NQX3-2	.;GEPH_HUMAN;.	D	76;76;76;9	ENSP00000312771:E76D;ENSP00000417901:E76D;ENSP00000438404:E76D;ENSP00000450706:E9D	ENSP00000312771:E76D	E	+	3	2	GPHN	66360971	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.444000	0.35068	0.910000	0.36722	0.254000	0.18369	GAA	.		0.393	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
SAMD15	161394	broad.mit.edu	37	14	77846826	77846826	+	Splice_Site	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr14:77846826T>C	ENST00000216471.4	+	2	2074		c.e2+2		SAMD15_ENST00000533095.2_Splice_Site	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15											breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GACATGAAGGTGAGTTGTGTC	0.463																																					.													.	SAMD15-90	0			c.1788+2T>C						.						113.0	86.0	96.0					14																	77846826		2203	4300	6503	SO:0001630	splice_region_variant	161394	exon2			TGAAGGTGAGTTG	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1788+2T>C	14.37:g.77846826T>C		164	1		133	4	NM_001010860	0	0	0	0	0	Q2M3P3	Splice_Site	SNP	ENST00000216471.4	37	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936328	0.73442	.	.	ENSG00000100583	ENST00000533095;ENST00000216471	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7935	0.63157	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SAMD15	76916579	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.841000	0.62824	1.888000	0.54679	0.459000	0.35465	.	.		0.463	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	Intron
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	62211634	62211634	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr15:62211634T>C	ENST00000261517.5	-	58	7565	c.7492A>G	c.(7492-7494)Aca>Gca	p.T2498A	VPS13C_ENST00000395898.3_Missense_Mutation_p.T2455A|VPS13C_ENST00000249837.3_Missense_Mutation_p.T2455A|VPS13C_ENST00000395896.4_Missense_Mutation_p.T2498A	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GCAACTTCTGTATATCCATGA	0.378																																					p.T2498A		.											.	VPS13C-92	0			c.A7492G						.						127.0	126.0	126.0					15																	62211634		2203	4299	6502	SO:0001583	missense	54832	exon58			CTTCTGTATATCC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.7492A>G	15.37:g.62211634T>C	ENSP00000261517:p.Thr2498Ala	83	0		103	42	NM_020821	0	0	0	0	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.059562	0.55325	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.44881	0.92;0.91;1.09	5.08	5.08	0.68730	.	0.343050	0.31071	N	0.008307	T	0.38585	0.1046	M	0.69823	2.125	0.36345	D	0.85969	B;B;B;P	0.35745	0.257;0.171;0.257;0.518	B;B;B;B	0.30316	0.089;0.089;0.089;0.114	T	0.49753	-0.8906	10	0.30078	T	0.28	.	11.1995	0.48733	0.0:0.0745:0.0:0.9255	.	2455;2498;2455;2498	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	A	2455;2498;2498;2498	ENSP00000249837:T2455A;ENSP00000261517:T2498A;ENSP00000379233:T2498A	ENSP00000249837:T2455A	T	-	1	0	VPS13C	59998926	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	2.093000	0.41710	2.023000	0.59567	0.533000	0.62120	ACA	.		0.378	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
ADAMTSL3	57188	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	84592737	84592737	+	Missense_Mutation	SNP	G	G	A	rs148020587		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr15:84592737G>A	ENST00000286744.5	+	17	2293	c.2069G>A	c.(2068-2070)cGt>cAt	p.R690H	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R690H	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	690						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			ATGGTCCACCGTCCTCCAGCC	0.537																																					p.R690H													.	ADAMTSL3-1153	0			c.G2069A						.						114.0	81.0	92.0					15																	84592737		2203	4300	6503	SO:0001583	missense	57188	exon17			TCCACCGTCCTCC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2069G>A	15.37:g.84592737G>A	ENSP00000286744:p.Arg690His	279	1		229	70	NM_207517	0	0	1	3	2	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614408	0.66672	.	.	ENSG00000156218	ENST00000286744	T	0.69040	-0.37	5.25	5.25	0.73442	.	0.071450	0.53938	D	0.000044	D	0.82453	0.5040	M	0.89478	3.035	0.39210	D	0.963298	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.945	D	0.85861	0.1410	10	0.72032	D	0.01	.	9.9604	0.41693	0.0927:0.0:0.9073:0.0	.	690;690	P82987-2;P82987	.;ATL3_HUMAN	H	690	ENSP00000286744:R690H	ENSP00000286744:R690H	R	+	2	0	ADAMTSL3	82383741	0.979000	0.34478	0.948000	0.38648	0.668000	0.39293	3.573000	0.53856	2.451000	0.82905	0.637000	0.83480	CGT	G|1.000;T|0.000		0.537	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
C15orf32	145858	broad.mit.edu	37	15	93016234	93016234	+	Silent	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr15:93016234T>C	ENST00000333334.2	+	2	921	c.426T>C	c.(424-426)gaT>gaC	p.D142D	RP11-763K15.1_ENST00000554440.1_lincRNA|C15orf32_ENST00000556865.1_Silent_p.D142D	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	142										endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			TGTGTACAGATTGCAAATTCA	0.473																																					p.D142D													.	C15orf32-91	0			c.T426C						.						132.0	122.0	125.0					15																	93016234		2198	4298	6496	SO:0001819	synonymous_variant	145858	exon2			TACAGATTGCAAA		CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.426T>C	15.37:g.93016234T>C		152	0		122	3	NM_153040	0	0	0	0	0	C5HTZ8|Q96M45	Silent	SNP	ENST00000333334.2	37	CCDS10373.1																																																																																			.		0.473	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313527.2	NM_153040	
RPL3L	6123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1995508	1995508	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:1995508C>A	ENST00000268661.7	-	9	1253	c.1159G>T	c.(1159-1161)Gcc>Tcc	p.A387S	MSRB1_ENST00000564908.1_5'Flank|MSRB1_ENST00000361871.3_5'Flank|MSRB1_ENST00000399753.2_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	387					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						ACCATGAAGGCCCTCTTCTCT	0.597																																					p.A387S		.											.	RPL3L-90	0			c.G1159T						.						55.0	46.0	50.0					16																	1995508		2199	4300	6499	SO:0001583	missense	6123	exon9			TGAAGGCCCTCTT	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.1159G>T	16.37:g.1995508C>A	ENSP00000268661:p.Ala387Ser	89	0		66	27	NM_005061	0	0	0	0	0		Missense_Mutation	SNP	ENST00000268661.7	37	CCDS10450.1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430672	0.25726	.	.	ENSG00000140986	ENST00000268661	T	0.32753	1.44	3.92	3.92	0.45320	.	0.259903	0.37178	N	0.002207	T	0.39384	0.1076	M	0.69248	2.105	0.50632	D	0.999888	P	0.44139	0.827	P	0.45856	0.495	T	0.40553	-0.9557	10	0.46703	T	0.11	-1.9802	15.4739	0.75461	0.0:1.0:0.0:0.0	.	387	Q92901	RL3L_HUMAN	S	387	ENSP00000268661:A387S	ENSP00000268661:A387S	A	-	1	0	RPL3L	1935509	1.000000	0.71417	0.999000	0.59377	0.185000	0.23345	4.700000	0.61803	2.185000	0.69588	0.563000	0.77884	GCC	.		0.597	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2	NM_005061	
SCNN1B	6338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23360139	23360139	+	Silent	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:23360139C>G	ENST00000343070.2	+	2	395	c.219C>G	c.(217-219)acC>acG	p.T73T	SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000307331.5_Silent_p.T118T|SCNN1B_ENST00000568085.1_Silent_p.T73T|SCNN1B_ENST00000568923.1_Silent_p.T73T	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	73					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	TCATCAGGACCTACTTGAGCT	0.587																																					p.T73T		.											.	SCNN1B-157	0			c.C219G						.						84.0	69.0	74.0					16																	23360139		2197	4300	6497	SO:0001819	synonymous_variant	6338	exon2			CAGGACCTACTTG	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.219C>G	16.37:g.23360139C>G		289	0		227	102	NM_000336	0	0	0	0	0	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Silent	SNP	ENST00000343070.2	37	CCDS10609.1																																																																																			C|1.000;A|0.000		0.587	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
RBBP6	5930	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24581493	24581493	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:24581493A>T	ENST00000319715.4	+	17	3914	c.3482A>T	c.(3481-3483)gAg>gTg	p.E1161V	RBBP6_ENST00000348022.2_Missense_Mutation_p.E1127V|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1161					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AAAGATTTTGAGTCTTCTTCA	0.348																																					p.E1161V													.	RBBP6-230	0			c.A3482T						.						56.0	63.0	61.0					16																	24581493		2197	4299	6496	SO:0001583	missense	5930	exon17			ATTTTGAGTCTTC		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3482A>T	16.37:g.24581493A>T	ENSP00000317872:p.Glu1161Val	121	1		109	39	NM_006910	0	0	1	6	5	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.404459	0.62288	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.18960	2.22;2.18	5.86	5.86	0.93980	.	0.091798	0.47093	D	0.000252	T	0.19805	0.0476	N	0.24115	0.695	0.37760	D	0.92627	B;B	0.34214	0.435;0.442	B;B	0.38755	0.281;0.146	T	0.10497	-1.0627	10	0.45353	T	0.12	-7.1997	16.2436	0.82429	1.0:0.0:0.0:0.0	.	1127;1161	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	V	1161;1127	ENSP00000317872:E1161V;ENSP00000316291:E1127V	ENSP00000317872:E1161V	E	+	2	0	RBBP6	24488994	1.000000	0.71417	0.976000	0.42696	0.991000	0.79684	5.840000	0.69402	2.232000	0.73038	0.533000	0.62120	GAG	.		0.348	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
MYLK3	91807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	46781755	46781755	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:46781755C>A	ENST00000394809.4	-	1	466	c.351G>T	c.(349-351)atG>atT	p.M117I	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	117					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCGCAGCCACCATCCTGAAGA	0.657																																					p.M117I		.											.	MYLK3-374	0			c.G351T						.						45.0	40.0	42.0					16																	46781755		2203	4300	6503	SO:0001583	missense	91807	exon1			AGCCACCATCCTG	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.351G>T	16.37:g.46781755C>A	ENSP00000378288:p.Met117Ile	146	0		93	48	NM_182493	0	0	0	0	0	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530435	0.45073	.	.	ENSG00000140795	ENST00000394809	T	0.69435	-0.4	4.87	4.87	0.63330	.	0.000000	0.43260	D	0.000583	T	0.65101	0.2659	M	0.67953	2.075	0.80722	D	1	P	0.38922	0.651	B	0.33521	0.165	T	0.69942	-0.5008	10	0.46703	T	0.11	.	18.3666	0.90392	0.0:1.0:0.0:0.0	.	117	Q32MK0	MYLK3_HUMAN	I	117	ENSP00000378288:M117I	ENSP00000378288:M117I	M	-	3	0	MYLK3	45339256	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	2.195000	0.42677	2.394000	0.81467	0.491000	0.48974	ATG	.		0.657	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
EDC4	23644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67910858	67910858	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:67910858T>G	ENST00000358933.5	+	4	673	c.434T>G	c.(433-435)tTg>tGg	p.L145W	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	145					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		AACTCCTTCTTGGCCTATGCC	0.507																																					p.L145W		.											.	EDC4-92	0			c.T434G						.						136.0	130.0	132.0					16																	67910858		2198	4300	6498	SO:0001583	missense	23644	exon4			CCTTCTTGGCCTA	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.434T>G	16.37:g.67910858T>G	ENSP00000351811:p.Leu145Trp	173	0		123	50	NM_014329	0	0	13	24	11	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.935710	0.92458	.	.	ENSG00000038358	ENST00000358933;ENST00000536072	T	0.42131	0.98	5.83	5.83	0.93111	WD40 repeat-like-containing domain (1);	0.081121	0.51477	D	0.000086	T	0.62901	0.2466	M	0.69823	2.125	0.58432	D	0.999996	D;D	0.71674	0.998;0.997	D;P	0.65140	0.932;0.903	T	0.66740	-0.5847	10	0.87932	D	0	-7.7554	15.8624	0.79035	0.0:0.0:0.0:1.0	.	77;145	B7Z7V8;Q6P2E9	.;EDC4_HUMAN	W	145;77	ENSP00000351811:L145W	ENSP00000351811:L145W	L	+	2	0	EDC4	66468359	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.997000	0.88414	2.235000	0.73313	0.533000	0.62120	TTG	.		0.507	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
AARS	16	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	70301662	70301662	+	Silent	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:70301662G>A	ENST00000261772.8	-	9	1265	c.1122C>T	c.(1120-1122)atC>atT	p.I374I	AARS_ENST00000564359.1_5'Flank	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		CTTCATTAATGATGTCCTTCA	0.517											OREG0023913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I374I													.	AARS-91	0			c.C1122T						.						150.0	133.0	138.0					16																	70301662		2198	4300	6498	SO:0001819	synonymous_variant	16	exon9			ATTAATGATGTCC	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1122C>T	16.37:g.70301662G>A		138	1	1121	107	8	NM_001605	0	0	67	78	11		Silent	SNP	ENST00000261772.8	37	CCDS32474.1																																																																																			.		0.517	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
HYDIN	54768	bcgsc.ca	37	16	71127828	71127828	+	Silent	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:71127828G>A	ENST00000393567.2	-	11	1488	c.1338C>T	c.(1336-1338)atC>atT	p.I446I	HYDIN_ENST00000393550.2_Silent_p.I446I|HYDIN_ENST00000541601.1_Silent_p.I463I|HYDIN_ENST00000288168.10_Silent_p.I463I|HYDIN_ENST00000321489.5_Silent_p.I446I|HYDIN_ENST00000448691.1_Silent_p.I446I|RP11-23E19.1_ENST00000563968.1_RNA|HYDIN_ENST00000448089.2_Silent_p.I446I|HYDIN_ENST00000538248.1_Silent_p.I473I	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	446					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGGGCAGACGGATTTCTCGGC	0.408																																					p.I473I													.	HYDIN-92	0			c.C1419T						.						58.0	58.0	58.0					16																	71127828		2198	4300	6498	SO:0001819	synonymous_variant	54768	exon11			CAGACGGATTTCT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1338C>T	16.37:g.71127828G>A		65	0		64	4	NM_001198542	0	0	0	0	0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.		0.408	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
USP10	9100	bcgsc.ca	37	16	84797744	84797744	+	Silent	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr16:84797744G>A	ENST00000219473.7	+	10	1820	c.1707G>A	c.(1705-1707)caG>caA	p.Q569Q	USP10_ENST00000570191.1_Silent_p.Q573Q	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	569	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AAGAAGAGCAGGAAGAACAAG	0.493																																					p.Q573Q													.	USP10-636	0			c.G1719A						.						57.0	58.0	58.0					16																	84797744		1887	4097	5984	SO:0001819	synonymous_variant	9100	exon11			AGAGCAGGAAGAA	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1707G>A	16.37:g.84797744G>A		246	5		213	11	NM_001272075	0	0	55	55	0	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	ENST00000219473.7	37	CCDS45537.1																																																																																			.		0.493	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	18057182	18057182	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:18057182C>G	ENST00000205890.5	+	43	8398	c.8060C>G	c.(8059-8061)gCc>gGc	p.A2687G	MYO15A_ENST00000418233.3_5'UTR|MYO15A_ENST00000585180.1_5'Flank	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2687	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TATCAGGACGCCCCCTGGAAG	0.657																																					p.A2687G		.											.	MYO15A-97	0			c.C8060G						.						45.0	46.0	46.0					17																	18057182		1888	4114	6002	SO:0001583	missense	51168	exon42			AGGACGCCCCCTG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8060C>G	17.37:g.18057182C>G	ENSP00000205890:p.Ala2687Gly	272	0		294	70	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536404	0.65085	.	.	ENSG00000091536	ENST00000205890	D	0.88586	-2.4	5.07	2.79	0.32731	.	.	.	.	.	T	0.82263	0.4999	M	0.64997	1.995	0.80722	D	1	P	0.35433	0.501	B	0.27608	0.081	T	0.80400	-0.1398	9	0.87932	D	0	.	2.5033	0.04638	0.222:0.4596:0.0:0.3183	.	2687	Q9UKN7	MYO15_HUMAN	G	2687	ENSP00000205890:A2687G	ENSP00000205890:A2687G	A	+	2	0	MYO15A	17997907	1.000000	0.71417	0.800000	0.32199	0.904000	0.53231	2.694000	0.47035	1.107000	0.41642	0.563000	0.77884	GCC	.		0.657	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
KLHL11	55175	broad.mit.edu	37	17	40021223	40021223	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:40021223C>T	ENST00000319121.3	-	1	461	c.401G>A	c.(400-402)cGc>cAc	p.R134H	ACLY_ENST00000588779.1_5'Flank	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	134	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				CCGTCCCGAGCGGGACTCGGA	0.692																																					p.R134H													.	KLHL11-90	0			c.G401A						.						27.0	29.0	28.0					17																	40021223		2201	4293	6494	SO:0001583	missense	55175	exon1			CCCGAGCGGGACT		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.401G>A	17.37:g.40021223C>T	ENSP00000314608:p.Arg134His	84	0		71	4	NM_018143	0	0	1	1	0		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	c	29.2	4.988187	0.93106	.	.	ENSG00000178502	ENST00000319121	T	0.66638	-0.22	4.69	4.69	0.59074	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.161290	0.42964	D	0.000627	T	0.61223	0.2330	L	0.36672	1.1	0.46437	D	0.999044	D	0.63046	0.992	B	0.43754	0.43	T	0.67562	-0.5639	10	0.56958	D	0.05	0.02	17.8294	0.88676	0.0:1.0:0.0:0.0	.	134	Q9NVR0	KLH11_HUMAN	H	134	ENSP00000314608:R134H	ENSP00000314608:R134H	R	-	2	0	KLHL11	37274749	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.550000	0.67268	2.437000	0.82529	0.645000	0.84053	CGC	.		0.692	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
ITGA2B	3674	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	42449792	42449792	+	Splice_Site	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:42449792C>T	ENST00000262407.5	-	30	3092		c.e30-1		ITGA2B_ENST00000353281.4_Splice_Site	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	AGAAGCCGACCTGGGGGTACA	0.577																																					.		.											.	ITGA2B-228	0			c.3061-1G>A						.						58.0	44.0	49.0					17																	42449792		2203	4300	6503	SO:0001630	splice_region_variant	3674	exon31			GCCGACCTGGGGG		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.3061-1G>A	17.37:g.42449792C>T		84	0		97	22	NM_000419	0	0	0	0	0	B2RCY8|O95366|Q14443|Q17R67	Splice_Site	SNP	ENST00000262407.5	37	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306424	0.60305	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8074	0.69968	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA2B	39805318	0.993000	0.37304	0.275000	0.24674	0.303000	0.27691	4.088000	0.57678	2.357000	0.79964	0.561000	0.74099	.	.		0.577	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		Intron
C17orf104	284071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42744196	42744196	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:42744196A>T	ENST00000409122.2	+	5	1059	c.917A>T	c.(916-918)cAa>cTa	p.Q306L	C17orf104_ENST00000409464.1_Missense_Mutation_p.Q140L|C17orf104_ENST00000359945.3_Missense_Mutation_p.Q306L	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	306										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						CCACTACAGCAAAAAAGGGCA	0.348																																					p.Q306L		.											.	C17orf104-22	0			c.A917T						.						27.0	28.0	28.0					17																	42744196		2202	4298	6500	SO:0001583	missense	284071	exon5			TACAGCAAAAAAG		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.917A>T	17.37:g.42744196A>T	ENSP00000386452:p.Gln306Leu	43	0		40	14	NM_001145080	0	0	0	0	0	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	ENST00000409122.2	37	CCDS45703.2	.	.	.	.	.	.	.	.	.	.	A	1.742	-0.491410	0.04322	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000432494;ENST00000409464	T;T;T;T	0.35421	1.31;1.31;1.37;1.31	5.45	4.38	0.52667	.	0.063895	0.64402	D	0.000008	T	0.25975	0.0633	N	0.24115	0.695	0.24874	N	0.992265	B;B;B	0.31548	0.328;0.161;0.161	B;B;B	0.35413	0.202;0.202;0.202	T	0.19257	-1.0311	10	0.59425	D	0.04	-14.3041	8.5529	0.33462	0.8008:0.1303:0.0689:0.0	.	306;306;140	A2RUB1-5;A2RUB1;A2RUB1-1	.;CQ104_HUMAN;.	L	306;306;140;140	ENSP00000353028:Q306L;ENSP00000386452:Q306L;ENSP00000399809:Q140L;ENSP00000386586:Q140L	ENSP00000353028:Q306L	Q	+	2	0	C17orf104	40099722	1.000000	0.71417	0.998000	0.56505	0.014000	0.08584	4.646000	0.61411	1.017000	0.39495	-0.388000	0.06559	CAA	.		0.348	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
SPAG9	9043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	49067112	49067112	+	Silent	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:49067112G>T	ENST00000262013.7	-	21	2947	c.2739C>A	c.(2737-2739)gtC>gtA	p.V913V	SPAG9_ENST00000357122.4_Silent_p.V899V|SPAG9_ENST00000505279.1_Silent_p.V903V|SPAG9_ENST00000510283.1_Silent_p.V756V	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	913					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GCTCTGTGTAGACGCCAGTTT	0.473																																					p.V913V		.											.	SPAG9-659	0			c.C2739A						.						165.0	133.0	144.0					17																	49067112		2203	4300	6503	SO:0001819	synonymous_variant	9043	exon21			TGTGTAGACGCCA	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.2739C>A	17.37:g.49067112G>T		221	0		259	56	NM_001130528	0	0	14	21	7	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	ENST00000262013.7	37	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	G	9.197	1.027489	0.19512	.	.	ENSG00000008294	ENST00000513906	.	.	.	5.77	0.0229	0.14135	.	.	.	.	.	T	0.41627	0.1167	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24548	-1.0157	4	.	.	.	-12.8707	1.4604	0.02394	0.2848:0.2293:0.3304:0.1555	.	.	.	.	Y	157	.	.	S	-	2	0	SPAG9	46422111	0.969000	0.33509	0.999000	0.59377	0.960000	0.62799	0.071000	0.14594	0.094000	0.17404	-1.467000	0.01014	TCT	.		0.473	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
METTL23	124512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74729098	74729098	+	Silent	SNP	C	C	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:74729098C>A	ENST00000341249.6	+	3	455	c.123C>A	c.(121-123)gcC>gcA	p.A41A	METTL23_ENST00000588783.1_Silent_p.A41A|METTL23_ENST00000591571.1_5'UTR|METTL23_ENST00000586738.1_Silent_p.A41A|MFSD11_ENST00000586622.1_5'Flank|METTL23_ENST00000590964.1_5'UTR|METTL23_ENST00000588302.1_5'UTR|RP11-318A15.7_ENST00000587459.1_Silent_p.A13A|METTL23_ENST00000588822.1_5'UTR|METTL23_ENST00000586752.1_5'UTR|METTL23_ENST00000586200.1_Intron|METTL23_ENST00000589977.1_Silent_p.A41A	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	41						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)			large_intestine(2)|lung(1)	3						TTTTGGCTGCCAAATGTGGTG	0.438																																					p.A41A		.											.	.	0			c.C123A						.						26.0	24.0	25.0					17																	74729098		1915	4132	6047	SO:0001819	synonymous_variant	124512	exon3			GGCTGCCAAATGT		CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.123C>A	17.37:g.74729098C>A		74	0		80	13	NM_001206984	0	0	58	85	27	H9ZYJ0|K7EK32	Silent	SNP	ENST00000341249.6	37	CCDS45787.1																																																																																			.		0.438	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451002.1	NM_001080510	
AATK	9625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79095314	79095314	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr17:79095314G>T	ENST00000326724.4	-	11	2446	c.2422C>A	c.(2422-2424)Cca>Aca	p.P808T	AATK_ENST00000417379.1_Missense_Mutation_p.P705T	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	808	Pro-rich.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGGGAAGTGGGGCTCCCTCC	0.701																																					p.P808T		.											.	AATK-933	0			c.C2422A						.						16.0	21.0	19.0					17																	79095314		2062	4182	6244	SO:0001583	missense	9625	exon11			GAAGTGGGGCTCC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.2422C>A	17.37:g.79095314G>T	ENSP00000324196:p.Pro808Thr	69	0		60	15	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	G	7.050	0.564179	0.13498	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.78246	-1.06;-1.16	4.36	2.21	0.28008	.	0.938651	0.08819	U	0.889000	T	0.66366	0.2782	L	0.43152	1.355	0.19575	N	0.999966	B	0.15141	0.012	B	0.09377	0.004	T	0.50276	-0.8847	10	0.22706	T	0.39	.	5.0003	0.14261	0.1085:0.0:0.552:0.3395	.	808	Q6ZMQ8	LMTK1_HUMAN	T	808;772	ENSP00000324196:P808T;ENSP00000363924:P772T	ENSP00000324196:P808T	P	-	1	0	AATK	76709909	0.000000	0.05858	0.647000	0.29507	0.154000	0.21943	0.726000	0.25984	0.801000	0.34066	0.561000	0.74099	CCA	.		0.701	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
MALT1	10892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	56400802	56400802	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr18:56400802A>G	ENST00000348428.3	+	11	1654	c.1396A>G	c.(1396-1398)Aaa>Gaa	p.K466E	MALT1_ENST00000345724.3_Missense_Mutation_p.K455E|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	466	Caspase-like.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TATGTGTAGGAAAAGGTAAGT	0.313			T	BIRC3	MALT																																p.K466E		.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1-660	0			c.A1396G						.						59.0	66.0	64.0					18																	56400802		2203	4299	6502	SO:0001583	missense	10892	exon11			TGTAGGAAAAGGT		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1396A>G	18.37:g.56400802A>G	ENSP00000319279:p.Lys466Glu	59	0		66	5	NM_006785	0	0	0	0	0	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	37	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599615	0.87055	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.41400	1.0;1.0	5.52	5.52	0.82312	Peptidase C14, caspase catalytic (1);	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.66767	-0.5840	10	0.72032	D	0.01	.	15.304	0.73979	1.0:0.0:0.0:0.0	.	455;466	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	E	466;455	ENSP00000319279:K466E;ENSP00000304161:K455E	ENSP00000304161:K455E	K	+	1	0	MALT1	54551782	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.153000	0.77428	2.106000	0.64143	0.528000	0.53228	AAA	.		0.313	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
CHAF1A	10036	broad.mit.edu	37	19	4433329	4433329	+	Silent	SNP	G	G	A	rs368347266		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:4433329G>A	ENST00000301280.5	+	13	2567	c.2466G>A	c.(2464-2466)ccG>ccA	p.P822P	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	822	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGTGCACCCGCAGGTGCTAC	0.617								Chromatin Structure																													p.P822P													.	CHAF1A-92	0			c.G2466A						.	G		1,4405	2.1+/-5.4	0,1,2202	76.0	74.0	75.0		2466	-10.3	0.1	19		75	0,8600		0,0,4300	no	coding-synonymous	CHAF1A	NM_005483.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		822/957	4433329	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10036	exon13			GCACCCGCAGGTG	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2466G>A	19.37:g.4433329G>A		99	0		67	3	NM_005483	0	0	15	15	0	Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	ENST00000301280.5	37	CCDS32875.1																																																																																			.		0.617	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
SPC24	147841	broad.mit.edu	37	19	11259779	11259779	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:11259779G>T	ENST00000592540.1	-	2	327	c.296C>A	c.(295-297)gCc>gAc	p.A99D		NM_182513.2	NP_872319.1	Q8NBT2	SPC24_HUMAN	SPC24, NDC80 kinetochore complex component	99	Interaction with the N-terminus of SPBC25.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleolus (GO:0005730)|nucleus (GO:0005634)				autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	5						TAGGAGGCTGGCCTTCAGACG	0.592																																					p.A99D													.	.	0			c.C296A						.						15.0	18.0	17.0					19																	11259779		1690	3413	5103	SO:0001583	missense	147841	exon2			AGGCTGGCCTTCA	AK075287	CCDS45974.1	19p13.2	2013-06-05	2013-06-05	2007-03-02		ENSG00000161888			26913	protein-coding gene	gene with protein product		609394	"""spindle pole body component 24 homolog (S. cerevisiae)"", ""SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC24			Standard	NM_182513		Approved	FLJ90806	uc002mql.2	Q8NBT2		ENST00000592540.1:c.296C>A	19.37:g.11259779G>T	ENSP00000465075:p.Ala99Asp	176	1		90	4	NM_182513	0	0	0	0	0	B4DZZ7|C9JGC4	Missense_Mutation	SNP	ENST00000592540.1	37	CCDS45974.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804761	0.31961	.	.	ENSG00000161888	ENST00000423327	.	.	.	4.2	1.97	0.26223	.	0.086068	0.47852	U	0.000206	T	0.62332	0.2419	M	0.64997	1.995	0.58432	D	0.999999	P	0.48998	0.918	P	0.51135	0.66	T	0.64377	-0.6422	9	0.72032	D	0.01	-0.9392	11.9287	0.52835	0.0:0.3382:0.6618:0.0	.	99	Q8NBT2	SPC24_HUMAN	D	99	.	ENSP00000397131:A99D	A	-	2	0	SPC24	11120779	0.995000	0.38212	0.982000	0.44146	0.032000	0.12392	3.051000	0.49885	0.239000	0.21243	-0.310000	0.09108	GCC	.		0.592	SPC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453059.1	NM_182513	
SYDE1	85360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15220001	15220001	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:15220001A>T	ENST00000342784.2	+	2	254	c.223A>T	c.(223-225)Agc>Tgc	p.S75C	SYDE1_ENST00000600252.1_5'UTR|SYDE1_ENST00000600440.1_Intron	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	75	Pro-rich.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						CTACCTGCAAAGCCTGGAGCC	0.706																																					p.S75C		.											.	SYDE1-92	0			c.A223T						.						13.0	13.0	13.0					19																	15220001		2148	4200	6348	SO:0001583	missense	85360	exon2			CTGCAAAGCCTGG	BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.223A>T	19.37:g.15220001A>T	ENSP00000341489:p.Ser75Cys	51	0		37	13	NM_033025	0	0	8	12	4	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	37	CCDS12324.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.951011	0.73787	.	.	ENSG00000105137	ENST00000342784	T	0.13778	2.56	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	L	0.47716	1.5	0.27009	N	0.964736	D	0.76494	0.999	D	0.80764	0.994	T	0.02781	-1.1111	10	0.87932	D	0	.	8.0008	0.30295	0.7926:0.2074:0.0:0.0	.	75	Q6ZW31	SYDE1_HUMAN	C	75	ENSP00000341489:S75C	ENSP00000341489:S75C	S	+	1	0	SYDE1	15081001	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.770000	0.62309	1.598000	0.50083	0.533000	0.62120	AGC	.		0.706	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
WDR87	83889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38385244	38385244	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:38385244G>T	ENST00000303868.5	-	4	1206	c.982C>A	c.(982-984)Cag>Aag	p.Q328K	WDR87_ENST00000447313.2_Missense_Mutation_p.Q367K	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	328										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CGACGCAACTGCTGGGGAGCA	0.532																																					p.Q328K		.											.	.	0			c.C982A						.						40.0	44.0	43.0					19																	38385244		692	1591	2283	SO:0001583	missense	83889	exon4			GCAACTGCTGGGG	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.982C>A	19.37:g.38385244G>T	ENSP00000368025:p.Gln328Lys	332	0		285	26	NM_031951	0	0	0	0	0	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	9.397	1.077065	0.20227	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.08807	3.05;3.61	6.06	2.62	0.31277	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.250921	0.28659	N	0.014578	T	0.05593	0.0147	L	0.48642	1.525	0.09310	N	1	P;P	0.39480	0.675;0.675	B;B	0.31442	0.13;0.13	T	0.32771	-0.9894	10	0.23302	T	0.38	-11.2696	5.4761	0.16695	0.0794:0.1424:0.6311:0.1472	.	328;367	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	K	367;328	ENSP00000405012:Q367K;ENSP00000368025:Q328K	ENSP00000368025:Q328K	Q	-	1	0	WDR87	43077084	0.045000	0.20229	0.992000	0.48379	0.739000	0.42172	0.957000	0.29215	1.562000	0.49601	0.643000	0.83706	CAG	.		0.532	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
FBXO11	80204	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	48040950	48040950	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:48040950C>T	ENST00000403359.3	-	17	2135	c.2063G>A	c.(2062-2064)gGa>gAa	p.G688E	FBXO11_ENST00000316377.4_Missense_Mutation_p.G604E|FBXO11_ENST00000402508.1_Missense_Mutation_p.G604E|FBXO11_ENST00000434523.2_Missense_Mutation_p.G112E	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	688					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AACTAGAATTCCACCATTCTG	0.388			"""Mis, F, D"""		DLBCL																																p.G688E		.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11-659	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.G2063A						.						118.0	116.0	117.0					2																	48040950		2202	4300	6502	SO:0001583	missense	80204	exon17			AGAATTCCACCAT	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2063G>A	2.37:g.48040950C>T	ENSP00000384823:p.Gly688Glu	61	0		44	5	NM_001190274	0	0	22	22	0	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.136371|5.136371	0.94517|0.94517	.|.	.|.	ENSG00000138081|ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523|ENST00000493962	D;D;D;D|.	0.90133|.	-2.62;-2.62;-2.62;-2.62|.	5.43|5.43	5.43|5.43	0.79202|0.79202	Pectin lyase fold/virulence factor (2);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);Pectin lyase fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86789|.	0.6017|.	M|M	0.92880|0.92880	3.355|3.355	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	D|.	0.89459|.	0.3735|.	10|.	0.66056|.	D|.	0.02|.	-12.1201|-12.1201	19.5994|19.5994	0.95554|0.95554	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	112;688|.	B3KUR1;Q86XK2|.	.;FBX11_HUMAN|.	E|X	604;688;604;112|479	ENSP00000385398:G604E;ENSP00000384823:G688E;ENSP00000323822:G604E;ENSP00000397359:G112E|.	ENSP00000323822:G604E|.	G|W	-|-	2|3	0|0	FBXO11|FBXO11	47894454|47894454	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.776000|7.776000	0.85560|0.85560	2.699000|2.699000	0.92147|0.92147	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.		0.388	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
AAK1	22848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	69757189	69757189	+	Silent	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:69757189G>A	ENST00000409085.4	-	8	1198	c.822C>T	c.(820-822)ttC>ttT	p.F274F	AAK1_ENST00000406297.3_Silent_p.F274F|AAK1_ENST00000409068.1_Silent_p.F274F|AAK1_ENST00000470281.1_5'Flank	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	274	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						CAGGAATTGTGAAGTTTCCAT	0.313																																					p.F274F		.											.	AAK1-333	0			c.C822T						.						58.0	54.0	55.0					2																	69757189		1830	4085	5915	SO:0001819	synonymous_variant	22848	exon8			AATTGTGAAGTTT	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.822C>T	2.37:g.69757189G>A		170	0		125	44	NM_014911	0	0	2	3	1	Q4ZFZ3|Q53RX6|Q9UPV4	Silent	SNP	ENST00000409085.4	37	CCDS1893.2																																																																																			.		0.313	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
RTKN	6242	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74668862	74668862	+	Silent	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:74668862G>T	ENST00000272430.5	-	1	164	c.82C>A	c.(82-84)Cga>Aga	p.R28R	RTKN_ENST00000233330.6_5'Flank|RTKN_ENST00000305557.5_5'Flank|RTKN_ENST00000484453.1_5'UTR	NM_001015055.1	NP_001015055.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						AGGCTGAGTCGGAAGCGGCCG	0.697																																					p.R28R		.											.	RTKN-91	0			c.C82A						.						28.0	33.0	31.0					2																	74668862		2202	4300	6502	SO:0001819	synonymous_variant	6242	exon1			TGAGTCGGAAGCG	AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000272430.5:c.82C>A	2.37:g.74668862G>T		65	0		38	12	NM_001015055	0	0	27	56	29		Silent	SNP	ENST00000272430.5	37	CCDS33226.1																																																																																			.		0.697	RTKN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328234.1	NM_001015055	
DQX1	165545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74755401	74755401	+	5'Flank	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:74755401G>T	ENST00000404568.3	-	0	0				AUP1_ENST00000377526.3_Missense_Mutation_p.F215L|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000258080.3_5'Flank|HTRA2_ENST00000352222.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TGAAAGGGACGAAAAGTGACC	0.537																																					p.F215L		.											.	AUP1-90	0			c.C645A						.						74.0	80.0	78.0					2																	74755401		2044	4193	6237	SO:0001631	upstream_gene_variant	550	exon6			AGGGACGAAAAGT	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74755401G>T	Exception_encountered	70	0		60	24	NM_181575	0	0	123	145	22	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701042	0.68501	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	D	0.92495	-3.05	5.1	3.01	0.34805	.	0.000000	0.85682	D	0.000000	D	0.94000	0.8078	M	0.66506	2.035	0.54753	D	0.999982	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.984;0.992;0.997	D	0.91236	0.5018	10	0.33940	T	0.23	-15.5435	8.4169	0.32676	0.226:0.0:0.774:0.0	.	272;281;215	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	L	215;279;217	ENSP00000366748:F215L	ENSP00000258081:F279L	F	-	3	2	AUP1	74608909	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.450000	0.35134	0.528000	0.28580	0.462000	0.41574	TTC	.		0.537	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
SOWAHC	65124	ucsc.edu;bcgsc.ca	37	2	110373074	110373074	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:110373074C>T	ENST00000356454.3	+	1	1164	c.1008C>T	c.(1006-1008)gcC>gcT	p.A336A	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	336																	ACATCGACGCCAGGACGAGCG	0.642																																					p.A336A													.	.	0			c.C1008T						.						36.0	40.0	39.0					2																	110373074		2202	4299	6501	SO:0001819	synonymous_variant	65124	exon1			CGACGCCAGGACG	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.1008C>T	2.37:g.110373074C>T		354	2		293	128	NM_023016	0	0	1	2	1	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			.		0.642	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
ANKRD30BL	554226	bcgsc.ca	37	2	132905741	132905741	+	Missense_Mutation	SNP	G	G	A	rs111770980		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:132905741G>A	ENST00000409867.1	-	6	989	c.740C>T	c.(739-741)aCg>aTg	p.T247M	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	247										endometrium(1)|kidney(3)	4						GCTTTCAGCCGTGTCAGGTGT	0.438																																					.													.	.	0			.						.																																			SO:0001583	missense	554226	.			TCAGCCGTGTCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.740C>T	2.37:g.132905741G>A	ENSP00000386398:p.Thr247Met	377	7		323	15	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.003	-2.579831	0.00129	.	.	ENSG00000163046	ENST00000409867	T	0.40225	1.04	0.109	-0.218	0.13142	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20306	-1.0279	5	0.36615	T	0.2	.	.	.	.	.	.	.	.	M	247	ENSP00000386398:T247M	ENSP00000386398:T247M	T	-	2	0	ANKRD30BL	132622211	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-2.520000	0.00951	-2.990000	0.00280	-3.030000	0.00073	ACG	.		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
LCT	3938	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	136555630	136555630	+	Silent	SNP	T	T	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:136555630T>G	ENST00000264162.2	-	13	4955	c.4945A>C	c.(4945-4947)Agg>Cgg	p.R1649R		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1649	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCCAAGCTCCTGTCACGGATC	0.582											OREG0014998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1649R													.	LCT-101	0			c.A4945C						.						113.0	103.0	106.0					2																	136555630		2203	4300	6503	SO:0001819	synonymous_variant	3938	exon13			AGCTCCTGTCACG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4945A>C	2.37:g.136555630T>G		99	1	1626	77	11	NM_002299	0	0	0	0	0	Q4ZG58	Silent	SNP	ENST00000264162.2	37	CCDS2178.1																																																																																			.		0.582	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170136009	170136009	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:170136009T>A	ENST00000263816.3	-	12	1723	c.1438A>T	c.(1438-1440)Aaa>Taa	p.K480*	LRP2_ENST00000443831.1_Nonsense_Mutation_p.K480*	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	480					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGATAGATTTTATTATTAACC	0.393																																					p.K480X		.											.	LRP2-175	0			c.A1438T						.						98.0	105.0	103.0					2																	170136009		2203	4300	6503	SO:0001587	stop_gained	4036	exon12			AGATTTTATTATT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1438A>T	2.37:g.170136009T>A	ENSP00000263816:p.Lys480*	72	0		81	26	NM_004525	0	0	0	0	0	O00711|Q16215	Nonsense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	39	7.557577	0.98358	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7574	0.78046	0.0:0.0:0.0:1.0	.	.	.	.	X	480	.	.	K	-	1	0	LRP2	169844255	1.000000	0.71417	0.998000	0.56505	0.410000	0.31052	7.971000	0.88012	2.136000	0.66102	0.528000	0.53228	AAA	.		0.393	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	171700591	171700591	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:171700591G>T	ENST00000358196.3	+	7	1225	c.675G>T	c.(673-675)atG>atT	p.M225I	GAD1_ENST00000429023.1_3'UTR	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	225					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TTGTCCTCATGGAACAAATAA	0.368																																					p.M225I		.											.	GAD1-91	0			c.G675T						.						210.0	215.0	213.0					2																	171700591		2203	4300	6503	SO:0001583	missense	2571	exon7			CCTCATGGAACAA		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.675G>T	2.37:g.171700591G>T	ENSP00000350928:p.Met225Ile	122	0		119	40	NM_000817	0	0	0	0	0	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500461	0.85176	.	.	ENSG00000128683	ENST00000358196	T	0.36520	1.25	6.17	6.17	0.99709	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.37865	0.1019	L	0.33624	1.015	0.80722	D	1	B	0.30021	0.265	B	0.35312	0.2	T	0.15350	-1.0440	10	0.72032	D	0.01	-26.7667	20.8794	0.99867	0.0:0.0:1.0:0.0	.	225	Q99259	DCE1_HUMAN	I	225	ENSP00000350928:M225I	ENSP00000350928:M225I	M	+	3	0	GAD1	171408837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.394000	0.97261	2.941000	0.99782	0.655000	0.94253	ATG	.		0.368	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
METAP1D	254042	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	172930452	172930452	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:172930452A>G	ENST00000315796.4	+	4	856	c.469A>G	c.(469-471)Aac>Gac	p.N157D	METAP1D_ENST00000488581.1_Intron	NM_199227.1	NP_954697.1	Q6UB28	MAP12_HUMAN	methionyl aminopeptidase type 1D (mitochondrial)	157					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|protein initiator methionine removal (GO:0070084)	mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			NS(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	8						CTCTGTAAACAACGTGCTCTG	0.383																																					p.N157D													.	METAP1D-90	0			c.A469G						.						144.0	115.0	125.0					2																	172930452		2203	4300	6503	SO:0001583	missense	254042	exon4			GTAAACAACGTGC	AY374142, BC029123	CCDS2246.1	2q31.1	2010-09-21			ENSG00000172878	ENSG00000172878			32583	protein-coding gene	gene with protein product	"""methionine aminopeptidase 1D"""	610267				14532271, 16568094	Standard	NM_199227		Approved	MAP1D, Metap1l	uc002uhk.3	Q6UB28	OTTHUMG00000132283	ENST00000315796.4:c.469A>G	2.37:g.172930452A>G	ENSP00000315152:p.Asn157Asp	167	2		172	57	NM_199227	0	0	2	3	1	Q1WNX3	Missense_Mutation	SNP	ENST00000315796.4	37	CCDS2246.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.930691	0.52866	.	.	ENSG00000172878	ENST00000315796	T	0.76060	-0.99	6.16	5.01	0.66863	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	T	0.71239	0.3316	N	0.25789	0.76	0.58432	D	0.999999	P	0.43701	0.815	P	0.50109	0.631	T	0.73714	-0.3896	10	0.72032	D	0.01	-8.6915	12.3265	0.55013	0.9346:0.0:0.0654:0.0	.	157	Q6UB28	AMP1D_HUMAN	D	157	ENSP00000315152:N157D	ENSP00000315152:N157D	N	+	1	0	METAP1D	172638698	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.675000	0.91195	1.153000	0.42468	-0.263000	0.10527	AAC	.		0.383	METAP1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255378.2	NM_199227	
SSFA2	6744	broad.mit.edu	37	2	182763639	182763639	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:182763639G>A	ENST00000431877.2	+	5	576	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	SSFA2_ENST00000428267.2_5'UTR|SSFA2_ENST00000409001.1_Missense_Mutation_p.E133K|SSFA2_ENST00000320370.7_Missense_Mutation_p.E133K	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	133						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGCTCAAATTGAAAACTGGTA	0.284																																					p.E133K													.	SSFA2-153	0			c.G397A						.						149.0	158.0	155.0					2																	182763639		2203	4300	6503	SO:0001583	missense	6744	exon5			CAAATTGAAAACT	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.397G>A	2.37:g.182763639G>A	ENSP00000388731:p.Glu133Lys	59	3		50	3	NM_001130445	0	0	0	0	0	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308712	0.60305	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001	T;T;T	0.14516	2.73;2.5;2.73	5.85	5.85	0.93711	.	0.709072	0.13892	N	0.355534	T	0.18718	0.0449	M	0.63428	1.95	0.80722	D	1	B;B;B	0.22800	0.075;0.075;0.075	B;B;B	0.26864	0.074;0.074;0.074	T	0.01844	-1.1262	10	0.34782	T	0.22	-8.7439	13.0329	0.58854	0.0774:0.0:0.9226:0.0	.	133;133;133	E9PHV5;P28290;P28290-3	.;SSFA2_HUMAN;.	K	133	ENSP00000388731:E133K;ENSP00000314669:E133K;ENSP00000387319:E133K	ENSP00000314669:E133K	E	+	1	0	SSFA2	182471884	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.131000	0.64751	2.773000	0.95371	0.655000	0.94253	GAA	.		0.284	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
MSTN	2660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190927181	190927181	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:190927181T>C	ENST00000260950.4	-	1	274	c.142A>G	c.(142-144)Act>Gct	p.T48A	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	48					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			GAAGATTTAGTGTTTTGTCTC	0.378																																					p.T48A		.											.	MSTN-650	0			c.A142G						.						198.0	194.0	195.0					2																	190927181		2203	4300	6503	SO:0001583	missense	2660	exon1			ATTTAGTGTTTTG	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.142A>G	2.37:g.190927181T>C	ENSP00000260950:p.Thr48Ala	52	0		49	22	NM_005259	0	0	0	0	0	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	37	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307916	0.40895	.	.	ENSG00000138379	ENST00000260950	T	0.64085	-0.08	5.64	5.64	0.86602	Transforming growth factor-beta, N-terminal (1);	0.217803	0.48286	D	0.000186	T	0.51753	0.1693	L	0.29908	0.895	0.43195	D	0.995031	B	0.09022	0.002	B	0.15870	0.014	T	0.43877	-0.9364	10	0.30854	T	0.27	-11.9215	16.0238	0.80522	0.0:0.0:0.0:1.0	.	48	O14793	GDF8_HUMAN	A	48	ENSP00000260950:T48A	ENSP00000260950:T48A	T	-	1	0	MSTN	190635426	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.928000	0.70088	2.367000	0.80283	0.528000	0.53228	ACT	.		0.378	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259	
C2orf69	205327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	200789854	200789854	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:200789854G>T	ENST00000319974.5	+	2	586	c.403G>T	c.(403-405)Gct>Tct	p.A135S	C2orf69_ENST00000491721.1_Intron	NM_153689.5	NP_710156.3	Q8N8R5	CB069_HUMAN	chromosome 2 open reading frame 69	135						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)|stomach(1)|urinary_tract(1)	11						AGAAAATGTTGCTACCATTTT	0.353																																					p.A135S		.											.	C2orf69-23	0			c.G403T						.						51.0	48.0	48.0					2																	200789854		1819	4077	5896	SO:0001583	missense	205327	exon2			AATGTTGCTACCA		CCDS46482.1	2q33.1	2008-08-08			ENSG00000178074	ENSG00000178074			26799	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38973"""					12477932	Standard	NM_153689		Approved	FLJ38973	uc010zhb.2	Q8N8R5	OTTHUMG00000154480	ENST00000319974.5:c.403G>T	2.37:g.200789854G>T	ENSP00000312770:p.Ala135Ser	56	0		92	31	NM_153689	0	0	0	2	2	Q8NE30	Missense_Mutation	SNP	ENST00000319974.5	37	CCDS46482.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667963	0.88348	.	.	ENSG00000178074	ENST00000319974	.	.	.	6.03	6.03	0.97812	.	0.049006	0.85682	D	0.000000	D	0.82600	0.5072	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.82600	-0.0377	9	0.62326	D	0.03	-10.3396	19.5548	0.95338	0.0:0.0:1.0:0.0	.	135	Q8N8R5	CB069_HUMAN	S	135	.	ENSP00000312770:A135S	A	+	1	0	C2orf69	200498099	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.827000	0.99397	2.854000	0.98071	0.655000	0.94253	GCT	.		0.353	C2orf69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335446.1	NM_153689	
DGKD	8527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234368926	234368926	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:234368926G>T	ENST00000264057.2	+	24	2928	c.2916G>T	c.(2914-2916)atG>atT	p.M972I	DGKD_ENST00000409813.3_Missense_Mutation_p.M928I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	972					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	ACCCGGAGATGCTGTCCGAGG	0.617																																					p.M972I		.											.	DGKD-676	0			c.G2916T						.						87.0	79.0	81.0					2																	234368926		2203	4300	6503	SO:0001583	missense	8527	exon24			GGAGATGCTGTCC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2916G>T	2.37:g.234368926G>T	ENSP00000264057:p.Met972Ile	544	1		376	143	NM_152879	0	0	0	2	2	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	7.872	0.728341	0.15507	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.78364	-0.99;-1.17	4.93	3.12	0.35913	.	0.425083	0.24007	N	0.042416	T	0.41419	0.1158	N	0.00652	-1.29	0.20403	N	0.999909	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33214	-0.9877	10	0.21014	T	0.42	.	4.9917	0.14218	0.132:0.4809:0.3087:0.0784	.	928;972	Q16760-2;Q16760	.;DGKD_HUMAN	I	972;928	ENSP00000264057:M972I;ENSP00000386455:M928I	ENSP00000264057:M972I	M	+	3	0	DGKD	234033665	1.000000	0.71417	0.994000	0.49952	0.551000	0.35334	1.017000	0.29989	0.790000	0.33803	0.563000	0.77884	ATG	.		0.617	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
SCLY	51540	hgsc.bcm.edu	37	2	239006933	239006933	+	Silent	SNP	C	C	T	rs78475597	byFrequency	TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:239006933C>T	ENST00000555827.1	+	12	1339	c.1275C>T	c.(1273-1275)gcC>gcT	p.A425A	SCLY_ENST00000422984.2_Silent_p.A331A|SCLY_ENST00000254663.6_Silent_p.A433A|SCLY_ENST00000429612.2_Silent_p.A219A|ESPNL_ENST00000343063.3_5'Flank|ESPNL_ENST00000409169.1_5'Flank			Q96I15	SCLY_HUMAN	selenocysteine lyase	425					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		CCACCAGGGCCGAGGTGGACC	0.716													C|||	26	0.00519169	0.0	0.0288	5008	,	,		15051	0.006		0.0	False		,,,				2504	0.0				p.A433A	Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)	.											.	SCLY-92	0			c.C1299T						.	C		1,4401		0,1,2200	28.0	27.0	27.0		1299	-9.5	0.0	2	dbSNP_131	27	1,8591		0,1,4295	no	coding-synonymous	SCLY	NM_016510.5		0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154		433/454	239006933	2,12992	2201	4296	6497	SO:0001819	synonymous_variant	51540	exon12			CAGGGCCGAGGTG	AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.1275C>T	2.37:g.239006933C>T		1	0		4	4	NM_016510	0	0	5	16	11	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Silent	SNP	ENST00000555827.1	37																																																																																				C|0.996;T|0.004		0.716	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	
FRG1B	284802	bcgsc.ca	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																					.													.	FRG1B-22	2	Substitution - Missense(2)	endometrium(2)	.						.																																			SO:0001583	missense	284802	.			AGAGAACCAAATT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr	139	2		114	6	.	0	0	2	2	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA	.		0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
PLTP	5360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44539886	44539886	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr20:44539886C>T	ENST00000477313.1	-	2	699	c.105G>A	c.(103-105)aaG>aaA	p.K35K	PLTP_ENST00000354050.4_Silent_p.K35K|PLTP_ENST00000542937.1_Silent_p.K55K|PLTP_ENST00000420868.2_Silent_p.K35K|PLTP_ENST00000372420.1_5'Flank|PLTP_ENST00000372431.3_Silent_p.K35K			P55058	PLTP_HUMAN	phospholipid transfer protein	35					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GCCCCTCCTGCTTCACTGAAG	0.602																																					p.K35K		.											.	PLTP-91	0			c.G105A						.						70.0	71.0	71.0					20																	44539886		2203	4300	6503	SO:0001819	synonymous_variant	5360	exon3			CTCCTGCTTCACT	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.105G>A	20.37:g.44539886C>T		124	0		91	32	NM_182676	0	0	0	0	0	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Silent	SNP	ENST00000477313.1	37	CCDS13386.1																																																																																			.		0.602	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
GID8	54994	broad.mit.edu;bcgsc.ca	37	20	61574952	61574952	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr20:61574952A>G	ENST00000266069.3	+	4	568	c.421A>G	c.(421-423)Aca>Gca	p.T141A		NM_017896.2	NP_060366.1	Q9NWU2	GID8_HUMAN	GID complex subunit 8	141						cell junction (GO:0030054)|nucleus (GO:0005634)											AGAGTGCCTCACAGAGATGGA	0.642																																					p.T141A													.	.	0			c.A421G						.						58.0	48.0	51.0					20																	61574952		2203	4300	6503	SO:0001583	missense	54994	exon4			TGCCTCACAGAGA	AK000609	CCDS13510.1	20q13.33	2013-07-31	2013-07-31	2012-07-20	ENSG00000101193	ENSG00000101193			15857	protein-coding gene	gene with protein product		611625	"""chromosome 20 open reading frame 11"", ""GID complex subunit 8 homolog (S. cerevisiae)"""	C20orf11		12559565	Standard	NM_017896		Approved	FLJ20602, bA305P22.1, TWA1	uc002ydy.3	Q9NWU2	OTTHUMG00000032949	ENST00000266069.3:c.421A>G	20.37:g.61574952A>G	ENSP00000266069:p.Thr141Ala	268	1		218	14	NM_017896	0	0	41	47	6	E1P5I3|Q8N5M5	Missense_Mutation	SNP	ENST00000266069.3	37	CCDS13510.1	.	.	.	.	.	.	.	.	.	.	A	6.461	0.453146	0.12283	.	.	ENSG00000101193	ENST00000266069	.	.	.	5.65	5.65	0.86999	Ran binding protein-like, CRA domain (1);Ran binding protein, CRA domain (1);	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	N	0.10809	0.05	0.58432	D	0.999996	B	0.14012	0.009	B	0.16722	0.016	T	0.23332	-1.0191	9	0.22706	T	0.39	-29.1609	16.161	0.81712	1.0:0.0:0.0:0.0	.	141	Q9NWU2	CT011_HUMAN	A	141	.	ENSP00000266069:T141A	T	+	1	0	C20orf11	61045397	1.000000	0.71417	0.997000	0.53966	0.164000	0.22412	5.766000	0.68843	2.274000	0.75844	0.533000	0.62120	ACA	.		0.642	GID8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080097.2	NM_017896	
SAMSN1	64092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	15889252	15889252	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr21:15889252T>A	ENST00000400566.1	-	3	321	c.240A>T	c.(238-240)aaA>aaT	p.K80N	SAMSN1_ENST00000400564.1_Intron|SAMSN1_ENST00000285670.2_Missense_Mutation_p.K148N	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	80					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TTTTACCCACTTTTTTCTTCA	0.328																																					p.K148N		.											.	SAMSN1-94	0			c.A444T						.						124.0	109.0	114.0					21																	15889252		1797	4068	5865	SO:0001583	missense	64092	exon4			ACCCACTTTTTTC	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.240A>T	21.37:g.15889252T>A	ENSP00000383411:p.Lys80Asn	47	0		51	21	NM_001256370	0	0	5	5	0	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.520541	0.44866	.	.	ENSG00000155307	ENST00000285670;ENST00000400566	T;T	0.57752	0.38;0.38	5.35	5.35	0.76521	.	0.100854	0.64402	D	0.000003	T	0.66076	0.2753	M	0.83953	2.67	0.43750	D	0.996253	D;D	0.56746	0.977;0.962	P;P	0.55923	0.787;0.688	T	0.71500	-0.4574	10	0.87932	D	0	-16.1663	7.6865	0.28544	0.0:0.1638:0.0:0.8362	.	148;80	F8WAA1;Q9NSI8	.;SAMN1_HUMAN	N	148;80	ENSP00000285670:K148N;ENSP00000383411:K80N	ENSP00000285670:K148N	K	-	3	2	SAMSN1	14811123	1.000000	0.71417	0.880000	0.34516	0.214000	0.24535	2.251000	0.43187	2.033000	0.60031	0.533000	0.62120	AAA	.		0.328	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		
TRPM2	7226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45825794	45825794	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr21:45825794C>T	ENST00000397928.1	+	18	3109	c.2664C>T	c.(2662-2664)atC>atT	p.I888I	TRPM2_ENST00000300482.5_Silent_p.I888I|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Silent_p.I888I|TRPM2_ENST00000300481.9_Silent_p.I868I	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	888					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCAGGCTCATCCCGGCGACGC	0.642																																					p.I888I		.											.	TRPM2-92	0			c.C2664T						.						67.0	71.0	70.0					21																	45825794		2203	4297	6500	SO:0001819	synonymous_variant	7226	exon18			GCTCATCCCGGCG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2664C>T	21.37:g.45825794C>T		18	0		19	10	NM_003307	0	0	0	0	0	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	ENST00000397928.1	37	CCDS13710.1																																																																																			.		0.642	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
ADORA2A	135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24836558	24836558	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr22:24836558G>T	ENST00000337539.7	+	3	799	c.340G>T	c.(340-342)Ggc>Tgc	p.G114C	ADORA2A_ENST00000496497.1_3'UTR|ADORA2A-AS1_ENST00000326341.4_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A-AS1_ENST00000543438.1_RNA	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	114					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	CAGGTACAATGGCTTGGTGAC	0.567																																					p.G114C		.											.	ADORA2A-90	0			c.G340T						.						107.0	101.0	103.0					22																	24836558		2203	4300	6503	SO:0001583	missense	135	exon3			TACAATGGCTTGG	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.340G>T	22.37:g.24836558G>T	ENSP00000336630:p.Gly114Cys	155	0		129	50	NM_000675	0	0	0	0	0	B2R7E0	Missense_Mutation	SNP	ENST00000337539.7	37	CCDS13826.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.71|15.71	2.914051|2.914051	0.52546|0.52546	.|.	.|.	ENSG00000128271|ENSG00000258555	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596|ENST00000493440	T;T|.	0.20332|.	2.08;2.08|.	4.97|4.97	3.95|3.95	0.45737|0.45737	GPCR, rhodopsin-like superfamily (1);|.	0.205313|.	0.49305|.	D|.	0.000152|.	T|T	0.56217|0.56217	0.1970|0.1970	L|L	0.45470|0.45470	1.425|1.425	0.43814|0.43814	D|D	0.996375|0.996375	D|.	0.65815|.	0.995|.	P|.	0.62014|.	0.897|.	T|T	0.51872|0.51872	-0.8650|-0.8650	10|5	0.59425|.	D|.	0.04|.	-27.3119|-27.3119	9.0177|9.0177	0.36179|0.36179	0.1684:0.0:0.8316:0.0|0.1684:0.0:0.8316:0.0	.|.	114|.	P29274|.	AA2AR_HUMAN|.	C|I	114|46	ENSP00000414802:G114C;ENSP00000336630:G114C|.	ENSP00000336630:G114C|.	G|M	+|+	1|3	0|0	ADORA2A|KB-1896H10.1	23166558|23166558	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.973000|0.973000	0.67179|0.67179	3.477000|3.477000	0.53151|0.53151	1.213000|1.213000	0.43380|0.43380	0.563000|0.563000	0.77884|0.77884	GGC|ATG	.		0.567	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319971.2	NM_000675	
CBX6	23466	broad.mit.edu;bcgsc.ca	37	22	39262330	39262330	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr22:39262330T>G	ENST00000407418.3	-	5	1246	c.1123A>C	c.(1123-1125)Agc>Cgc	p.S375R	CBX6_ENST00000216083.6_Missense_Mutation_p.S357R			O95503	CBX6_HUMAN	chromobox homolog 6	375					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					AGGAGGTTGCTGGTGACATCG	0.657																																					p.S375R													.	CBX6-226	0			c.A1123C						.						56.0	57.0	57.0					22																	39262330		2203	4300	6503	SO:0001583	missense	23466	exon5			GGTTGCTGGTGAC		CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.1123A>C	22.37:g.39262330T>G	ENSP00000384490:p.Ser375Arg	130	0		110	34	NM_014292	0	0	4	7	3	A8KAH0|Q96EM5	Missense_Mutation	SNP	ENST00000407418.3	37	CCDS13980.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.554120	0.65425	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	.	.	.	4.23	4.23	0.50019	.	0.240026	0.26899	N	0.021925	T	0.62588	0.2440	L	0.50333	1.59	0.40639	D	0.981929	D	0.59357	0.985	P	0.53360	0.724	T	0.68217	-0.5467	9	0.66056	D	0.02	.	13.4862	0.61366	0.0:0.0:0.0:1.0	.	375	O95503	CBX6_HUMAN	R	375;357	.	ENSP00000216083:S357R	S	-	1	0	CBX6	37592276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.312000	0.59154	1.773000	0.52216	0.334000	0.21626	AGC	.		0.657	CBX6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318190.1	NM_014292	
SATB1	6304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	18390936	18390936	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:18390936T>C	ENST00000338745.6	-	11	3752	c.2018A>G	c.(2017-2019)gAg>gGg	p.E673G	SATB1_ENST00000454909.2_Missense_Mutation_p.E673G|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000417717.2_Missense_Mutation_p.E705G	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	673					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CTGGATGGCCTCTTCGTCAGG	0.517																																					p.E705G		.											.	SATB1-228	0			c.A2114G						.						141.0	140.0	140.0					3																	18390936		2203	4300	6503	SO:0001583	missense	6304	exon12			ATGGCCTCTTCGT		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.2018A>G	3.37:g.18390936T>C	ENSP00000341024:p.Glu673Gly	202	0		175	73	NM_001195470	0	0	13	18	5	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.370587	0.61624	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	D;D;D	0.96745	-4.11;-4.11;-4.11	5.27	5.27	0.74061	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.049242	0.85682	N	0.000000	D	0.96642	0.8904	L	0.32530	0.975	0.80722	D	1	B;D	0.89917	0.013;1.0	B;D	0.97110	0.004;1.0	D	0.97662	1.0161	10	0.87932	D	0	-15.8047	15.186	0.73002	0.0:0.0:0.0:1.0	.	705;673	Q01826-2;Q01826	.;SATB1_HUMAN	G	673;673;705	ENSP00000341024:E673G;ENSP00000399708:E673G;ENSP00000399518:E705G	ENSP00000341024:E673G	E	-	2	0	SATB1	18365940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.911000	0.87458	1.993000	0.58246	0.460000	0.39030	GAG	.		0.517	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
EPM2AIP1	9852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37033483	37033483	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:37033483C>A	ENST00000322716.5	-	1	1312	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F	MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000435176.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	362					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						CTACTGAAACCAAGAACGCTT	0.413																																					p.L362F		.											.	.	0			c.G1086T						.						190.0	192.0	191.0					3																	37033483		1871	4110	5981	SO:0001583	missense	9852	exon1			TGAAACCAAGAAC	AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.1086G>T	3.37:g.37033483C>A	ENSP00000406027:p.Leu362Phe	62	0		62	10	NM_014805	0	0	1	2	1	O94866|Q9H3L3	Missense_Mutation	SNP	ENST00000322716.5	37	CCDS46790.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275856	0.59649	.	.	ENSG00000178567	ENST00000322716	T	0.31247	1.5	4.71	4.71	0.59529	.	.	.	.	.	T	0.41834	0.1176	L	0.27053	0.805	0.47698	D	0.999499	D	0.76494	0.999	D	0.74674	0.984	T	0.29549	-1.0008	9	0.49607	T	0.09	-10.3057	15.1824	0.72968	0.0:1.0:0.0:0.0	.	362	Q7L775	EPMIP_HUMAN	F	362	ENSP00000406027:L362F	ENSP00000406027:L362F	L	-	3	2	EPM2AIP1	37008487	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	2.648000	0.46647	2.424000	0.82194	0.591000	0.81541	TTG	.		0.413	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470593.1	NM_014805	
LIMD1	8994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45637412	45637412	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:45637412T>G	ENST00000273317.4	+	1	1062	c.1041T>G	c.(1039-1041)agT>agG	p.S347R	LIMD1_ENST00000465039.1_Intron|LIMD1_ENST00000440097.1_Missense_Mutation_p.S347R	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	347					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		ACCTTTCCAGTTCTGCCCCGT	0.622																																					p.S347R		.											.	LIMD1-279	0			c.T1041G						.						78.0	78.0	78.0					3																	45637412		2203	4300	6503	SO:0001583	missense	8994	exon1			TTCCAGTTCTGCC	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.1041T>G	3.37:g.45637412T>G	ENSP00000273317:p.Ser347Arg	251	0		231	79	NM_014240	0	0	0	2	2	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	T	9.543	1.113931	0.20795	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.58506	0.33;0.53	4.73	1.1	0.20463	.	1.824180	0.02460	N	0.086523	T	0.44953	0.1318	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.14420	-1.0473	10	0.22706	T	0.39	.	6.3277	0.21253	0.0:0.4757:0.0:0.5243	.	347	Q9UGP4	LIMD1_HUMAN	R	347	ENSP00000394537:S347R;ENSP00000273317:S347R	ENSP00000273317:S347R	S	+	3	2	LIMD1	45612416	0.001000	0.12720	0.006000	0.13384	0.180000	0.23129	-0.032000	0.12266	0.203000	0.20529	0.533000	0.62120	AGT	.		0.622	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
ATRIP	84126	ucsc.edu	37	3	48488465	48488465	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:48488465C>T	ENST00000320211.3	+	1	329	c.216C>T	c.(214-216)agC>agT	p.S72S	ATRIP_ENST00000346691.4_Silent_p.S72S|RP11-24C3.2_ENST00000435578.1_RNA|RP11-24C3.2_ENST00000438872.1_RNA|ATRIP_ENST00000412052.1_5'Flank|ATRIP_ENST00000357105.6_Intron	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	72					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGGCCCTGAGCCAATGTCCGG	0.677								Other conserved DNA damage response genes																													p.S72S													.	ATRIP-23	0			c.C216T						.						18.0	20.0	20.0					3																	48488465		2180	4262	6442	SO:0001819	synonymous_variant	84126	exon1			CCTGAGCCAATGT	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.216C>T	3.37:g.48488465C>T		84	0		45	4	NM_130384	0	0	3	3	0	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	ENST00000320211.3	37	CCDS2768.1																																																																																			.		0.677	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
GMPPB	29925	broad.mit.edu	37	3	49760823	49760823	+	Splice_Site	SNP	A	A	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:49760823A>C	ENST00000480687.1	-	3	327		c.e3+1		AMIGO3_ENST00000535833.1_Splice_Site|GMPPB_ENST00000308388.6_Splice_Site|GMPPB_ENST00000308375.6_Splice_Site			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTGCCTCACCCTCTGCTC	0.607																																					.													.	GMPPB-90	0			c.210+2T>G						.						124.0	116.0	119.0					3																	49760823		2203	4300	6503	SO:0001630	splice_region_variant	29925	exon3			TGCCTCACCCTCT	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.210+1T>G	3.37:g.49760823A>C		126	7		88	11	NM_021971	0	0	0	0	0	A8K6N5|Q9H7U3	Splice_Site	SNP	ENST00000480687.1	37	CCDS2803.1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.743778	0.69418	.	.	ENSG00000173540	ENST00000480687;ENST00000308375;ENST00000308388	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7476	0.57289	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GMPPB	49735827	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.493000	0.90474	1.949000	0.56562	0.374000	0.22700	.	.		0.607	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	Intron
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52416419	52416419	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:52416419T>C	ENST00000420323.2	+	50	8150	c.7889T>C	c.(7888-7890)cTc>cCc	p.L2630P		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2630	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AAGGTCCTGCTCAAGGCGGGC	0.582																																					p.L2630P		.											.	DNAH1-67	0			c.T7889C						.						169.0	177.0	175.0					3																	52416419		2125	4239	6364	SO:0001583	missense	25981	exon50			TCCTGCTCAAGGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7889T>C	3.37:g.52416419T>C	ENSP00000401514:p.Leu2630Pro	197	0		143	57	NM_015512	0	0	0	1	1	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.529987	0.64860	.	.	ENSG00000114841	ENST00000420323	T	0.54279	0.58	4.49	4.49	0.54785	.	0.155058	0.30126	N	0.010343	T	0.76898	0.4052	M	0.93507	3.425	0.80722	D	1	D	0.61697	0.99	D	0.67725	0.953	T	0.80817	-0.1213	10	0.35671	T	0.21	.	13.9669	0.64213	0.0:0.0:0.0:1.0	.	2630	C9JXH6	.	P	2630	ENSP00000401514:L2630P	ENSP00000401514:L2630P	L	+	2	0	DNAH1	52391459	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	5.444000	0.66587	1.883000	0.54544	0.379000	0.24179	CTC	.		0.582	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
IGSF10	285313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	151166796	151166796	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:151166796C>T	ENST00000282466.3	-	4	972	c.973G>A	c.(973-975)Gga>Aga	p.G325R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	325					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCTTCATTTCCAGACTGATCT	0.433																																					p.G325R		.											.	IGSF10-102	0			c.G973A						.						108.0	109.0	109.0					3																	151166796		2203	4300	6503	SO:0001583	missense	285313	exon4			CATTTCCAGACTG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.973G>A	3.37:g.151166796C>T	ENSP00000282466:p.Gly325Arg	126	0		117	46	NM_178822	0	0	0	0	0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243180	0.39697	.	.	ENSG00000152580	ENST00000282466	T	0.75260	-0.92	5.37	4.5	0.54988	.	0.000000	0.47093	D	0.000256	T	0.67915	0.2944	M	0.64997	1.995	0.38362	D	0.944634	B	0.34200	0.441	B	0.26094	0.066	T	0.72513	-0.4270	10	0.87932	D	0	.	10.7221	0.46046	0.0:0.7971:0.1309:0.072	.	325	Q6WRI0	IGS10_HUMAN	R	325	ENSP00000282466:G325R	ENSP00000282466:G325R	G	-	1	0	IGSF10	152649486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.805000	0.38883	1.270000	0.44297	0.650000	0.86243	GGA	.		0.433	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
BOD1L1	259282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	13601745	13601745	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:13601745G>A	ENST00000040738.5	-	10	6914	c.6779C>T	c.(6778-6780)tCg>tTg	p.S2260L		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2260						nucleus (GO:0005634)	DNA binding (GO:0003677)										GTCTTCCACCGAGCTCGTAGA	0.542																																					p.S2260L		.											.	.	0			c.C6779T						.						79.0	69.0	72.0					4																	13601745		2203	4300	6503	SO:0001583	missense	259282	exon10			TCCACCGAGCTCG	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6779C>T	4.37:g.13601745G>A	ENSP00000040738:p.Ser2260Leu	171	0		149	16	NM_148894	0	0	1	1	0	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194306	0.78902	.	.	ENSG00000038219	ENST00000040738	T	0.12255	2.7	5.46	5.46	0.80206	.	0.000000	0.45126	D	0.000387	T	0.23727	0.0574	M	0.64997	1.995	0.30881	N	0.731467	D	0.63046	0.992	P	0.51055	0.657	T	0.15350	-1.0440	10	0.72032	D	0.01	-3.6924	11.8817	0.52579	0.0832:0.0:0.9168:0.0	.	2260	Q8NFC6	BOD1L_HUMAN	L	2260	ENSP00000040738:S2260L	ENSP00000040738:S2260L	S	-	2	0	BOD1L	13210843	0.993000	0.37304	0.944000	0.38274	0.889000	0.51656	2.414000	0.44627	2.573000	0.86826	0.650000	0.86243	TCG	.		0.542	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
RUFY3	22902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71588406	71588406	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:71588406G>T	ENST00000226328.4	+	1	679	c.116G>T	c.(115-117)tGg>tTg	p.W39L	RUFY3_ENST00000417478.2_Intron|RUFY3_ENST00000536664.1_Missense_Mutation_p.W5L|RUFY3_ENST00000381006.3_Missense_Mutation_p.W39L	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	39					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			GATGGAGAATGGCTCTGCCTG	0.532																																					p.W39L		.											.	RUFY3-90	0			c.G116T						.						204.0	166.0	179.0					4																	71588406		2203	4300	6503	SO:0001583	missense	22902	exon1			GAGAATGGCTCTG	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.116G>T	4.37:g.71588406G>T	ENSP00000226328:p.Trp39Leu	284	1		247	93	NM_001037442	0	0	1	1	0	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797286	0.70567	.	.	ENSG00000018189	ENST00000381006;ENST00000226328;ENST00000536664	T;T;T	0.35973	1.81;1.28;2.13	5.51	5.51	0.81932	.	0.200815	0.47852	D	0.000210	T	0.57227	0.2039	L	0.52011	1.625	0.58432	D	0.999999	B;D;D	0.67145	0.001;0.996;0.967	B;D;P	0.78314	0.002;0.991;0.901	T	0.58301	-0.7660	10	0.87932	D	0	0.0099	19.4131	0.94683	0.0:0.0:1.0:0.0	.	5;39;39	B4DKC2;Q7L099-3;Q7L099	.;.;RUFY3_HUMAN	L	39;39;5	ENSP00000370394:W39L;ENSP00000226328:W39L;ENSP00000443652:W5L	ENSP00000226328:W39L	W	+	2	0	RUFY3	71807270	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.476000	0.97823	2.590000	0.87494	0.555000	0.69702	TGG	.		0.532	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
GRID2	2895	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	94138031	94138031	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:94138031A>G	ENST00000282020.4	+	6	1190	c.932A>G	c.(931-933)gAt>gGt	p.D311G	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.D216G	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	311					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		ACATTGTGTGATCCAAAGGAT	0.413																																					p.D311G													.	GRID2-159	0			c.A932G						.						145.0	145.0	145.0					4																	94138031		2203	4300	6503	SO:0001583	missense	2895	exon6			TGTGTGATCCAAA	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.932A>G	4.37:g.94138031A>G	ENSP00000282020:p.Asp311Gly	90	1		83	25	NM_001510	0	0	0	0	0	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.329783	0.81690	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.82433	-1.61;-1.61	4.76	4.76	0.60689	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.87277	0.6137	L	0.46157	1.445	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.77004	0.989;0.989	D	0.86678	0.1915	10	0.40728	T	0.16	.	13.7424	0.62855	1.0:0.0:0.0:0.0	.	216;311	E9PH24;O43424	.;GRID2_HUMAN	G	311;216	ENSP00000282020:D311G;ENSP00000421257:D216G	ENSP00000282020:D311G	D	+	2	0	GRID2	94357054	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.754000	0.91642	1.909000	0.55274	0.482000	0.46254	GAT	.		0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
NFKB1	4790	broad.mit.edu;bcgsc.ca	37	4	103501735	103501735	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:103501735G>T	ENST00000505458.1	+	9	1048	c.771G>T	c.(769-771)agG>agT	p.R257S	NFKB1_ENST00000394820.4_Missense_Mutation_p.R257S|NFKB1_ENST00000600343.1_Missense_Mutation_p.R77S|NFKB1_ENST00000510638.1_3'UTR|NFKB1_ENST00000226574.4_Missense_Mutation_p.R258S			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	257	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	GAATGGACAGGACAGCTGGAT	0.413																																					p.R258S													.	NFKB1-912	0			c.G774T						.						126.0	126.0	126.0					4																	103501735		2203	4300	6503	SO:0001583	missense	4790	exon9			GGACAGGACAGCT	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.771G>T	4.37:g.103501735G>T	ENSP00000424790:p.Arg257Ser	143	0		122	7	NM_003998	0	0	32	32	0	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	ENST00000505458.1	37	CCDS54783.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.913709	0.72983	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458;ENST00000508584	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.5	2.79	0.32731	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.34279	0.0892	L	0.42581	1.335	0.46823	D	0.999212	D;D;D	0.71674	0.989;0.998;0.989	P;P;P	0.62089	0.868;0.82;0.898	T	0.06698	-1.0812	10	0.87932	D	0	.	6.915	0.24355	0.2731:0.1171:0.6098:0.0	.	77;257;258	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	S	258;257;257;51	ENSP00000226574:R258S;ENSP00000378297:R257S;ENSP00000424790:R257S;ENSP00000424815:R51S	ENSP00000226574:R258S	R	+	3	2	NFKB1	103720773	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.650000	0.24858	0.677000	0.31305	0.650000	0.86243	AGG	.		0.413	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1		
KIAA1109	84162	broad.mit.edu	37	4	123185457	123185457	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:123185457G>A	ENST00000264501.4	+	45	7565	c.7192G>A	c.(7192-7194)Gtc>Atc	p.V2398I	KIAA1109_ENST00000455637.1_Missense_Mutation_p.V2398I|KIAA1109_ENST00000388738.3_Missense_Mutation_p.V2398I			Q2LD37	K1109_HUMAN	KIAA1109	2398					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTTCAACACTGTCTTGTCTAG	0.403																																					p.V2398I													.	KIAA1109-80	0			c.G7192A						.						101.0	100.0	101.0					4																	123185457		1929	4142	6071	SO:0001583	missense	84162	exon43			AACACTGTCTTGT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7192G>A	4.37:g.123185457G>A	ENSP00000264501:p.Val2398Ile	95	0		107	5	NM_015312	0	0	0	0	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.158765|4.158765	0.78226|0.78226	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.25414	.|2.43;2.43;1.8	5.92|5.92	5.08|5.08	0.68730|0.68730	.|.	.|0.127540	.|0.30126	.|N	.|0.010349	T|T	0.17323|0.17323	0.0416|0.0416	N|N	0.19112|0.19112	0.55|0.55	0.40902|0.40902	D|D	0.984167|0.984167	.|B;B;B	.|0.15141	.|0.001;0.003;0.012	.|B;B;B	.|0.11329	.|0.004;0.006;0.004	T|T	0.06499|0.06499	-1.0823|-1.0823	5|10	.|0.14656	.|T	.|0.56	.|.	15.1126|15.1126	0.72372|0.72372	0.0674:0.0:0.9326:0.0|0.0674:0.0:0.9326:0.0	.|.	.|2398;2397;2398	.|Q2LD37-6;Q2LD37-2;Q2LD37	.|.;.;K1109_HUMAN	Y|I	355|2398	.|ENSP00000264501:V2398I;ENSP00000373390:V2398I;ENSP00000389925:V2398I	.|ENSP00000264501:V2398I	C|V	+|+	2|1	0|0	KIAA1109|KIAA1109	123404907|123404907	1.000000|1.000000	0.71417|0.71417	0.928000|0.928000	0.36995|0.36995	0.998000|0.998000	0.95712|0.95712	7.792000|7.792000	0.85828|0.85828	1.525000|1.525000	0.49052|0.49052	0.650000|0.650000	0.86243|0.86243	TGT|GTC	.		0.403	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
CENPK	64105	broad.mit.edu	37	5	64847424	64847424	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr5:64847424C>T	ENST00000396679.1	-	5	422	c.208G>A	c.(208-210)Gaa>Aaa	p.E70K	CENPK_ENST00000510693.1_Missense_Mutation_p.E40K|CENPK_ENST00000510354.1_Missense_Mutation_p.E70K|CENPK_ENST00000242872.3_Missense_Mutation_p.E70K|CENPK_ENST00000506282.2_Intron|CENPK_ENST00000508421.1_Missense_Mutation_p.E40K|CENPK_ENST00000514814.1_Missense_Mutation_p.E70K	NM_022145.4	NP_071428.2	Q9BS16	CENPK_HUMAN	centromere protein K	70					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)	10		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		TGACTGAGTTCAGCGGTTAAA	0.259																																					p.E70K													.	CENPK-90	0			c.G208A						.						69.0	69.0	69.0					5																	64847424		2201	4295	6496	SO:0001583	missense	64105	exon5			TGAGTTCAGCGGT	BC008504	CCDS3984.1	5q12.3	2013-11-05			ENSG00000123219	ENSG00000123219			29479	protein-coding gene	gene with protein product		611502				8950979	Standard	NM_022145		Approved	FKSG14, SOLT, CENP-K	uc003jtu.3	Q9BS16	OTTHUMG00000131227	ENST00000396679.1:c.208G>A	5.37:g.64847424C>T	ENSP00000379911:p.Glu70Lys	116	0		123	5	NM_001267038	0	0	0	0	0	Q9H4L0	Missense_Mutation	SNP	ENST00000396679.1	37	CCDS3984.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854522	0.91355	.	.	ENSG00000123219	ENST00000514814;ENST00000396679;ENST00000242872;ENST00000508421;ENST00000510693;ENST00000515497;ENST00000502997;ENST00000510354	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.78666	0.4319	M	0.70275	2.135	0.53005	D	0.999966	D	0.89917	1.0	D	0.87578	0.998	T	0.79339	-0.1844	9	0.72032	D	0.01	-22.078	16.1014	0.81175	0.0:1.0:0.0:0.0	.	70	Q9BS16	CENPK_HUMAN	K	70;70;70;40;40;72;70;70	.	ENSP00000242872:E70K	E	-	1	0	CENPK	64883180	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	3.891000	0.56227	2.878000	0.98634	0.650000	0.86243	GAA	.		0.259	CENPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253971.2	NM_022145	
TAF7	6879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140699374	140699374	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr5:140699374T>C	ENST00000313368.5	-	1	956	c.238A>G	c.(238-240)Att>Gtt	p.I80V		NM_005642.2	NP_005633.2	Q15545	TAF7_HUMAN	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	80					DNA-templated transcription, initiation (GO:0006352)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of histone acetylation (GO:0035067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermine transport (GO:0000296)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	histone acetyltransferase binding (GO:0035035)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|vitamin D receptor binding (GO:0042809)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTTATCAATGGTTTTCAAG	0.443																																					p.I80V		.											.	TAF7-90	0			c.A238G						.						120.0	113.0	116.0					5																	140699374		2203	4300	6503	SO:0001583	missense	6879	exon1			TATCAATGGTTTT	AF349038	CCDS4259.1	5q31	2008-02-05	2002-08-29	2001-12-07	ENSG00000178913	ENSG00000178913			11541	protein-coding gene	gene with protein product		600573	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, F, 55kD"""	TAF2F		7824954	Standard	NM_005642		Approved	TAFII55	uc003ljg.3	Q15545	OTTHUMG00000129628	ENST00000313368.5:c.238A>G	5.37:g.140699374T>C	ENSP00000312709:p.Ile80Val	111	0		90	29	NM_005642	0	0	37	73	36	B2RBV9|Q13036	Missense_Mutation	SNP	ENST00000313368.5	37	CCDS4259.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307342	0.23821	.	.	ENSG00000178913	ENST00000313368	T	0.23348	1.91	5.08	3.93	0.45458	TAFII55 protein, conserved region (1);	0.259807	0.37809	N	0.001931	T	0.13586	0.0329	N	0.17312	0.475	0.41194	D	0.986322	B	0.09022	0.002	B	0.12837	0.008	T	0.10567	-1.0624	10	0.19590	T	0.45	-6.4089	7.5444	0.27757	0.0:0.0947:0.0:0.9053	.	80	Q15545	TAF7_HUMAN	V	80	ENSP00000312709:I80V	ENSP00000312709:I80V	I	-	1	0	TAF7	140679558	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.373000	0.59537	1.092000	0.41356	0.533000	0.62120	ATT	.		0.443	TAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251823.2	NM_005642	
TFAP2A	7020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	10398689	10398689	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:10398689G>C	ENST00000482890.1	-	8	1627	c.1275C>G	c.(1273-1275)aaC>aaG	p.N425K	TFAP2A_ENST00000497266.1_5'Flank|TFAP2A_ENST00000379608.3_Missense_Mutation_p.N419K|TFAP2A_ENST00000379604.2_Missense_Mutation_p.N425K|TFAP2A_ENST00000379613.3_Missense_Mutation_p.N427K|TFAP2A_ENST00000319516.4_Missense_Mutation_p.N421K			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	425					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				TGCTTTTGGCGTTGTTGTCCG	0.637																																					p.N425K		.											.	TFAP2A-91	0			c.C1275G						.						303.0	314.0	310.0					6																	10398689		2203	4300	6503	SO:0001583	missense	7020	exon7			TTTGGCGTTGTTG	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1275C>G	6.37:g.10398689G>C	ENSP00000418541:p.Asn425Lys	193	0		146	46	NM_003220	0	0	0	0	0	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	37	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	G	5.052	0.195211	0.09599	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17	5.41	5.41	0.78517	.	0.166295	0.64402	D	0.000003	T	0.82139	0.4972	N	0.02539	-0.55	0.34515	D	0.707504	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.74665	-0.3589	10	0.08381	T	0.77	-4.3896	19.197	0.93693	0.0:0.0:1.0:0.0	.	421;425;419	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	K	427;425;421;419;425	ENSP00000368933:N427K;ENSP00000368924:N425K;ENSP00000316516:N421K;ENSP00000368928:N419K;ENSP00000418541:N425K	ENSP00000316516:N421K	N	-	3	2	TFAP2A	10506675	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.556000	0.53734	2.532000	0.85374	0.655000	0.94253	AAC	.		0.637	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
KIF13A	63971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	17817447	17817447	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:17817447C>T	ENST00000259711.6	-	17	1909	c.1804G>A	c.(1804-1806)Gtt>Att	p.V602I	KIF13A_ENST00000378814.5_Missense_Mutation_p.V602I|KIF13A_ENST00000503342.1_5'Flank|KIF13A_ENST00000378826.2_Missense_Mutation_p.V602I|KIF13A_ENST00000378843.2_Missense_Mutation_p.V602I|KIF13A_ENST00000378816.5_Missense_Mutation_p.V602I	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	602					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			AGGACCTGAACCACATTTTGA	0.532																																					p.V602I		.											.	KIF13A-137	0			c.G1804A						.						74.0	79.0	78.0					6																	17817447		2040	4210	6250	SO:0001583	missense	63971	exon17			CCTGAACCACATT	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1804G>A	6.37:g.17817447C>T	ENSP00000259711:p.Val602Ile	153	0		131	41	NM_001105567	0	0	0	1	1	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074673	0.76415	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58	5.92	5.92	0.95590	.	0.060329	0.64402	D	0.000003	T	0.43787	0.1263	L	0.27053	0.805	0.58432	D	0.99999	B;B;P;B;P	0.37731	0.112;0.094;0.48;0.112;0.607	B;B;B;B;B	0.34722	0.034;0.108;0.188;0.034;0.187	T	0.52064	-0.8625	10	0.08599	T	0.76	.	20.3248	0.98698	0.0:1.0:0.0:0.0	.	573;602;602;602;602	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	I	602	ENSP00000368091:V602I;ENSP00000259711:V602I;ENSP00000368103:V602I;ENSP00000368120:V602I;ENSP00000368093:V602I	ENSP00000259711:V602I	V	-	1	0	KIF13A	17925426	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.432000	0.80349	2.818000	0.97014	0.655000	0.94253	GTT	.		0.532	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
UHRF1BP1	54887	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	34825520	34825520	+	Silent	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:34825520C>T	ENST00000192788.5	+	13	1764	c.1593C>T	c.(1591-1593)taC>taT	p.Y531Y	UHRF1BP1_ENST00000452449.2_Silent_p.Y531Y	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	531							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						CTAATCTCTACATTCAGTTAA	0.398																																					p.Y531Y		.											.	UHRF1BP1-93	0			c.C1593T						.						158.0	148.0	151.0					6																	34825520		1859	4088	5947	SO:0001819	synonymous_variant	54887	exon13			TCTCTACATTCAG	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1593C>T	6.37:g.34825520C>T		174	0		144	9	NM_017754	0	0	0	0	0	Q9NXE0	Silent	SNP	ENST00000192788.5	37	CCDS43455.1																																																																																			.		0.398	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
PRIM2	5558	broad.mit.edu;bcgsc.ca	37	6	57467120	57467120	+	3'UTR	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:57467120G>T	ENST00000389488.2	+	0	1148				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CACAGCTTTGGAAAGGAAGGC	0.418																																					.													.	PRIM2-227	0			.						.						122.0	113.0	116.0					6																	57467120		1980	4180	6160	SO:0001624	3_prime_UTR_variant	5558	.			GCTTTGGAAAGGA		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1145G>T	6.37:g.57467120G>T		299	0		293	10	.	0	0	7	7	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000389488.2	37																																																																																				.		0.418	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947	
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	75861881	75861881	+	Silent	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:75861881T>C	ENST00000322507.8	-	19	4110	c.3801A>G	c.(3799-3801)gcA>gcG	p.A1267A	COL12A1_ENST00000416123.2_Silent_p.A1267A|COL12A1_ENST00000345356.6_Silent_p.A103A|COL12A1_ENST00000483888.2_Silent_p.A1267A	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1267	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACGGCAAGTTTGCCACAGCTT	0.473																																					p.A1267A		.											.	COL12A1-142	0			c.A3801G						.						102.0	99.0	100.0					6																	75861881		1976	4162	6138	SO:0001819	synonymous_variant	1303	exon19			CAAGTTTGCCACA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3801A>G	6.37:g.75861881T>C		211	0		199	74	NM_004370	0	0	1	2	1	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	T	4.645	0.119852	0.08881	.	.	ENSG00000111799	ENST00000419671	.	.	.	5.94	-10.2	0.00374	.	.	.	.	.	T	0.24851	0.0603	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48570	-0.9024	4	.	.	.	.	5.2576	0.15555	0.078:0.3395:0.3536:0.2289	.	.	.	.	E	9	.	.	K	-	1	0	COL12A1	75918601	0.080000	0.21391	0.440000	0.26846	0.478000	0.33099	-0.719000	0.04974	-1.241000	0.02526	-1.293000	0.01348	AAA	.		0.473	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
TMEM30A	55754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	75977367	75977367	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:75977367T>A	ENST00000230461.6	-	2	664	c.335A>T	c.(334-336)aAg>aTg	p.K112M	TMEM30A_ENST00000475111.2_Intron|TMEM30A_ENST00000370050.5_De_novo_Start_InFrame	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	112					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTCAAATGACTTTTCCAGTGT	0.363																																					p.K112M		.											.	TMEM30A-90	0			c.A335T						.						130.0	135.0	133.0					6																	75977367		2203	4300	6503	SO:0001583	missense	55754	exon2			AATGACTTTTCCA	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.335A>T	6.37:g.75977367T>A	ENSP00000230461:p.Lys112Met	41	0		44	18	NM_018247	0	0	0	0	0	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082970	0.76642	.	.	ENSG00000112697	ENST00000230461;ENST00000545449	.	.	.	5.28	5.28	0.74379	.	0.326351	0.37761	N	0.001944	T	0.77890	0.4198	M	0.84326	2.69	0.80722	D	1	B	0.27264	0.173	P	0.47251	0.542	T	0.80511	-0.1350	9	0.66056	D	0.02	.	14.8721	0.70465	0.0:0.0:0.0:1.0	.	112	Q9NV96	CC50A_HUMAN	M	112;96	.	ENSP00000230461:K112M	K	-	2	0	TMEM30A	76034087	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	7.596000	0.82721	1.997000	0.58415	0.454000	0.30748	AAG	.		0.363	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
MAP3K7	6885	bcgsc.ca	37	6	91226401	91226401	+	Splice_Site	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:91226401C>T	ENST00000369329.3	-	17	1802		c.e17-1		MAP3K7_ENST00000369320.1_Splice_Site|MAP3K7_ENST00000369332.3_Splice_Site|MAP3K7_ENST00000369325.3_Splice_Site|MAP3K7_ENST00000369327.3_Splice_Site|MAP3K7_ENST00000479630.1_Splice_Site	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TAGTTCTTGCCTACAAACAAA	0.348																																					.													.	MAP3K7-980	0			c.1641-1G>A						.						108.0	100.0	103.0					6																	91226401		2203	4300	6503	SO:0001630	splice_region_variant	6885	exon18			TCTTGCCTACAAA	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1641-1G>A	6.37:g.91226401C>T		73	0		66	20	NM_145331	0	0	0	0	0	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Splice_Site	SNP	ENST00000369329.3	37	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939262	0.73557	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000369320;ENST00000450832	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5538	0.95333	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAP3K7	91283122	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.688000	0.91661	0.655000	0.94253	.	.		0.348	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	Intron
HDAC2	3066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	114264645	114264645	+	Silent	SNP	A	A	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:114264645A>C	ENST00000519065.1	-	12	1624	c.1248T>G	c.(1246-1248)gcT>gcG	p.A416A	HDAC2_ENST00000519108.1_Silent_p.A386A|HDAC2_ENST00000398283.2_Silent_p.A510A|HDAC2_ENST00000368632.2_Silent_p.A386A			Q92769	HDAC2_HUMAN	histone deacetylase 2	416					ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	CTTCATCACAAGCTATCCGCT	0.363																																					p.A416A		.											.	HDAC2-660	0			c.T1248G						.						126.0	110.0	115.0					6																	114264645		1841	4082	5923	SO:0001819	synonymous_variant	3066	exon12			ATCACAAGCTATC	U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.1248T>G	6.37:g.114264645A>C		16	0		15	8	NM_001527	0	0	54	89	35	B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	Silent	SNP	ENST00000519065.1	37	CCDS43493.2																																																																																			.		0.363	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041909.2		
ELMO1	9844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	37053037	37053037	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr7:37053037C>T	ENST00000310758.4	-	16	1951	c.1304G>A	c.(1303-1305)aGt>aAt	p.S435N	ELMO1_ENST00000341056.3_Missense_Mutation_p.S137N|ELMO1_ENST00000448602.1_Missense_Mutation_p.S435N|ELMO1_ENST00000442504.1_Missense_Mutation_p.S435N|ELMO1-AS1_ENST00000419535.1_RNA	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	435	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GCAGGTCTCACTAGCTGGAGG	0.458																																					p.S435N		.											.	ELMO1-96	0			c.G1304A						.						79.0	75.0	76.0					7																	37053037		2203	4300	6503	SO:0001583	missense	9844	exon16			GTCTCACTAGCTG	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1304G>A	7.37:g.37053037C>T	ENSP00000312185:p.Ser435Asn	122	0		88	31	NM_014800	0	0	0	0	0	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774299	0.49786	.	.	ENSG00000155849	ENST00000341056;ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	6.06	6.06	0.98353	Engulfment/cell motility, ELMO (2);	0.147484	0.64402	D	0.000020	T	0.21841	0.0526	N	0.12527	0.23	0.48571	D	0.999678	B	0.06786	0.001	B	0.12156	0.007	T	0.07366	-1.0776	10	0.22109	T	0.4	.	20.2348	0.98355	0.0:1.0:0.0:0.0	.	435	Q92556	ELMO1_HUMAN	N	137;435;339;435;435	ENSP00000342142:S137N;ENSP00000312185:S435N;ENSP00000406952:S435N;ENSP00000394458:S435N	ENSP00000312185:S435N	S	-	2	0	ELMO1	37019562	1.000000	0.71417	0.988000	0.46212	0.765000	0.43378	4.885000	0.63142	2.879000	0.98667	0.650000	0.86243	AGT	.		0.458	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	104717538	104717538	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr7:104717538G>C	ENST00000311117.3	+	10	1442	c.897G>C	c.(895-897)gaG>gaC	p.E299D	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000476671.1_Missense_Mutation_p.E299D|KMT2E_ENST00000334877.4_Missense_Mutation_p.E299D|KMT2E_ENST00000257745.4_Missense_Mutation_p.E299D	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	299					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTCAGAGGGAGGCACAAAGAA	0.393																																					p.E299D		.											.	MLL5-93	0			c.G897C						.						125.0	115.0	118.0					7																	104717538		2203	4300	6503	SO:0001583	missense	55904	exon9			GAGGGAGGCACAA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.897G>C	7.37:g.104717538G>C	ENSP00000312379:p.Glu299Asp	180	0		166	19	NM_018682	0	0	4	6	2	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576129	0.65878	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	D;D;D;D;D	0.95756	-2.92;-2.54;-2.92;-3.8;-3.28	6.07	4.28	0.50868	.	0.000000	0.64402	D	0.000001	D	0.94185	0.8134	L	0.44542	1.39	0.80722	D	1	D;P	0.67145	0.996;0.943	P;P	0.54499	0.754;0.576	D	0.91766	0.5424	10	0.14656	T	0.56	.	12.3705	0.55252	0.1346:0.0:0.8654:0.0	.	299;299	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	D	299;299;299;299;299;157;299;233	ENSP00000312379:E299D;ENSP00000335599:E299D;ENSP00000257745:E299D;ENSP00000419883:E157D;ENSP00000417888:E299D	ENSP00000257745:E299D	E	+	3	2	MLL5	104504774	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.197000	0.72100	1.587000	0.49959	-0.136000	0.14681	GAG	.		0.393	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116423474	116423474	+	Missense_Mutation	SNP	T	T	C	rs121913245		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr7:116423474T>C	ENST00000318493.6	+	19	3990	c.3803T>C	c.(3802-3804)aTg>aCg	p.M1268T	MET_ENST00000539704.1_Missense_Mutation_p.M120T|MET_ENST00000397752.3_Missense_Mutation_p.M1250T			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M1268T(4)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTGAAGTGGATGGCTTTGGAA	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.M1268T		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	4	Substitution - Missense(4)	kidney(4)	c.T3803C	GRCh37	CM992181	MET	M	rs121913245	.						93.0	92.0	92.0					7																	116423474		1872	4102	5974	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AGTGGATGGCTTT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3803T>C	7.37:g.116423474T>C	ENSP00000317272:p.Met1268Thr	98	0		83	27	NM_001127500	0	0	82	163	81	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740165	0.69304	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.37752	1.18;1.18;1.18	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;1.0	T	0.65734	-0.6096	10	0.87932	D	0	.	16.2225	0.82267	0.0:0.0:0.0:1.0	.	1268;1250	P08581-2;P08581	.;MET_HUMAN	T	1250;1268;120	ENSP00000380860:M1250T;ENSP00000317272:M1268T;ENSP00000445020:M120T	ENSP00000317272:M1268T	M	+	2	0	MET	116210710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.289000	0.77006	0.460000	0.39030	ATG	.		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
GPR37	2861	hgsc.bcm.edu	37	7	124405027	124405027	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr7:124405027G>A	ENST00000303921.2	-	1	654	c.4C>T	c.(4-6)Cga>Tga	p.R2*		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	2					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCCGGGGCTCGCATGGCTTGG	0.637																																					p.R2X		.											.	GPR37-523	0			c.C4T						.						7.0	6.0	7.0					7																	124405027		2164	4249	6413	SO:0001587	stop_gained	2861	exon1			GGGCTCGCATGGC		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.4C>T	7.37:g.124405027G>A	ENSP00000306449:p.Arg2*	4	0		6	4	NM_005302	0	0	0	0	0	A4D0Y6|O00348|O14768|Q8TD39	Nonsense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	40	8.449312	0.98815	.	.	ENSG00000170775	ENST00000303921	.	.	.	5.31	3.45	0.39498	.	0.960325	0.08673	N	0.910555	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-4.8252	6.6615	0.23016	0.0898:0.0:0.7349:0.1753	.	.	.	.	X	2	.	ENSP00000306449:R2X	R	-	1	2	GPR37	124192263	0.983000	0.35010	0.703000	0.30354	0.397000	0.30659	1.951000	0.40333	0.767000	0.33267	0.655000	0.94253	CGA	.		0.637	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
NRG1	3084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	32616873	32616873	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:32616873A>T	ENST00000405005.3	+	10	980	c.980A>T	c.(979-981)gAa>gTa	p.E327V	NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000521670.1_Missense_Mutation_p.E327V|NRG1_ENST00000356819.4_Missense_Mutation_p.E332V|NRG1_ENST00000519301.1_Missense_Mutation_p.E277V|NRG1_ENST00000539990.1_Missense_Mutation_p.E170V|NRG1_ENST00000523079.1_Missense_Mutation_p.E324V|NRG1_ENST00000287845.5_Missense_Mutation_p.E298V|NRG1_ENST00000338921.4_Missense_Mutation_p.E335V|NRG1_ENST00000287842.3_Missense_Mutation_p.E324V			Q02297	NRG1_HUMAN	neuregulin 1	327					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GTTGAGAGAGAAGCAGAGACA	0.408																																					p.E332V		.											.	NRG1-525	0			c.A995T						.						201.0	169.0	180.0					8																	32616873		2203	4300	6503	SO:0001583	missense	3084	exon11			AGAGAGAAGCAGA	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.980A>T	8.37:g.32616873A>T	ENSP00000384620:p.Glu327Val	157	0		145	41	NM_013956	0	0	2	2	0	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.300044	0.81136	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000539990	T;T;T;T;T;T;T;T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03;0.03;0.03;0.03;0.03;0.03;0.03;0.03	6.16	6.16	0.99307	Neuregulin 1-related, C-terminal (1);	0.100274	0.64402	D	0.000002	T	0.70824	0.3268	L	0.41573	1.285	0.53688	D	0.999971	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.996;1.0;1.0;1.0;1.0;1.0;0.983;0.999;0.999;1.0;1.0	D;D;D;D;D;D;P;D;D;D;D	0.97110	0.997;0.999;1.0;0.984;0.991;1.0;0.592;0.984;0.985;0.984;0.999	T	0.64694	-0.6347	10	0.14252	T	0.57	-8.3311	16.8061	0.85666	1.0:0.0:0.0:0.0	.	170;173;324;298;332;323;335;324;327;332;327	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;Q02297-2;Q02297-7;Q02297;Q02297-6;Q02297-3	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.	V	294;277;400;324;335;332;327;298;324;327;327;170	ENSP00000430053:E294V;ENSP00000429582:E277V;ENSP00000429067:E400V;ENSP00000430120:E324V;ENSP00000343395:E335V;ENSP00000349275:E332V;ENSP00000287840:E327V;ENSP00000287845:E298V;ENSP00000287842:E324V;ENSP00000384620:E327V;ENSP00000428828:E327V;ENSP00000439276:E170V	ENSP00000287840:E327V	E	+	2	0	NRG1	32736415	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.312000	0.65792	2.367000	0.80283	0.528000	0.53228	GAA	.		0.408	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
NKX6-3	157848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	41504065	41504065	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:41504065G>T	ENST00000524115.2	-	2	314	c.311C>A	c.(310-312)cCg>cAg	p.P104Q		NM_152568.2	NP_689781.1	A6NJ46	NKX63_HUMAN	NK6 homeobox 3	234					cell fate determination (GO:0001709)|glandular epithelial cell differentiation (GO:0002067)|negative regulation of epithelial cell differentiation (GO:0030857)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(1)	1	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GGGGTCCAGCGGCTTGTTGTA	0.731																																					p.P104Q		.											.	NKX6-3-90	0			c.C311A						.						43.0	38.0	39.0					8																	41504065		2201	4300	6501	SO:0001583	missense	157848	exon2			TCCAGCGGCTTGT	AK057898	CCDS6118.1	8p11.21	2014-08-12	2007-07-09		ENSG00000165066	ENSG00000165066		"""Homeoboxes / ANTP class : NKL subclass"""	26328	protein-coding gene	gene with protein product		610772	"""NK6 transcription factor related, locus 3 (Drosophila)"""			16326147	Standard	XM_005273422		Approved	FLJ25169	uc003xoa.2	A6NJ46	OTTHUMG00000164083	ENST00000524115.2:c.311C>A	8.37:g.41504065G>T	ENSP00000429553:p.Pro104Gln	32	0		24	15	NM_152568	0	0	0	1	1	Q96LR0	Missense_Mutation	SNP	ENST00000524115.2	37	CCDS6118.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124514	0.94429	.	.	ENSG00000165066	ENST00000524115;ENST00000425142;ENST00000518699	T;T	0.57907	0.37;0.37	4.9	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.70718	0.3256	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.73170	-0.4067	9	0.56958	D	0.05	.	12.1998	0.54319	0.0832:0.0:0.9168:0.0	.	104	A6NJ46-2	.	Q	104;234;234	ENSP00000429553:P104Q;ENSP00000428361:P234Q	ENSP00000414183:P234Q	P	-	2	0	NKX6-3	41623222	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.856000	0.86956	1.066000	0.40716	0.491000	0.48974	CCG	.		0.731	NKX6-3-002	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000377166.2	NM_152568	
NCOA2	10499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	71053580	71053580	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:71053580G>A	ENST00000452400.2	-	14	3048	c.2867C>T	c.(2866-2868)cCg>cTg	p.P956L	NCOA2_ENST00000267974.4_Missense_Mutation_p.P44L	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	956					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CGAACTCTGCGGTGCCCATTC	0.532			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P956L		.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2-639	0			c.C2867T						.						57.0	60.0	59.0					8																	71053580		2052	4211	6263	SO:0001583	missense	10499	exon14			CTCTGCGGTGCCC	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.2867C>T	8.37:g.71053580G>A	ENSP00000399968:p.Pro956Leu	155	0		152	28	NM_006540	0	0	2	3	1	Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	37	CCDS47872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.585|1.585	-0.530666|-0.530666	0.04112|0.04112	.|.	.|.	ENSG00000140396|ENSG00000140396	ENST00000452400;ENST00000267974|ENST00000518363	T;T|.	0.06849|.	4.9;3.25|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.483437|.	0.22937|.	N|.	0.053835|.	T|T	0.28532|0.28532	0.0706|0.0706	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.35192|.	0.489;0.059|.	B;B|.	0.24974|.	0.057;0.01|.	T|T	0.19289|0.19289	-1.0310|-1.0310	10|5	0.02654|.	T|.	1|.	.|.	16.5528|16.5528	0.84476|0.84476	0.0:0.1389:0.8611:0.0|0.0:0.1389:0.8611:0.0	.|.	44;956|.	F8WAJ2;Q15596|.	.;NCOA2_HUMAN|.	L|C	956;44|57	ENSP00000399968:P956L;ENSP00000267974:P44L|.	ENSP00000267974:P44L|.	P|R	-|-	2|1	0|0	NCOA2|NCOA2	71216134|71216134	0.778000|0.778000	0.28640|0.28640	0.149000|0.149000	0.22428|0.22428	0.831000|0.831000	0.47069|0.47069	4.231000|4.231000	0.58639|0.58639	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	CCG|CGC	.		0.532	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113316994	113316994	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:113316994G>A	ENST00000297405.5	-	52	8466	c.8222C>T	c.(8221-8223)cCt>cTt	p.P2741L	CSMD3_ENST00000343508.3_Missense_Mutation_p.P2701L|CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000352409.3_Missense_Mutation_p.P2671L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2741	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGTACCATTAGGAAGACATTC	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P2741L		.											.	CSMD3-1132	0			c.C8222T						.						133.0	118.0	123.0					8																	113316994		2203	4300	6503	SO:0001583	missense	114788	exon52			CCATTAGGAAGAC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8222C>T	8.37:g.113316994G>A	ENSP00000297405:p.Pro2741Leu	151	0		136	53	NM_198123	0	0	0	0	0	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.891954	0.52014	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	4.9	4.9	0.64082	Complement control module (2);Sushi/SCR/CCP (3);	0.178361	0.34200	N	0.004165	T	0.48259	0.1490	N	0.13272	0.32	0.54753	D	0.99998	B;B	0.30211	0.273;0.006	B;B	0.30105	0.111;0.026	T	0.47849	-0.9085	10	0.38643	T	0.18	.	18.4479	0.90691	0.0:0.0:1.0:0.0	.	2741;2701	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	L	2701;2741;2011;2671	ENSP00000345799:P2701L;ENSP00000297405:P2741L;ENSP00000341558:P2011L;ENSP00000343124:P2671L	ENSP00000297405:P2741L	P	-	2	0	CSMD3	113386170	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	9.775000	0.98995	2.385000	0.81259	0.561000	0.74099	CCT	.		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
PHF20L1	51105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133806739	133806739	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:133806739A>G	ENST00000395386.2	+	3	466	c.167A>G	c.(166-168)gAg>gGg	p.E56G	PHF20L1_ENST00000395376.1_Missense_Mutation_p.E56G|PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000337920.4_Missense_Mutation_p.E56G|PHF20L1_ENST00000395390.2_Missense_Mutation_p.E56G|PHF20L1_ENST00000395379.1_Missense_Mutation_p.E56G	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	56	Tudor 1.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CGTTATGATGAGTGGATTTAC	0.408																																					p.E56G		.											.	PHF20L1-92	0			c.A167G						.						134.0	122.0	126.0					8																	133806739		2203	4300	6503	SO:0001583	missense	51105	exon3			ATGATGAGTGGAT	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.167A>G	8.37:g.133806739A>G	ENSP00000378784:p.Glu56Gly	130	0		140	48	NM_016018	0	0	0	0	0	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	A	31	5.078557	0.94050	.	.	ENSG00000129292	ENST00000395383;ENST00000395379;ENST00000361997;ENST00000395386;ENST00000315808;ENST00000337920;ENST00000395376;ENST00000522580;ENST00000395390	T;T;T;T;T;T;T;T	0.56275	0.53;0.48;0.51;1.1;0.47;0.49;0.55;1.13	5.91	5.91	0.95273	Tudor-like, plant (1);Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.90759	3.145	0.80722	D	1	D;P;D;D;P	0.89917	1.0;0.735;1.0;1.0;0.714	D;P;D;D;P	0.91635	0.997;0.734;0.999;0.994;0.669	T	0.82833	-0.0262	10	0.87932	D	0	7.5356	15.5298	0.75948	1.0:0.0:0.0:0.0	.	56;56;56;56;56	F8W9L8;A8MW92;A8MW92-4;A8MW92-2;A8MUE8	.;P20L1_HUMAN;.;.;.	G	56;56;56;56;56;56;56;14;56	ENSP00000378781:E56G;ENSP00000378777:E56G;ENSP00000355301:E56G;ENSP00000378784:E56G;ENSP00000324519:E56G;ENSP00000338269:E56G;ENSP00000378775:E56G;ENSP00000378788:E56G	ENSP00000324519:E56G	E	+	2	0	PHF20L1	133875921	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.317000	0.96327	2.259000	0.74868	0.528000	0.53228	GAG	.		0.408	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
ZNF16	7564	bcgsc.ca	37	8	146156384	146156384	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr8:146156384C>T	ENST00000276816.4	-	4	1975	c.1789G>A	c.(1789-1791)Ggg>Agg	p.G597R	ZNF16_ENST00000394909.2_Missense_Mutation_p.G597R	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	597					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GGTTTTTCCCCAGTATGAACT	0.488																																					p.G597R													.	ZNF16-95	0			c.G1789A						.						102.0	93.0	96.0					8																	146156384		2203	4300	6503	SO:0001583	missense	7564	exon3			TTTCCCCAGTATG	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1789G>A	8.37:g.146156384C>T	ENSP00000276816:p.Gly597Arg	80	1		50	4	NM_006958	0	0	4	4	0	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318705	0.60524	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.26223	1.75;1.75	4.0	4.0	0.46444	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46658	0.1404	L	0.55103	1.725	0.31838	N	0.623894	D	0.89917	1.0	D	0.97110	1.0	T	0.55270	-0.8167	9	0.72032	D	0.01	.	15.0179	0.71600	0.0:1.0:0.0:0.0	.	597	P17020	ZNF16_HUMAN	R	597	ENSP00000276816:G597R;ENSP00000378369:G597R	ENSP00000276816:G597R	G	-	1	0	ZNF16	146127188	0.869000	0.29996	1.000000	0.80357	0.924000	0.55760	3.212000	0.51145	2.058000	0.61347	0.462000	0.41574	GGG	.		0.488	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
AQP3	360	bcgsc.ca	37	9	33447471	33447471	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:33447471G>A	ENST00000297991.4	-	1	138	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	20					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		CGGAGCAGCCGGTAGCGGATG	0.716																																					p.R20W													.	AQP3-90	0			c.C58T						.						18.0	21.0	20.0					9																	33447471		2187	4290	6477	SO:0001583	missense	360	exon1			GCAGCCGGTAGCG		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.58C>T	9.37:g.33447471G>A	ENSP00000297991:p.Arg20Trp	176	1		120	5	NM_004925	0	0	12	12	0	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Missense_Mutation	SNP	ENST00000297991.4	37	CCDS6542.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.136024	0.77662	.	.	ENSG00000165272	ENST00000297991;ENST00000343952	D	0.85629	-2.01	5.74	4.79	0.61399	Aquaporin-like (2);	0.457287	0.23211	N	0.050673	D	0.87904	0.6295	L	0.42245	1.32	0.32753	N	0.506114	D;D;D	0.76494	0.999;0.99;0.999	D;P;P	0.69479	0.964;0.536;0.865	D	0.88979	0.3406	10	0.59425	D	0.04	-2.3009	11.196	0.48713	0.0:0.0:0.743:0.257	.	20;20;20	C9JAH5;Q92482;B4E034	.;AQP3_HUMAN;.	W	20	ENSP00000297991:R20W	ENSP00000297991:R20W	R	-	1	2	AQP3	33437471	0.999000	0.42202	1.000000	0.80357	0.566000	0.35808	0.585000	0.23879	2.712000	0.92718	0.561000	0.74099	CGG	.		0.716	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
SLC28A3	64078	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86900438	86900438	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:86900438A>T	ENST00000376238.4	-	14	1518	c.1469T>A	c.(1468-1470)tTc>tAc	p.F490Y	SLC28A3_ENST00000537648.1_Missense_Mutation_p.F421Y|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	490					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	AAAGGGCATGAAGATGTAGGA	0.413																																					p.F490Y	Ovarian(106;425 1539 34835 42413 43572)												.	SLC28A3-94	0			c.T1469A						.						87.0	84.0	85.0					9																	86900438		2203	4300	6503	SO:0001583	missense	64078	exon14			GGCATGAAGATGT	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1469T>A	9.37:g.86900438A>T	ENSP00000365413:p.Phe490Tyr	164	1		171	62	NM_001199633	0	0	0	0	0	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.918255	0.92249	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.09911	2.93;2.93	5.74	5.74	0.90152	Na dependent nucleoside transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46210	0.1381	H	0.94771	3.58	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.61232	-0.7104	10	0.87932	D	0	-28.3331	16.3305	0.83010	1.0:0.0:0.0:0.0	.	490	Q9HAS3	S28A3_HUMAN	Y	490;421	ENSP00000365413:F490Y;ENSP00000446438:F421Y	ENSP00000365413:F490Y	F	-	2	0	SLC28A3	86090258	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.273000	0.95719	2.317000	0.78254	0.459000	0.35465	TTC	.		0.413	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	
PALM2	114299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	112705604	112705604	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:112705604A>G	ENST00000374531.2	+	7	1113	c.1039A>G	c.(1039-1041)Aca>Gca	p.T347A	PALM2-AKAP2_ENST00000302798.7_Intron|PALM2_ENST00000483909.1_Missense_Mutation_p.T345A|PALM2-AKAP2_ENST00000374530.3_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.T381A|AKAP2_ENST00000555236.1_Intron|PALM2_ENST00000314527.4_Missense_Mutation_p.T379A|AKAP2_ENST00000510514.5_Intron	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	347					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						CTCAGACACCACAGAGCCCTC	0.552																																					p.T379A		.											.	PALM2-71	0			c.A1135G						.						113.0	110.0	111.0					9																	112705604		2203	4300	6503	SO:0001583	missense	114299	exon7			GACACCACAGAGC	AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.1039A>G	9.37:g.112705604A>G	ENSP00000363656:p.Thr347Ala	118	0		128	19	NM_053016	0	0	0	0	0	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.711967	0.48517	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.22945	2.36;2.36;2.36;2.36;1.93	5.86	5.86	0.93980	.	.	.	.	.	T	0.33498	0.0865	L	0.59436	1.845	0.80722	D	1	P;P	0.48503	0.788;0.911	P;P	0.51516	0.548;0.672	T	0.13710	-1.0499	9	0.05351	T	0.99	.	15.4456	0.75228	1.0:0.0:0.0:0.0	.	347;381	Q8IXS6;D3YTA4	PALM2_HUMAN;.	A	347;381;345;379;379	ENSP00000363656:T347A;ENSP00000400206:T381A;ENSP00000417525:T345A;ENSP00000323805:T379A;ENSP00000397839:T379A	ENSP00000397839:T379A	T	+	1	0	PALM2-AKAP2;PALM2	111745425	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.339000	0.96797	2.244000	0.73946	0.528000	0.53228	ACA	.		0.552	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293	
FAM102A	399665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130707096	130707096	+	Silent	SNP	G	G	A			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:130707096G>A	ENST00000373095.1	-	9	1374	c.999C>T	c.(997-999)atC>atT	p.I333I	FAM102A_ENST00000373084.4_Silent_p.I191I|FAM102A_ENST00000300434.3_5'UTR	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	333										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						GGCTCTGCACGATCTTCTCCA	0.672																																					p.I333I		.											.	FAM102A-91	0			c.C999T						.						89.0	64.0	72.0					9																	130707096		2203	4300	6503	SO:0001819	synonymous_variant	399665	exon9			CTGCACGATCTTC		CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.999C>T	9.37:g.130707096G>A		60	0		39	23	NM_001035254	0	0	1	6	5	A2A329|Q8TEL4	Silent	SNP	ENST00000373095.1	37	CCDS35150.1																																																																																			.		0.672	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
NUP188	23511	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131749966	131749966	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:131749966T>C	ENST00000372577.2	+	23	2384	c.2363T>C	c.(2362-2364)aTt>aCt	p.I788T		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	788					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GTGGACACCATTGACATGGTG	0.493																																					p.I788T													.	NUP188-207	0			c.T2363C						.						170.0	146.0	154.0					9																	131749966		2203	4300	6503	SO:0001583	missense	23511	exon23			ACACCATTGACAT	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2363T>C	9.37:g.131749966T>C	ENSP00000361658:p.Ile788Thr	182	2		147	48	NM_015354	0	0	1	4	3	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407163	0.83230	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.32753	1.44	5.65	5.65	0.86999	.	0.045126	0.85682	D	0.000000	T	0.35219	0.0924	L	0.29908	0.895	0.58432	D	0.999999	P;P	0.51537	0.822;0.946	P;P	0.51550	0.493;0.673	T	0.13150	-1.0520	10	0.87932	D	0	-16.8028	15.3584	0.74448	0.0:0.0:0.0:1.0	.	121;788	E9PET9;Q5SRE5	.;NU188_HUMAN	T	677;788	ENSP00000361658:I788T	ENSP00000349125:I677T	I	+	2	0	NUP188	130789787	1.000000	0.71417	0.959000	0.39883	0.993000	0.82548	7.459000	0.80802	2.279000	0.76181	0.533000	0.62120	ATT	.		0.493	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53440302	53440302	+	Silent	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chrX:53440302C>G	ENST00000322213.4	-	4	622	c.495G>C	c.(493-495)gcG>gcC	p.A165A	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	165					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.A165A(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CATACTCCTGCGCCAGCTCCC	0.463																																					p.A165A		.											.	SMC1A-232	1	Substitution - coding silent(1)	lung(1)	c.G495C						.						138.0	124.0	129.0					X																	53440302		2203	4300	6503	SO:0001819	synonymous_variant	8243	exon4			CTCCTGCGCCAGC	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.495G>C	X.37:g.53440302C>G		102	0		50	40	NM_006306	0	0	0	5	5	O14995|Q16351|Q2M228	Silent	SNP	ENST00000322213.4	37	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	C	5.699	0.313435	0.10789	.	.	ENSG00000072501	ENST00000428014	.	.	.	4.63	0.543	0.17179	.	.	.	.	.	T	0.41971	0.1182	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20773	-1.0265	4	.	.	.	.	1.4228	0.02316	0.1701:0.1318:0.2791:0.419	.	.	.	.	P	170	.	.	R	-	2	0	SMC1A	53457027	0.002000	0.14202	0.996000	0.52242	0.942000	0.58702	-1.093000	0.03362	-0.226000	0.09899	-1.768000	0.00664	CGC	.		0.463	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
LONRF3	79836	broad.mit.edu;bcgsc.ca	37	X	118151559	118151559	+	Missense_Mutation	SNP	G	G	A	rs143959775		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chrX:118151559G>A	ENST00000371628.3	+	11	2217	c.2186G>A	c.(2185-2187)cGa>cAa	p.R729Q	LONRF3_ENST00000304778.7_Missense_Mutation_p.R688Q|LONRF3_ENST00000422289.2_Missense_Mutation_p.R473Q|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	729	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						TTGGAAAGCCGAGCTCAGCTC	0.502																																					p.R729Q													.	LONRF3-289	0			c.G2186A						.	G	GLN/ARG,GLN/ARG	1,3834		0,1,1631,571	144.0	119.0	127.0		2186,2063	4.7	1.0	X	dbSNP_134	127	0,6728		0,0,2428,1872	no	missense,missense	LONRF3	NM_001031855.1,NM_024778.4	43,43	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging	729/760,688/719	118151559	1,10562	2203	4300	6503	SO:0001583	missense	79836	exon11			AAAGCCGAGCTCA	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.2186G>A	X.37:g.118151559G>A	ENSP00000360690:p.Arg729Gln	77	1		53	4	NM_001031855	0	0	2	2	0	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661769	0.88154	2.61E-4	0.0	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.56	4.69	0.59074	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.64402	D	0.000001	T	0.46444	0.1393	N	0.20766	0.605	0.35057	D	0.761236	D;P;D	0.89917	1.0;0.879;1.0	D;B;D	0.77004	0.971;0.358;0.989	T	0.53279	-0.8461	10	0.28530	T	0.3	-65.9818	13.0438	0.58915	0.0806:0.0:0.9194:0.0	.	473;688;729	B3KUN7;Q496Y0-2;Q496Y0	.;.;LONF3_HUMAN	Q	688;688;729;473	ENSP00000360691:R688Q;ENSP00000307732:R688Q;ENSP00000360690:R729Q;ENSP00000408894:R473Q	ENSP00000307732:R688Q	R	+	2	0	LONRF3	118035587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.352000	0.66028	2.360000	0.80028	0.592000	0.82586	CGA	G|1.000;A|0.000		0.502	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
UPF3B	65109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	118985467	118985467	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chrX:118985467C>G	ENST00000276201.2	-	3	430	c.361G>C	c.(361-363)Gac>Cac	p.D121H	UPF3B_ENST00000345865.2_Missense_Mutation_p.D121H	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	121	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						CCTTTATTGTCAAGGAATACA	0.363																																					p.D121H		.											.	UPF3B-133	0			c.G361C						.						104.0	86.0	92.0					X																	118985467		2203	4300	6503	SO:0001583	missense	65109	exon3			TATTGTCAAGGAA	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.361G>C	X.37:g.118985467C>G	ENSP00000276201:p.Asp121His	214	1		159	121	NM_023010	0	0	0	0	0	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031576	0.75504	.	.	ENSG00000125351	ENST00000276201;ENST00000345865;ENST00000439808	T;T	0.74526	-0.85;-0.85	5.1	5.1	0.69264	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.90246	0.6950	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93290	0.6667	10	0.87932	D	0	.	16.142	0.81534	0.0:1.0:0.0:0.0	.	121;121	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	H	121	ENSP00000276201:D121H;ENSP00000245418:D121H	ENSP00000276201:D121H	D	-	1	0	UPF3B	118869495	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.226000	0.78060	2.111000	0.64477	0.600000	0.82982	GAC	.		0.363	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		
ABCA4	24	hgsc.bcm.edu;bcgsc.ca	37	1	94522320	94522320	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:94522320delA	ENST00000370225.3	-	15	2305	c.2219delT	c.(2218-2220)ttcfs	p.F740fs	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	740					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGCAGTGGAGAAAGCCAACAA	0.517																																					p.F740fs		.											.	ABCA4-162	0			c.2219delT						.						111.0	98.0	102.0					1																	94522320		2203	4300	6503	SO:0001589	frameshift_variant	24	exon15			.	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2219delT	1.37:g.94522320delA	ENSP00000359245:p.Phe740fs	322	0		231	60	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Frame_Shift_Del	DEL	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.517	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	179959644	179959645	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:179959644_179959645delGA	ENST00000367607.3	+	4	541_542	c.123_124delGA	c.(121-126)ctgagafs	p.R42fs		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	42					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AACTTTAGCTGAGACACATTGA	0.337																																					p.41_42del		.											.	CEP350-26	0			c.123_124del						.																																			SO:0001589	frameshift_variant	9857	exon4			.	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.123_124delGA	1.37:g.179959646_179959647delGA	ENSP00000356579:p.Arg42fs	67	0		66	14	NM_014810	0	0	0	0	0	O75068|Q8TDK3|Q8WY20	Frame_Shift_Del	DEL	ENST00000367607.3	37	CCDS1336.1																																																																																			.		0.337	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
AKR1C2	1646	broad.mit.edu	37	10	5038014	5038014	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr10:5038014delA	ENST00000380753.4	-	6	801	c.614delT	c.(613-615)ttcfs	p.F205fs	RP11-499O7.7_ENST00000451575.2_RNA|AKR1C2_ENST00000421196.3_Frame_Shift_Del_p.F179fs|AKR1C2_ENST00000407674.1_Frame_Shift_Del_p.F205fs|RP11-499O7.7_ENST00000440414.1_RNA	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	205					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	TGACTTGCAGAAATCCAGCAG	0.393																																					p.F205fs													.	AKR1C2-514	0			c.614delT						.						62.0	57.0	59.0					10																	5038014		2203	4296	6499	SO:0001589	frameshift_variant	1646	exon8			TTGCAGAAATCCA	L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.614delT	10.37:g.5038014delA	ENSP00000370129:p.Phe205fs	719	0		650	51	NM_001354	0	0	0	0	0	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Frame_Shift_Del	DEL	ENST00000380753.4	37	CCDS7062.1																																																																																			.		0.393	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354	
SORBS1	10580	broad.mit.edu;bcgsc.ca	37	10	97170380	97170388	+	Splice_Site	DEL	CCTCTCTTA	CCTCTCTTA	-	rs376551293		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	CCTCTCTTA	CCTCTCTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr10:97170380_97170388delCCTCTCTTA	ENST00000361941.3	-	8	982		c.e8+1		SORBS1_ENST00000371249.2_Splice_Site|SORBS1_ENST00000393949.1_Splice_Site|SORBS1_ENST00000371246.2_Splice_Site|SORBS1_ENST00000277982.5_Splice_Site|SORBS1_ENST00000371247.2_Splice_Site|SORBS1_ENST00000474353.2_Splice_Site|SORBS1_ENST00000347291.4_Splice_Site|SORBS1_ENST00000371245.3_Splice_Site|SORBS1_ENST00000353505.5_Splice_Site|SORBS1_ENST00000371227.4_Splice_Site|SORBS1_ENST00000306402.6_Splice_Site|SORBS1_ENST00000371241.1_Splice_Site|SORBS1_ENST00000607232.1_Splice_Site|SORBS1_ENST00000354106.3_Splice_Site|SORBS1_ENST00000371239.1_Splice_Site	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GGGGCACAAGCCTCTCTTACCTCGATTGT	0.45																																					.													.	SORBS1-155	0			.						.																																			SO:0001630	splice_region_variant	10580	.			CACAAGCCTCTCT	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.955+1TAAGAGAGG>-	10.37:g.97170380_97170388delCCTCTCTTA		133	0		110	29	.	0	0	0	0	0		Splice_Site	DEL	ENST00000361941.3	37	CCDS31255.1																																																																																			.		0.450	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		Intron
VPS51	738	broad.mit.edu	37	11	64875862	64875862	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:64875862delG	ENST00000279281.3	+	5	1011	c.919delG	c.(919-921)ggafs	p.G308fs	AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	308					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CACCGACCATGGAGGCAGTGG	0.706																																					p.G307fs													.	.	0			c.919delG						.						21.0	25.0	24.0					11																	64875862		2197	4295	6492	SO:0001589	frameshift_variant	738	exon5			GACCATGGAGGCA	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.919delG	11.37:g.64875862delG	ENSP00000279281:p.Gly308fs	31	0		20	7	NM_013265	0	0	0	0	0	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Frame_Shift_Del	DEL	ENST00000279281.3	37	CCDS8093.1																																																																																			.		0.706	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	
YARS2	51067	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	32908454	32908454	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr12:32908454delG	ENST00000324868.8	-	1	382	c.355delC	c.(355-357)ctgfs	p.L119fs		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	119					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	GGGTCTCCCAGGCGCGCCGTG	0.682											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L119fs		.											.	YARS2-90	0			c.355delC						.						14.0	16.0	16.0					12																	32908454		2196	4290	6486	SO:0001589	frameshift_variant	51067	exon1			.	AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.355delC	12.37:g.32908454delG	ENSP00000320658:p.Leu119fs	29	0	836	47	18	NM_001040436	0	0	0	0	0	D3DUW8|Q9H817	Frame_Shift_Del	DEL	ENST00000324868.8	37	CCDS31770.1																																																																																			.		0.682	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404153.1	NM_015936	
CDH24	64403	broad.mit.edu;bcgsc.ca	37	14	23517629	23517629	+	Frame_Shift_Del	DEL	C	C	-	rs138543733	byFrequency	TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr14:23517629delC	ENST00000267383.5	-	12	2112	c.2020delG	c.(2020-2022)gagfs	p.E676fs	CDH24_ENST00000485922.1_5'UTR|CDH24_ENST00000397359.3_Frame_Shift_Del_p.E676fs|CDH24_ENST00000554034.1_Frame_Shift_Del_p.E638fs|CDH24_ENST00000487137.2_Frame_Shift_Del_p.E638fs			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	676					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		TCCTCCTCCTCCAGTACCATC	0.662																																					p.E674fs													.	CDH24-90	0			c.2020delG						.						74.0	78.0	76.0					14																	23517629		2202	4300	6502	SO:0001589	frameshift_variant	64403	exon13			CCTCCTCCAGTAC	AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.2020delG	14.37:g.23517629delC	ENSP00000267383:p.Glu676fs	74	0		25	9	NM_022478	0	0	0	0	0	D3DS44|Q86UP1|Q9NT84	Frame_Shift_Del	DEL	ENST00000267383.5	37	CCDS9585.1																																																																																			.		0.662	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478	
PPIP5K1	9677	hgsc.bcm.edu	37	15	43863609	43863609	+	Splice_Site	DEL	C	C	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr15:43863609delC	ENST00000396923.3	-	24	3089		c.e24+1		PPIP5K1_ENST00000432870.3_Splice_Site|PPIP5K1_ENST00000334933.4_Splice_Site|PPIP5K1_ENST00000360301.4_Splice_Site|PPIP5K1_ENST00000348806.6_Splice_Site|PPIP5K1_ENST00000381879.4_Splice_Site|PPIP5K1_ENST00000381885.1_Splice_Site|PPIP5K1_ENST00000420765.1_Splice_Site|PPIP5K1_ENST00000360135.4_Splice_Site			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1						inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						CCTCTCATTACCTCCATGGAA	0.557																																					.		.											.	PPIP5K1-90	0			c.2955+1G>-						.																																			SO:0001630	splice_region_variant	9677	exon25			.	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.2967+1G>-	15.37:g.43863609delC		106	0		91	18	NM_014659	0	0	0	0	0	O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Splice_Site	DEL	ENST00000396923.3	37	CCDS45252.1																																																																																			.		0.557	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659	Intron
PDCD5	9141	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	33077794	33077794	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:33077794delA	ENST00000590247.2	+	5	483	c.289delA	c.(289-291)aaafs	p.K98fs	PDCD5_ENST00000419343.3_3'UTR|PDCD5_ENST00000592786.1_Stop_Codon_Del|PDCD5_ENST00000379316.3_Intron|PDCD5_ENST00000586035.1_Frame_Shift_Del_p.K60fs	NM_004708.3	NP_004699.1	O14737	PDCD5_HUMAN	programmed cell death 5	98					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|large_intestine(2)|lung(1)|ovary(1)	5	Esophageal squamous(110;0.137)					AGAAATCCTTAAAAAAGTAAG	0.323																																					p.K97fs		.											.	PDCD5-228	0			c.289delA						.						81.0	87.0	85.0					19																	33077794		2203	4300	6503	SO:0001589	frameshift_variant	9141	exon5			.	AF014955	CCDS12423.1	19q13.11	2012-10-15			ENSG00000105185	ENSG00000105185			8764	protein-coding gene	gene with protein product	"""TFAR19 novel apoptosis-related"", ""TF1 cell apoptosis-related gene 19"""	604583				9920759	Standard	NM_004708		Approved	TFAR19, MGC9294	uc002ntm.3	O14737	OTTHUMG00000180224	ENST00000590247.2:c.289delA	19.37:g.33077794delA	ENSP00000466214:p.Lys98fs	144	0		124	43	NM_004708	0	0	0	0	0	B4DE64|Q53YC9|Q6IB70	Frame_Shift_Del	DEL	ENST00000590247.2	37	CCDS12423.1																																																																																			.		0.323	PDCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450320.2	NM_004708	
ZNF792	126375	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	35450211	35450211	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:35450211delT	ENST00000404801.1	-	4	934	c.548delA	c.(547-549)aacfs	p.N183fs	ZNF792_ENST00000605484.1_Frame_Shift_Del_p.N116fs	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GTTGTGTACGTTCTGCTGCAC	0.542																																					p.N183fs	GBM(1;7 183 21053 22581 22847)	.											.	.	0			c.548delA						.						256.0	248.0	251.0					19																	35450211		2203	4300	6503	SO:0001589	frameshift_variant	126375	exon4			.	AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.548delA	19.37:g.35450211delT	ENSP00000385099:p.Asn183fs	348	0		273	101	NM_175872	0	0	0	0	0	B4E333|Q495L1|Q495L3|Q8N932	Frame_Shift_Del	DEL	ENST00000404801.1	37	CCDS12440.2																																																																																			.		0.542	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317673.1	NM_175872	
ZNF256	10172	hgsc.bcm.edu;bcgsc.ca	37	19	58452565	58452565	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr19:58452565delA	ENST00000282308.3	-	3	1807	c.1611delT	c.(1609-1611)catfs	p.H537fs	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	537					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GACTTCTCCTATGTCTAATGA	0.468																																					p.H537fs	NSCLC(55;1313 1552 8040 11996)	.											.	ZNF256-92	0			c.1611delT						.						66.0	58.0	61.0					19																	58452565		2203	4300	6503	SO:0001589	frameshift_variant	10172	exon3			.	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1611delT	19.37:g.58452565delA	ENSP00000282308:p.His537fs	129	0		98	19	NM_005773	0	0	0	0	0	B2RA92|Q53Y85|Q9BV71	Frame_Shift_Del	DEL	ENST00000282308.3	37	CCDS12966.1																																																																																			.		0.468	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
GREB1	9687	bcgsc.ca	37	2	11767087	11767100	+	Splice_Site	DEL	GACAGAGGGATGTC	GACAGAGGGATGTC	-	rs538826695|rs201880234		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	GACAGAGGGATGTC	GACAGAGGGATGTC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr2:11767087_11767100delGACAGAGGGATGTC	ENST00000381486.2	+	25	4606_4619	c.4306_4319delGACAGAGGGATGTC	c.(4306-4320)gacagagggatgtcc>c	p.DRGMS1436fs	GREB1_ENST00000234142.5_Splice_Site_p.DRGMS1436fs|GREB1_ENST00000396123.1_Splice_Site_p.DRGMS434fs	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1436						integral component of membrane (GO:0016021)		p.G1438E(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ATTTGGTGCAGACAGAGGGATGTCCCGGAAGCCG	0.519																																					p.1436_1440del	Ovarian(39;850 945 2785 23371 33093)												.	GREB1-91	1	Substitution - Missense(1)	lung(1)	c.4307_4319del						.																																			SO:0001630	splice_region_variant	9687	exon25			GGTGCAGACAGAG		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4307-1GACAGAGGGATGTC>-	2.37:g.11767087_11767100delGACAGAGGGATGTC		159	0		140	5	NM_014668	0	0	0	0	0	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Frame_Shift_Del	DEL	ENST00000381486.2	37	CCDS42655.1																																																																																			.		0.519	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	Frame_Shift_Del
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	57782069	57782069	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr20:57782069delA	ENST00000371030.2	+	3	3985	c.3985delA	c.(3985-3987)aagfs	p.K1329fs		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1329							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TGAGGGACTGAAGCCATGCAG	0.577																																					p.K1329fs		.											.	ZNF831-126	0			c.3985delA						.						68.0	73.0	71.0					20																	57782069		1968	4144	6112	SO:0001589	frameshift_variant	128611	exon3			.	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3985delA	20.37:g.57782069delA	ENSP00000360069:p.Lys1329fs	108	0		104	43	NM_178457	0	0	0	0	0	Q5TDR4|Q8TCP0	Frame_Shift_Del	DEL	ENST00000371030.2	37	CCDS42894.1																																																																																			.		0.577	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	38740016	38740018	+	In_Frame_Del	DEL	ACT	ACT	-	rs200063383	byFrequency	TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	ACT	ACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:38740016_38740018delACT	ENST00000449082.2	-	27	4692_4694	c.4693_4695delAGT	c.(4693-4695)agtdel	p.S1565del		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1565					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGGAGAAGTAACTTTGAAGTGAC	0.478																																					p.1565_1565del		.											.	SCN10A-99	0			c.4693_4695del						.																																			SO:0001651	inframe_deletion	6336	exon27			.	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4693_4695delAGT	3.37:g.38740016_38740018delACT	ENSP00000390600:p.Ser1565del	164	0		118	18	NM_006514	0	0	0	0	0	A6NDQ1	In_Frame_Del	DEL	ENST00000449082.2	37	CCDS33736.1																																																																																			.		0.478	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	38740022	38740022	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr3:38740022delA	ENST00000449082.2	-	27	4688	c.4689delT	c.(4687-4689)cttfs	p.L1563fs		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1563					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGTAACTTTGAAGTGACTTAA	0.478																																					p.L1563fs		.											.	SCN10A-99	0			c.4689delT						.						58.0	59.0	59.0					3																	38740022		2203	4300	6503	SO:0001589	frameshift_variant	6336	exon27			.	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4689delT	3.37:g.38740022delA	ENSP00000390600:p.Leu1563fs	158	0		107	18	NM_006514	0	0	0	0	0	A6NDQ1	Frame_Shift_Del	DEL	ENST00000449082.2	37	CCDS33736.1																																																																																			.		0.478	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
FBXW7	55294	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	153250883	153250883	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr4:153250883delG	ENST00000281708.4	-	8	2406	c.1177delC	c.(1177-1179)cgafs	p.R393fs	FBXW7_ENST00000263981.5_Frame_Shift_Del_p.R313fs|FBXW7_ENST00000603841.1_Frame_Shift_Del_p.R393fs|FBXW7_ENST00000603548.1_Frame_Shift_Del_p.R393fs|FBXW7_ENST00000393956.3_Frame_Shift_Del_p.R217fs|FBXW7_ENST00000296555.5_Frame_Shift_Del_p.R275fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	393					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R393*(7)|p.R313*(1)|p.R154*(1)|p.?(1)|p.R275*(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTAACTATTCGGTTACCACAA	0.343			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R393fs		.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	FBXW7-6296	11	Substitution - Nonsense(10)|Unknown(1)	endometrium(5)|large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)|stomach(1)	c.1177delC						.						118.0	107.0	111.0					4																	153250883		2203	4300	6503	SO:0001589	frameshift_variant	55294	exon8			.	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1177delC	4.37:g.153250883delG	ENSP00000281708:p.Arg393fs	89	0		98	35	NM_033632	0	0	0	0	0	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Del	DEL	ENST00000281708.4	37	CCDS3777.1																																																																																			.		0.343	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
MAP3K7	6885	hgsc.bcm.edu;bcgsc.ca	37	6	91226399	91226400	+	Splice_Site	DEL	GC	GC	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:91226399_91226400delGC	ENST00000369329.3	-	17	1802_1803	c.1641_1642delGC	c.(1639-1644)aagcaa>aaaa	p.Q548fs	MAP3K7_ENST00000369320.1_Splice_Site_p.Q202fs|MAP3K7_ENST00000369332.3_Splice_Site_p.Q521fs|MAP3K7_ENST00000369325.3_Splice_Site_p.A509fs|MAP3K7_ENST00000369327.3_Splice_Site_p.A482fs|MAP3K7_ENST00000479630.1_5'UTR	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	548					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		ACTAGTTCTTGCCTACAAACAA	0.351																																					p.547_548del		.											.	MAP3K7-980	0			c.1641_1642del						.																																			SO:0001630	splice_region_variant	6885	exon17			.	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1641-1GC>-	6.37:g.91226399_91226400delGC		76	0		66	20	NM_145331	0	0	0	0	0	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Frame_Shift_Del	DEL	ENST00000369329.3	37	CCDS5028.1																																																																																			.		0.351	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	Frame_Shift_Del
MAP3K7	6885	hgsc.bcm.edu	37	6	91226399	91226401	+	Splice_Site	DEL	GCC	GCC	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	GCC	GCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:91226399_91226401delGCC	ENST00000369329.3	-	17	1802_1803	c.1641_1642delGGC	c.(1639-1644)aaggca>aaca	p.547_548KA>N	MAP3K7_ENST00000369320.1_Splice_Site_p.201_202KA>N|MAP3K7_ENST00000369332.3_Splice_Site_p.520_521KA>N|MAP3K7_ENST00000369325.3_Splice_Site_p.G509del|MAP3K7_ENST00000369327.3_Splice_Site_p.G482del|MAP3K7_ENST00000479630.1_5'UTR	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	547					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		ACTAGTTCTTGCCTACAAACAAA	0.35																																					p.547_548del		.											.	MAP3K7-980	0			c.1641_1642del						.																																			SO:0001630	splice_region_variant	6885	exon17			.	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1641-1GGC>-	6.37:g.91226399_91226401delGCC		77	0		67	13	NM_145331	0	0	0	0	0	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Frame_Shift_Del	DEL	ENST00000369329.3	37	CCDS5028.1																																																																																			.		0.350	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	In_Frame_Del
GRIK2	2898	hgsc.bcm.edu;bcgsc.ca	37	6	102513771	102513771	+	Intron	DEL	T	T	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr6:102513771delT	ENST00000421544.1	+	16	3052				GRIK2_ENST00000369137.3_Intron|GRIK2_ENST00000369138.1_Frame_Shift_Del_p.L888fs|GRIK2_ENST00000413795.1_Intron|GRIK2_ENST00000369134.4_Intron	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ttcatcatcattatcatcatG	0.363																																					p.L888fs		.											.	GRIK2-157	0			c.2662delT						.						287.0	228.0	246.0					6																	102513771		692	1590	2282	SO:0001627	intron_variant	2898	exon16			.		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2563-2451T>-	6.37:g.102513771delT		96	0		80	37	NM_001166247	0	0	0	0	0	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Frame_Shift_Del	DEL	ENST00000421544.1	37	CCDS5048.1																																																																																			.		0.363	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
LAMB4	22798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	107732109	107732120	+	In_Frame_Del	DEL	CCTCGTAGAGAT	CCTCGTAGAGAT	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	CCTCGTAGAGAT	CCTCGTAGAGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr7:107732109_107732120delCCTCGTAGAGAT	ENST00000388781.3	-	14	1735_1746	c.1652_1663delATCTCTACGAGG	c.(1651-1665)tatctctacgaggca>tca	p.551_555YLYEA>S	LAMB4_ENST00000418464.1_In_Frame_Del_p.551_555YLYEA>S|LAMB4_ENST00000414450.2_In_Frame_Del_p.551_555YLYEA>S|LAMB4_ENST00000205386.4_In_Frame_Del_p.551_555YLYEA>S|LAMB4_ENST00000388780.3_In_Frame_Del_p.551_555YLYEA>S	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	551	Laminin EGF-like 5; truncated. {ECO:0000255|PROSITE-ProRule:PRU00460}.|Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.Y553D(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GCTTCCTCTGCCTCGTAGAGATAGAAATTCAA	0.491																																					p.551_555del		.											.	LAMB4-140	1	Substitution - Missense(1)	prostate(1)	c.1652_1663del						.																																			SO:0001651	inframe_deletion	22798	exon14			.	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1652_1663delATCTCTACGAGG	7.37:g.107732109_107732120delCCTCGTAGAGAT	ENSP00000373433:p.Tyr551_Ala555delinsSer	174	0		119	23	NM_007356	0	0	0	0	0	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	In_Frame_Del	DEL	ENST00000388781.3	37	CCDS34732.1																																																																																			.		0.491	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
PTPN3	5774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	112219466	112219466	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr9:112219466delC	ENST00000374541.2	-	4	380	c.276delG	c.(274-276)aggfs	p.R92fs	PTPN3_ENST00000262539.3_Frame_Shift_Del_p.E10fs	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	92	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TTAACTGCTTCCTGATGGCTT	0.413																																					p.R92fs		.											.	PTPN3-229	0			c.276delG						.						197.0	168.0	177.0					9																	112219466		2203	4300	6503	SO:0001589	frameshift_variant	5774	exon4			.		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.276delG	9.37:g.112219466delC	ENSP00000363667:p.Arg92fs	167	0		113	32	NM_001145368	0	0	0	0	0	A0AUW9|E7EN99|E9PGU7	Frame_Shift_Del	DEL	ENST00000374541.2	37	CCDS6776.1																																																																																			.		0.413	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
SUPT20HL1	100130302	broad.mit.edu	37	X	24382371	24382373	+	IGR	DEL	TAT	TAT	-	rs371342199|rs35206911|rs2695489|rs201827126		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	TAT	TAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chrX:24382371_24382373delTAT								AC004552.1 (15348 upstream) : PDK3 (100964 downstream)																							ctgctgctgctattgctgctgct	0.576																																					p.498_499del													.	.	0			c.1494_1496del						.			51,3098		12,21,6,1318,441						0.1	0.0		dbSNP_130	9	95,5572		7,39,42,2032,1469	no	coding	FAM48B1	NM_001136234.1		19,60,48,3350,1910	A1A1,A1R,A1,RR,R		1.6764,1.6196,1.6561				146,8670				SO:0001628	intergenic_variant	100130302	exon1			TGCTGCTATTGCT																													X.37:g.24382371_24382373delTAT		376	0		300	7	NM_001136234	0	0	0	0	0		In_Frame_Del	DEL		37																																																																																				.	0	0.576								
CENPL	91687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	173772297	173772298	+	Frame_Shift_Ins	INS	-	-	T	rs139873333	byFrequency	TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr1:173772297_173772298insT	ENST00000345664.6	-	4	979_980	c.766_767insA	c.(766-768)atafs	p.I256fs	CENPL_ENST00000356198.2_Frame_Shift_Ins_p.I302fs|CENPL_ENST00000367710.3_Frame_Shift_Ins_p.I256fs	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	256					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						CTCTGGATGTATTGCGAAAGAA	0.45																																					p.I302fs		.											.	CENPL-90	0			c.905_906insA						.																																			SO:0001589	frameshift_variant	91687	exon6			.	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.767dupA	1.37:g.173772299_173772299dupT	ENSP00000323543:p.Ile256fs	123	0		74	18	NM_001127181	0	0	0	0	0	Q5TEL5|Q96ND4	Frame_Shift_Ins	INS	ENST00000345664.6	37	CCDS30938.1																																																																																			.		0.450	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319	
MTG1	92170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	135209749	135209750	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr10:135209749_135209750insGC	ENST00000317502.6	+	3	310_311	c.260_261insGC	c.(259-264)ttggcgfs	p.A88fs	MTG1_ENST00000477902.2_Frame_Shift_Ins_p.A47fs|RP11-108K14.8_ENST00000468317.2_Frame_Shift_Ins_p.A93fs	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	88	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		AAGATGGACTTGGCGGATCTTA	0.515																																					p.L87fs		.											.	MTG1-91	0			c.260_261insGC						.																																			SO:0001589	frameshift_variant	92170	exon3			.		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	Exception_encountered	10.37:g.135209749_135209750insGC	ENSP00000323047:p.Ala88fs	139	0		108	42	NM_138384	0	0	0	0	0	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Frame_Shift_Ins	INS	ENST00000317502.6	37	CCDS31320.1																																																																																			.		0.515	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384	
NEFH	4744	hgsc.bcm.edu;broad.mit.edu	37	22	29885591	29885592	+	In_Frame_Ins	INS	-	-	CCTGAGAAGGCCAAGTCC	rs200984527|rs267607533		TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr22:29885591_29885592insCCTGAGAAGGCCAAGTCC	ENST00000310624.6	+	4	1995_1996	c.1962_1963insCCTGAGAAGGCCAAGTCC	c.(1963-1965)cca>CCTGAGAAGGCCAAGTCCcca	p.655_655P>PEKAKSP		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCCAAGTCCCCAGAGAAGGA	0.559																																					p.S654delinsSPEKAKS		.											.	NEFH-90	0			c.1962_1963insCCTGAGAAGGCCAAGTCC						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1945_1962dupCCTGAGAAGGCCAAGTCC	22.37:g.29885591_29885592insCCTGAGAAGGCCAAGTCC	ENSP00000311997:p.GluLysAlaLysSerPro655dup	329	0		226	59	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
OVOL1	5017	broad.mit.edu	37	11	65562811	65562812	+	Nonstop_Mutation	DNP	GA	GA	TT			TCGA-MH-A561-01A-11D-A26P-10	TCGA-MH-A561-10A-01D-A26P-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2e8ad1cd-d5d5-4bb4-8bbd-e9bef45088da	ebf9ee83-790d-43a8-ae04-e32e2f61bfa6	g.chr11:65562811_65562812GA>TT	ENST00000335987.3	+	4	1155_1156	c.803_804GA>TT	c.(802-804)tGA>tTT	p.*268F	RP11-770G2.5_ENST00000531155.1_RNA|OVOL1_ENST00000532448.1_Nonstop_Mutation_p.*206F	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	0					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		CCCCACCTGTGAGTGGCTCGAG	0.653																																					.													.	OVOL1-68	0			c.A804T						.																																			SO:0001578	stop_lost	5017	exon4			CCTGTGAGTGGCT	BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	Exception_encountered	11.37:g.65562811_65562812delinsTT	Exception_encountered	53	0		41	3	NM_004561	0	0	0	0	0	Q6PCB1	Nonstop_Mutation	DNP	ENST00000335987.3	37	CCDS8112.1																																																																																			.		0.653	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390690.1	NM_004561	
