#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WDR64	128025	hgsc.bcm.edu	37	1	241875146	241875146	+	Silent	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr1:241875146T>C	ENST00000366552.2	+	8	1194	c.987T>C	c.(985-987)ttT>ttC	p.F329F	WDR64_ENST00000437684.2_Silent_p.F329F	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	329										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CCAACACTTTTTGCTACTGTG	0.393																																					p.F329F		.											.	WDR64-91	0			c.T987C						.						119.0	111.0	114.0					1																	241875146		2203	4300	6503	SO:0001819	synonymous_variant	128025	exon8			CACTTTTTGCTAC	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.987T>C	1.37:g.241875146T>C		95	0		40	2	NM_144625	0	0	0	0	0	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	ENST00000366552.2	37																																																																																				.		0.393	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
PCDH15	65217	broad.mit.edu;bcgsc.ca	37	10	55617003	55617003	+	Silent	SNP	C	C	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr10:55617003C>A	ENST00000320301.6	-	28	4132	c.3738G>T	c.(3736-3738)ctG>ctT	p.L1246L	PCDH15_ENST00000361849.3_Silent_p.L1246L|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000409834.1_Silent_p.L857L|PCDH15_ENST00000395433.1_Silent_p.L1224L|PCDH15_ENST00000395438.1_Silent_p.L1246L|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000414778.1_Silent_p.L1251L|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395432.2_Silent_p.L1209L|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000437009.1_Silent_p.L1175L|PCDH15_ENST00000373965.2_Silent_p.L1253L|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395430.1_Silent_p.L1246L|PCDH15_ENST00000395445.1_Silent_p.L1253L	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1246	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.L1251L(2)|p.L1246L(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTGCATATCCAGCTGATTGA	0.333										HNSCC(58;0.16)																											p.L1251L													.	PCDH15-193	4	Substitution - coding silent(4)	lung(4)	c.G3753T						.						76.0	76.0	76.0					10																	55617003		2203	4299	6502	SO:0001819	synonymous_variant	65217	exon29			CATATCCAGCTGA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3738G>T	10.37:g.55617003C>A		89	0		128	6	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.333	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
DOCK1	1793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129245700	129245700	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr10:129245700T>A	ENST00000280333.6	+	51	5502	c.5393T>A	c.(5392-5394)gTc>gAc	p.V1798D		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1798	Interaction with NCK2 second and third SH3 domain (minor).				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GTGGCCGATGTCCCACCCCCT	0.592																																					p.V1798D													.	DOCK1-698	0			c.T5393A						.						39.0	44.0	42.0					10																	129245700		1998	4174	6172	SO:0001583	missense	1793	exon51			CCGATGTCCCACC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.5393T>A	10.37:g.129245700T>A	ENSP00000280333:p.Val1798Asp	40	0		20	4	NM_001380	0	0	6	9	3	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	T	14.26	2.480917	0.44044	.	.	ENSG00000150760	ENST00000280333	T	0.03982	3.74	5.22	4.09	0.47781	.	1.233990	0.05657	N	0.586186	T	0.05686	0.0149	L	0.40543	1.245	0.51233	D	0.999914	B;B	0.23058	0.079;0.079	B;B	0.25884	0.064;0.064	T	0.40117	-0.9580	10	0.12103	T	0.63	.	8.0983	0.30842	0.0:0.1519:0.0:0.8481	.	1798;1798	B2RUU3;Q14185	.;DOCK1_HUMAN	D	1798	ENSP00000280333:V1798D	ENSP00000280333:V1798D	V	+	2	0	DOCK1	129135690	0.696000	0.27757	0.918000	0.36340	0.711000	0.40976	2.404000	0.44539	2.099000	0.63709	0.533000	0.62120	GTC	.		0.592	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
CCKBR	887	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	6281226	6281226	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr11:6281226G>C	ENST00000334619.2	+	1	261	c.68G>C	c.(67-69)cGc>cCc	p.R23P	CCKBR_ENST00000531712.1_Missense_Mutation_p.R23P|CCKBR_ENST00000525462.1_Missense_Mutation_p.R23P|CCKBR_ENST00000532715.1_Missense_Mutation_p.R23P|CCKBR_ENST00000525014.1_Missense_Mutation_p.R23P	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	23					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TCCCTGTGCCGCCCGGGGGCG	0.716																																					p.R23P		.											.	CCKBR-574	0			c.G68C						.						9.0	13.0	12.0					11																	6281226		2165	4246	6411	SO:0001583	missense	887	exon1			TGTGCCGCCCGGG	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.68G>C	11.37:g.6281226G>C	ENSP00000335544:p.Arg23Pro	23	0		26	7	NM_176875	0	0	0	0	0	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	g	8.885	0.952549	0.18431	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525014;ENST00000525462;ENST00000531712	T;T;T;T;T	0.77098	0.34;-1.07;-0.06;0.35;0.15	2.75	2.75	0.32379	.	0.513554	0.16331	U	0.219138	T	0.78027	0.4219	L	0.47716	1.5	0.31075	N	0.712597	D;B	0.61080	0.989;0.337	P;B	0.56865	0.808;0.11	T	0.74156	-0.3756	10	0.31617	T	0.26	.	9.2026	0.37268	0.0:0.0:1.0:0.0	.	23;23	P32239-2;P32239	.;GASR_HUMAN	P	23	ENSP00000335544:R23P;ENSP00000432079:R23P;ENSP00000437001:R23P;ENSP00000435534:R23P;ENSP00000435675:R23P	ENSP00000335544:R23P	R	+	2	0	CCKBR	6237802	1.000000	0.71417	0.996000	0.52242	0.042000	0.13812	1.757000	0.38400	1.859000	0.53934	0.580000	0.79431	CGC	.		0.716	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
LRP4	4038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46920187	46920187	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr11:46920187T>A	ENST00000378623.1	-	7	960	c.718A>T	c.(718-720)Agt>Tgt	p.S240C		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	240	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CACAGGCCACTGTCACACATG	0.567																																					p.S240C		.											.	LRP4-94	0			c.A718T						.						160.0	153.0	156.0					11																	46920187		2201	4299	6500	SO:0001583	missense	4038	exon7			GGCCACTGTCACA	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.718A>T	11.37:g.46920187T>A	ENSP00000367888:p.Ser240Cys	325	1		294	67	NM_002334	0	0	0	0	0	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	T	32	5.116456	0.94385	.	.	ENSG00000134569	ENST00000378623	D	0.95918	-3.85	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.98632	0.9542	H	0.97940	4.11	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.976	D	0.99694	1.1002	10	0.72032	D	0.01	.	15.3761	0.74607	0.0:0.0:0.0:1.0	.	285;240	C9JRN7;O75096	.;LRP4_HUMAN	C	240	ENSP00000367888:S240C	ENSP00000367888:S240C	S	-	1	0	LRP4	46876763	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.040000	0.89188	2.047000	0.60756	0.459000	0.35465	AGT	.		0.567	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
DCP1B	196513	hgsc.bcm.edu	37	12	2062350	2062350	+	Missense_Mutation	SNP	C	C	G	rs570843986	byFrequency	TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:2062350C>G	ENST00000280665.6	-	7	835	c.756G>C	c.(754-756)caG>caC	p.Q252H	DCP1B_ENST00000540622.1_Missense_Mutation_p.Q126H|DCP1B_ENST00000397173.4_Missense_Mutation_p.Q150H|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	252	Poly-Gln.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Q252H(8)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			gctgctgctgctgGTGGAGAG	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		14619	0.002		0.0	False		,,,				2504	0.0				p.Q252H		.											.	DCP1B-91	8	Substitution - Missense(8)	endometrium(5)|lung(2)|large_intestine(1)	c.G756C						.						35.0	42.0	40.0					12																	2062350		2203	4300	6503	SO:0001583	missense	196513	exon7			CTGCTGCTGGTGG	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.756G>C	12.37:g.2062350C>G	ENSP00000280665:p.Gln252His	73	1		97	5	NM_152640	0	0	8	8	0	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	37	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361713	0.01235	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19250	2.19;2.17;2.16	4.04	-8.09	0.01090	.	1.568620	0.03045	N	0.153823	T	0.13072	0.0317	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15694	-1.0428	10	0.17369	T	0.5	.	12.662	0.56820	0.0881:0.1213:0.7178:0.0728	.	150;252	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	H	252;150;126	ENSP00000280665:Q252H;ENSP00000380358:Q150H;ENSP00000444374:Q126H	ENSP00000280665:Q252H	Q	-	3	2	DCP1B	1932611	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.268000	0.02836	-2.090000	0.00859	-2.175000	0.00321	CAG	.		0.552	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
EPS8	2059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	15784493	15784493	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:15784493C>A	ENST00000281172.5	-	18	2363	c.1927G>T	c.(1927-1929)Gca>Tca	p.A643S	EPS8_ENST00000542903.1_Missense_Mutation_p.A383S|EPS8_ENST00000543523.1_Missense_Mutation_p.A643S|EPS8_ENST00000543612.1_Missense_Mutation_p.A643S|EPS8_ENST00000540613.1_Missense_Mutation_p.A383S	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	643	Pro-rich.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		GGAACAGGTGCTGGAGTGGAA	0.547																																					p.A643S		.											.	EPS8-94	0			c.G1927T						.						152.0	128.0	136.0					12																	15784493		2203	4300	6503	SO:0001583	missense	2059	exon18			CAGGTGCTGGAGT	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1927G>T	12.37:g.15784493C>A	ENSP00000281172:p.Ala643Ser	150	0		173	28	NM_004447	0	0	21	28	7	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064340	0.55432	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.08546	3.21;3.21;3.21;3.08;3.08	5.75	5.75	0.90469	.	0.131007	0.51477	D	0.000098	T	0.19846	0.0477	L	0.38531	1.155	0.44104	D	0.996874	D	0.63880	0.993	D	0.72625	0.978	T	0.02654	-1.1128	10	0.20519	T	0.43	-4.529	18.1274	0.89590	0.0:1.0:0.0:0.0	.	643	Q12929	EPS8_HUMAN	S	643;643;643;383;383;643	ENSP00000441867:A643S;ENSP00000281172:A643S;ENSP00000442388:A643S;ENSP00000441888:A383S;ENSP00000437806:A383S	ENSP00000281172:A643S	A	-	1	0	EPS8	15675760	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.997000	0.49457	2.714000	0.92807	0.650000	0.86243	GCA	.		0.547	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
SCAF11	9169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46320210	46320210	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:46320210G>T	ENST00000369367.3	-	11	3507	c.3274C>A	c.(3274-3276)Cag>Aag	p.Q1092K	SCAF11_ENST00000549162.1_Missense_Mutation_p.Q900K|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.Q777K|SCAF11_ENST00000419565.2_Missense_Mutation_p.Q1092K	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1092					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TTTTCATTCTGATCTTTATAG	0.433																																					p.Q1092K		.											.	SCAF11-93	0			c.C3274A						.						68.0	73.0	71.0					12																	46320210		2203	4300	6503	SO:0001583	missense	9169	exon11			CATTCTGATCTTT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.3274C>A	12.37:g.46320210G>T	ENSP00000358374:p.Gln1092Lys	133	0		145	23	NM_004719	0	0	2	2	0	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546855	0.65198	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.85	5.85	0.93711	.	0.089021	0.49916	D	0.000137	T	0.64294	0.2585	M	0.62723	1.935	0.28696	N	0.904354	D;D	0.71674	0.998;0.988	D;P	0.65684	0.937;0.788	T	0.58578	-0.7612	10	0.12766	T	0.61	-12.0691	20.1563	0.98114	0.0:0.0:1.0:0.0	.	900;1092	F8VXG7;Q99590	.;SCAFB_HUMAN	K	777;1092;900;1092	ENSP00000449812:Q777K;ENSP00000358374:Q1092K;ENSP00000448864:Q900K;ENSP00000413036:Q1092K	ENSP00000358374:Q1092K	Q	-	1	0	SCAF11	44606477	1.000000	0.71417	0.980000	0.43619	0.815000	0.46073	5.535000	0.67173	2.775000	0.95449	0.655000	0.94253	CAG	.		0.433	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
INHBC	3626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57828750	57828750	+	Silent	SNP	A	A	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:57828750A>C	ENST00000309668.2	+	1	208	c.81A>C	c.(79-81)ccA>ccC	p.P27P	RP11-756H6.1_ENST00000547552.1_lincRNA	NM_005538.2	NP_005529.1	P55103	INHBC_HUMAN	inhibin, beta C	27					growth (GO:0040007)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	transforming growth factor beta receptor binding (GO:0005160)			breast(2)|endometrium(1)|large_intestine(6)|liver(2)|lung(4)|prostate(1)	16						GTCAGTGTCCAGCATGTGGGG	0.607																																					p.P27P		.											.	INHBC-514	0			c.A81C						.						41.0	41.0	41.0					12																	57828750		2203	4300	6503	SO:0001819	synonymous_variant	3626	exon1			GTGTCCAGCATGT		CCDS8938.1	12q13	2008-02-05				ENSG00000175189			6068	protein-coding gene	gene with protein product		601233				7826378	Standard	NM_005538		Approved		uc001snv.1	P55103	OTTHUMG00000169994	ENST00000309668.2:c.81A>C	12.37:g.57828750A>C		67	0		97	15	NM_005538	0	0	1	1	0	A1L3Y2	Silent	SNP	ENST00000309668.2	37	CCDS8938.1																																																																																			.		0.607	INHBC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406770.1	NM_005538	
ALDH1L2	160428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	105428135	105428135	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:105428135A>C	ENST00000258494.9	-	19	2327	c.2187T>G	c.(2185-2187)atT>atG	p.I729M	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	729	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						GCCCAGCAGCAATACAGTTCT	0.418																																					p.I729M		.											.	ALDH1L2-91	0			c.T2187G						.						107.0	90.0	96.0					12																	105428135		2203	4300	6503	SO:0001583	missense	160428	exon19			AGCAGCAATACAG	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2187T>G	12.37:g.105428135A>C	ENSP00000258494:p.Ile729Met	95	0		91	18	NM_001034173	0	0	0	0	0	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	37	CCDS31891.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699315	0.68501	.	.	ENSG00000136010	ENST00000258494	T	0.76839	-1.05	5.46	-0.924	0.10462	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);Aldehyde dehydrogenase, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	N	0.20574	0.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75227	-0.3392	10	0.87932	D	0	.	11.4475	0.50131	0.6024:0.0:0.3976:0.0	.	729	Q3SY69	AL1L2_HUMAN	M	729	ENSP00000258494:I729M	ENSP00000258494:I729M	I	-	3	3	ALDH1L2	103952265	1.000000	0.71417	0.991000	0.47740	0.968000	0.65278	1.140000	0.31516	-0.085000	0.12573	-0.388000	0.06559	ATT	.		0.418	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
RNF6	6049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	26788332	26788332	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr13:26788332T>A	ENST00000381588.4	-	5	2439	c.1687A>T	c.(1687-1689)Agt>Tgt	p.S563C	RNF6_ENST00000381570.3_Missense_Mutation_p.S563C|RNF6_ENST00000468480.1_Intron|RNF6_ENST00000346166.3_Missense_Mutation_p.S563C|RNF6_ENST00000399762.2_Missense_Mutation_p.S207C	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	563					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		CTACTGTCACTGTTTCGAGTA	0.483																																					p.S563C		.											.	RNF6-228	0			c.A1687T						.						152.0	148.0	149.0					13																	26788332		2203	4300	6503	SO:0001583	missense	6049	exon5			TGTCACTGTTTCG	AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.1687A>T	13.37:g.26788332T>A	ENSP00000371000:p.Ser563Cys	198	0		185	50	NM_183043	0	0	5	7	2	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	ENST00000381588.4	37	CCDS9316.1	.	.	.	.	.	.	.	.	.	.	T	5.021	0.189542	0.09547	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570;ENST00000399762	T;T;T;T	0.15834	2.97;2.97;2.97;2.39	4.87	0.818	0.18778	.	0.588235	0.19777	N	0.106316	T	0.18215	0.0437	L	0.43152	1.355	0.09310	N	1	D;P	0.56287	0.975;0.948	P;B	0.49047	0.599;0.41	T	0.08371	-1.0725	10	0.59425	D	0.04	-0.6579	8.2879	0.31939	0.0:0.069:0.3791:0.552	.	207;563	B4DDP0;Q9Y252	.;RNF6_HUMAN	C	563;563;563;207	ENSP00000342121:S563C;ENSP00000371000:S563C;ENSP00000370982:S563C;ENSP00000382665:S207C	ENSP00000342121:S563C	S	-	1	0	RNF6	25686332	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.774000	0.26675	0.069000	0.16605	0.460000	0.39030	AGT	.		0.483	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977	
TEP1	7011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20857434	20857434	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr14:20857434C>T	ENST00000262715.5	-	17	2528	c.2488G>A	c.(2488-2490)Gat>Aat	p.D830N	TEP1_ENST00000556935.1_Missense_Mutation_p.D722N	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	830					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGTGTCACATCATTGGGATTC	0.418																																					p.D830N		.											.	TEP1-95	0			c.G2488A						.						170.0	144.0	153.0					14																	20857434		2203	4300	6503	SO:0001583	missense	7011	exon17			TCACATCATTGGG		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2488G>A	14.37:g.20857434C>T	ENSP00000262715:p.Asp830Asn	141	0		77	17	NM_007110	0	0	0	0	0	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675408	0.47781	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.51817	0.7;0.69	5.14	5.14	0.70334	.	0.398706	0.30219	N	0.010131	T	0.55481	0.1923	L	0.41824	1.3	0.80722	D	1	D;B;D	0.57257	0.979;0.005;0.964	P;B;P	0.59703	0.862;0.01;0.732	T	0.55483	-0.8134	10	0.51188	T	0.08	-3.8703	14.0724	0.64868	0.0:1.0:0.0:0.0	.	722;180;830	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	N	830;830;722	ENSP00000262715:D830N;ENSP00000452574:D722N	ENSP00000262715:D830N	D	-	1	0	TEP1	19927274	0.981000	0.34729	0.998000	0.56505	0.734000	0.41952	0.854000	0.27791	2.392000	0.81423	0.561000	0.74099	GAT	.		0.418	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
SYNE2	23224	hgsc.bcm.edu	37	14	64520135	64520135	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr14:64520135A>G	ENST00000344113.4	+	48	9716	c.9504A>G	c.(9502-9504)atA>atG	p.I3168M	SYNE2_ENST00000358025.3_Missense_Mutation_p.I3168M|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.I3201M	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3168					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAAATCAGATAAAATCTCAAT	0.318																																					p.I3168M		.											.	SYNE2-164	0			c.A9504G						.						42.0	42.0	42.0					14																	64520135		1807	4067	5874	SO:0001583	missense	23224	exon48			TCAGATAAAATCT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9504A>G	14.37:g.64520135A>G	ENSP00000341781:p.Ile3168Met	72	0		30	2	NM_182914	0	0	1	1	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.131028	0.37630	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59906	0.61;0.61;0.23	5.39	2.83	0.33086	.	0.202730	0.35040	N	0.003495	T	0.51432	0.1674	L	0.29908	0.895	0.80722	D	1	P;D	0.54047	0.94;0.964	P;P	0.55545	0.605;0.778	T	0.47169	-0.9138	10	0.38643	T	0.18	.	4.6279	0.12488	0.5373:0.1327:0.0:0.33	.	3168;3168	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	M	3168;3168;3201;3201	ENSP00000350719:I3168M;ENSP00000341781:I3168M;ENSP00000452570:I3201M	ENSP00000261678:I3201M	I	+	3	3	SYNE2	63589888	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.494000	0.22467	0.850000	0.35239	0.379000	0.24179	ATA	.		0.318	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ATP10A	57194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	25959389	25959389	+	Splice_Site	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr15:25959389C>G	ENST00000356865.6	-	10	1888		c.e10-1			NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCACCCTCACCTGCAAGAGAA	0.582																																					.		.											.	ATP10A-139	0			c.1777-1G>C						.						26.0	30.0	29.0					15																	25959389		2188	4268	6456	SO:0001630	splice_region_variant	57194	exon11			CCTCACCTGCAAG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1777-1G>C	15.37:g.25959389C>G		79	0		43	5	NM_024490	0	0	0	0	0	Q4G0S9|Q969I4	Splice_Site	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018554	0.75275	.	.	ENSG00000206190	ENST00000356865	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6469	0.88151	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP10A	23510482	1.000000	0.71417	0.996000	0.52242	0.877000	0.50540	6.761000	0.74945	2.412000	0.81896	0.655000	0.94253	.	.		0.582	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	Intron
ALDH3A2	224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	19575183	19575183	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr17:19575183T>A	ENST00000176643.6	+	9	1803	c.1357T>A	c.(1357-1359)Ttt>Att	p.F453I	ALDH3A2_ENST00000579855.1_Missense_Mutation_p.F453I|ALDH3A2_ENST00000571163.1_Intron|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.F453I|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.F453I|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.F453I			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	453					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TTGGGGAAAATTTTTTCTCTT	0.423																																					p.F453I		.											.	ALDH3A2-228	0			c.T1357A						.						129.0	143.0	138.0					17																	19575183		2203	4300	6503	SO:0001583	missense	224	exon9			GGAAAATTTTTTC	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1357T>A	17.37:g.19575183T>A	ENSP00000176643:p.Phe453Ile	236	0		298	65	NM_001031806	0	0	9	14	5	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	37	CCDS11210.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144131	0.37825	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.80909	-1.42;-1.42;-1.43	6.07	3.72	0.42706	.	0.133335	0.64402	D	0.000001	T	0.66703	0.2816	N	0.24115	0.695	0.22656	N	0.998887	B;P	0.37061	0.444;0.58	B;B	0.39068	0.133;0.289	T	0.55237	-0.8172	10	0.22706	T	0.39	-18.8603	8.3131	0.32084	0.0:0.0691:0.1325:0.7984	.	453;453	P51648;P51648-2	AL3A2_HUMAN;.	I	453	ENSP00000176643:F453I;ENSP00000378942:F453I;ENSP00000345774:F453I	ENSP00000176643:F453I	F	+	1	0	ALDH3A2	19515775	0.922000	0.31269	0.032000	0.17829	0.671000	0.39405	1.408000	0.34668	1.093000	0.41377	0.533000	0.62120	TTT	.		0.423	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1		
RAB34	83871	hgsc.bcm.edu;bcgsc.ca	37	17	27038593	27038593	+	IGR	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr17:27038593C>T	ENST00000395245.3	-	0	1736				PROCA1_ENST00000301039.2_Missense_Mutation_p.C29Y|PROCA1_ENST00000581289.1_Missense_Mutation_p.C29Y|PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_5'Flank	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family						antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CTTACCGCGGCATCTGCTCTC	0.682																																					p.C29Y	Pancreas(175;216 2049 29940 32498 41589)	.											.	PROCA1-91	0			c.G86A						.						78.0	68.0	72.0					17																	27038593		2203	4300	6503	SO:0001628	intergenic_variant	147011	exon1			CCGCGGCATCTGC	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680		17.37:g.27038593C>T		87	0		86	13	NM_152465	0	0	0	0	0	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000395245.3	37	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	C	8.048	0.765458	0.15914	.	.	ENSG00000167525	ENST00000301039	T	0.29917	1.55	2.0	2.0	0.26442	.	0.967617	0.08473	U	0.940674	T	0.16642	0.0400	N	0.08118	0	0.27121	N	0.962131	B	0.11235	0.004	B	0.14023	0.01	T	0.16748	-1.0392	10	0.56958	D	0.05	.	7.523	0.27639	0.0:1.0:0.0:0.0	.	29	Q8NCQ7-2	.	Y	29	ENSP00000301039:C29Y	ENSP00000301039:C29Y	C	-	2	0	PROCA1	24062720	0.026000	0.19158	0.014000	0.15608	0.004000	0.04260	0.601000	0.24119	1.414000	0.47017	0.514000	0.50259	TGC	.		0.682	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
ENGASE	64772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	77079593	77079593	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr17:77079593C>G	ENST00000579016.1	+	9	1172	c.1172C>G	c.(1171-1173)cCc>cGc	p.P391R	ENGASE_ENST00000584568.1_3'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	391						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						CGTTATCTGCCCACACATAGC	0.617																																					p.P391R		.											.	ENGASE-91	0			c.C1172G						.						111.0	118.0	116.0					17																	77079593		2136	4241	6377	SO:0001583	missense	64772	exon9			ATCTGCCCACACA	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1172C>G	17.37:g.77079593C>G	ENSP00000462333:p.Pro391Arg	52	0		78	11	NM_001042573	0	0	4	5	1	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	ENST00000579016.1	37	CCDS42394.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987187	0.35036	.	.	ENSG00000167280	ENST00000545583	.	.	.	5.47	5.47	0.80525	Glycoside hydrolase, family 85 (1);	0.309415	0.36778	N	0.002406	T	0.61173	0.2326	M	0.69823	2.125	0.80722	D	1	P	0.45240	0.854	P	0.46144	0.505	T	0.59685	-0.7408	9	0.28530	T	0.3	-4.1388	12.6473	0.56742	0.0:0.9243:0.0:0.0757	.	391	Q8NFI3	ENASE_HUMAN	R	391	.	ENSP00000438577:P391R	P	+	2	0	ENGASE	74591188	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	2.094000	0.41719	2.563000	0.86464	0.561000	0.74099	CCC	.		0.617	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	
AATK	9625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79094952	79094952	+	Silent	SNP	A	A	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr17:79094952A>T	ENST00000326724.4	-	11	2808	c.2784T>A	c.(2782-2784)tcT>tcA	p.S928S	AATK_ENST00000417379.1_Silent_p.S825S	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	928					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCTGCCCTCCAGAGGGGCCAG	0.647																																					p.S928S		.											.	AATK-933	0			c.T2784A						.						10.0	12.0	11.0					17																	79094952		1972	4143	6115	SO:0001819	synonymous_variant	9625	exon11			CCCTCCAGAGGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.2784T>A	17.37:g.79094952A>T		29	0		27	7	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	A	0.866	-0.733743	0.03111	.	.	ENSG00000181409	ENST00000417379	.	.	.	3.95	-2.58	0.06228	.	.	.	.	.	T	0.43188	0.1236	.	.	.	0.37603	D	0.920626	.	.	.	.	.	.	T	0.43048	-0.9415	4	.	.	.	.	5.1955	0.15233	0.3603:0.1879:0.4518:0.0	.	.	.	.	Q	881	.	.	L	-	2	0	AATK	76709547	0.166000	0.22962	0.006000	0.13384	0.142000	0.21351	0.558000	0.23469	-0.121000	0.11787	-0.464000	0.05259	CTG	.		0.647	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ZNF208	7757	hgsc.bcm.edu	37	19	22154841	22154841	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr19:22154841T>C	ENST00000397126.4	-	4	3143	c.2995A>G	c.(2995-2997)Aaa>Gaa	p.K999E	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	999					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTGTAGGGTTTCTCTCCAGTA	0.358																																					p.K999E		.											.	ZNF208-7	0			c.A2995G						.						59.0	65.0	63.0					19																	22154841		2095	4240	6335	SO:0001583	missense	7757	exon4			AGGGTTTCTCTCC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2995A>G	19.37:g.22154841T>C	ENSP00000380315:p.Lys999Glu	54	0		50	3	NM_007153	0	2	52	54	0		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.228557	0.39399	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.27104	1.69	2.58	2.58	0.30949	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44414	0.1292	.	.	.	0.26358	N	0.977095	P	0.51791	0.948	D	0.64237	0.923	T	0.18335	-1.0340	8	0.87932	D	0	.	9.4923	0.38967	0.0:0.0:0.0:1.0	.	871	O43345	ZN208_HUMAN	E	999;871	ENSP00000380315:K999E	ENSP00000380315:K999E	K	-	1	0	ZNF208	21946681	0.119000	0.22226	0.028000	0.17463	0.366000	0.29705	2.087000	0.41653	0.848000	0.35191	0.240000	0.17902	AAA	.		0.358	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
FCGRT	2217	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	50017180	50017180	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr19:50017180T>C	ENST00000221466.5	+	3	601	c.115T>C	c.(115-117)Tcg>Ccg	p.S39P	FCGRT_ENST00000594823.1_3'UTR|FCGRT_ENST00000426395.3_Missense_Mutation_p.S39P|FCGRT_ENST00000596975.1_Missense_Mutation_p.S39P|FCGRT_ENST00000599988.1_Intron	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	39	Alpha-1.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		CGCGGTGTCCTCGCCTGCCCC	0.657																																					p.S39P		.											.	FCGRT-91	0			c.T115C						.						128.0	127.0	127.0					19																	50017180		2203	4300	6503	SO:0001583	missense	2217	exon3			GTGTCCTCGCCTG	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.115T>C	19.37:g.50017180T>C	ENSP00000221466:p.Ser39Pro	286	2		231	64	NM_001136019	0	0	37	58	21	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	T	9.571	1.121014	0.20877	.	.	ENSG00000104870	ENST00000221466;ENST00000426395;ENST00000415900;ENST00000452439	T;T	0.00730	5.77;5.77	4.6	-9.19	0.00685	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	3.212320	0.01032	N	0.004150	T	0.00875	0.0029	L	0.42686	1.345	0.09310	N	1	P	0.36249	0.545	B	0.34652	0.187	T	0.06356	-1.0831	10	0.87932	D	0	.	5.6115	0.17408	0.2613:0.1951:0.46:0.0836	.	39	P55899	FCGRN_HUMAN	P	39	ENSP00000221466:S39P;ENSP00000410798:S39P	ENSP00000221466:S39P	S	+	1	0	FCGRT	54708992	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-4.455000	0.00231	-5.243000	0.00018	-1.310000	0.01310	TCG	.		0.657	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
NCOA1	8648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	24991159	24991159	+	Silent	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:24991159C>T	ENST00000406961.1	+	23	4877	c.4225C>T	c.(4225-4227)Ctg>Ttg	p.L1409L	NCOA1_ENST00000395856.3_Silent_p.L1408L|NCOA1_ENST00000538539.1_3'UTR|NCOA1_ENST00000288599.5_3'UTR|NCOA1_ENST00000405141.1_3'UTR|NCOA1_ENST00000348332.3_Silent_p.L1409L|NCOA1_ENST00000407230.1_3'UTR			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1409					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGACCCTTACCTGAACCAGCC	0.532			T	PAX3	alveolar rhadomyosarcoma																																p.L1409L		.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1-228	0			c.C4225T						.						89.0	90.0	90.0					2																	24991159		2203	4300	6503	SO:0001819	synonymous_variant	8648	exon21			CCTTACCTGAACC	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4225C>T	2.37:g.24991159C>T		159	0		141	27	NM_003743	0	0	2	2	0	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	CCDS1712.1																																																																																			.		0.532	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
RTKN	6242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74657398	74657398	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:74657398A>G	ENST00000233330.6	-	5	693	c.376T>C	c.(376-378)Ttt>Ctt	p.F126L	RTKN_ENST00000484453.1_5'Flank|RTKN_ENST00000272430.5_Missense_Mutation_p.F176L|RTKN_ENST00000305557.5_Missense_Mutation_p.F163L	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						TTGCTCTGAAAGGAGATGTCT	0.562																																					p.F176L		.											.	RTKN-91	0			c.T526C						.						101.0	89.0	93.0					2																	74657398		2203	4300	6503	SO:0001583	missense	6242	exon5			TCTGAAAGGAGAT	AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.376T>C	2.37:g.74657398A>G	ENSP00000233330:p.Phe126Leu	49	0		44	8	NM_001015055	0	0	14	20	6		Missense_Mutation	SNP	ENST00000233330.6	37	CCDS42699.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.037389	0.93630	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	T;T;T	0.53857	0.6;0.6;0.6	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	M	0.81112	2.525	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.74494	-0.3647	10	0.48119	T	0.1	.	12.7658	0.57391	1.0:0.0:0.0:0.0	.	176;163	Q9BST9;Q9BST9-2	RTKN_HUMAN;.	L	163;176;126	ENSP00000305298:F163L;ENSP00000272430:F176L;ENSP00000233330:F126L	ENSP00000233330:F126L	F	-	1	0	RTKN	74510906	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.671000	0.91174	2.111000	0.64477	0.460000	0.39030	TTT	.		0.562	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328236.3	NM_001015055	
SPOPL	339745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	139308572	139308572	+	Silent	SNP	A	A	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:139308572A>G	ENST00000280098.4	+	4	679	c.300A>G	c.(298-300)gcA>gcG	p.A100A		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	100	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AAGTTCGAGCAAAATTCAAAT	0.368																																					p.A100A		.											.	SPOPL-92	0			c.A300G						.						69.0	73.0	72.0					2																	139308572		2203	4299	6502	SO:0001819	synonymous_variant	339745	exon4			TCGAGCAAAATTC		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.300A>G	2.37:g.139308572A>G		103	0		119	32	NM_001001664	0	0	1	1	0		Silent	SNP	ENST00000280098.4	37	CCDS33298.1																																																																																			.		0.368	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1		
KYNU	8942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	143718222	143718222	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:143718222C>G	ENST00000264170.4	+	8	870	c.612C>G	c.(610-612)atC>atG	p.I204M	KYNU_ENST00000375773.2_Missense_Mutation_p.I204M|KYNU_ENST00000409512.1_Missense_Mutation_p.I204M	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TAGAGGATATCCTTGAAGTAA	0.368																																					p.I204M		.											.	KYNU-92	0			c.C612G						.						105.0	106.0	106.0					2																	143718222		2203	4300	6503	SO:0001583	missense	8942	exon9			GGATATCCTTGAA	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.612C>G	2.37:g.143718222C>G	ENSP00000264170:p.Ile204Met	87	0		93	15	NM_001199241	0	0	3	3	0		Missense_Mutation	SNP	ENST00000264170.4	37	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960574	0.53400	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	T;T;T	0.58797	0.31;0.31;0.31	5.35	-0.683	0.11335	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	M	0.93898	3.47	0.80722	D	1	D;D	0.76494	0.975;0.999	D;D	0.85130	0.927;0.997	T	0.72567	-0.4254	10	0.72032	D	0.01	.	6.1677	0.20400	0.123:0.4133:0.0:0.4637	.	204;204	Q16719;Q9BVW3	KYNU_HUMAN;.	M	204	ENSP00000264170:I204M;ENSP00000364928:I204M;ENSP00000386731:I204M	ENSP00000264170:I204M	I	+	3	3	KYNU	143434692	0.998000	0.40836	0.989000	0.46669	0.991000	0.79684	0.528000	0.23002	-0.374000	0.07967	-0.147000	0.13772	ATC	.		0.368	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998	
LY75	4065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160665004	160665004	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:160665004T>C	ENST00000263636.4	-	33	4805	c.4778A>G	c.(4777-4779)aAc>aGc	p.N1593S	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.N1593S|LY75_ENST00000554112.1_Missense_Mutation_p.N1593S|LY75_ENST00000553424.1_Missense_Mutation_p.N1593S|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.N1593S	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1593	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		CATGGTAATGTTATTATTTTC	0.338																																					p.N1593S		.											.	LY75-90	0			c.A4778G						.						224.0	217.0	219.0					2																	160665004		2202	4299	6501	SO:0001583	missense	4065	exon33			GTAATGTTATTAT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4778A>G	2.37:g.160665004T>C	ENSP00000263636:p.Asn1593Ser	80	0		82	21	NM_002349	0	0	2	4	2	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	T	10.94	1.491766	0.26774	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25	5.55	5.55	0.83447	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.242632	0.21380	U	0.075495	T	0.09818	0.0241	L	0.33710	1.025	0.26761	N	0.969999	B;P;D	0.53619	0.082;0.912;0.961	B;P;P	0.52066	0.087;0.574;0.689	T	0.09422	-1.0675	10	0.08381	T	0.77	-17.923	9.2003	0.37254	0.2708:0.0:0.0:0.7292	.	1593;1593;1593	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	S	1593	ENSP00000451511:N1593S;ENSP00000451446:N1593S;ENSP00000263636:N1593S;ENSP00000423463:N1593S;ENSP00000421035:N1593S	ENSP00000423463:N1593S	N	-	2	0	LY75;LY75-CD302	160373250	0.999000	0.42202	0.998000	0.56505	0.984000	0.73092	2.859000	0.48364	2.105000	0.64084	0.402000	0.26972	AAC	.		0.338	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
ABCA12	26154	broad.mit.edu;bcgsc.ca	37	2	215821466	215821466	+	Missense_Mutation	SNP	T	T	C	rs368283339		TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:215821466T>C	ENST00000272895.7	-	42	6373	c.6154A>G	c.(6154-6156)Atc>Gtc	p.I2052V	ABCA12_ENST00000389661.4_Missense_Mutation_p.I1734V|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2052					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATCGCAATGATACCAATTGAA	0.348																																					p.I2052V	Ovarian(66;664 1488 5121 34295)												.	ABCA12-99	0			c.A6154G						.	T	VAL/ILE,VAL/ILE	0,4406		0,0,2203	108.0	107.0	107.0		5200,6154	3.9	1.0	2		107	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ABCA12	NM_015657.3,NM_173076.2	29,29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	1734/2278,2052/2596	215821466	1,13005	2203	4300	6503	SO:0001583	missense	26154	exon42			CAATGATACCAAT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6154A>G	2.37:g.215821466T>C	ENSP00000272895:p.Ile2052Val	116	1		125	5	NM_173076	0	0	3	3	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	0.080	-1.185337	0.01620	0.0	1.16E-4	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.88201	-2.35;-2.35	5.69	3.88	0.44766	.	0.106321	0.41500	N	0.000861	T	0.70824	0.3268	N	0.04148	-0.265	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.60772	-0.7197	10	0.06625	T	0.88	.	8.1764	0.31285	0.0:0.6864:0.0:0.3136	.	2052;1734	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	V	2052;1734	ENSP00000272895:I2052V;ENSP00000374312:I1734V	ENSP00000272895:I2052V	I	-	1	0	ABCA12	215529711	0.996000	0.38824	1.000000	0.80357	0.872000	0.50106	1.295000	0.33377	0.743000	0.32719	-0.242000	0.12053	ATC	.		0.348	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
PCSK2	5126	hgsc.bcm.edu	37	20	17462695	17462695	+	Missense_Mutation	SNP	A	A	G	rs375179104		TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:17462695A>G	ENST00000262545.2	+	12	2212	c.1897A>G	c.(1897-1899)Agc>Ggc	p.S633G	PCSK2_ENST00000377899.1_Missense_Mutation_p.S614G|PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000536609.1_Missense_Mutation_p.S598G	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	633					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGCCTGAAAAGCATCCTTAA	0.587																																					p.S633G		.											.	PCSK2-157	0			c.A1897G						.	A	GLY/SER,GLY/SER,GLY/SER	0,4370		0,0,2185	32.0	28.0	29.0		1840,1792,1897	4.7	1.0	20		29	1,8553		0,1,4276	no	missense,missense,missense	PCSK2	NM_001201528.1,NM_001201529.1,NM_002594.3	56,56,56	0,1,6461	GG,GA,AA		0.0117,0.0,0.0077	benign,benign,benign	614/620,598/604,633/639	17462695	1,12923	2185	4277	6462	SO:0001583	missense	5126	exon12			CTGAAAAGCATCC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1897A>G	20.37:g.17462695A>G	ENSP00000262545:p.Ser633Gly	38	0		47	3	NM_002594	0	0	0	0	0	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017933	0.54576	0.0	1.17E-4	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.72167	-0.44;-0.45;-0.63	5.77	4.67	0.58626	.	0.035091	0.85682	N	0.000000	T	0.71693	0.3370	N	0.22421	0.69	0.58432	D	0.999999	B;B;P	0.52842	0.0;0.005;0.956	B;B;D	0.65010	0.0;0.007;0.931	T	0.73471	-0.3972	10	0.66056	D	0.02	-33.2862	10.6214	0.45483	0.9241:0.0:0.0759:0.0	.	598;614;633	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	G	614;633;598	ENSP00000367131:S614G;ENSP00000262545:S633G;ENSP00000437458:S598G	ENSP00000262545:S633G	S	+	1	0	PCSK2	17410695	1.000000	0.71417	0.976000	0.42696	0.275000	0.26752	7.124000	0.77185	1.005000	0.39183	0.377000	0.23210	AGC	.		0.587	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
CSRP2BP	57325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	18142850	18142850	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:18142850C>G	ENST00000435364.3	+	5	1410	c.1069C>G	c.(1069-1071)Cca>Gca	p.P357A	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.P356A|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.P229A	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	357					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						AGATCTGATTCCAGATGTGAT	0.458																																					p.P357A		.											.	CSRP2BP-525	0			c.C1069G						.						216.0	229.0	224.0					20																	18142850		2203	4300	6503	SO:0001583	missense	57325	exon5			CTGATTCCAGATG	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1069C>G	20.37:g.18142850C>G	ENSP00000392318:p.Pro357Ala	596	0		629	129	NM_020536	0	0	0	0	0	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555785	0.86231	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.43294	0.95;0.95;0.95;0.99	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.55955	0.1953	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.994	T	0.57004	-0.7885	10	0.72032	D	0.01	-20.8382	20.5666	0.99351	0.0:1.0:0.0:0.0	.	229;357	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	A	357;356;357;229	ENSP00000278816:P357A;ENSP00000366909:P356A;ENSP00000392318:P357A;ENSP00000425909:P229A	ENSP00000278816:P357A	P	+	1	0	CSRP2BP	18090850	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	7.364000	0.79526	2.854000	0.98071	0.655000	0.94253	CCA	.		0.458	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
HM13	81502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	30137040	30137040	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:30137040G>A	ENST00000340852.5	+	6	695	c.571G>A	c.(571-573)Gcc>Acc	p.A191T	HM13_ENST00000376127.3_Intron|HM13_ENST00000335574.5_Missense_Mutation_p.A191T|HM13_ENST00000398174.3_Missense_Mutation_p.A191T|HM13_ENST00000492709.1_3'UTR	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13	191					membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTTTGGCCTGGCCTTCTCCCT	0.567																																					p.A191T		.											.	HM13-153	0			c.G571A						.						216.0	199.0	205.0					20																	30137040		2203	4300	6503	SO:0001583	missense	81502	exon6			GGCCTGGCCTTCT	AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.571G>A	20.37:g.30137040G>A	ENSP00000343032:p.Ala191Thr	326	0		349	63	NM_178581	0	0	68	90	22	B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Missense_Mutation	SNP	ENST00000340852.5	37	CCDS13182.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315948	0.81469	.	.	ENSG00000101294	ENST00000335574;ENST00000340852;ENST00000398174	T;T;T	0.21361	2.01;2.01;2.01	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.42359	0.1199	M	0.73962	2.25	0.80722	D	1	P;P;B	0.43519	0.809;0.802;0.338	P;P;B	0.54210	0.745;0.607;0.281	T	0.21314	-1.0249	10	0.48119	T	0.1	-2.7651	17.5166	0.87776	0.0:0.0:1.0:0.0	.	191;191;191	Q8TCT9;Q8TCT9-4;Q8TCT9-2	HM13_HUMAN;.;.	T	191	ENSP00000335294:A191T;ENSP00000343032:A191T;ENSP00000381237:A191T	ENSP00000335294:A191T	A	+	1	0	HM13	29600701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.992000	0.93519	2.604000	0.88044	0.650000	0.86243	GCC	.		0.567	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078527.2	NM_178580	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q		.											.	NCOA6-292	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		56	1		82	6	NM_014071	0	0	7	7	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
CHD6	84181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	40080522	40080522	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:40080522C>G	ENST00000373233.3	-	22	3644	c.3467G>C	c.(3466-3468)tGg>tCg	p.W1156S	CHD6_ENST00000309279.7_Missense_Mutation_p.W639S	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1156					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GATCAGTTCCCAAATGAAACT	0.522																																					p.W1156S		.											.	CHD6-238	0			c.G3467C						.						259.0	206.0	224.0					20																	40080522		2203	4300	6503	SO:0001583	missense	84181	exon22			AGTTCCCAAATGA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.3467G>C	20.37:g.40080522C>G	ENSP00000362330:p.Trp1156Ser	213	0		279	45	NM_032221	0	0	2	3	1	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.899700|4.899700	0.91962|0.91962	.|.	.|.	ENSG00000124177|ENSG00000124177	ENST00000440697|ENST00000373233;ENST00000309279	.|D;D	.|0.98060	.|-4.69;-4.69	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.000000	.|0.56097	.|D	.|0.000033	D|D	0.98801|0.98801	0.9596|0.9596	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.72982	.|0.979	D|D	0.99651|0.99651	1.0991|1.0991	5|10	.|0.87932	.|D	.|0	-10.1751|-10.1751	20.0435|20.0435	0.97601|0.97601	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1156	.|Q8TD26	.|CHD6_HUMAN	R|S	342|1156;639	.|ENSP00000362330:W1156S;ENSP00000308684:W639S	.|ENSP00000308684:W639S	G|W	-|-	1|2	0|0	CHD6|CHD6	39513936|39513936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.776000|7.776000	0.85560|0.85560	2.731000|2.731000	0.93534|0.93534	0.650000|0.650000	0.86243|0.86243	GGG|TGG	.		0.522	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
PARD6B	84612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49367023	49367023	+	Nonstop_Mutation	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:49367023T>C	ENST00000371610.2	+	3	1360	c.1117T>C	c.(1117-1119)Tga>Cga	p.*373R	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	0					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						CATAACATTATGAAACCGTGG	0.398																																					p.X373R		.											.	PARD6B-91	0			c.T1117C						.						35.0	34.0	34.0					20																	49367023		2202	4298	6500	SO:0001578	stop_lost	84612	exon3			ACATTATGAAACC	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.1117T>C	20.37:g.49367023T>C	ENSP00000360672:p.*373Argext*13	59	0		62	11	NM_032521	0	0	2	3	1	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	37	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.695570	0.30052	.	.	ENSG00000124171	ENST00000371610	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5383	0.76021	0.0:0.0:0.0:1.0	.	.	.	.	R	373	.	.	X	+	1	0	PARD6B	48800430	1.000000	0.71417	0.503000	0.27626	0.446000	0.32137	6.377000	0.73145	2.073000	0.62155	0.482000	0.46254	TGA	.		0.398	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
ZNF512B	57473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62648174	62648174	+	Intron	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr20:62648174T>C	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Silent_p.H541H			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ATCGGAAGCATACCTGGATGG	0.552																																					p.H541H		.											.	PRPF6-70	0			c.T1623C						.						183.0	150.0	161.0					20																	62648174		2203	4300	6503	SO:0001627	intron_variant	24148	exon12			GAAGCATACCTGG	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+31883A>G	20.37:g.62648174T>C		80	2		77	13	NM_012469	0	0	21	30	9	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.552	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	38159473	38159473	+	Silent	SNP	A	A	G	rs201702862		TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr3:38159473A>G	ENST00000308059.6	+	33	4683	c.4662A>G	c.(4660-4662)tcA>tcG	p.S1554S	DLEC1_ENST00000346219.3_Silent_p.S1554S|DLEC1_ENST00000452631.2_Silent_p.S1557S					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AGACAGCCTCAGCGGACAAGC	0.612											OREG0015476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	a|||	1	0.000199681	0.0	0.0	5008	,	,		20227	0.001		0.0	False		,,,				2504	0.0				p.S1554S		.											.	DLEC1-161	0			c.A4662G						.						38.0	47.0	44.0					3																	38159473		2188	4287	6475	SO:0001819	synonymous_variant	9940	exon33			AGCCTCAGCGGAC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.4662A>G	3.37:g.38159473A>G		32	0	876	23	5	NM_007337	0	0	0	0	0		Silent	SNP	ENST00000308059.6	37	CCDS2672.2																																																																																			A|0.999;G|0.000		0.612	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
RGS12	6002	hgsc.bcm.edu;broad.mit.edu	37	4	3441324	3441324	+	Silent	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr4:3441324T>C	ENST00000344733.5	+	18	5161	c.4257T>C	c.(4255-4257)ccT>ccC	p.P1419P	RGS12_ENST00000338806.4_Silent_p.P771P|HGFAC_ENST00000382774.3_5'Flank|HGFAC_ENST00000511533.1_5'Flank	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1419					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTGGTGGGCCTCCTACATCAG	0.677																																					p.P1419P		.											.	RGS12-226	0			c.T4257C						.						29.0	28.0	28.0					4																	3441324		2201	4296	6497	SO:0001819	synonymous_variant	6002	exon18			TGGGCCTCCTACA	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.4257T>C	4.37:g.3441324T>C		35	0		39	8	NM_198229	0	0	3	3	0	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	CCDS3366.1																																																																																			.		0.677	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
CCNG2	901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	78082688	78082688	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr4:78082688C>T	ENST00000316355.5	+	5	939	c.583C>T	c.(583-585)Cga>Tga	p.R195*	CCNG2_ENST00000395640.1_Nonsense_Mutation_p.R195*|CCNG2_ENST00000354403.5_Nonsense_Mutation_p.R195*|CCNG2_ENST00000509972.1_Nonsense_Mutation_p.R195*|CCNG2_ENST00000502280.1_Nonsense_Mutation_p.R195*|CCNG2_ENST00000497512.1_3'UTR	NM_004354.2	NP_004345.1	Q16589	CCNG2_HUMAN	cyclin G2	195					cell cycle checkpoint (GO:0000075)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TTGCAACTGCCGACTCATCTT	0.294																																					p.R195X		.											.	CCNG2-416	0			c.C583T						.						52.0	59.0	57.0					4																	78082688		2202	4300	6502	SO:0001587	stop_gained	901	exon5			AACTGCCGACTCA	BC032518	CCDS3581.1	4q21.22	2009-05-07			ENSG00000138764	ENSG00000138764			1593	protein-coding gene	gene with protein product		603203				8806701	Standard	NM_004354		Approved		uc003hkq.4	Q16589	OTTHUMG00000130100	ENST00000316355.5:c.583C>T	4.37:g.78082688C>T	ENSP00000315743:p.Arg195*	64	0		57	9	NM_004354	0	0	10	10	0	B4DF25|Q6FGA7|Q6FGC6	Nonsense_Mutation	SNP	ENST00000316355.5	37	CCDS3581.1	.	.	.	.	.	.	.	.	.	.	C	38	6.688916	0.97764	.	.	ENSG00000138764	ENST00000316355;ENST00000354403;ENST00000502280;ENST00000395640;ENST00000509972	.	.	.	5.52	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.4327	15.8563	0.78979	0.1366:0.8634:0.0:0.0	.	.	.	.	X	195	.	ENSP00000315743:R195X	R	+	1	2	CCNG2	78301712	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.923000	0.48868	1.331000	0.45412	-0.152000	0.13540	CGA	.		0.294	CCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252404.3	NM_004354	
SYNPO2	171024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	119952706	119952706	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr4:119952706A>T	ENST00000429713.2	+	4	2958	c.2776A>T	c.(2776-2778)Aat>Tat	p.N926Y	SYNPO2_ENST00000307142.4_Missense_Mutation_p.N926Y|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Missense_Mutation_p.N926Y	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	926						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGTGGCCTATAATCCTATCCA	0.572																																					p.N926Y		.											.	SYNPO2-92	0			c.A2776T						.						87.0	82.0	84.0					4																	119952706		2203	4300	6503	SO:0001583	missense	171024	exon4			GCCTATAATCCTA	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2776A>T	4.37:g.119952706A>T	ENSP00000395143:p.Asn926Tyr	128	0		108	30	NM_001128934	0	0	0	0	0	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.960913|3.960913	0.74016|0.74016	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.15017|.	2.46;2.58;2.46|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|.	0.77239|.	0.4101|.	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.997|.	D;D;D;D|.	0.91635|.	0.998;0.999;0.997;0.991|.	T|.	0.78874|.	-0.2032|.	9|.	.|.	.|.	.|.	-24.3416|-24.3416	15.8861|15.8861	0.79251|0.79251	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	926;926;926;926|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	Y|L	926|877	ENSP00000306015:N926Y;ENSP00000395143:N926Y;ENSP00000390965:N926Y|.	.|.	N|X	+|+	1|2	0|2	SYNPO2|SYNPO2	120172154|120172154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.913000|0.913000	0.54294|0.54294	9.339000|9.339000	0.96797|0.96797	2.156000|2.156000	0.67533|0.67533	0.533000|0.533000	0.62120|0.62120	AAT|TAA	.		0.572	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
MAML3	55534	hgsc.bcm.edu	37	4	140811126	140811126	+	Silent	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr4:140811126C>T	ENST00000509479.2	-	2	2320	c.1464G>A	c.(1462-1464)caG>caA	p.Q488Q	MAML3_ENST00000398940.1_Silent_p.Q27Q|MAML3_ENST00000327122.5_Silent_p.Q332Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgttgctgttgctgtt	0.547																																					p.Q488Q		.											.	MAML3-455	0			c.G1464A						.						17.0	20.0	19.0					4																	140811126		2194	4294	6488	SO:0001819	synonymous_variant	55534	exon2			CTGTTGCTGTTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1464G>A	4.37:g.140811126C>T		34	1		28	2	NM_018717	0	0	0	0	0		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.547	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
ANKRD32	84250	broad.mit.edu	37	5	94030836	94030836	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr5:94030836C>A	ENST00000265140.5	+	21	3415	c.2996C>A	c.(2995-2997)aCc>aAc	p.T999N	ANKRD32_ENST00000493934.1_Intron	NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	999						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		CATAAAGAAACCACCAGTGTT	0.348																																					p.T999N													.	ANKRD32-92	0			c.C2996A						.						66.0	67.0	67.0					5																	94030836		2203	4299	6502	SO:0001583	missense	84250	exon21			AAGAAACCACCAG	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2996C>A	5.37:g.94030836C>A	ENSP00000265140:p.Thr999Asn	49	4		59	14	NM_032290	0	0	0	0	0	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356986	0.24598	.	.	ENSG00000133302	ENST00000265140	T	0.40476	1.03	5.46	4.54	0.55810	.	0.441905	0.22207	N	0.063146	T	0.27489	0.0675	N	0.24115	0.695	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.07770	-1.0755	10	0.31617	T	0.26	.	10.5297	0.44969	0.1322:0.6385:0.2293:0.0	.	999	Q9BQI6	ANR32_HUMAN	N	999	ENSP00000265140:T999N	ENSP00000265140:T999N	T	+	2	0	ANKRD32	94056592	0.001000	0.12720	0.978000	0.43139	0.992000	0.81027	1.019000	0.30014	2.579000	0.87056	0.591000	0.81541	ACC	.		0.348	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
FTMT	94033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	121188229	121188229	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr5:121188229G>A	ENST00000321339.1	+	1	580	c.571G>A	c.(571-573)Gat>Aat	p.D191N		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	191	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CCATTTGTGCGATTTCCTGGA	0.507																																					p.D191N		.											.	FTMT-91	0			c.G571A						.						133.0	130.0	131.0					5																	121188229		2203	4300	6503	SO:0001583	missense	94033	exon1			TTGTGCGATTTCC	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.571G>A	5.37:g.121188229G>A	ENSP00000313691:p.Asp191Asn	237	0		217	55	NM_177478	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321339.1	37	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316794	0.81469	.	.	ENSG00000181867	ENST00000321339	T	0.70516	-0.49	3.39	3.39	0.38822	Ferritin/ribonucleotide reductase-like (1);Ferritin, conserved site (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.000000	0.85682	D	0.000000	T	0.78253	0.4254	M	0.67700	2.07	0.58432	D	0.999999	P	0.52577	0.954	P	0.57548	0.823	T	0.81355	-0.0970	10	0.72032	D	0.01	.	13.0805	0.59112	0.0:0.0:1.0:0.0	.	191	Q8N4E7	FTMT_HUMAN	N	191	ENSP00000313691:D191N	ENSP00000313691:D191N	D	+	1	0	FTMT	121216128	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.967000	0.93402	2.185000	0.69588	0.609000	0.83330	GAT	.		0.507	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
TRIM52	84851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	180687083	180687083	+	Silent	SNP	G	G	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr5:180687083G>T	ENST00000327767.4	-	1	1036	c.732C>A	c.(730-732)gcC>gcA	p.A244A	CTC-338M12.4_ENST00000417281.2_RNA|CTC-338M12.4_ENST00000506340.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA|TRIM52_ENST00000514805.1_5'UTR|CTC-338M12.4_ENST00000511331.1_RNA|CTC-338M12.4_ENST00000505151.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	244					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		CCACACAGATGGCCTCTTTGT	0.537																																					p.A244A		.											.	TRIM52-90	0			c.C732A						.						135.0	129.0	131.0					5																	180687083		2203	4300	6503	SO:0001819	synonymous_variant	84851	exon1			ACAGATGGCCTCT		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.732C>A	5.37:g.180687083G>T		257	0		155	39	NM_032765	0	0	1	2	1		Silent	SNP	ENST00000327767.4	37	CCDS4467.1																																																																																			.		0.537	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765	
MEOX2	4223	hgsc.bcm.edu	37	7	15725794	15725794	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:15725794G>C	ENST00000262041.5	-	1	643	c.234C>G	c.(232-234)caC>caG	p.H78Q	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	78	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		gctgatggtggtgatggtggt	0.622																																					p.H78Q	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											.	MEOX2-515	0			c.C234G						.						21.0	22.0	22.0					7																	15725794		2203	4300	6503	SO:0001583	missense	4223	exon1			ATGGTGGTGATGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.234C>G	7.37:g.15725794G>C	ENSP00000262041:p.His78Gln	16	2		13	3	NM_005924	0	0	0	0	0	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	CCDS34605.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.261308	0.23051	.	.	ENSG00000106511	ENST00000262041	D	0.90133	-2.62	5.33	-0.657	0.11432	.	0.000000	0.64402	D	0.000002	T	0.81856	0.4911	L	0.44542	1.39	0.38139	D	0.938398	B	0.09022	0.002	B	0.04013	0.001	T	0.68911	-0.5284	10	0.02654	T	1	-15.7329	11.015	0.47682	0.5519:0.0:0.4481:0.0	.	78	P50222	MEOX2_HUMAN	Q	78	ENSP00000262041:H78Q	ENSP00000262041:H78Q	H	-	3	2	MEOX2	15692319	0.956000	0.32656	0.998000	0.56505	0.962000	0.63368	0.018000	0.13422	-0.067000	0.12976	0.655000	0.94253	CAC	.		0.622	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MEOX2	4223	hgsc.bcm.edu	37	7	15725809	15725809	+	Silent	SNP	G	G	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:15725809G>A	ENST00000262041.5	-	1	628	c.219C>T	c.(217-219)caC>caT	p.H73H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	73	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtggtggtggtggtggt	0.597																																					p.H73H	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											.	MEOX2-515	0			c.C219T						.						22.0	23.0	23.0					7																	15725809		2203	4299	6502	SO:0001819	synonymous_variant	4223	exon1			GTGGTGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.219C>T	7.37:g.15725809G>A		16	2		17	8	NM_005924	0	0	0	0	0	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	CCDS34605.1																																																																																			.		0.597	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
DDX56	54606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44607797	44607797	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:44607797T>G	ENST00000258772.5	-	12	1515	c.1409A>C	c.(1408-1410)gAc>gCc	p.D470A	DDX56_ENST00000431640.1_Missense_Mutation_p.D430A|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	470					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						CAGCTGGAGGTCCCTAGGGTT	0.567																																					p.D470A		.											.	DDX56-227	0			c.A1409C						.						80.0	76.0	77.0					7																	44607797		2203	4300	6503	SO:0001583	missense	54606	exon12			TGGAGGTCCCTAG	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.1409A>C	7.37:g.44607797T>G	ENSP00000258772:p.Asp470Ala	57	0		53	9	NM_019082	0	0	19	32	13	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	27.7	4.856346	0.91355	.	.	ENSG00000136271	ENST00000258772;ENST00000431640;ENST00000448192	T;T	0.07908	3.19;3.15	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.34658	0.0905	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.26608	-1.0098	10	0.62326	D	0.03	-35.5767	13.7285	0.62771	0.0:0.0:0.0:1.0	.	430;470	C9JV95;Q9NY93	.;DDX56_HUMAN	A	470;430;75	ENSP00000258772:D470A;ENSP00000393488:D430A	ENSP00000258772:D470A	D	-	2	0	DDX56	44574322	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.924000	0.75823	2.137000	0.66172	0.533000	0.62120	GAC	.		0.567	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	103234873	103234873	+	Silent	SNP	G	G	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:103234873G>C	ENST00000428762.1	-	26	3765	c.3606C>G	c.(3604-3606)ccC>ccG	p.P1202P	RELN_ENST00000424685.2_Silent_p.P1202P|RELN_ENST00000343529.5_Silent_p.P1202P	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1202					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTGAGAACACGGGCTGCCACC	0.488																																					p.P1202P	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.C3606G						.						182.0	181.0	181.0					7																	103234873		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon26			GAACACGGGCTGC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3606C>G	7.37:g.103234873G>C		334	0		341	22	NM_173054	0	0	1	1	0	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.488	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
CFTR	1080	hgsc.bcm.edu	37	7	117174330	117174330	+	Splice_Site	SNP	A	A	G	rs200885306		TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:117174330A>G	ENST00000003084.6	+	5	622	c.490A>G	c.(490-492)Act>Gct	p.T164A	CFTR_ENST00000454343.1_Splice_Site_p.T164A	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	164	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTTCTTTTAGACTTTAAAGCT	0.264									Cystic Fibrosis																												p.T164A		.											.	CFTR-518	0			c.A490G						.	A	ALA/THR	0,4404		0,0,2202	53.0	51.0	52.0		490	5.5	1.0	7		52	2,8594	2.2+/-6.3	0,2,4296	yes	missense-near-splice	CFTR	NM_000492.3	58	0,2,6498	GG,GA,AA		0.0233,0.0,0.0154	benign	164/1481	117174330	2,12998	2202	4298	6500	SO:0001630	splice_region_variant	1080	exon5	Familial Cancer Database	CF	TTTTAGACTTTAA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.490-1A>G	7.37:g.117174330A>G		35	0		40	2	NM_000492	0	0	0	0	0	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.462862	0.26248	0.0	2.33E-4	ENSG00000001626	ENST00000003084;ENST00000454343	D;D	0.91237	-2.81;-2.81	5.5	5.5	0.81552	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.044119	0.85682	D	0.000000	D	0.84768	0.5545	N	0.11724	0.165	0.58432	D	0.999999	B	0.18968	0.032	B	0.35859	0.212	T	0.79509	-0.1774	9	.	.	.	-21.6143	15.9153	0.79512	1.0:0.0:0.0:0.0	.	164	P13569	CFTR_HUMAN	A	164	ENSP00000003084:T164A;ENSP00000403677:T164A	.	T	+	1	0	CFTR	116961566	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.628000	0.90979	2.213000	0.71641	0.477000	0.44152	ACT	.		0.264	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	Missense_Mutation
CPED1	79974	hgsc.bcm.edu	37	7	120655879	120655879	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:120655879T>C	ENST00000310396.5	+	3	877	c.410T>C	c.(409-411)cTa>cCa	p.L137P	CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000450913.2_Missense_Mutation_p.L137P|CPED1_ENST00000340646.5_Missense_Mutation_p.L137P	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	137						endoplasmic reticulum (GO:0005783)											AATGCTGGCCTAGGGCCGGGG	0.448																																					p.L137P		.											.	.	0			c.T410C						.						60.0	48.0	52.0					7																	120655879		2203	4300	6503	SO:0001583	missense	79974	exon2			CTGGCCTAGGGCC		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.410T>C	7.37:g.120655879T>C	ENSP00000309772:p.Leu137Pro	40	0		36	2	NM_001105533	0	0	0	0	0	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	T	3.706	-0.060530	0.07317	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000340646	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.84	-3.37	0.04898	.	1.302160	0.04994	N	0.467807	T	0.26340	0.0643	N	0.20401	0.57	0.19775	N	0.999959	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.003	T	0.25152	-1.0140	10	0.48119	T	0.1	.	6.7639	0.23556	0.0:0.3864:0.1286:0.485	.	137;137	A4D0V7-2;A4D0V7	.;CG058_HUMAN	P	137	ENSP00000309772:L137P;ENSP00000398082:L137P;ENSP00000406122:L137P;ENSP00000345235:L137P	ENSP00000309772:L137P	L	+	2	0	C7orf58	120443115	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.173000	0.09854	-0.867000	0.04063	0.482000	0.46254	CTA	.		0.448	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
PRSS55	203074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	10388999	10388999	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr8:10388999C>G	ENST00000328655.3	+	3	582	c.542C>G	c.(541-543)cCc>cGc	p.P181R	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Missense_Mutation_p.P181R	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	181	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						CCCACGCAGCCCGGCCCTGCC	0.587																																					p.P181R		.											.	PRSS55-91	0			c.C542G						.						70.0	64.0	66.0					8																	10388999		2203	4300	6503	SO:0001583	missense	203074	exon3			CGCAGCCCGGCCC	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.542C>G	8.37:g.10388999C>G	ENSP00000333003:p.Pro181Arg	110	0		102	11	NM_001197020	0	0	0	0	0	E5RJX5	Missense_Mutation	SNP	ENST00000328655.3	37	CCDS5976.1	.	.	.	.	.	.	.	.	.	.	C	5.554	0.287080	0.10513	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	D;D	0.88509	-2.39;-2.39	4.79	-3.88	0.04205	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.401620	0.05168	N	0.499078	T	0.71256	0.3318	N	0.11427	0.14	0.09310	N	1	B	0.31256	0.316	B	0.28553	0.091	T	0.62210	-0.6902	10	0.16896	T	0.51	.	1.6522	0.02774	0.3222:0.3223:0.2083:0.1472	.	181	Q6UWB4	PRS55_HUMAN	R	181	ENSP00000333003:P181R;ENSP00000430459:P181R	ENSP00000333003:P181R	P	+	2	0	PRSS55	10426409	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.518000	0.06267	-0.898000	0.03906	-2.547000	0.00178	CCC	.		0.587	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
TRHR	7201	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	110131438	110131438	+	Silent	SNP	G	G	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr8:110131438G>A	ENST00000518632.1	+	3	1302	c.951G>A	c.(949-951)ccG>ccA	p.P317P	TRHR_ENST00000311762.2_Silent_p.P317P			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	317					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CCATCAACCCGGTGATTTACA	0.438																																					p.P317P		.											.	TRHR-620	0			c.G951A						.						214.0	212.0	213.0					8																	110131438		2203	4299	6502	SO:0001819	synonymous_variant	7201	exon2			CAACCCGGTGATT		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.951G>A	8.37:g.110131438G>A		250	2		333	67	NM_003301	0	0	0	0	0	Q2M339	Silent	SNP	ENST00000518632.1	37	CCDS6311.1																																																																																			.		0.438	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	139790649	139790649	+	Splice_Site	SNP	C	C	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr8:139790649C>T	ENST00000303045.6	-	15	2151	c.1705G>A	c.(1705-1707)Ggg>Agg	p.G569R	COL22A1_ENST00000435777.1_Splice_Site_p.G569R	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	569	Collagen-like 3.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCTTGGGGCCCCTGCAGAAGA	0.572										HNSCC(7;0.00092)																											p.G569R		.											.	COL22A1-103	0			c.G1705A						.						41.0	46.0	44.0					8																	139790649		2203	4300	6503	SO:0001630	splice_region_variant	169044	exon15			GGGGCCCCTGCAG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1705-1G>A	8.37:g.139790649C>T		55	0		59	21	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	5.522	0.281168	0.10458	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000522546	D;D;D	0.99488	-5.77;-3.26;-6.0	4.97	3.15	0.36227	.	0.000000	0.48286	U	0.000185	D	0.99127	0.9699	H	0.96633	3.855	0.44966	D	0.997988	B	0.20052	0.041	B	0.26202	0.067	D	0.99679	1.0998	10	0.72032	D	0.01	.	6.7777	0.23628	0.0:0.7264:0.1791:0.0945	.	569	Q8NFW1	COMA1_HUMAN	R	569;569;19	ENSP00000303153:G569R;ENSP00000387655:G569R;ENSP00000428244:G19R	ENSP00000303153:G569R	G	-	1	0	COL22A1	139859831	1.000000	0.71417	0.962000	0.40283	0.102000	0.19082	3.260000	0.51523	0.791000	0.33826	-0.176000	0.13171	GGG	.		0.572	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	Missense_Mutation
UHRF2	115426	hgsc.bcm.edu	37	9	6493920	6493920	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr9:6493920C>G	ENST00000276893.5	+	10	1760	c.1592C>G	c.(1591-1593)aCa>aGa	p.T531R	UHRF2_ENST00000485617.2_3'UTR	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	531	Methyl-CpG binding and interaction with HDAC1.|YDG. {ECO:0000255|PROSITE- ProRule:PRU00358}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		CAAACATTAACAAACATGAAC	0.373																																					p.T531R		.											.	UHRF2-721	0			c.C1592G						.						71.0	63.0	66.0					9																	6493920		2203	4300	6503	SO:0001583	missense	115426	exon10			CATTAACAAACAT	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.1592C>G	9.37:g.6493920C>G	ENSP00000276893:p.Thr531Arg	54	0		37	2	NM_152896	0	0	0	0	0	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	37	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683378	0.88542	.	.	ENSG00000147854	ENST00000276893	D	0.86366	-2.11	5.27	5.27	0.74061	SRA-YDG (4);	0.000000	0.85682	D	0.000000	D	0.94082	0.8103	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	D	0.94545	0.7748	10	0.66056	D	0.02	-10.3302	18.8971	0.92427	0.0:1.0:0.0:0.0	.	308;531	B3KV82;Q96PU4	.;UHRF2_HUMAN	R	531	ENSP00000276893:T531R	ENSP00000276893:T531R	T	+	2	0	UHRF2	6483920	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.704000	0.84595	2.475000	0.83589	0.591000	0.81541	ACA	.		0.373	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306	
ANKS6	203286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	101533259	101533259	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr9:101533259A>T	ENST00000353234.4	-	10	1938	c.1891T>A	c.(1891-1893)Ttc>Atc	p.F631I	ANKS6_ENST00000375018.1_Missense_Mutation_p.F631I|ANKS6_ENST00000540940.1_Missense_Mutation_p.F436I|ANKS6_ENST00000375019.2_Missense_Mutation_p.F330I			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	631	Ser-rich.					cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GAGTGGTTGAAGTTTCCAGAA	0.582																																					p.F631I		.											.	ANKS6-92	0			c.T1891A						.						51.0	57.0	55.0					9																	101533259		1872	4107	5979	SO:0001583	missense	203286	exon10			GGTTGAAGTTTCC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1891T>A	9.37:g.101533259A>T	ENSP00000297837:p.Phe631Ile	56	0		56	13	NM_173551	0	0	0	1	1	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	37	CCDS43856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.4|20.4	3.990515|3.990515	0.74589|0.74589	.|.	.|.	ENSG00000165138|ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940|ENST00000444472	T;T;T;T|.	0.70045|.	1.72;-0.45;-0.45;1.97|.	5.76|5.76	4.61|4.61	0.57282|0.57282	.|.	0.212682|.	0.51477|.	D|.	0.000093|.	T|T	0.62380|0.62380	0.2423|0.2423	L|L	0.56769|0.56769	1.78|1.78	0.43617|0.43617	D|D	0.995998|0.995998	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.83275|.	0.996;0.991|.	T|T	0.59215|0.59215	-0.7496|-0.7496	10|5	0.36615|.	T|.	0.2|.	-12.8842|-12.8842	11.2813|11.2813	0.49197|0.49197	0.8468:0.1532:0.0:0.0|0.8468:0.1532:0.0:0.0	.|.	631;631|.	Q68DC2-4;Q68DC2|.	.;ANKS6_HUMAN|.	I|H	330;631;631;436|99	ENSP00000364159:F330I;ENSP00000364158:F631I;ENSP00000297837:F631I;ENSP00000442189:F436I|.	ENSP00000297837:F631I|.	F|L	-|-	1|2	0|0	ANKS6|ANKS6	100573080|100573080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.549000|0.549000	0.35272|0.35272	5.521000|5.521000	0.67086|0.67086	0.994000|0.994000	0.38892|0.38892	-0.648000|-0.648000	0.03929|0.03929	TTC|CTT	.		0.582	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
ALG2	85365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	101980774	101980774	+	Silent	SNP	G	G	A			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr9:101980774G>A	ENST00000476832.1	-	2	754	c.693C>T	c.(691-693)atC>atT	p.I231I	ALG2_ENST00000319033.6_Silent_p.I138I	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				CGTATCTGTTGATGGAGAGCA	0.463																																					p.I231I		.											.	ALG2-92	0			c.C693T						.						124.0	124.0	124.0					9																	101980774		2203	4300	6503	SO:0001819	synonymous_variant	85365	exon2			TCTGTTGATGGAG	AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.693C>T	9.37:g.101980774G>A		127	0		98	25	NM_033087	0	0	5	5	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Silent	SNP	ENST00000476832.1	37	CCDS6739.1																																																																																			.		0.463	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
EDA	1896	hgsc.bcm.edu	37	X	69243092	69243092	+	Splice_Site	SNP	G	G	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chrX:69243092G>C	ENST00000374552.4	+	3	768		c.e3+1		EDA_ENST00000524573.1_Splice_Site|EDA_ENST00000374553.2_Splice_Site|MIR676_ENST00000390702.2_RNA	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A						cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						AAGAAAAAGGGTAAGTTCCTG	0.264																																					.		.											.	EDA-195	0			c.526+1G>C						.						38.0	35.0	36.0					X																	69243092		2196	4292	6488	SO:0001630	splice_region_variant	1896	exon3			AAAAGGGTAAGTT	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.526+1G>C	X.37:g.69243092G>C		17	0		19	2	NM_001399	0	0	0	0	0	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Splice_Site	SNP	ENST00000374552.4	37	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381525	0.42207	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573;ENST00000503592	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7627	0.62977	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EDA	69159817	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	4.821000	0.62679	2.348000	0.79779	0.513000	0.50165	.	.		0.264	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399	Intron
BHLHB9	80823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	102004858	102004858	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chrX:102004858G>C	ENST00000372735.1	+	4	1520	c.935G>C	c.(934-936)tGt>tCt	p.C312S	BHLHB9_ENST00000448867.1_Missense_Mutation_p.C312S|BHLHB9_ENST00000457056.1_Missense_Mutation_p.C312S|BHLHB9_ENST00000447531.1_Missense_Mutation_p.C312S|BHLHB9_ENST00000361229.4_Missense_Mutation_p.C312S			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	312					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CCATTTGCTTGTCCTTGCAAA	0.398																																					p.C312S		.											.	BHLHB9-132	0			c.G935C						.						93.0	85.0	88.0					X																	102004858		2203	4300	6503	SO:0001583	missense	80823	exon2			TTGCTTGTCCTTG	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.935G>C	X.37:g.102004858G>C	ENSP00000361820:p.Cys312Ser	67	0		62	19	NM_001142530	0	0	1	1	0	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084883	0.55861	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	4.68	4.68	0.58851	Armadillo-type fold (1);	0.000000	0.51477	D	0.000090	T	0.47857	0.1468	L	0.52905	1.665	0.33452	D	0.583863	D	0.89917	1.0	D	0.91635	0.999	T	0.57118	-0.7866	9	.	.	.	-17.5444	11.7841	0.52032	0.0:0.0:1.0:0.0	.	312	Q6PI77	BHLH9_HUMAN	S	312	ENSP00000403226:C312S;ENSP00000354675:C312S;ENSP00000405893:C312S;ENSP00000391722:C312S;ENSP00000361820:C312S	.	C	+	2	0	BHLHB9	101891514	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.642000	0.54367	2.557000	0.86248	0.594000	0.82650	TGT	.		0.398	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
SLC17A6	57084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	22363111	22363112	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr11:22363111_22363112delGA	ENST00000263160.3	+	2	561_562	c.124_125delGA	c.(124-126)gagfs	p.E42fs		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	42					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GGAGACAATCGAGCTGACGGAG	0.649																																					p.42_42del		.											.	SLC17A6-580	0			c.124_125del						.																																			SO:0001589	frameshift_variant	57084	exon2			.	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.124_125delGA	11.37:g.22363111_22363112delGA	ENSP00000263160:p.Glu42fs	113	0		112	17	NM_020346	0	0	0	0	0	A6NKS2	Frame_Shift_Del	DEL	ENST00000263160.3	37	CCDS7856.1																																																																																			.		0.649	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
MORN3	283385	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	122107353	122107353	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr12:122107353delG	ENST00000355329.3	-	1	207	c.37delC	c.(37-39)ctgfs	p.L13fs		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	13						nucleus (GO:0005634)				breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CCCTTCCACAGGGACTCCGAC	0.602																																					p.L13fs		.											.	MORN3-90	0			c.37delC						.						126.0	115.0	119.0					12																	122107353		2203	4300	6503	SO:0001589	frameshift_variant	283385	exon1			.	BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.37delC	12.37:g.122107353delG	ENSP00000347486:p.Leu13fs	203	0		236	42	NM_173855	0	0	0	0	0	Q86YQ9	Frame_Shift_Del	DEL	ENST00000355329.3	37	CCDS31917.1																																																																																			.		0.602	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402154.1	NM_173855	
APOB	338	broad.mit.edu	37	2	21266775	21266783	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs17240441	byFrequency	TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	GCAGCGCCA	GCAGCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:21266775_21266783delGCAGCGCCA	ENST00000233242.1	-	1	162_170	c.35_43delTGGCGCTGC	c.(34-45)ctggcgctgcct>cct	p.LAL12del	APOB_ENST00000399256.4_In_Frame_Del_p.LAL12del	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	12			Missing. {ECO:0000269|PubMed:22095935}.	Missing (in Ref. 5; AAB60718/CAA28420). {ECO:0000305}.	artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					agcagcgcaggcagcgccagcagcgccag	0.794														1108	0.221246	0.202	0.3271	5008	,	,		8689	0.1815		0.3012	False		,,,				2504	0.1309				p.12_15del													.	APOB-175	0			c.35_43del	GRCh37	CD068106	APOB	D	rs17240441	.			24,258		10,4,127						-3.0	0.0		dbSNP_123	1	109,613		53,3,305	no	coding	APOB	NM_000384.2		63,7,432	A1A1,A1R,RR		15.097,8.5106,13.247				133,871				SO:0001651	inframe_deletion	338	exon1			GCGCAGGCAGCGC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.35_43delTGGCGCTGC	2.37:g.21266784_21266792delGCAGCGCCA	ENSP00000233242:p.Leu12_Leu14del	3	0		8	3	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	In_Frame_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.794	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
FKBP9	11328	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	33014881	33014881	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr7:33014881delC	ENST00000242209.4	+	3	624	c.455delC	c.(454-456)accfs	p.T152fs	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538336.1_Frame_Shift_Del_p.T205fs|FKBP9_ENST00000538443.1_Frame_Shift_Del_p.T14fs	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	152					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			CAGATTCACACCTATTTCAAG	0.468																																					p.T152fs		.											.	FKBP9-651	0			c.455delC						.						114.0	103.0	107.0					7																	33014881		2203	4300	6503	SO:0001589	frameshift_variant	11328	exon3			.	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.455delC	7.37:g.33014881delC	ENSP00000242209:p.Thr152fs	111	0		95	17	NM_007270	0	0	0	0	0	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Frame_Shift_Del	DEL	ENST00000242209.4	37	CCDS5439.1																																																																																			.		0.468	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
GPATCH11	253635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37319335	37319336	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-A4-7286-01A-11D-2136-08	TCGA-A4-7286-10A-01D-2136-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ab0f9d3-99a7-4bcc-9b8e-643a30a9979c	08ec176f-4bd6-4128-97b3-ea6aa610eeb9	g.chr2:37319335_37319336AA>CT	ENST00000608836.1	+	6	610_611	c.465_466AA>CT	c.(463-468)gaAAtg>gaCTtg	p.155_156EM>DL	GPATCH11_ENST00000281932.5_Missense_Mutation_p.52_53EM>DL|GPATCH11_ENST00000409774.1_Missense_Mutation_p.181_182EM>DL	NM_174931.2	NP_777591.3	Q8N954	GPT11_HUMAN	G patch domain containing 11	155							nucleic acid binding (GO:0003676)										AGCAAGATGAAATGAAGCTAGA	0.361																																					p.EM155DL		.											.	.	0			c.A466T						.																																			SO:0001583	missense	253635	exon6			GATGAAATGAAGC	AK095667	CCDS1785.2, CCDS62891.1, CCDS1785.3	2p22.2	2013-11-05	2013-01-28	2013-01-28	ENSG00000152133	ENSG00000152133		"""G patch domain containing"""	26768	protein-coding gene	gene with protein product	"""centromere protein Y"""		"""coiled-coil domain containing 75"""	CCDC75			Standard	NM_001278505		Approved	FLJ38348, CENPY, CENP-Y	uc010ezz.3	Q8N954	OTTHUMG00000128469	Exception_encountered	2.37:g.37319335_37319336delinsCT	ENSP00000476383:p.E155_M156delinsDL	28.0	0.0		28.0	9.0		0	0	0	0	0	A8K0D9|B7Z2G4|B8ZZ44	Missense_Mutation	DNP	ENST00000608836.1	37	CCDS1785.2																																																																																			.		0.361	GPATCH11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_174931	
