#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	8674682	8674682	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:8674682A>T	ENST00000337907.3	-	5	1094	c.460T>A	c.(460-462)Tct>Act	p.S154T	RERE_ENST00000400907.2_Missense_Mutation_p.S154T|RERE_ENST00000400908.2_Missense_Mutation_p.S154T	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	154	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		ACCGGCAGAGAGCATGCTGGG	0.498																																					p.S154T		.											.	RERE-515	0			c.T460A						.						77.0	86.0	83.0					1																	8674682		2203	4300	6503	SO:0001583	missense	473	exon5			GCAGAGAGCATGC	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.460T>A	1.37:g.8674682A>T	ENSP00000338629:p.Ser154Thr	217	0		183	57	NM_012102	0	0	5	5	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568378	0.45798	.	.	ENSG00000142599	ENST00000337907;ENST00000400907;ENST00000400908	T;T	0.43294	0.95;0.95	5.33	5.33	0.75918	Bromo adjacent homology (BAH) domain (3);	.	.	.	.	T	0.42314	0.1197	N	0.17631	0.505	0.80722	D	1	D	0.53885	0.963	D	0.67231	0.95	T	0.21827	-1.0234	9	0.07644	T	0.81	-16.2545	11.6091	0.51049	1.0:0.0:0.0:0.0	.	154	Q9P2R6	RERE_HUMAN	T	154	ENSP00000338629:S154T;ENSP00000383700:S154T	ENSP00000338629:S154T	S	-	1	0	RERE	8597269	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.525000	0.22956	2.234000	0.73211	0.533000	0.62120	TCT	.		0.498	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
TNFRSF1B	7133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12266986	12266986	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:12266986C>T	ENST00000376259.3	+	10	1384	c.1295C>T	c.(1294-1296)tCa>tTa	p.S432L	TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	432					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GCCTTTCGGTCACAGCTGGAG	0.622																																					p.S432L		.											.	TNFRSF1B-1085	0			c.C1295T						.						100.0	96.0	98.0					1																	12266986		2203	4300	6503	SO:0001583	missense	7133	exon10			TTCGGTCACAGCT	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.1295C>T	1.37:g.12266986C>T	ENSP00000365435:p.Ser432Leu	137	0		116	34	NM_001066	0	0	31	34	3	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	37	CCDS145.1	.	.	.	.	.	.	.	.	.	.	C	8.806	0.934041	0.18206	.	.	ENSG00000028137	ENST00000376259	D	0.86865	-2.18	4.93	3.01	0.34805	.	3.844360	0.01082	N	0.005008	D	0.85366	0.5680	L	0.57536	1.79	0.09310	N	0.999998	B	0.30068	0.267	B	0.28139	0.086	T	0.66901	-0.5806	10	0.44086	T	0.13	-20.2744	6.4642	0.21973	0.1787:0.7264:0.0:0.0949	.	432	P20333	TNR1B_HUMAN	L	432	ENSP00000365435:S432L	ENSP00000365435:S432L	S	+	2	0	TNFRSF1B	12189573	0.043000	0.20138	0.045000	0.18777	0.005000	0.04900	2.194000	0.42668	0.564000	0.29238	0.561000	0.74099	TCA	.		0.622	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
AGMAT	79814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15909721	15909721	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:15909721T>A	ENST00000375826.3	-	2	584	c.442A>T	c.(442-444)Att>Ttt	p.I148F	RP4-680D5.2_ENST00000428945.1_RNA|DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	148					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGCTACAATTTTCTCATAG	0.502																																					p.I148F	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT-91	0			c.A442T						.						60.0	62.0	61.0					1																	15909721		2203	4300	6503	SO:0001583	missense	79814	exon2			CTACAATTTTCTC	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.442A>T	1.37:g.15909721T>A	ENSP00000364986:p.Ile148Phe	74	0		59	24	NM_024758	0	0	39	67	28	Q5TDH1|Q9H5J3	Missense_Mutation	SNP	ENST00000375826.3	37	CCDS160.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.284549	0.40394	.	.	ENSG00000116771	ENST00000375826	D	0.86097	-2.07	5.17	4.0	0.46444	Ureohydrolase domain (1);	0.051325	0.85682	D	0.000000	D	0.85864	0.5796	M	0.88241	2.94	0.49483	D	0.99979	B	0.30914	0.3	B	0.28553	0.091	D	0.83786	0.0228	10	0.62326	D	0.03	-10.0798	10.1512	0.42794	0.0:0.0812:0.0:0.9188	.	148	Q9BSE5	SPEB_HUMAN	F	148	ENSP00000364986:I148F	ENSP00000364986:I148F	I	-	1	0	AGMAT	15782308	1.000000	0.71417	0.015000	0.15790	0.482000	0.33219	3.489000	0.53237	0.768000	0.33290	0.460000	0.39030	ATT	.		0.502	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
SLC5A9	200010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	48713171	48713171	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:48713171C>T	ENST00000438567.2	+	14	2054	c.2002C>T	c.(2002-2004)Ctt>Ttt	p.L668F	SLC5A9_ENST00000471020.1_3'UTR|SLC5A9_ENST00000236495.5_Missense_Mutation_p.L693F|SLC5A9_ENST00000533824.1_Missense_Mutation_p.L689F	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	668					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CAATGCTGTCCTTTTGCTGGC	0.527																																					p.L693F		.											.	SLC5A9-93	0			c.C2077T						.						118.0	109.0	112.0					1																	48713171		2203	4300	6503	SO:0001583	missense	200010	exon15			GCTGTCCTTTTGC	BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.2002C>T	1.37:g.48713171C>T	ENSP00000401730:p.Leu668Phe	143	0		131	36	NM_001135181	0	0	17	31	14	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	ENST00000438567.2	37	CCDS30709.2	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633803	0.47049	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.89485	-2.46;-2.45;-2.52	4.91	-2.59	0.06209	.	0.427982	0.25433	N	0.030704	D	0.85208	0.5644	L	0.43646	1.37	0.80722	D	1	P;P;P	0.52577	0.883;0.954;0.954	P;P;P	0.50617	0.459;0.526;0.646	T	0.80341	-0.1423	10	0.28530	T	0.3	.	10.552	0.45095	0.6789:0.2512:0.0:0.0699	.	689;668;693	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	F	689;668;693	ENSP00000431900:L689F;ENSP00000401730:L668F;ENSP00000236495:L693F	ENSP00000236495:L693F	L	+	1	0	SLC5A9	48485758	0.564000	0.26602	0.314000	0.25224	0.881000	0.50899	-0.070000	0.11523	-0.340000	0.08388	0.561000	0.74099	CTT	.		0.527	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174	
ZYG11B	79699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	53287171	53287171	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:53287171A>G	ENST00000294353.6	+	14	2250	c.2105A>G	c.(2104-2106)aAa>aGa	p.K702R	ZYG11B_ENST00000443756.2_Missense_Mutation_p.K632R	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	702										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TACAACATCAAAGATCATGAA	0.418																																					p.K702R		.											.	ZYG11B-94	0			c.A2105G						.						98.0	85.0	89.0					1																	53287171		2203	4300	6503	SO:0001583	missense	79699	exon14			ACATCAAAGATCA	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.2105A>G	1.37:g.53287171A>G	ENSP00000294353:p.Lys702Arg	83	0		84	18	NM_024646	0	0	14	26	12	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.462431	0.26248	.	.	ENSG00000162378	ENST00000443756;ENST00000294353	T;T	0.48836	0.8;0.8	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.155352	0.56097	D	0.000023	T	0.25791	0.0628	N	0.08118	0	0.80722	D	1	B;B	0.16802	0.019;0.001	B;B	0.22753	0.041;0.001	T	0.13415	-1.0510	10	0.14656	T	0.56	.	9.8251	0.40908	0.9231:0.0:0.0769:0.0	.	632;702	B4DK95;Q9C0D3	.;ZY11B_HUMAN	R	632;702	ENSP00000400522:K632R;ENSP00000294353:K702R	ENSP00000294353:K702R	K	+	2	0	ZYG11B	53059759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.218000	0.51192	2.019000	0.59389	0.482000	0.46254	AAA	.		0.418	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
USP24	23358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	55612677	55612677	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:55612677A>G	ENST00000294383.6	-	19	2174	c.2175T>C	c.(2173-2175)taT>taC	p.Y725Y	USP24_ENST00000407756.1_Silent_p.Y565Y	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	725					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TCCAGCCCAGATACAGAGTAG	0.393																																					p.Y725Y		.											.	USP24-521	0			c.T2175C						.						104.0	99.0	101.0					1																	55612677		1852	4098	5950	SO:0001819	synonymous_variant	23358	exon19			GCCCAGATACAGA	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2175T>C	1.37:g.55612677A>G		55	0		54	20	NM_015306	0	0	9	15	6	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	37	CCDS44154.2																																																																																			.		0.393	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	62365295	62365295	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:62365295C>T	ENST00000371158.2	+	23	3286	c.3172C>T	c.(3172-3174)Cca>Tca	p.P1058S	INADL_ENST00000316485.6_Missense_Mutation_p.P1058S	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1058					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGAAGAAACTCCAAATTTTAG	0.398																																					p.P1058S		.											.	INADL-94	0			c.C3172T						.						179.0	177.0	178.0					1																	62365295		2203	4300	6503	SO:0001583	missense	10207	exon23			GAAACTCCAAATT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3172C>T	1.37:g.62365295C>T	ENSP00000360200:p.Pro1058Ser	263	0		256	78	NM_176877	0	0	48	92	44	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626785	0.87560	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.13307	2.74;2.6	5.26	5.26	0.73747	PDZ/DHR/GLGF (1);	0.000000	0.64402	D	0.000001	T	0.39655	0.1086	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	0.991;0.999;1.0	D;D;D	0.85130	0.98;0.997;0.994	T	0.04915	-1.0918	10	0.34782	T	0.22	.	19.2911	0.94100	0.0:1.0:0.0:0.0	.	1058;1058;1058	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	S	1058	ENSP00000360200:P1058S;ENSP00000326199:P1058S	ENSP00000255202:P1058S	P	+	1	0	INADL	62137883	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.990000	0.63876	2.636000	0.89361	0.579000	0.79373	CCA	.		0.398	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
HIST2H2BE	8349	broad.mit.edu	37	1	149858178	149858178	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:149858178C>T	ENST00000369155.2	-	1	54	c.13G>A	c.(13-15)Gca>Aca	p.A5T	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	5				A -> S (in Ref. 7; AAH98112/AAH98289). {ECO:0000305}.	antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCGGATTTTGCCGGTTCAGGC	0.507																																					p.A5T													.	HIST2H2BE-69	0			c.G13A						.						57.0	58.0	58.0					1																	149858178		2203	4300	6503	SO:0001583	missense	8349	exon1			ATTTTGCCGGTTC	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.13G>A	1.37:g.149858178C>T	ENSP00000358151:p.Ala5Thr	74	0		80	4	NM_003528	0	0	53	53	0	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	37	CCDS936.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216193	0.79352	.	.	ENSG00000184678	ENST00000369155	T	0.18810	2.19	5.99	5.99	0.97316	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.15652	0.0377	L	0.59436	1.845	0.43218	D	0.99509	B	0.25904	0.137	B	0.13407	0.009	T	0.01266	-1.1401	10	0.66056	D	0.02	.	19.1154	0.93336	0.0:1.0:0.0:0.0	.	5	Q16778	H2B2E_HUMAN	T	5	ENSP00000358151:A5T	ENSP00000358151:A5T	A	-	1	0	HIST2H2BE	148124802	1.000000	0.71417	0.870000	0.34147	0.970000	0.65996	5.960000	0.70348	2.857000	0.98124	0.650000	0.86243	GCA	.		0.507	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
TCHH	7062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152082279	152082279	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:152082279C>T	ENST00000368804.1	-	2	3413	c.3414G>A	c.(3412-3414)agG>agA	p.R1138R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1138	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cccgatattgcctctccagct	0.612																																					p.R1138R		.											.	TCHH-72	0			c.G3414A						.						91.0	90.0	90.0					1																	152082279		2000	4154	6154	SO:0001819	synonymous_variant	7062	exon3			ATATTGCCTCTCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3414G>A	1.37:g.152082279C>T		175	0		139	39	NM_007113	0	0	0	0	0	Q5VUI3	Silent	SNP	ENST00000368804.1	37	CCDS41396.1																																																																																			.		0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
KCNN3	3782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154841688	154841688	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:154841688G>A	ENST00000271915.4	-	1	1068	c.753C>T	c.(751-753)agC>agT	p.S251S	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	256					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	AGGTGGTGCTGCTGGCGGTGG	0.567																																					p.S251S		.											.	KCNN3-91	0			c.C753T						.						109.0	104.0	106.0					1																	154841688		2203	4300	6503	SO:0001819	synonymous_variant	3782	exon1			GGTGCTGCTGGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.753C>T	1.37:g.154841688G>A		161	0		113	41	NM_001204087	0	0	4	4	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.567	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
EFNA1	1942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155104075	155104075	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:155104075A>G	ENST00000368407.3	+	2	871	c.353A>G	c.(352-354)aAg>aGg	p.K118R	EFNA1_ENST00000469878.1_3'UTR|EFNA1_ENST00000368406.2_Missense_Mutation_p.K118R	NM_004428.2	NP_004419.2	P20827	EFNA1_HUMAN	ephrin-A1	118	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|ephrin receptor signaling pathway (GO:0048013)|mitral valve morphogenesis (GO:0003183)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|notochord formation (GO:0014028)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of angiogenesis (GO:0045765)|regulation of axonogenesis (GO:0050770)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|substrate adhesion-dependent cell spreading (GO:0034446)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ephrin receptor binding (GO:0046875)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(1)|lung(1)|skin(1)	5	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCCTGGGCAAGGAGTTCAAA	0.527																																					p.K118R		.											.	EFNA1-90	0			c.A353G						.						53.0	47.0	49.0					1																	155104075		2203	4300	6503	SO:0001583	missense	1942	exon2			TGGGCAAGGAGTT		CCDS1091.1, CCDS1092.1	1q21-q22	2011-03-09			ENSG00000169242	ENSG00000169242		"""Ephrins"""	3221	protein-coding gene	gene with protein product		191164		TNFAIP4, EPLG1		2233719, 8660976	Standard	NM_182685		Approved	LERK1, ECKLG	uc001fhh.3	P20827	OTTHUMG00000035312	ENST00000368407.3:c.353A>G	1.37:g.155104075A>G	ENSP00000357392:p.Lys118Arg	65	0		47	10	NM_182685	0	0	41	70	29	D3DV86|Q5SR60|Q5SR61|Q6I9T9|Q8N578	Missense_Mutation	SNP	ENST00000368407.3	37	CCDS1091.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554194	0.86231	.	.	ENSG00000169242	ENST00000368407;ENST00000368406	T;T	0.43294	0.95;0.95	5.22	5.22	0.72569	Ephrin, conserved site (1);Cupredoxin (2);	0.045262	0.85682	D	0.000000	T	0.51500	0.1678	M	0.71581	2.175	0.53688	D	0.999973	D;D	0.76494	0.997;0.999	P;D	0.71184	0.9;0.972	T	0.51124	-0.8745	10	0.33940	T	0.23	-2.5539	13.3345	0.60509	1.0:0.0:0.0:0.0	.	118;118	P20827-2;P20827	.;EFNA1_HUMAN	R	118	ENSP00000357392:K118R;ENSP00000357391:K118R	ENSP00000357391:K118R	K	+	2	0	EFNA1	153370699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.204000	0.51082	2.097000	0.63578	0.533000	0.62120	AAG	.		0.527	EFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085428.1	NM_004428	
PTCHD3	374308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	27687708	27687708	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:27687708A>G	ENST00000438700.3	-	4	1936	c.1819T>C	c.(1819-1821)Ttt>Ctt	p.F607L		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	607					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						ACATATATAAAGACTACAAAA	0.383																																					p.F607L		.											.	PTCHD3-94	0			c.T1819C						.						64.0	65.0	64.0					10																	27687708		2203	4300	6503	SO:0001583	missense	374308	exon4			ATATAAAGACTAC	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1819T>C	10.37:g.27687708A>G	ENSP00000417658:p.Phe607Leu	92	0		95	63	NM_001034842	0	0	0	0	0	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.996644	0.00044	.	.	ENSG00000182077	ENST00000438700	D	0.83914	-1.78	4.05	-0.446	0.12238	.	0.493132	0.20919	N	0.083307	T	0.41650	0.1168	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.48410	-0.9038	10	0.02654	T	1	-5.7246	0.1591	0.00101	0.2673:0.2583:0.2122:0.2622	.	607	Q3KNS1	PTHD3_HUMAN	L	607	ENSP00000417658:F607L	ENSP00000417658:F607L	F	-	1	0	PTCHD3	27727714	0.012000	0.17670	0.007000	0.13788	0.009000	0.06853	-0.796000	0.04575	-0.287000	0.09064	-0.425000	0.05940	TTT	.		0.383	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
NCOA4	8031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	51585156	51585156	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:51585156G>T	ENST00000443446.1	+	8	1484	c.1255G>T	c.(1255-1257)Gat>Tat	p.D419Y	NCOA4_ENST00000414907.2_Missense_Mutation_p.D253Y|NCOA4_ENST00000430396.2_Missense_Mutation_p.D319Y|NCOA4_ENST00000438493.1_Missense_Mutation_p.D435Y|NCOA4_ENST00000452682.1_Missense_Mutation_p.D435Y|NCOA4_ENST00000344348.6_Missense_Mutation_p.D419Y|NCOA4_ENST00000374087.4_Missense_Mutation_p.D419Y|NCOA4_ENST00000374082.1_Missense_Mutation_p.D419Y	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	419					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTGTGTGTGTGATGAGAATTG	0.483			T	RET	papillary thyroid																																p.D435Y		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.G1303T						.						71.0	74.0	73.0					10																	51585156		2203	4300	6503	SO:0001583	missense	8031	exon9			GTGTGTGATGAGA	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1255G>T	10.37:g.51585156G>T	ENSP00000390713:p.Asp419Tyr	99	0		104	69	NM_001145261	0	0	117	545	428	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878324	0.91740	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.30981	1.99;2.0;1.7;2.0;1.51;2.0;1.7;2.0	5.6	5.6	0.85130	.	0.334273	0.35805	N	0.002979	T	0.54983	0.1892	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.76494	0.999;0.994;0.994;0.997	D;P;P;P	0.63488	0.915;0.87;0.87;0.819	T	0.51593	-0.8686	9	.	.	.	-20.3172	19.608	0.95587	0.0:0.0:1.0:0.0	.	319;435;435;419	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	Y	435;435;319;419;253;419;419;419	ENSP00000405146:D435Y;ENSP00000395465:D435Y;ENSP00000393053:D319Y;ENSP00000363200:D419Y;ENSP00000411018:D253Y;ENSP00000344552:D419Y;ENSP00000363195:D419Y;ENSP00000390713:D419Y	.	D	+	1	0	NCOA4	51255162	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.392000	0.97252	2.647000	0.89833	0.650000	0.86243	GAT	.		0.483	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
SLC29A3	55315	broad.mit.edu	37	10	73111339	73111339	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:73111339T>A	ENST00000373189.5	+	4	456	c.404T>A	c.(403-405)gTc>gAc	p.V135D		NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	135					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						CACATCCGTGTCCTGGCCTCA	0.602																																					p.V135D	Esophageal Squamous(200;1319 2142 18949 31248 39672)												.	SLC29A3-90	0			c.T404A						.						169.0	130.0	143.0					10																	73111339		2203	4300	6503	SO:0001583	missense	55315	exon4			TCCGTGTCCTGGC	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.404T>A	10.37:g.73111339T>A	ENSP00000362285:p.Val135Asp	120	0		86	4	NM_018344	0	0	15	15	0	B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Missense_Mutation	SNP	ENST00000373189.5	37	CCDS7310.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.411418	0.62399	.	.	ENSG00000198246	ENST00000373189	T	0.59638	0.25	5.36	5.36	0.76844	.	0.355948	0.29924	N	0.010858	T	0.74566	0.3733	M	0.83012	2.62	0.36975	D	0.894034	D	0.56968	0.978	P	0.59703	0.862	T	0.82705	-0.0325	9	0.87932	D	0	-34.3891	14.2128	0.65776	0.0:0.0:0.0:1.0	.	135	Q9BZD2	S29A3_HUMAN	D	135	ENSP00000362285:V135D	ENSP00000362285:V135D	V	+	2	0	SLC29A3	72781345	1.000000	0.71417	0.838000	0.33150	0.023000	0.10783	5.964000	0.70379	2.166000	0.68216	0.454000	0.30748	GTC	.		0.602	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048544.1	NM_018344	
WAPAL	23063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	88259986	88259986	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:88259986C>A	ENST00000298767.5	-	3	1486	c.1014G>T	c.(1012-1014)aaG>aaT	p.K338N		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	338	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CACCCCCTTTCTTTGCCTGAT	0.448																																					p.K338N		.											.	WAPAL-91	0			c.G1014T						.						182.0	152.0	162.0					10																	88259986		2203	4300	6503	SO:0001583	missense	23063	exon3			CCCTTTCTTTGCC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1014G>T	10.37:g.88259986C>A	ENSP00000298767:p.Lys338Asn	190	0		166	117	NM_015045	0	0	13	84	71	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653403	0.29425	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.29397	1.57	5.77	0.75	0.18387	.	0.497401	0.21168	N	0.079024	T	0.20901	0.0503	L	0.36672	1.1	0.80722	D	1	B;B;B	0.26809	0.099;0.099;0.16	B;B;B	0.28232	0.017;0.027;0.087	T	0.04708	-1.0932	10	0.52906	T	0.07	.	5.8006	0.18412	0.126:0.4044:0.0:0.4696	.	338;338;381	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	N	423;338;423	ENSP00000298767:K338N	ENSP00000298767:K338N	K	-	3	2	WAPAL	88249966	0.994000	0.37717	0.998000	0.56505	0.897000	0.52465	0.251000	0.18257	0.097000	0.17492	-0.145000	0.13849	AAG	.		0.448	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
PAPSS2	9060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	89503313	89503313	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:89503313C>T	ENST00000361175.4	+	10	1760	c.1391C>T	c.(1390-1392)gCt>gTt	p.A464V	PAPSS2_ENST00000427144.2_Missense_Mutation_p.A468V|PAPSS2_ENST00000456849.1_Missense_Mutation_p.A469V	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	464					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CAGCACGCGGCTGTGCTCGAG	0.587																																					p.A469V		.											.	PAPSS2-493	0			c.C1406T						.						105.0	91.0	96.0					10																	89503313		2203	4300	6503	SO:0001583	missense	9060	exon11			ACGCGGCTGTGCT	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1391C>T	10.37:g.89503313C>T	ENSP00000354436:p.Ala464Val	108	0		91	47	NM_001015880	0	4	4	74	66	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	37	CCDS7385.1	.	.	.	.	.	.	.	.	.	.	C	31	5.099439	0.94197	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.34472	1.36;1.36;1.36	5.33	5.33	0.75918	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.047627	0.85682	D	0.000000	T	0.56441	0.1985	M	0.62154	1.92	0.80722	D	1	D;D	0.63880	0.991;0.993	P;P	0.61201	0.885;0.773	T	0.54043	-0.8352	10	0.49607	T	0.09	-17.1332	19.2123	0.93760	0.0:1.0:0.0:0.0	.	464;469	O95340;O95340-2	PAPS2_HUMAN;.	V	464;469;468;468	ENSP00000354436:A464V;ENSP00000406157:A469V;ENSP00000397123:A468V	ENSP00000354436:A464V	A	+	2	0	PAPSS2	89493293	1.000000	0.71417	0.889000	0.34880	0.628000	0.37860	7.315000	0.78998	2.771000	0.95319	0.561000	0.74099	GCT	.		0.587	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
DOCK1	1793	ucsc.edu;bcgsc.ca	37	10	129209146	129209146	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:129209146G>A	ENST00000280333.6	+	43	4432	c.4323G>A	c.(4321-4323)cgG>cgA	p.R1441R		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1441	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AATATTCTCGGCCAATCCGGA	0.403																																					p.R1441R													.	DOCK1-698	0			c.G4323A						.						69.0	67.0	67.0					10																	129209146		1868	4101	5969	SO:0001819	synonymous_variant	1793	exon43			TTCTCGGCCAATC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4323G>A	10.37:g.129209146G>A		45	0		39	4	NM_001380	0	0	131	131	0	A9Z1Z5	Silent	SNP	ENST00000280333.6	37																																																																																				.		0.403	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
OR52K1	390036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4510932	4510932	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:4510932C>T	ENST00000307632.3	+	1	824	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R268S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCGTGTAGCCCGCCATGCTGC	0.507																																					p.R268C		.											.	OR52K1-68	1	Substitution - Missense(1)	lung(1)	c.C802T						.						213.0	192.0	199.0					11																	4510932		2201	4298	6499	SO:0001583	missense	390036	exon1			GTAGCCCGCCATG	AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.802C>T	11.37:g.4510932C>T	ENSP00000302422:p.Arg268Cys	300	0		230	66	NM_001005171	0	0	0	0	0	B9EH54|Q6IFK5	Missense_Mutation	SNP	ENST00000307632.3	37	CCDS31352.1	.	.	.	.	.	.	.	.	.	.	C	3.130	-0.178651	0.06380	.	.	ENSG00000196778	ENST00000307632	T	0.37411	1.2	4.5	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.429234	0.17846	N	0.160035	T	0.28896	0.0717	L	0.42529	1.33	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.25328	-1.0135	10	0.87932	D	0	.	6.8973	0.24262	0.1728:0.7359:0.0:0.0912	.	268	Q8NGK4	O52K1_HUMAN	C	268	ENSP00000302422:R268C	ENSP00000302422:R268C	R	+	1	0	OR52K1	4467508	0.000000	0.05858	0.723000	0.30687	0.076000	0.17211	-0.593000	0.05740	1.235000	0.43724	0.411000	0.27672	CGC	.		0.507	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385846.1	NM_001005171	
USP47	55031	hgsc.bcm.edu;broad.mit.edu	37	11	11942036	11942036	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:11942036G>T	ENST00000399455.2	+	11	1393	c.1273G>T	c.(1273-1275)Gat>Tat	p.D425Y	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000339865.5_Missense_Mutation_p.D337Y|USP47_ENST00000527733.1_Missense_Mutation_p.D405Y	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	425	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TGATGTTGAAGATGAGGTAAA	0.303																																					p.D337Y		.											.	USP47-660	0			c.G1009T						.						77.0	72.0	74.0					11																	11942036		1819	4070	5889	SO:0001583	missense	55031	exon9			GTTGAAGATGAGG	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1273G>T	11.37:g.11942036G>T	ENSP00000382382:p.Asp425Tyr	39	0		75	21	NM_017944	0	0	0	0	0	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37		.	.	.	.	.	.	.	.	.	.	G	23.4	4.416072	0.83449	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000535588	T;T;T	0.32272	1.46;1.46;1.46	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	N	0.20986	0.625	0.80722	D	1	D;D	0.64830	0.991;0.994	P;P	0.62649	0.905;0.846	T	0.34850	-0.9812	10	0.59425	D	0.04	.	18.9869	0.92775	0.0:0.0:1.0:0.0	.	405;337	E9PM46;Q96K76-2	.;.	Y	337;405;425;425	ENSP00000339957:D337Y;ENSP00000433146:D405Y;ENSP00000382382:D425Y	ENSP00000339957:D337Y	D	+	1	0	USP47	11898612	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.591000	0.87537	0.563000	0.77884	GAT	.		0.303	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
DDB1	1642	broad.mit.edu	37	11	61081866	61081866	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:61081866G>A	ENST00000301764.7	-	13	1900	c.1503C>T	c.(1501-1503)gcC>gcT	p.A501A	DDB1_ENST00000450997.2_Intron|DDB1_ENST00000545930.1_5'Flank	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	501	Interaction with CDT1.|WD repeat beta-propeller B; Interaction with CUL4A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						TATTGCAGGAGGCCACACTGA	0.532								Nucleotide excision repair (NER)																													p.A501A													.	DDB1-661	0			c.C1503T						.						157.0	147.0	150.0					11																	61081866		2203	4299	6502	SO:0001819	synonymous_variant	1642	exon13			GCAGGAGGCCACA	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.1503C>T	11.37:g.61081866G>A		229	1		229	4	NM_001923	0	0	260	267	7	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Silent	SNP	ENST00000301764.7	37	CCDS31576.1																																																																																			.		0.532	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	
SLC25A45	283130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65144060	65144060	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:65144060T>C	ENST00000527174.1	-	6	740	c.685A>G	c.(685-687)Atg>Gtg	p.M229V	RP11-867O8.5_ENST00000533886.1_RNA|SLC25A45_ENST00000360662.3_Missense_Mutation_p.M205V|SLC25A45_ENST00000526432.1_Missense_Mutation_p.M167V|SLC25A45_ENST00000534028.1_Missense_Mutation_p.M205V|SLC25A45_ENST00000417511.2_Missense_Mutation_p.M187V|SLC25A45_ENST00000294187.6_Missense_Mutation_p.M187V|SLC25A45_ENST00000398802.1_Missense_Mutation_p.M229V|SLC25A45_ENST00000377152.2_Missense_Mutation_p.M125V			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	229					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						TCCATCTGCATCCGGGACTTG	0.617																																					p.M229V		.											.	SLC25A45-68	0			c.A685G						.						92.0	97.0	95.0					11																	65144060		2158	4257	6415	SO:0001583	missense	283130	exon7			TCTGCATCCGGGA	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.685A>G	11.37:g.65144060T>C	ENSP00000435489:p.Met229Val	150	0		121	33	NM_182556	0	0	0	0	0	Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	37	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.433016	0.62844	.	.	ENSG00000162241	ENST00000527174;ENST00000534028;ENST00000398802;ENST00000360662;ENST00000377152;ENST00000294187;ENST00000417511;ENST00000526432	T;T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	4.58	3.41	0.39046	Mitochondrial carrier domain (2);	.	.	.	.	T	0.72566	0.3476	L	0.37630	1.12	0.37087	D	0.899261	B;B;B	0.31256	0.316;0.056;0.122	B;B;B	0.35470	0.203;0.139;0.156	T	0.73943	-0.3823	9	0.72032	D	0.01	-0.0527	8.8454	0.35168	0.0:0.0:0.3728:0.6272	.	167;205;229	E9PJQ3;Q8N413-4;Q8N413	.;.;S2545_HUMAN	V	229;205;229;205;125;187;187;167	ENSP00000435489:M229V;ENSP00000431769:M205V;ENSP00000381782:M229V;ENSP00000353879:M205V;ENSP00000366357:M125V;ENSP00000294187:M187V;ENSP00000407530:M187V;ENSP00000435547:M167V	ENSP00000294187:M187V	M	-	1	0	SLC25A45	64900636	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.144000	0.42197	0.866000	0.35629	0.459000	0.35465	ATG	.		0.617	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556	
RELA	5970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65423175	65423175	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:65423175A>G	ENST00000406246.3	-	10	1278	c.1017T>C	c.(1015-1017)gcT>gcC	p.A339A	RELA_ENST00000525693.1_Silent_p.A339A|RELA_ENST00000308639.9_Silent_p.A336A	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	339					acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TGGGGACAGAAGCTGAGCTGC	0.607																																					p.A339A		.											.	RELA-872	0			c.T1017C						.						79.0	75.0	77.0					11																	65423175		2201	4297	6498	SO:0001819	synonymous_variant	5970	exon10			GACAGAAGCTGAG	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1017T>C	11.37:g.65423175A>G		74	0		67	16	NM_021975	0	0	56	94	38	Q6GTV1|Q6SLK1	Silent	SNP	ENST00000406246.3	37	CCDS31609.1	.	.	.	.	.	.	.	.	.	.	A	1.229	-0.624695	0.03636	.	.	ENSG00000173039	ENST00000426617	.	.	.	4.46	0.645	0.17782	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.817	0.18497	0.5244:0.0:0.4756:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RELA	65179751	0.675000	0.27558	0.008000	0.14137	0.234000	0.25298	0.116000	0.15561	0.141000	0.18875	0.454000	0.30748	.	.		0.607	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
ANO1	55107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	69951883	69951883	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:69951883C>T	ENST00000355303.5	+	5	1041	c.736C>T	c.(736-738)Cgg>Tgg	p.R246W	ANO1_ENST00000530676.1_Missense_Mutation_p.R130W|ANO1_ENST00000531349.1_5'Flank|ANO1_ENST00000398543.2_Missense_Mutation_p.R130W|ANO1_ENST00000316296.5_Missense_Mutation_p.R218W|ANO1_ENST00000538023.1_Missense_Mutation_p.R246W	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	246					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CAGCAAAACCCGGAGCACGAT	0.488																																					p.R246W		.											.	ANO1-47	0			c.C736T						.						91.0	90.0	91.0					11																	69951883		1928	4129	6057	SO:0001583	missense	55107	exon5			AAAACCCGGAGCA	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.736C>T	11.37:g.69951883C>T	ENSP00000347454:p.Arg246Trp	94	0		47	15	NM_018043	0	0	0	0	0	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621448	0.46736	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000531604;ENST00000316296;ENST00000530676	T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.86965	0.6060	M	0.93720	3.45	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89503	0.3765	9	.	.	.	.	11.6143	0.51080	0.2839:0.7161:0.0:0.0	.	218;246	Q5XXA6-3;Q5XXA6	.;ANO1_HUMAN	W	246;246;130;30;213;218;130	ENSP00000347454:R246W;ENSP00000444689:R246W;ENSP00000381551:R130W;ENSP00000436392:R213W;ENSP00000319477:R218W;ENSP00000435797:R130W	.	R	+	1	2	ANO1	69629531	0.996000	0.38824	1.000000	0.80357	0.109000	0.19521	3.489000	0.53237	2.437000	0.82529	0.650000	0.86243	CGG	.		0.488	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
MAML2	84441	hgsc.bcm.edu	37	11	95825431	95825431	+	Silent	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:95825431T>C	ENST00000524717.1	-	2	3048	c.1764A>G	c.(1762-1764)caA>caG	p.Q588Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	588					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgTTGGGTGTAGT	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q588Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.A1764G						.																																			SO:0001819	synonymous_variant	84441	exon2			TTGCTGTTGGGTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1764A>G	11.37:g.95825431T>C		12	2		8	2	NM_032427	0	0	44	44	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ZC3H12C	85463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	110007683	110007683	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:110007683T>C	ENST00000278590.3	+	2	368	c.317T>C	c.(316-318)aTt>aCt	p.I106T	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.I107T|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.I75T	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	106							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTGGGTAGCATTTCAGTAGAG	0.448																																					p.I106T		.											.	ZC3H12C-68	0			c.T317C						.						42.0	41.0	41.0					11																	110007683		1893	4130	6023	SO:0001583	missense	85463	exon2			GTAGCATTTCAGT		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.317T>C	11.37:g.110007683T>C	ENSP00000278590:p.Ile106Thr	33	0		27	15	NM_033390	0	0	1	1	0	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	t	0.015	-1.546583	0.00926	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.29917	1.55;1.55;1.56	5.42	4.29	0.51040	.	.	.	.	.	T	0.18759	0.0450	N	0.25647	0.755	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.11329	0.005;0.006;0.006	T	0.31475	-0.9942	9	0.13853	T	0.58	-1.7133	6.4988	0.22158	0.0:0.1421:0.1326:0.7254	.	107;106;106	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	T	106;107;75	ENSP00000278590:I106T;ENSP00000431821:I107T;ENSP00000413094:I75T	ENSP00000278590:I106T	I	+	2	0	ZC3H12C	109512893	0.003000	0.15002	0.297000	0.24988	0.069000	0.16628	0.578000	0.23773	0.902000	0.36520	0.528000	0.53228	ATT	.		0.448	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
DRD2	1813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113295344	113295344	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:113295344A>G	ENST00000362072.3	-	2	374	c.30T>C	c.(28-30)gaT>gaC	p.D10D	DRD2_ENST00000544518.1_Silent_p.D10D|DRD2_ENST00000355319.2_Silent_p.D10D|DRD2_ENST00000535984.1_5'Flank|DRD2_ENST00000346454.3_Silent_p.D10D|DRD2_ENST00000538967.1_Silent_p.D10D|DRD2_ENST00000542968.1_Silent_p.D10D	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	10					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCAGATCATCATCATACCAGG	0.587																																					p.D10D		.											.	DRD2-92	0			c.T30C						.						116.0	103.0	107.0					11																	113295344		2201	4296	6497	SO:0001819	synonymous_variant	1813	exon2			ATCATCATCATAC	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.30T>C	11.37:g.113295344A>G		132	0		107	27	NM_016574	0	0	0	0	0	Q9NZR3|Q9UPA9	Silent	SNP	ENST00000362072.3	37	CCDS8361.1																																																																																			.		0.587	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
PCED1B	91523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	47628909	47628909	+	Silent	SNP	G	G	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr12:47628909G>T	ENST00000546455.1	+	4	794	c.63G>T	c.(61-63)ctG>ctT	p.L21L	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Silent_p.L21L			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	21							hydrolase activity (GO:0016787)										TGGTCATCCTGGGGGACTCTG	0.602																																					p.L21L		.											.	.	0			c.G63T						.						73.0	71.0	72.0					12																	47628909		2203	4300	6503	SO:0001819	synonymous_variant	91523	exon2			CATCCTGGGGGAC	BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.63G>T	12.37:g.47628909G>T		89	0		74	24	NM_138371	0	0	12	12	0	Q96B20	Silent	SNP	ENST00000546455.1	37	CCDS8752.1																																																																																			.		0.602	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
TMEM120B	144404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	122190050	122190050	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr12:122190050G>A	ENST00000449592.2	+	5	483	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	128						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CTACAAGGACGAATATGAGAA	0.577																																					p.E128K		.											.	TMEM120B-68	0			c.G382A						.						111.0	130.0	124.0					12																	122190050		2155	4240	6395	SO:0001583	missense	144404	exon5			AAGGACGAATATG	BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.382G>A	12.37:g.122190050G>A	ENSP00000404991:p.Glu128Lys	129	0		120	40	NM_001080825	0	0	9	15	6	A0PK01|B3KX33	Missense_Mutation	SNP	ENST00000449592.2	37	CCDS41852.1	.	.	.	.	.	.	.	.	.	.	G	32	5.129163	0.94473	.	.	ENSG00000188735	ENST00000449592;ENST00000541467	T;T	0.42513	0.97;0.97	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.73133	0.3548	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81391	-0.0954	10	0.87932	D	0	-29.3312	15.8383	0.78818	0.0:0.0:1.0:0.0	.	128	A0PK00	T120B_HUMAN	K	128;107	ENSP00000404991:E128K;ENSP00000442105:E107K	ENSP00000345152:E128K	E	+	1	0	TMEM120B	120674433	1.000000	0.71417	0.995000	0.50966	0.953000	0.61014	9.405000	0.97313	2.387000	0.81309	0.491000	0.48974	GAA	.		0.577	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402158.1	NM_001080825	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102500785	102500785	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr14:102500785A>G	ENST00000360184.4	+	56	10914	c.10750A>G	c.(10750-10752)Aat>Gat	p.N3584D	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|DYNC1H1_ENST00000556791.1_3'UTR	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3584	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAAACGATTCAATAGGTATGA	0.473																																					p.N3584D		.											.	DYNC1H1-98	0			c.A10750G						.						94.0	85.0	88.0					14																	102500785		2203	4300	6503	SO:0001583	missense	1778	exon56			CGATTCAATAGGT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10750A>G	14.37:g.102500785A>G	ENSP00000348965:p.Asn3584Asp	186	0		137	39	NM_001376	0	0	0	0	0	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.89|14.89	2.671516|2.671516	0.47781|0.47781	.|.	.|.	ENSG00000197102|ENSG00000197102	ENST00000360184|ENST00000553423	T|.	0.52057|.	0.68|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72358|0.72358	0.3450|0.3450	M|M	0.68728|0.68728	2.09|2.09	0.80722|0.80722	D|D	1|1	D|.	0.60160|.	0.987|.	D|.	0.63488|.	0.915|.	T|T	0.72491|0.72491	-0.4277|-0.4277	10|5	0.41790|.	T|.	0.15|.	.|.	15.2984|15.2984	0.73928|0.73928	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3584|.	Q14204|.	DYHC1_HUMAN|.	D|R	3584|59	ENSP00000348965:N3584D|.	ENSP00000348965:N3584D|.	N|Q	+|+	1|2	0|0	DYNC1H1|DYNC1H1	101570538|101570538	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.411000|0.411000	0.31082|0.31082	7.417000|7.417000	0.80156|0.80156	2.090000|2.090000	0.63153|0.63153	0.482000|0.482000	0.46254|0.46254	AAT|CAA	.		0.473	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
CALML4	91860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	68489823	68489823	+	Missense_Mutation	SNP	G	G	A	rs201056051		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:68489823G>A	ENST00000467889.1	-	4	632	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	CALML4_ENST00000395465.3_Intron|RP11-315D16.2_ENST00000562767.1_Missense_Mutation_p.A76V|CALML4_ENST00000540479.1_Missense_Mutation_p.R74W|CALML4_ENST00000448060.2_Missense_Mutation_p.R103W	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	150	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						AGTTTTGACCGCAGGTCGGAC	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		20494	0.0		0.001	False		,,,				2504	0.0				p.R150W		.											.	CALML4-90	0			c.C448T						.						154.0	150.0	151.0					15																	68489823		1978	4138	6116	SO:0001583	missense	91860	exon4			TTGACCGCAGGTC	AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.448C>T	15.37:g.68489823G>A	ENSP00000419081:p.Arg150Trp	167	0		136	45	NM_033429	0	0	148	277	129	B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	Missense_Mutation	SNP	ENST00000467889.1	37	CCDS10226.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.57	3.161345	0.57368	.	.	ENSG00000129007	ENST00000478113;ENST00000448060;ENST00000395463;ENST00000540479;ENST00000467889	T;T;T	0.81247	-1.47;-1.47;-1.47	5.02	3.98	0.46160	EF-hand-like domain (1);	0.052342	0.64402	D	0.000001	D	0.92890	0.7738	H	0.98068	4.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94426	0.7645	10	0.87932	D	0	-25.9495	12.4925	0.55907	0.0:0.0:0.7081:0.2919	.	103;150	F8W6Y4;Q96GE6	.;CALL4_HUMAN	W	35;103;35;74;150	ENSP00000400755:R103W;ENSP00000438177:R74W;ENSP00000419081:R150W	ENSP00000435285:R35W	R	-	1	2	CALML4	66276877	1.000000	0.71417	0.996000	0.52242	0.473000	0.32948	1.955000	0.40372	2.501000	0.84356	0.491000	0.48974	CGG	G|0.999;A|0.000		0.507	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257067.3	NM_033429	
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	88679229	88679229	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:88679229G>C	ENST00000360948.2	-	8	969	c.808C>G	c.(808-810)Ctg>Gtg	p.L270V	NTRK3_ENST00000357724.2_Missense_Mutation_p.L270V|NTRK3_ENST00000317501.3_Missense_Mutation_p.L270V|NTRK3_ENST00000355254.2_Missense_Mutation_p.L270V|NTRK3_ENST00000558676.1_Missense_Mutation_p.L270V|NTRK3_ENST00000394480.2_Missense_Mutation_p.L270V|NTRK3_ENST00000542733.2_Missense_Mutation_p.L172V|NTRK3_ENST00000540489.2_Missense_Mutation_p.L270V|NTRK3_ENST00000557856.1_Missense_Mutation_p.L270V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	270	Ig-like C2-type 1.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L270M(1)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACATTCACCAGCGTCAAGTTG	0.478			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.L270V		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3-3538	1	Substitution - Missense(1)	lung(1)	c.C808G						.						241.0	164.0	190.0					15																	88679229		2201	4299	6500	SO:0001583	missense	4916	exon9			TCACCAGCGTCAA	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.808C>G	15.37:g.88679229G>C	ENSP00000354207:p.Leu270Val	164	0		136	42	NM_001243101	0	0	2	2	0	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422428	0.62622	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.51	4.6	0.57074	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.072619	0.56097	D	0.000024	T	0.75982	0.3924	L	0.57536	1.79	0.47819	D	0.999528	D;D;P;D;D;P	0.71674	0.967;0.969;0.87;0.998;0.969;0.87	P;P;P;D;P;P	0.69824	0.808;0.645;0.777;0.966;0.594;0.718	T	0.76515	-0.2931	10	0.54805	T	0.06	.	10.3176	0.43747	0.1599:0.0:0.8401:0.0	.	172;270;270;270;270;270	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	V	270;270;270;270;172;270;270	ENSP00000377990:L270V;ENSP00000354207:L270V;ENSP00000350356:L270V;ENSP00000347397:L270V;ENSP00000437773:L172V;ENSP00000444673:L270V;ENSP00000318328:L270V	ENSP00000318328:L270V	L	-	1	2	NTRK3	86480233	1.000000	0.71417	0.940000	0.37924	0.891000	0.51852	4.245000	0.58734	1.336000	0.45506	-0.253000	0.11424	CTG	.		0.478	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
ACAN	176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	89398462	89398462	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:89398462C>T	ENST00000561243.1	+	11	2646	c.2646C>T	c.(2644-2646)ttC>ttT	p.F882F	ACAN_ENST00000559004.1_Silent_p.F882F|ACAN_ENST00000439576.2_Silent_p.F882F|ACAN_ENST00000352105.7_Silent_p.F882F			P16112	PGCA_HUMAN	aggrecan	881	CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			ACCTTGACTTCAGTGGGCAGC	0.597																																					p.F882F		.											.	ACAN-25	0			c.C2646T						.						59.0	65.0	63.0					15																	89398462		2009	4185	6194	SO:0001819	synonymous_variant	176	exon12			TGACTTCAGTGGG	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2646C>T	15.37:g.89398462C>T		101	0		74	22	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.597	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
RHCG	51458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90026327	90026327	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:90026327T>C	ENST00000268122.4	-	3	561	c.493A>G	c.(493-495)Aat>Gat	p.N165D	RHCG_ENST00000544600.1_Missense_Mutation_p.N165D	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	165					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					ATGAACTCATTCACAGCGAAG	0.537																																					p.N165D		.											.	RHCG-226	0			c.A493G						.						68.0	51.0	57.0					15																	90026327		2200	4299	6499	SO:0001583	missense	51458	exon3			ACTCATTCACAGC	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.493A>G	15.37:g.90026327T>C	ENSP00000268122:p.Asn165Asp	67	0		78	29	NM_016321	0	0	0	0	0	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	37	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811144	0.70797	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.23147	1.92;1.92	5.47	5.47	0.80525	Ammonium transporter AmtB-like (3);	0.089021	0.85682	D	0.000000	T	0.63570	0.2522	H	0.95611	3.695	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.72075	0.976;0.976	T	0.76181	-0.3053	9	.	.	.	-18.2072	15.5452	0.76093	0.0:0.0:0.0:1.0	.	165;165	A8K4D4;Q9UBD6	.;RHCG_HUMAN	D	165;165;156	ENSP00000438123:N165D;ENSP00000268122:N165D	.	N	-	1	0	RHCG	87827331	1.000000	0.71417	0.940000	0.37924	0.612000	0.37316	5.740000	0.68629	2.076000	0.62316	0.533000	0.62120	AAT	.		0.537	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
BAIAP3	8938	hgsc.bcm.edu	37	16	1398016	1398016	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:1398016C>G	ENST00000324385.5	+	32	3410	c.3252C>G	c.(3250-3252)taC>taG	p.Y1084*	BAIAP3_ENST00000568887.1_Nonsense_Mutation_p.Y1021*|BAIAP3_ENST00000397488.2_Nonsense_Mutation_p.Y1066*|BAIAP3_ENST00000421665.2_Nonsense_Mutation_p.Y1013*|BAIAP3_ENST00000562208.1_Nonsense_Mutation_p.Y1026*|BAIAP3_ENST00000426824.3_Nonsense_Mutation_p.Y1049*|BAIAP3_ENST00000397489.1_Nonsense_Mutation_p.Y1066*	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1084	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				AACTCTTCTACTTGTGAGTGT	0.652																																					p.Y1084X		.											.	BAIAP3-91	0			c.C3252G						.						50.0	50.0	50.0					16																	1398016		2198	4300	6498	SO:0001587	stop_gained	8938	exon32			CTTCTACTTGTGA	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.3252C>G	16.37:g.1398016C>G	ENSP00000324510:p.Tyr1084*	115	0		66	6	NM_003933	0	0	0	0	0	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Nonsense_Mutation	SNP	ENST00000324385.5	37	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	C	38	6.826251	0.97865	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	.	.	.	4.65	1.6	0.23607	.	0.402932	0.24625	N	0.036938	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.1567	6.7323	0.23390	0.0:0.6052:0.0:0.3948	.	.	.	.	X	1049;1066;1084;1066;1013	.	ENSP00000324510:Y1084X	Y	+	3	2	BAIAP3	1338017	0.998000	0.40836	0.998000	0.56505	0.087000	0.18053	0.792000	0.26929	0.068000	0.16574	-0.258000	0.10820	TAC	.		0.652	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
PSMB10	5699	hgsc.bcm.edu	37	16	67970649	67970649	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:67970649G>C	ENST00000358514.4	-	1	341	c.4C>G	c.(4-6)Ctg>Gtg	p.L2V	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	2					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	GCTGGCTTCAGCATCTTGGGG	0.657																																					p.L2V		.											.	PSMB10-90	0			c.C4G						.						6.0	9.0	8.0					16																	67970649		2068	4126	6194	SO:0001583	missense	5699	exon1			GCTTCAGCATCTT	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.4C>G	16.37:g.67970649G>C	ENSP00000351314:p.Leu2Val	2	0		11	6	NM_002801	0	0	45	144	99	B2R5J4|Q5U098	Missense_Mutation	SNP	ENST00000358514.4	37	CCDS10853.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368139	0.61513	.	.	ENSG00000205220	ENST00000358514	T	0.29917	1.55	5.44	3.45	0.39498	.	0.789141	0.11429	N	0.564987	T	0.22322	0.0538	L	0.34521	1.04	0.31055	N	0.714774	B	0.21225	0.053	B	0.17722	0.019	T	0.14783	-1.0460	10	0.33940	T	0.23	-0.1279	7.6089	0.28118	0.1898:0.0:0.8102:0.0	.	2	P40306	PSB10_HUMAN	V	2	ENSP00000351314:L2V	ENSP00000351314:L2V	L	-	1	2	PSMB10	66528150	0.741000	0.28217	0.993000	0.49108	0.082000	0.17680	0.926000	0.28804	1.422000	0.47177	0.549000	0.68633	CTG	.		0.657	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801	
KCNJ12	3768	broad.mit.edu;bcgsc.ca	37	17	21319584	21319584	+	Silent	SNP	C	C	T	rs548667759		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:21319584C>T	ENST00000583088.1	+	3	1825	c.930C>T	c.(928-930)acC>acT	p.T310T	KCNJ12_ENST00000331718.5_Silent_p.T310T	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	310					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CCATGACCACCCAGGCCCGCA	0.607										Prostate(3;0.18)																											p.T310T													.	.	0			c.C930T						.						101.0	101.0	101.0					17																	21319584		2203	4300	6503	SO:0001819	synonymous_variant	100134444	exon3			GACCACCCAGGCC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.930C>T	17.37:g.21319584C>T		259	0		227	10	NM_001194958	0	0	3	3	0	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																			.		0.607	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
SSH2	85464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27975326	27975326	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:27975326C>A	ENST00000269033.3	-	13	1333	c.1182G>T	c.(1180-1182)atG>atT	p.M394I	SSH2_ENST00000540801.1_Missense_Mutation_p.M421I|RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.11_ENST00000582881.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	394	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GACTCACCCCCATTTTGCAGT	0.443																																					p.M394I		.											.	SSH2-92	0			c.G1182T						.						89.0	78.0	82.0					17																	27975326		2203	4300	6503	SO:0001583	missense	85464	exon13			CACCCCCATTTTG	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.1182G>T	17.37:g.27975326C>A	ENSP00000269033:p.Met394Ile	60	0		85	46	NM_033389	0	0	23	45	22	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	C	36	5.803091	0.96960	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	D;D	0.85411	-1.98;-1.98	5.95	5.95	0.96441	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.94611	0.8263	M	0.94101	3.495	0.80722	D	1	P;P;P	0.50710	0.526;0.895;0.938	P;P;D	0.65233	0.701;0.647;0.933	D	0.94987	0.8131	10	0.87932	D	0	-16.2523	20.3932	0.98965	0.0:1.0:0.0:0.0	.	421;394;394	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	I	394;421;394	ENSP00000269033:M394I;ENSP00000444743:M421I	ENSP00000269033:M394I	M	-	3	0	SSH2	24999452	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	ATG	.		0.443	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
WIPF2	147179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38416825	38416825	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:38416825G>A	ENST00000323571.4	+	3	342	c.102G>A	c.(100-102)caG>caA	p.Q34Q	WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Silent_p.Q34Q|WIPF2_ENST00000394103.3_Silent_p.Q34Q|WIPF2_ENST00000583130.1_Silent_p.Q34Q|WIPF2_ENST00000536600.1_Silent_p.Q34Q	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	34					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						GAGATGAGCAGCGGGGTCGAG	0.522										HNSCC(43;0.11)																											p.Q34Q		.											.	WIPF2-93	0			c.G102A						.						101.0	89.0	93.0					17																	38416825		2203	4300	6503	SO:0001819	synonymous_variant	147179	exon3			TGAGCAGCGGGGT	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.102G>A	17.37:g.38416825G>A		158	0		161	38	NM_133264	0	0	40	59	19	A8K0L3|Q658J8|Q71RE1|Q8TE44	Silent	SNP	ENST00000323571.4	37	CCDS11364.1																																																																																			.		0.522	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39191010	39191010	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:39191010A>T	ENST00000344363.5	-	1	97	c.64T>A	c.(64-66)Tcc>Acc	p.S22T		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	22						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCAGCTGGAGCCGCATGTC	0.587																																					p.S22T		.											.	.	0			c.T64A						.						41.0	49.0	47.0					17																	39191010		1974	4168	6142	SO:0001583	missense	81850	exon1			AGCTGGAGCCGCA	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.64T>A	17.37:g.39191010A>T	ENSP00000344420:p.Ser22Thr	80	2		97	9	NM_030966	0	0	0	0	0	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	37	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	A	9.615	1.132314	0.21041	.	.	ENSG00000221880	ENST00000344363	T	0.33216	1.42	4.31	0.846	0.18955	.	.	.	.	.	T	0.15652	0.0377	.	.	.	0.26468	N	0.975321	B	0.09022	0.002	B	0.15484	0.013	T	0.30060	-0.9991	8	0.21014	T	0.42	.	3.8262	0.08855	0.6175:0.1859:0.1966:0.0	.	22	Q8IUG1	KRA13_HUMAN	T	22	ENSP00000344420:S22T	ENSP00000344420:S22T	S	-	1	0	KRTAP1-3	36444536	.	.	0.993000	0.49108	0.724000	0.41520	.	.	0.093000	0.17368	-0.376000	0.06991	TCC	.		0.587	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
CDC27	996	hgsc.bcm.edu	37	17	45249300	45249300	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:45249300A>C	ENST00000066544.3	-	3	327	c.234T>G	c.(232-234)tgT>tgG	p.C78W	CDC27_ENST00000446365.2_Intron|CDC27_ENST00000527547.1_Missense_Mutation_p.C78W|CDC27_ENST00000528748.1_5'UTR|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000531206.1_Missense_Mutation_p.C78W	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	78					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATCAACACAACATTTTGCAA	0.338																																					p.C78W		.											.	CDC27-291	0			c.T234G						.						38.0	38.0	38.0					17																	45249300		2202	4300	6502	SO:0001583	missense	996	exon3			AACACAACATTTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.234T>G	17.37:g.45249300A>C	ENSP00000066544:p.Cys78Trp	59	0		69	4	NM_001114091	0	0	48	48	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668591	0.67814	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000527547;ENST00000526866	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.69	3.44	0.39384	Tetratricopeptide-like helical (1);	0.046528	0.85682	N	0.000000	D	0.83580	0.5285	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.81143	-0.1067	10	0.87932	D	0	-31.1317	4.5705	0.12207	0.6658:0.1666:0.1676:0.0	.	78;78;78	G5EA36;G3V1C4;P30260	.;.;CDC27_HUMAN	W	78	ENSP00000066544:C78W;ENSP00000434614:C78W;ENSP00000437339:C78W;ENSP00000432105:C78W	ENSP00000066544:C78W	C	-	3	2	CDC27	42604299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.381000	0.52455	0.421000	0.25980	0.482000	0.46254	TGT	.		0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
TLK2	11011	hgsc.bcm.edu	37	17	60650591	60650591	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:60650591A>G	ENST00000326270.9	+	12	1252	c.984A>G	c.(982-984)atA>atG	p.I328M	TLK2_ENST00000343388.7_Missense_Mutation_p.I296M|TLK2_ENST00000582809.1_Missense_Mutation_p.I179M|TLK2_ENST00000346027.5_Missense_Mutation_p.I328M|TLK2_ENST00000542523.1_Missense_Mutation_p.I296M	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	328					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						AGGAAAGGATAAATTCACAGA	0.423																																					p.I328M		.											.	TLK2-464	0			c.A984G						.						39.0	36.0	37.0					17																	60650591		2203	4300	6503	SO:0001583	missense	11011	exon12			AAGGATAAATTCA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.984A>G	17.37:g.60650591A>G	ENSP00000316512:p.Ile328Met	40	0		36	2	NM_006852	0	0	41	41	0	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	A	11.04	1.523127	0.27211	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.69926	-0.4;-0.44;-0.38;-0.44	6.08	6.08	0.98989	.	0.085573	0.85682	D	0.000000	T	0.77691	0.4168	M	0.75085	2.285	0.58432	D	0.999994	P;P;P;D	0.56968	0.955;0.553;0.712;0.978	P;B;B;P	0.54629	0.726;0.287;0.381;0.757	T	0.80721	-0.1256	10	0.87932	D	0	.	15.825	0.78698	1.0:0.0:0.0:0.0	.	328;296;328;328	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	M	328;296;328;296	ENSP00000275780:I328M;ENSP00000340800:I296M;ENSP00000316512:I328M;ENSP00000442311:I296M	ENSP00000316512:I328M	I	+	3	3	TLK2	58004323	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.963000	0.40452	2.333000	0.79357	0.533000	0.62120	ATA	.		0.423	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
GAREM	64762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	29867256	29867256	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr18:29867256A>G	ENST00000269209.6	-	4	1307	c.1304T>C	c.(1303-1305)tTc>tCc	p.F435S	GAREM_ENST00000399218.4_Missense_Mutation_p.F435S|RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'Flank			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	435					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AGCTTCTGGGAAAAGGTAGTC	0.557																																					p.F435S		.											.	.	0			c.T1304C						.						103.0	109.0	107.0					18																	29867256		2203	4300	6503	SO:0001583	missense	64762	exon4			TCTGGGAAAAGGT	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1304T>C	18.37:g.29867256A>G	ENSP00000269209:p.Phe435Ser	211	0		210	69	NM_022751	0	0	28	58	30	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	A	0.031	-1.336778	0.01287	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.13538	2.58;2.58	5.65	5.65	0.86999	.	0.136032	0.64402	D	0.000002	T	0.09468	0.0233	N	0.12182	0.205	0.58432	D	0.99999	B;B	0.17852	0.024;0.012	B;B	0.20577	0.03;0.019	T	0.28839	-1.0031	10	0.22109	T	0.4	-29.2932	16.1512	0.81624	1.0:0.0:0.0:0.0	.	435;435	Q9H706;Q9H706-3	FA59A_HUMAN;.	S	435	ENSP00000382165:F435S;ENSP00000269209:F435S	ENSP00000269209:F435S	F	-	2	0	FAM59A	28121254	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	7.042000	0.76565	2.275000	0.75901	0.459000	0.35465	TTC	.		0.557	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
MBD1	4152	hgsc.bcm.edu;broad.mit.edu	37	18	47800703	47800703	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr18:47800703C>T	ENST00000591416.1	-	11	1430	c.999G>A	c.(997-999)cgG>cgA	p.R333R	MBD1_ENST00000588937.1_Silent_p.R310R|MBD1_ENST00000457839.2_Silent_p.R358R|MBD1_ENST00000269468.5_Silent_p.R333R|MBD1_ENST00000587605.1_Intron|MBD1_ENST00000382948.5_Silent_p.R333R|MBD1_ENST00000591535.1_Silent_p.R310R|MBD1_ENST00000398495.2_Intron|MBD1_ENST00000424334.2_Silent_p.R384R|MBD1_ENST00000339998.6_Silent_p.R333R|MBD1_ENST00000398488.1_Intron|MBD1_ENST00000349085.2_Intron|MBD1_ENST00000398493.1_Intron|MBD1_ENST00000353909.3_Silent_p.R284R|MBD1_ENST00000585595.1_Silent_p.R358R|MBD1_ENST00000590208.1_Silent_p.R333R|MBD1_ENST00000347968.3_Intron|MBD1_ENST00000585672.1_Silent_p.R283R|MBD1_ENST00000269471.5_Silent_p.R310R|MBD1_ENST00000436910.1_Silent_p.R310R			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	333					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						TGCGGTTCTGCCGGCGGTTCG	0.642																																					p.R358R		.											.	MBD1-228	0			c.G1074A						.						23.0	23.0	23.0					18																	47800703		2202	4300	6502	SO:0001819	synonymous_variant	4152	exon12			GTTCTGCCGGCGG	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.999G>A	18.37:g.47800703C>T		68	0		57	3	NM_001204137	0	0	33	33	0	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	ENST00000591416.1	37	CCDS11943.1																																																																																			.		0.642	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
ZNF516	9658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74154041	74154041	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr18:74154041C>T	ENST00000443185.2	-	3	1287	c.970G>A	c.(970-972)Gag>Aag	p.E324K	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		ATCACCTCCTCCTGGACCACG	0.602																																					p.E324K		.											.	ZNF516-69	0			c.G970A						.						64.0	73.0	70.0					18																	74154041		2178	4264	6442	SO:0001583	missense	9658	exon3			CCTCCTCCTGGAC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.970G>A	18.37:g.74154041C>T	ENSP00000394757:p.Glu324Lys	98	0		87	24	NM_014643	0	0	3	6	3		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	C	25.9	4.681412	0.88542	.	.	ENSG00000101493	ENST00000443185	T	0.11495	2.77	4.97	4.97	0.65823	.	0.095344	0.49916	D	0.000140	T	0.36138	0.0956	.	.	.	0.54753	D	0.999984	D	0.76494	0.999	D	0.80764	0.994	T	0.12604	-1.0541	9	0.62326	D	0.03	-3.4552	18.4275	0.90614	0.0:1.0:0.0:0.0	.	324	Q92618	ZN516_HUMAN	K	324	ENSP00000394757:E324K	ENSP00000394757:E324K	E	-	1	0	ZNF516	72283029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.572000	0.67411	2.578000	0.87016	0.655000	0.94253	GAG	.		0.602	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
CD209	30835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7810714	7810714	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:7810714G>A	ENST00000315599.7	-	4	460	c.438C>T	c.(436-438)atC>atT	p.I146I	CD209_ENST00000593821.1_Silent_p.I102I|CD209_ENST00000601951.1_Silent_p.I122I|CD209_ENST00000601256.1_Silent_p.I122I|CD209_ENST00000204801.8_Silent_p.I102I|CD209_ENST00000394173.4_Intron|CD209_ENST00000593660.1_Silent_p.I122I|CD209_ENST00000354397.6_Silent_p.I146I|CD209_ENST00000602261.1_Silent_p.I146I|CD209_ENST00000301357.8_Intron|CD209_ENST00000394161.5_Intron|CD209_ENST00000315591.8_Silent_p.I122I	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	146	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCTCCTGGTAGATCTCCTGCA	0.547																																					p.I146I		.											.	CD209-91	0			c.C438T						.						106.0	105.0	105.0					19																	7810714		2197	4299	6496	SO:0001819	synonymous_variant	30835	exon4			CTGGTAGATCTCC	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.438C>T	19.37:g.7810714G>A		367	0		237	73	NM_021155	0	0	4	4	0	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Silent	SNP	ENST00000315599.7	37	CCDS12186.1																																																																																			.		0.547	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155	
BRD4	23476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15350519	15350519	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:15350519C>T	ENST00000263377.2	-	16	3617	c.3396G>A	c.(3394-3396)gaG>gaA	p.E1132E		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1132	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GCTTGGGGGGCTCCGGCCGCA	0.711			T	C15orf55	lethal midline carcinoma of young people																																p.E1132E		.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4-767	0			c.G3396A						.						19.0	26.0	24.0					19																	15350519		2159	4231	6390	SO:0001819	synonymous_variant	23476	exon16			GGGGGGCTCCGGC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3396G>A	19.37:g.15350519C>T		88	0		69	27	NM_058243	0	0	22	40	18	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	37	CCDS12328.1																																																																																			.		0.711	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40419757	40419757	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:40419757A>G	ENST00000221347.6	-	6	3244	c.3237T>C	c.(3235-3237)caT>caC	p.H1079H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1079	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCAGCTTGCTATGGCACTCCC	0.642																																					p.H1079H		.											.	FCGBP-98	0			c.T3237C						.						70.0	65.0	67.0					19																	40419757		2203	4300	6503	SO:0001819	synonymous_variant	8857	exon6			CTTGCTATGGCAC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3237T>C	19.37:g.40419757A>G		181	0		162	44	NM_003890	0	0	24	24	0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
HRC	3270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49658077	49658077	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:49658077C>G	ENST00000252825.4	-	1	604	c.418G>C	c.(418-420)Gaa>Caa	p.E140Q	HRC_ENST00000595625.1_Missense_Mutation_p.E140Q|TRPM4_ENST00000252826.5_5'Flank|TRPM4_ENST00000427978.2_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	140	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TCCGTGTCTTCACTCCCGTGG	0.597																																					p.E140Q	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.G418C						.						176.0	128.0	144.0					19																	49658077		2203	4300	6503	SO:0001583	missense	3270	exon1			TGTCTTCACTCCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.418G>C	19.37:g.49658077C>G	ENSP00000252825:p.Glu140Gln	152	0		113	34	NM_002152	0	0	1	1	0	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264155	0.59431	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06933	3.24	2.6	2.6	0.31112	.	.	.	.	.	T	0.24624	0.0597	M	0.73217	2.22	0.23923	N	0.996455	D	0.89917	1.0	D	0.79108	0.992	T	0.03000	-1.1084	9	0.35671	T	0.21	-0.6964	11.3389	0.49520	0.0:1.0:0.0:0.0	.	140	P23327	SRCH_HUMAN	Q	140;110	ENSP00000252825:E140Q	ENSP00000252825:E140Q	E	-	1	0	HRC	54349889	0.062000	0.20869	0.037000	0.18230	0.019000	0.09904	1.982000	0.40638	1.775000	0.52247	0.462000	0.41574	GAA	.		0.597	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
VN1R2	317701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53762787	53762787	+	Nonsense_Mutation	SNP	C	C	T	rs374706531		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:53762787C>T	ENST00000341702.3	+	1	1243	c.1159C>T	c.(1159-1161)Cga>Tga	p.R387*	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	387					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AAGAAATAGACGATTCTTTCA	0.433																																					p.R387X		.											.	VN1R2-90	0			c.C1159T						.						105.0	103.0	104.0					19																	53762787		2203	4300	6503	SO:0001587	stop_gained	317701	exon1			AATAGACGATTCT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1159C>T	19.37:g.53762787C>T	ENSP00000351244:p.Arg387*	165	0		139	35	NM_173856	0	0	0	0	0	A1L411|Q8TDU4	Nonsense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024586	0.35701	.	.	ENSG00000196131	ENST00000341702	.	.	.	2.92	-5.84	0.02318	.	.	.	.	.	.	.	.	.	.	.	0.20764	N	0.999858	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.3458	0.04271	0.3322:0.4169:0.1115:0.1395	.	.	.	.	X	387	.	ENSP00000351244:R387X	R	+	1	2	VN1R2	58454599	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.676000	0.00396	-3.923000	0.00091	-0.582000	0.04134	CGA	C|1.000;T|0.000		0.433	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
LRPPRC	10128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44139638	44139638	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:44139638A>G	ENST00000260665.7	-	30	3265	c.3208T>C	c.(3208-3210)Tac>Cac	p.Y1070H		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1070					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGATTGCTGTAGGTTTCAGCA	0.313																																					p.Y1070H		.											.	LRPPRC-93	0			c.T3208C						.						112.0	107.0	109.0					2																	44139638		2202	4297	6499	SO:0001583	missense	10128	exon30			TGCTGTAGGTTTC	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3208T>C	2.37:g.44139638A>G	ENSP00000260665:p.Tyr1070His	58	0		86	33	NM_133259	0	0	72	158	86	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643279	0.67244	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.13420	2.59	5.78	5.78	0.91487	.	0.065106	0.64402	D	0.000006	T	0.40272	0.1110	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.27773	-1.0064	10	0.66056	D	0.02	-5.0562	15.7709	0.78167	1.0:0.0:0.0:0.0	.	970;1070	F5H4J6;P42704	.;LPPRC_HUMAN	H	970;1070	ENSP00000260665:Y1070H	ENSP00000260665:Y1070H	Y	-	1	0	LRPPRC	43993142	1.000000	0.71417	0.283000	0.24790	0.010000	0.07245	7.018000	0.76406	2.205000	0.71048	0.533000	0.62120	TAC	.		0.313	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
MTHFD2	10797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74441208	74441208	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:74441208G>A	ENST00000394053.2	+	8	972	c.892G>A	c.(892-894)Gtc>Atc	p.V298I	RP11-287D1.3_ENST00000451608.2_Intron|MTHFD2_ENST00000394050.3_Missense_Mutation_p.V134I|MTHFD2_ENST00000409601.1_Missense_Mutation_p.V215I|MTHFD2_ENST00000264090.4_Missense_Mutation_p.V196I|MTHFD2_ENST00000409804.1_Missense_Mutation_p.V170I|SLC4A5_ENST00000483195.1_5'Flank	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	298					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	CTATGTAGGAGTCAGACAAAA	0.398																																					p.V298I		.											.	MTHFD2-90	0			c.G892A						.						110.0	119.0	116.0					2																	74441208		2029	4215	6244	SO:0001583	missense	10797	exon8			GTAGGAGTCAGAC	X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.892G>A	2.37:g.74441208G>A	ENSP00000377617:p.Val298Ile	274	0		244	71	NM_006636	0	0	0	0	0	Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	ENST00000394053.2	37	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540151	0.85917	.	.	ENSG00000065911	ENST00000394053;ENST00000409804;ENST00000264090;ENST00000394050;ENST00000409601	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.37	5.58	5.58	0.84498	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.114477	0.64402	D	0.000017	T	0.78291	0.4260	M	0.82323	2.585	0.80722	D	1	D;D	0.71674	0.988;0.998	D;D	0.74023	0.919;0.982	T	0.80569	-0.1324	10	0.72032	D	0.01	.	17.4533	0.87599	0.0:0.0:1.0:0.0	.	215;298	B8ZZU9;P13995	.;MTDC_HUMAN	I	298;170;196;134;215	ENSP00000377617:V298I;ENSP00000386536:V170I;ENSP00000264090:V196I;ENSP00000377614:V134I;ENSP00000386542:V215I	ENSP00000264090:V196I	V	+	1	0	MTHFD2	74294716	1.000000	0.71417	0.821000	0.32701	0.724000	0.41520	9.415000	0.97375	2.813000	0.96785	0.655000	0.94253	GTC	.		0.398	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		
IL1RL2	8808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102849533	102849533	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:102849533C>T	ENST00000264257.2	+	10	1372	c.1246C>T	c.(1246-1248)Caa>Taa	p.Q416*	IL1RL2_ENST00000539491.1_Nonsense_Mutation_p.Q416*|IL1RL2_ENST00000441515.2_Nonsense_Mutation_p.Q298*|IL1RL2_ENST00000481806.1_3'UTR	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	416	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						GTTGGAGAGACAATGTGGATA	0.453																																					p.Q416X		.											.	IL1RL2-92	0			c.C1246T						.						116.0	111.0	113.0					2																	102849533		2203	4300	6503	SO:0001587	stop_gained	8808	exon10			GAGAGACAATGTG	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.1246C>T	2.37:g.102849533C>T	ENSP00000264257:p.Gln416*	127	0		128	38	NM_003854	0	0	1	2	1	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Nonsense_Mutation	SNP	ENST00000264257.2	37	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	C	36	5.844802	0.97016	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	.	.	.	6.07	6.07	0.98685	.	0.205036	0.43919	D	0.000507	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	416;298;416	.	ENSP00000264257:Q416X	Q	+	1	0	IL1RL2	102215965	0.985000	0.35326	1.000000	0.80357	0.447000	0.32167	2.970000	0.49240	2.885000	0.99019	0.655000	0.94253	CAA	.		0.453	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
IL1RN	3557	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	113885204	113885204	+	Start_Codon_SNP	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:113885204G>A	ENST00000409930.3	+	1	67	c.3G>A	c.(1-3)atG>atA	p.M1I	IL1RN_ENST00000354115.2_Intron|IL1RN_ENST00000259206.5_Intron|IL1RN_ENST00000361779.3_Intron|IL1RN_ENST00000409052.1_Intron	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	1					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)			breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	GTCACAGAATGGAAATCTGCA	0.532									Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.M1I													.	IL1RN-92	0			c.G3A						.						52.0	56.0	55.0					2																	113885204		1327	2309	3636	SO:0001582	initiator_codon_variant	3557	exon1	Familial Cancer Database	Lichen Sclerosis, Familial	CAGAATGGAAATC	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.3G>A	2.37:g.113885204G>A	ENSP00000387173:p.Met1Ile	58	0		54	12	NM_173842	0	0	4	4	0	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	37	CCDS46396.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054017	0.55218	.	.	ENSG00000136689	ENST00000409930	T	0.38722	1.12	5.24	5.24	0.73138	.	.	.	.	.	T	0.62804	0.2458	.	.	.	0.48975	D	0.999733	D	0.57899	0.981	D	0.65140	0.932	T	0.66412	-0.5930	8	0.87932	D	0	.	14.6809	0.69017	0.0:0.0:1.0:0.0	.	1	P18510	IL1RA_HUMAN	I	1	ENSP00000387173:M1I	ENSP00000387173:M1I	M	+	3	0	IL1RN	113601675	1.000000	0.71417	0.771000	0.31576	0.114000	0.19823	4.363000	0.59473	2.604000	0.88044	0.655000	0.94253	ATG	.		0.532	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841	Missense_Mutation
KIF5C	3800	hgsc.bcm.edu	37	2	149850958	149850958	+	Silent	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:149850958G>C	ENST00000435030.1	+	17	2297	c.1929G>C	c.(1927-1929)ctG>ctC	p.L643L	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000397413.1_Silent_p.L411L|KIF5C_ENST00000414838.2_Silent_p.L548L			O60282	KIF5C_HUMAN	kinesin family member 5C	643					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		TCAAGTCTCTGACAGACTACA	0.498																																					p.L643L		.											.	KIF5C-69	0			c.G1929C						.						34.0	36.0	36.0					2																	149850958		1969	4163	6132	SO:0001819	synonymous_variant	3800	exon17			GTCTCTGACAGAC	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1929G>C	2.37:g.149850958G>C		13	0		11	3	NM_004522	0	0	0	0	0	O95079|Q2YDC5	Silent	SNP	ENST00000435030.1	37																																																																																				.		0.498	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
PSMD14	10213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	162227815	162227815	+	Silent	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:162227815T>C	ENST00000409682.3	+	7	1148	c.444T>C	c.(442-444)atT>atC	p.I148I		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	148					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						TGGATCCCATTCAGAGTGTAA	0.408																																					p.I148I		.											.	PSMD14-433	0			c.T444C						.						121.0	120.0	121.0					2																	162227815		1930	4131	6061	SO:0001819	synonymous_variant	10213	exon7			TCCCATTCAGAGT	U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.444T>C	2.37:g.162227815T>C		25	0		20	4	NM_005805	0	0	82	155	73	B3KNW2|O00176	Silent	SNP	ENST00000409682.3	37	CCDS46437.1																																																																																			.		0.408	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805	
NBEAL1	65065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	204039877	204039877	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:204039877A>T	ENST00000449802.1	+	41	6577	c.6244A>T	c.(6244-6246)Aat>Tat	p.N2082Y		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2082	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CAGATATGAAAATTTTGAGGA	0.333																																					p.N2082Y		.											.	NBEAL1-92	0			c.A6244T						.						66.0	66.0	66.0					2																	204039877		1802	4060	5862	SO:0001583	missense	65065	exon41			TATGAAAATTTTG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6244A>T	2.37:g.204039877A>T	ENSP00000399903:p.Asn2082Tyr	93	0		83	27	NM_001114132	0	0	0	0	0	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547864	0.86022	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	T;T	0.80304	-1.36;-1.36	5.92	5.92	0.95590	BEACH domain (4);	0.091060	0.85682	D	0.000000	D	0.82300	0.5007	L	0.28649	0.875	0.54753	D	0.999985	P;P	0.48016	0.904;0.904	P;P	0.57371	0.819;0.748	T	0.82971	-0.0192	10	0.48119	T	0.1	.	16.0292	0.80564	1.0:0.0:0.0:0.0	.	2082;2071	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	Y	2082;2082;97	ENSP00000399903:N2082Y;ENSP00000388466:N97Y	ENSP00000344985:N2082Y	N	+	1	0	NBEAL1	203748122	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.287000	0.95975	2.254000	0.74563	0.528000	0.53228	AAT	.		0.333	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
GIGYF2	26058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233660917	233660917	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:233660917A>G	ENST00000409547.1	+	16	1936	c.1625A>G	c.(1624-1626)cAg>cGg	p.Q542R	GIGYF2_ENST00000409451.3_Missense_Mutation_p.Q563R|GIGYF2_ENST00000373566.3_Missense_Mutation_p.Q564R|GIGYF2_ENST00000409196.3_Missense_Mutation_p.Q536R|GIGYF2_ENST00000409480.1_Missense_Mutation_p.Q564R|GIGYF2_ENST00000373563.4_Missense_Mutation_p.Q542R|GIGYF2_ENST00000452341.2_Missense_Mutation_p.Q373R	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	542	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AAAGATCCTCAGGGAGAAATT	0.378																																					p.Q563R		.											.	GIGYF2-28	0			c.A1688G						.						121.0	117.0	118.0					2																	233660917		2203	4300	6503	SO:0001583	missense	26058	exon16			ATCCTCAGGGAGA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1625A>G	2.37:g.233660917A>G	ENSP00000386537:p.Gln542Arg	117	0		136	33	NM_001103147	0	0	19	38	19	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.654738	0.88056	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;D;T;T;T;T	0.81579	-1.35;-1.33;-1.35;-1.33;-1.51;-1.32;-1.35;-1.45;-1.27	5.68	5.68	0.88126	GYF (4);	0.000000	0.85682	D	0.000000	D	0.91529	0.7325	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.71674	0.994;0.998;0.997;0.969	D;D;D;D	0.83275	0.986;0.996;0.992;0.968	D	0.93157	0.6554	10	0.87932	D	0	-17.6236	16.2119	0.82168	1.0:0.0:0.0:0.0	.	373;563;542;536	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	R	564;485;542;564;542;542;485;536;563;536;373	ENSP00000362667:Q564R;ENSP00000362664:Q542R;ENSP00000386765:Q564R;ENSP00000386537:Q542R;ENSP00000404195:Q485R;ENSP00000387070:Q536R;ENSP00000387170:Q563R;ENSP00000410297:Q536R;ENSP00000411505:Q373R	ENSP00000362664:Q542R	Q	+	2	0	GIGYF2	233369161	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.287000	0.95975	2.288000	0.76882	0.482000	0.46254	CAG	.		0.378	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
SLC24A3	57419	hgsc.bcm.edu;ucsc.edu	37	20	19679325	19679325	+	Splice_Site	SNP	G	G	C	rs201062990		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr20:19679325G>C	ENST00000328041.6	+	15	1916		c.e15+1		RP4-718D20.3_ENST00000598694.1_RNA|RP4-718D20.3_ENST00000609846.1_RNA|RP4-718D20.3_ENST00000435992.2_RNA|RP4-718D20.3_ENST00000593770.1_RNA|RP4-718D20.3_ENST00000600889.1_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3						ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CGGATCCTACGTAAGTGGTTT	0.542																																					.		.											.	SLC24A3-91	0			c.1719+1G>C						.						79.0	63.0	68.0					20																	19679325		2203	4299	6502	SO:0001630	splice_region_variant	57419	exon15			TCCTACGTAAGTG	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1719+1G>C	20.37:g.19679325G>C		14	0		19	9	NM_020689	0	0	0	3	3	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Splice_Site	SNP	ENST00000328041.6	37	CCDS13140.1	.	.	.	.	.	.	.	.	.	.	G	32	5.120039	0.94385	.	.	ENSG00000185052	ENST00000328041	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8252	0.92115	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC24A3	19627325	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	9.869000	0.99810	2.758000	0.94735	0.561000	0.74099	.	G|0.999;A|0.000		0.542	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	Intron
DPM1	8813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49576203	49576203	+	5'Flank	SNP	T	T	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr20:49576203T>G	ENST00000371588.5	-	0	0				DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371583.5_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.L275W	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						AGTGGCAGCTTGTTGCTCTTT	0.632																																					p.L275W		.											.	MOCS3-93	0			c.T824G						.						46.0	51.0	50.0					20																	49576203		2203	4300	6503	SO:0001631	upstream_gene_variant	27304	exon1			GCAGCTTGTTGCT	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49576203T>G	Exception_encountered	104	0		120	63	NM_014484	0	0	10	37	27	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.243077	0.58995	.	.	ENSG00000124217	ENST00000244051	T	0.37058	1.22	5.27	5.27	0.74061	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);MoeZ/MoeB (1);	0.229560	0.37483	N	0.002066	T	0.75824	0.3902	H	0.98965	4.385	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.86356	0.1714	9	.	.	.	-5.0901	15.1888	0.73025	0.0:0.0:0.0:1.0	.	275	O95396	MOCS3_HUMAN	W	275	ENSP00000244051:L275W	.	L	+	2	0	MOCS3	49009610	1.000000	0.71417	0.918000	0.36340	0.234000	0.25298	5.437000	0.66544	1.992000	0.58205	0.459000	0.35465	TTG	.		0.632	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
NFATC2	4773	broad.mit.edu	37	20	50092014	50092014	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr20:50092014T>G	ENST00000396009.3	-	4	1735	c.1516A>C	c.(1516-1518)Aaa>Caa	p.K506Q	NFATC2_ENST00000371564.3_Missense_Mutation_p.K506Q|NFATC2_ENST00000414705.1_Missense_Mutation_p.K486Q|NFATC2_ENST00000610033.1_Missense_Mutation_p.K287Q|NFATC2_ENST00000609943.1_Missense_Mutation_p.K486Q|NFATC2_ENST00000609507.1_Missense_Mutation_p.K287Q	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	506	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K506Q(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					ATGTTGTTTTTGGGCTCCAAG	0.577																																					p.K506Q													.	NFATC2-92	1	Substitution - Missense(1)	prostate(1)	c.A1516C						.						181.0	186.0	184.0					20																	50092014		2203	4300	6503	SO:0001583	missense	4773	exon4			TGTTTTTGGGCTC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1516A>C	20.37:g.50092014T>G	ENSP00000379330:p.Lys506Gln	213	0		240	3	NM_012340	0	0	3	3	0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597747	0.66332	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.45276	0.9;0.9;0.9	5.26	5.26	0.73747	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57344	0.2047	L	0.43152	1.355	0.45528	D	0.998486	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.998;0.988;0.998;0.998	T	0.60500	-0.7251	10	0.72032	D	0.01	-14.8818	15.1948	0.73078	0.0:0.0:0.0:1.0	.	486;486;506;506	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	Q	506;506;486	ENSP00000360619:K506Q;ENSP00000379330:K506Q;ENSP00000396471:K486Q	ENSP00000360619:K506Q	K	-	1	0	NFATC2	49525421	1.000000	0.71417	0.982000	0.44146	0.941000	0.58515	3.350000	0.52224	1.982000	0.57802	0.477000	0.44152	AAA	.		0.577	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
ARVCF	421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19965495	19965495	+	Missense_Mutation	SNP	C	C	G	rs373958610		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr22:19965495C>G	ENST00000263207.3	-	8	1975	c.1684G>C	c.(1684-1686)Gac>Cac	p.D562H	ARVCF_ENST00000406522.1_Missense_Mutation_p.D499H|ARVCF_ENST00000406259.1_Missense_Mutation_p.D562H|ARVCF_ENST00000344269.3_Missense_Mutation_p.D499H|ARVCF_ENST00000401994.1_Missense_Mutation_p.D499H	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	562					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					TTGTCAGTGTCCTTCCGGCCC	0.652																																					p.D562H		.											.	ARVCF-91	0			c.G1684C						.						61.0	50.0	54.0					22																	19965495		2203	4300	6503	SO:0001583	missense	421	exon8			CAGTGTCCTTCCG		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1684G>C	22.37:g.19965495C>G	ENSP00000263207:p.Asp562His	77	0		58	16	NM_001670	0	0	0	2	2	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145373	0.77888	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	4.03	4.03	0.46877	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.973;0.999	D	0.89030	0.3441	9	.	.	.	-17.2062	17.0615	0.86548	0.0:1.0:0.0:0.0	.	562;84	O00192;E7EV58	ARVC_HUMAN;.	H	562;499;499;499;562	ENSP00000263207:D562H;ENSP00000342042:D499H;ENSP00000384341:D499H;ENSP00000384732:D499H;ENSP00000385444:D562H	.	D	-	1	0	ARVCF	18345495	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	5.569000	0.67391	2.541000	0.85698	0.655000	0.94253	GAC	.		0.652	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
CCR3	1232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	46307340	46307340	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:46307340A>G	ENST00000357422.2	+	4	1234	c.691A>G	c.(691-693)Agt>Ggt	p.S231G	CCR3_ENST00000541018.1_Missense_Mutation_p.S231G|CCR3_ENST00000395940.2_Missense_Mutation_p.S231G|CCR3_ENST00000395942.2_Missense_Mutation_p.S231G|CCR3_ENST00000545097.1_Missense_Mutation_p.S252G			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	231					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		GAGGTGCCCCAGTAAAAAAAA	0.463																																					p.S252G		.											.	CCR3-660	0			c.A754G						.						73.0	72.0	72.0					3																	46307340		2203	4300	6503	SO:0001583	missense	1232	exon3			TGCCCCAGTAAAA	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.691A>G	3.37:g.46307340A>G	ENSP00000350003:p.Ser231Gly	101	0		62	28	NM_178328	0	0	0	0	0	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.712194	0.30322	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.96	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.34424	0.0897	N	0.21448	0.665	0.09310	N	1	B;B	0.14805	0.009;0.011	B;B	0.23150	0.036;0.044	T	0.31166	-0.9953	9	0.66056	D	0.02	.	9.5513	0.39313	0.8017:0.0:0.1983:0.0	.	252;231	F5GWL6;P51677	.;CCR3_HUMAN	G	231;252;231;231;231	ENSP00000350003:S231G;ENSP00000441600:S252G;ENSP00000440097:S231G;ENSP00000379271:S231G;ENSP00000379273:S231G	ENSP00000350003:S231G	S	+	1	0	CCR3	46282344	0.001000	0.12720	0.041000	0.18516	0.744000	0.42396	1.757000	0.38400	0.158000	0.19367	0.533000	0.62120	AGT	.		0.463	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
PLXNB1	5364	ucsc.edu	37	3	48447207	48447207	+	Splice_Site	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:48447207T>C	ENST00000358536.4	-	37	6498		c.e37-2		PLXNB1_ENST00000296440.6_Splice_Site|PLXNB1_ENST00000358459.4_Splice_Site|PLXNB1_ENST00000456774.1_Splice_Site|PLXNB1_ENST00000448774.2_Splice_Site	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1						axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGAGTAGTTCTAGGGAAGAGG	0.612																																					.													.	PLXNB1-293	0			c.6229-2A>G						.						49.0	48.0	48.0					3																	48447207		2203	4300	6503	SO:0001630	splice_region_variant	5364	exon38			TAGTTCTAGGGAA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.6229-2A>G	3.37:g.48447207T>C		55	0		47	1	NM_002673	0	0	1	1	0	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Splice_Site	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.040651	0.55003	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.461	0.67450	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNB1	48422211	1.000000	0.71417	0.991000	0.47740	0.495000	0.33615	6.184000	0.72008	2.021000	0.59480	0.528000	0.53228	.	.		0.612	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	Intron
GNAI2	2771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50294280	50294280	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:50294280A>C	ENST00000313601.6	+	6	1103	c.719A>C	c.(718-720)gAg>gCg	p.E240A	GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000536647.1_Missense_Mutation_p.E159A|GNAI2_ENST00000422163.1_Missense_Mutation_p.E224A|GNAI2_ENST00000440628.1_Missense_Mutation_p.E188A|GNAI2_ENST00000451956.1_Missense_Mutation_p.E203A|GNAI2_ENST00000266027.5_Missense_Mutation_p.E224A	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	240					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GAGGACGAGGAGATGGTGAGA	0.577																																					p.E240A		.											.	GNAI2-417	0			c.A719C						.						113.0	107.0	109.0					3																	50294280		2203	4300	6503	SO:0001583	missense	2771	exon6			ACGAGGAGATGGT	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.719A>C	3.37:g.50294280A>C	ENSP00000312999:p.Glu240Ala	105	0		87	35	NM_002070	0	0	0	0	0	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	37	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703847	0.68501	.	.	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	4.62	4.62	0.57501	.	0.117678	0.64402	D	0.000009	T	0.67924	0.2945	M	0.77103	2.36	0.80722	D	1	B;B;B;B	0.17852	0.002;0.007;0.024;0.019	B;B;B;B	0.23852	0.049;0.049;0.049;0.029	T	0.69928	-0.5012	10	0.72032	D	0.01	.	12.3095	0.54920	1.0:0.0:0.0:0.0	.	203;240;224;224	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	A	224;240;159;240;188;203;224	ENSP00000406871:E224A;ENSP00000312999:E240A;ENSP00000444360:E159A;ENSP00000395736:E188A;ENSP00000406369:E203A;ENSP00000266027:E224A	ENSP00000266027:E224A	E	+	2	0	GNAI2	50269284	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.285000	0.78660	2.088000	0.63022	0.459000	0.35465	GAG	.		0.577	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376113	113376113	+	Silent	SNP	C	C	T	rs62265537|rs59601191|rs112313093|rs59990801|rs397990842|rs10606566		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:113376113C>T	ENST00000478658.1	-	5	4433	c.4416G>A	c.(4414-4416)caG>caA	p.Q1472Q	KIAA2018_ENST00000316407.4_Silent_p.Q1472Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1472	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgctgttgctgctgctgct	0.502																																					p.Q1472Q		.											.	KIAA2018-93	0			c.G4416A						.						68.0	71.0	70.0					3																	113376113		2188	4274	6462	SO:0001819	synonymous_variant	205717	exon7			CTGTTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4416G>A	3.37:g.113376113C>T		42	2		46	7	NM_001009899	0	0	8	9	1	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.502	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ZXDC	79364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	126194470	126194470	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:126194470T>C	ENST00000389709.3	-	1	292	c.239A>G	c.(238-240)gAa>gGa	p.E80G	ZXDC_ENST00000336332.5_Missense_Mutation_p.E80G	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	80					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		GTGCGGCACTTCCAGCAGCAC	0.766																																					p.E80G		.											.	ZXDC-91	0			c.A239G						.						10.0	11.0	10.0					3																	126194470		1178	2759	3937	SO:0001583	missense	79364	exon1			GGCACTTCCAGCA	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.239A>G	3.37:g.126194470T>C	ENSP00000374359:p.Glu80Gly	40	0		18	11	NM_025112	0	0	0	0	0	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	ENST00000389709.3	37	CCDS43145.1	.	.	.	.	.	.	.	.	.	.	T	7.919	0.738083	0.15574	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.29142	1.58;1.58	3.22	1.97	0.26223	.	3.885840	0.01408	U	0.013872	T	0.25269	0.0614	L	0.40543	1.245	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.001	T	0.10800	-1.0614	10	0.23891	T	0.37	-0.3189	3.4994	0.07668	0.0:0.1312:0.2352:0.6336	.	80;80	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	G	80	ENSP00000374359:E80G;ENSP00000337694:E80G	ENSP00000337694:E80G	E	-	2	0	ZXDC	127677160	0.000000	0.05858	0.272000	0.24630	0.077000	0.17291	0.070000	0.14573	0.233000	0.21120	0.358000	0.22013	GAA	.		0.766	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
C4orf36	132989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	87809274	87809274	+	Splice_Site	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:87809274A>T	ENST00000473559.1	-	6	883	c.220T>A	c.(220-222)Tct>Act	p.S74T	C4orf36_ENST00000295898.3_Splice_Site_p.S74T|C4orf36_ENST00000503001.1_5'Flank			Q96KX1	CD036_HUMAN	chromosome 4 open reading frame 36	74										breast(1)|kidney(1)|lung(1)|prostate(1)	4		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		AGGAACTTACATTCTGCAGAA	0.363																																					p.S74T		.											.	C4orf36-90	0			c.T220A						.						65.0	66.0	66.0					4																	87809274		2203	4300	6503	SO:0001630	splice_region_variant	132989	exon3			ACTTACATTCTGC	BC016746	CCDS3615.1	4q21.3	2008-02-05			ENSG00000163633	ENSG00000163633			28386	protein-coding gene	gene with protein product						12477932	Standard	NM_144645		Approved	MGC26744	uc003hqe.4	Q96KX1	OTTHUMG00000130597	ENST00000473559.1:c.220+1T>A	4.37:g.87809274A>T		101	0		89	25	NM_144645	0	0	0	0	0		Missense_Mutation	SNP	ENST00000473559.1	37	CCDS3615.1	.	.	.	.	.	.	.	.	.	.	A	7.943	0.743153	0.15642	.	.	ENSG00000163633	ENST00000295898;ENST00000473559;ENST00000506308;ENST00000504008	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.13	-6.29	0.02013	.	1.537520	0.03676	N	0.244784	T	0.22003	0.0530	N	0.17082	0.46	0.23249	N	0.99805	B	0.06786	0.001	B	0.08055	0.003	T	0.13764	-1.0497	9	.	.	.	0.0079	6.0792	0.19933	0.2272:0.2261:0.0:0.5468	.	74	Q96KX1	CD036_HUMAN	T	74	ENSP00000295898:S74T;ENSP00000420949:S74T;ENSP00000421141:S74T;ENSP00000422720:S74T	.	S	-	1	0	C4orf36	88028298	0.908000	0.30866	0.122000	0.21767	0.240000	0.25518	-0.311000	0.08124	-0.602000	0.05775	0.482000	0.46254	TCT	.		0.363	C4orf36-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253045.2	NM_144645	Missense_Mutation
PLK4	10733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	128812805	128812805	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:128812805C>A	ENST00000270861.5	+	9	2281	c.2007C>A	c.(2005-2007)aaC>aaA	p.N669K	PLK4_ENST00000514379.1_Missense_Mutation_p.N628K|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000515069.1_Missense_Mutation_p.N591K|PLK4_ENST00000513090.1_Missense_Mutation_p.N637K|PLK4_ENST00000507249.1_Missense_Mutation_p.N608K	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	669					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CTACTGACAACATCAGTAGGT	0.318																																					p.N669K	Colon(135;508 1718 19061 31832 42879)	.											.	PLK4-333	0			c.C2007A						.						89.0	97.0	94.0					4																	128812805		2203	4300	6503	SO:0001583	missense	10733	exon9			TGACAACATCAGT	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2007C>A	4.37:g.128812805C>A	ENSP00000270861:p.Asn669Lys	162	0		176	59	NM_014264	0	0	1	1	0	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.175146	0.57692	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.07	2.4	0.29515	.	0.153463	0.56097	D	0.000021	T	0.32255	0.0823	L	0.51422	1.61	0.35092	D	0.764371	P;P	0.47762	0.9;0.839	P;B	0.48400	0.576;0.372	T	0.41360	-0.9513	10	0.59425	D	0.04	-4.1709	7.6088	0.28118	0.1342:0.724:0.0:0.1418	.	637;669	O00444-2;O00444	.;PLK4_HUMAN	K	669;591;637;608;628	ENSP00000270861:N669K;ENSP00000421774:N591K;ENSP00000427554:N637K;ENSP00000423412:N608K;ENSP00000423582:N628K	ENSP00000270861:N669K	N	+	3	2	PLK4	129032255	0.963000	0.33076	0.983000	0.44433	0.892000	0.51952	0.033000	0.13754	0.309000	0.22966	0.467000	0.42956	AAC	.		0.318	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
FHDC1	85462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	153896859	153896859	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:153896859G>A	ENST00000511601.1	+	12	2604	c.2416G>A	c.(2416-2418)Ggc>Agc	p.G806S	FHDC1_ENST00000260008.3_Missense_Mutation_p.G806S			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	806									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GGAAGGGGATGGCTCCATGTC	0.652																																					p.G806S		.											.	FHDC1-136	0			c.G2416A						.						51.0	61.0	58.0					4																	153896859		2203	4300	6503	SO:0001583	missense	85462	exon11			GGGGATGGCTCCA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2416G>A	4.37:g.153896859G>A	ENSP00000427567:p.Gly806Ser	151	0		139	52	NM_033393	0	0	3	6	3		Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	G	5.523	0.281358	0.10458	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.29917	1.55;1.55	4.95	3.16	0.36331	.	0.771246	0.12008	N	0.508193	T	0.16811	0.0404	L	0.29908	0.895	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.07947	-1.0746	10	0.02654	T	1	.	10.0533	0.42230	0.0:0.1495:0.695:0.1555	.	806	Q9C0D6	FHDC1_HUMAN	S	806	ENSP00000427567:G806S;ENSP00000260008:G806S	ENSP00000260008:G806S	G	+	1	0	FHDC1	154116309	0.062000	0.20869	0.002000	0.10522	0.222000	0.24845	2.052000	0.41316	0.455000	0.26910	0.563000	0.77884	GGC	.		0.652	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1074691	1074691	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:1074691T>G	ENST00000264930.5	-	16	2106	c.2063A>C	c.(2062-2064)aAg>aCg	p.K688T		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	688					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCTCCAGTTCTTGGTGTGGGG	0.657																																					p.K688T		.											.	SLC12A7-138	0			c.A2063C						.						54.0	51.0	52.0					5																	1074691		2201	4299	6500	SO:0001583	missense	10723	exon16			CAGTTCTTGGTGT	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2063A>C	5.37:g.1074691T>G	ENSP00000264930:p.Lys688Thr	103	0		100	31	NM_006598	0	0	0	0	0	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	17.74|17.74	3.464117|3.464117	0.63513|0.63513	.|.	.|.	ENSG00000113504|ENSG00000113504	ENST00000264930|ENST00000513223	D|.	0.99186|.	-5.53|.	3.81|3.81	3.81|3.81	0.43845|0.43845	Amino acid permease domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86682|0.86682	0.5991|0.5991	H|H	0.97707|0.97707	4.06|4.06	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.46912|.	0.886|.	P|.	0.46339|.	0.513|.	D|D	0.89599|0.89599	0.3833|0.3833	10|5	0.87932|.	D|.	0|.	.|.	10.8081|10.8081	0.46529|0.46529	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	688|.	Q9Y666|.	S12A7_HUMAN|.	T|H	688|45	ENSP00000264930:K688T|.	ENSP00000264930:K688T|.	K|Q	-|-	2|3	0|2	SLC12A7|SLC12A7	1127691|1127691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.335000|0.335000	0.28730|0.28730	7.076000|7.076000	0.76806|0.76806	1.501000|1.501000	0.48654|0.48654	0.260000|0.260000	0.18958|0.18958	AAG|CAA	.		0.657	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
PCDHA11	56138	hgsc.bcm.edu;bcgsc.ca	37	5	140250097	140250097	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:140250097G>C	ENST00000398640.2	+	1	1409	c.1409G>C	c.(1408-1410)gGc>gCc	p.G470A	PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACCCACCAGGCTGCCACATC	0.667																																					p.G470A		.											.	PCDHA11-67	0			c.G1409C						.						105.0	109.0	108.0					5																	140250097		2203	4300	6503	SO:0001583	missense	56138	exon1			CACCAGGCTGCCA	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1409G>C	5.37:g.140250097G>C	ENSP00000381636:p.Gly470Ala	272	1		239	23	NM_018902	0	0	0	0	0	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905417	0.52333	.	.	ENSG00000249158	ENST00000398640	T	0.69806	-0.43	5.55	5.55	0.83447	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.80565	0.4647	L	0.58428	1.81	0.51233	D	0.999911	D;D	0.89917	1.0;1.0	D;D	0.91635	0.986;0.999	T	0.81673	-0.0826	9	0.87932	D	0	.	19.1659	0.93557	0.0:0.0:1.0:0.0	.	470;470	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	A	470	ENSP00000381636:G470A	ENSP00000381636:G470A	G	+	2	0	PCDHA11	140230281	1.000000	0.71417	0.897000	0.35233	0.024000	0.10985	4.966000	0.63715	2.618000	0.88619	0.556000	0.70494	GGC	.		0.667	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
F12	2161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176831350	176831350	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:176831350A>G	ENST00000253496.3	-	9	913	c.865T>C	c.(865-867)Tac>Cac	p.Y289H	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	289	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	AGGTCGCAGTACTCCCAGCTC	0.697									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y289H		.											.	F12-90	0			c.T865C						.						16.0	20.0	19.0					5																	176831350		2200	4296	6496	SO:0001583	missense	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	CGCAGTACTCCCA	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.865T>C	5.37:g.176831350A>G	ENSP00000253496:p.Tyr289His	33	0	1934	36	15	NM_000505	0	0	1	5	4	P78339	Missense_Mutation	SNP	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.074641	0.76415	.	.	ENSG00000131187	ENST00000253496	T	0.66460	-0.21	5.45	5.45	0.79879	Kringle (5);Kringle-like fold (1);	0.000000	0.42682	D	0.000679	T	0.73497	0.3594	M	0.75150	2.29	0.80722	D	1	P	0.51537	0.946	P	0.54210	0.745	T	0.74548	-0.3629	10	0.41790	T	0.15	.	9.0885	0.36596	0.9168:0.0:0.0832:0.0	.	289	P00748	FA12_HUMAN	H	289	ENSP00000253496:Y289H	ENSP00000253496:Y289H	Y	-	1	0	F12	176763956	0.924000	0.31332	0.575000	0.28536	0.770000	0.43624	2.546000	0.45778	2.080000	0.62538	0.459000	0.35465	TAC	.		0.697	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31927082	31927082	+	Missense_Mutation	SNP	C	C	A	rs563036739	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:31927082C>A	ENST00000375394.2	+	2	144	c.31C>A	c.(31-33)Cct>Act	p.P11T	NELFE_ENST00000444811.2_5'Flank|NELFE_ENST00000375425.5_5'Flank|MIR1236_ENST00000408340.1_RNA|SKIV2L_ENST00000544581.1_5'UTR|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375429.3_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	11					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						AGTGCTACCCCCTCCAGATCC	0.602																																					p.P11T		.											.	SKIV2L-290	0			c.C31A						.						221.0	230.0	227.0					6																	31927082		2203	4299	6502	SO:0001583	missense	6499	exon2			CTACCCCCTCCAG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.31C>A	6.37:g.31927082C>A	ENSP00000364543:p.Pro11Thr	587	1		457	133	NM_006929	0	0	0	0	0	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	9.522	1.108545	0.20714	.	.	ENSG00000204351	ENST00000375394	T	0.45276	0.9	5.18	3.42	0.39159	.	0.176723	0.50627	D	0.000113	T	0.18130	0.0435	L	0.47716	1.5	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04900	-1.0919	10	0.40728	T	0.16	-13.5646	9.0377	0.36298	0.0:0.8274:0.0:0.1726	.	11	Q15477	SKIV2_HUMAN	T	11	ENSP00000364543:P11T	ENSP00000364543:P11T	P	+	1	0	SKIV2L	32035061	1.000000	0.71417	0.993000	0.49108	0.481000	0.33189	1.932000	0.40143	0.781000	0.33589	0.655000	0.94253	CCT	.		0.602	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51930865	51930865	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:51930865A>G	ENST00000371117.3	-	12	1064	c.789T>C	c.(787-789)tcT>tcC	p.S263S	PKHD1_ENST00000340994.4_Silent_p.S263S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	263	IPT/TIG 3.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGGAAACACAGATAATATTT	0.328																																					p.S263S		.											.	PKHD1-603	0			c.T789C						.						67.0	66.0	66.0					6																	51930865		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon12			AAACACAGATAAT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.789T>C	6.37:g.51930865A>G		66	0		53	15	NM_170724	0	0	1	1	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																			.		0.328	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PARK2	5071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	162864432	162864432	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:162864432C>T	ENST00000366898.1	-	2	183	c.81G>A	c.(79-81)aaG>aaA	p.K27K	PARK2_ENST00000338468.3_5'UTR|PARK2_ENST00000366892.1_Silent_p.K27K|PARK2_ENST00000366896.1_Silent_p.K27K|PARK2_ENST00000366894.1_5'UTR|PARK2_ENST00000366897.1_Silent_p.K27K	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	27	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CAACCACCTCCTTGAGCTGGA	0.542																																					p.K27K		.											.	PARK2-91	0			c.G81A						.						163.0	138.0	146.0					6																	162864432		2203	4300	6503	SO:0001819	synonymous_variant	5071	exon2			CACCTCCTTGAGC		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.81G>A	6.37:g.162864432C>T		197	1		160	47	NM_004562	0	0	10	13	3	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Silent	SNP	ENST00000366898.1	37	CCDS5281.1																																																																																			.		0.542	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
FSCN1	6624	hgsc.bcm.edu;broad.mit.edu	37	7	5633277	5633277	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:5633277G>A	ENST00000382361.3	+	1	824	c.710G>A	c.(709-711)aGc>aAc	p.S237N	FSCN1_ENST00000340250.6_Missense_Mutation_p.S216N	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	237					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		TCGGGGCCCAGCGGCACGCTC	0.716																																					p.S237N		.											.	FSCN1-91	0			c.G710A						.						5.0	5.0	5.0					7																	5633277		1934	3850	5784	SO:0001583	missense	6624	exon1			GGCCCAGCGGCAC	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.710G>A	7.37:g.5633277G>A	ENSP00000371798:p.Ser237Asn	25	0		24	3	NM_003088	0	0	38	65	27	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462789	0.43736	.	.	ENSG00000075618	ENST00000340250;ENST00000382361	T;T	0.44881	0.91;1.48	3.4	2.5	0.30297	Fascin domain (1);Actin cross-linking (1);	0.346255	0.27227	N	0.020326	T	0.38134	0.1029	L	0.56769	1.78	0.45307	D	0.998308	B	0.26809	0.16	B	0.24701	0.055	T	0.34775	-0.9815	10	0.87932	D	0	2.5978	10.5668	0.45177	0.0:0.0:0.805:0.195	.	237	Q16658	FSCN1_HUMAN	N	216;237	ENSP00000339729:S216N;ENSP00000371798:S237N	ENSP00000339729:S216N	S	+	2	0	FSCN1	5599803	0.943000	0.32029	0.992000	0.48379	0.996000	0.88848	0.989000	0.29629	0.627000	0.30340	0.462000	0.41574	AGC	.		0.716	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088	
RELN	5649	broad.mit.edu	37	7	103159949	103159949	+	Silent	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:103159949T>C	ENST00000428762.1	-	49	7842	c.7683A>G	c.(7681-7683)ttA>ttG	p.L2561L	RELN_ENST00000424685.2_Silent_p.L2561L|RELN_ENST00000343529.5_Silent_p.L2561L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2561					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGTGACTAATAATCGACTAC	0.328																																					p.L2561L	NSCLC(146;835 1944 15585 22231 52158)												.	RELN-574	0			c.A7683G						.						84.0	74.0	78.0					7																	103159949		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon49			GACTAATAATCGA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7683A>G	7.37:g.103159949T>C		86	0		98	5	NM_173054	0	0	34	37	3	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.328	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	111555869	111555869	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:111555869G>A	ENST00000437633.1	-	13	1413	c.1157C>T	c.(1156-1158)aCa>aTa	p.T386I	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.T386I	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	386					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CAGCTTCCTTGTTATGGATAC	0.368																																					p.T386I		.											.	DOCK4-26	0			c.C1157T						.						57.0	53.0	54.0					7																	111555869		1820	4078	5898	SO:0001583	missense	9732	exon13			TTCCTTGTTATGG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1157C>T	7.37:g.111555869G>A	ENSP00000404179:p.Thr386Ile	35	0		48	13	NM_014705	0	0	8	8	0	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.816438|4.816438	0.90790|0.90790	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.03580	.|3.88;3.88	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.19167	.|0.0460	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.997;0.997	.|D;D	.|0.67103	.|0.949;0.949	.|T	.|0.00003	.|-1.2602	.|10	.|0.87932	.|D	.|0	.|.	19.3311|19.3311	0.94288|0.94288	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|386;386	.|Q149N5;Q8N1I0	.|.;DOCK4_HUMAN	X|I	374|374;386;386;374;385	.|ENSP00000410746:T386I;ENSP00000404179:T386I	.|ENSP00000345432:T374I	Q|T	-|-	1|2	0|0	DOCK4|DOCK4	111343105|111343105	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.960000|0.960000	0.62799|0.62799	8.322000|8.322000	0.90000|0.90000	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	CAA|ACA	.		0.368	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
AOC1	26	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150553627	150553627	+	Silent	SNP	G	G	C	rs186258416	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:150553627G>C	ENST00000493429.1	+	4	653	c.69G>C	c.(67-69)ccG>ccC	p.P23P	AOC1_ENST00000467291.1_Silent_p.P23P|AOC1_ENST00000360937.4_Silent_p.P23P|AOC1_ENST00000416793.2_Silent_p.P23P			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	23					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	AGCCCTCCCCGGGGACTCTGC	0.632																																					p.P23P		.											.	ABP1-139	0			c.G69C						.						41.0	42.0	42.0					7																	150553627		1927	4136	6063	SO:0001819	synonymous_variant	26	exon2			CTCCCCGGGGACT	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.69G>C	7.37:g.150553627G>C		69	1		82	37	NM_001091	0	0	2	31	29	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	ENST00000493429.1	37	CCDS43679.1																																																																																			G|0.999;A|0.001		0.632	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	28991695	28991695	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:28991695C>G	ENST00000524189.1	-	22	2684	c.2646G>C	c.(2644-2646)caG>caC	p.Q882H	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	882					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GGGACAGATGCTGTGGCAACC	0.488																																					p.Q882H		.											.	KIF13B-22	0			c.G2646C						.						81.0	81.0	81.0					8																	28991695		1901	4128	6029	SO:0001583	missense	23303	exon22			CAGATGCTGTGGC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.2646G>C	8.37:g.28991695C>G	ENSP00000427900:p.Gln882His	119	0		122	45	NM_015254	0	0	21	33	12	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235189	0.58886	.	.	ENSG00000197892	ENST00000524189	T	0.10382	2.88	5.28	2.49	0.30216	.	0.057734	0.64402	D	0.000001	T	0.23094	0.0558	M	0.68317	2.08	0.80722	D	1	D	0.60575	0.988	P	0.59221	0.854	T	0.00992	-1.1488	10	0.45353	T	0.12	.	10.5748	0.45221	0.0:0.7286:0.0:0.2714	.	882	F8VPJ2	.	H	882	ENSP00000427900:Q882H	ENSP00000427900:Q882H	Q	-	3	2	KIF13B	29047614	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.458000	0.21892	0.810000	0.34279	0.650000	0.86243	CAG	.		0.488	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
RB1CC1	9821	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53570007	53570007	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:53570007C>T	ENST00000025008.5	-	15	2905	c.2382G>A	c.(2380-2382)ctG>ctA	p.L794L	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Silent_p.L794L|RB1CC1_ENST00000435644.2_Silent_p.L794L	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	794					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ACTGGACATTCAGAGAAGTAT	0.378																																					p.L794L	GBM(180;1701 2102 13475 42023 52570)												.	RB1CC1-170	0			c.G2382A						.						162.0	150.0	154.0					8																	53570007		2203	4300	6503	SO:0001819	synonymous_variant	9821	exon15			GACATTCAGAGAA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2382G>A	8.37:g.53570007C>T		164	0		166	58	NM_001083617	0	0	11	23	12	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	37	CCDS34892.1																																																																																			.		0.378	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
C8orf46	254778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	67405943	67405943	+	Silent	SNP	T	T	A	rs139160272	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:67405943T>A	ENST00000305454.3	+	1	501	c.60T>A	c.(58-60)atT>atA	p.I20I	C8orf46_ENST00000522977.1_Silent_p.I20I|C8orf46_ENST00000482608.2_Intron|C8orf46_ENST00000480005.1_Silent_p.I20I|C8orf46_ENST00000521495.1_Silent_p.I20I	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	20										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CCACCGTGATTCCTTCCAAGG	0.502																																					p.I20I		.											.	C8orf46-92	0			c.T60A						.						124.0	98.0	107.0					8																	67405943		2203	4300	6503	SO:0001819	synonymous_variant	254778	exon1			CGTGATTCCTTCC	BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.60T>A	8.37:g.67405943T>A		71	0		76	22	NM_152765	0	0	0	0	0	B2RDC3|B4DFU4|C9J814|C9JCS3	Silent	SNP	ENST00000305454.3	37	CCDS6191.2																																																																																			T|0.999;C|0.001		0.502	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347010.1	NM_152765	
KCNV2	169522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	2718279	2718279	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:2718279C>T	ENST00000382082.3	+	1	778	c.540C>T	c.(538-540)cgC>cgT	p.R180R		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	180					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		GTCCGCGCCGCTTCCTGGAGG	0.657																																					p.R180R		.											.	KCNV2-515	0			c.C540T						.						19.0	17.0	18.0					9																	2718279		2200	4292	6492	SO:0001819	synonymous_variant	169522	exon1			GCGCCGCTTCCTG	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.540C>T	9.37:g.2718279C>T		34	0		17	6	NM_133497	0	0	0	0	0	Q5T6X0	Silent	SNP	ENST00000382082.3	37	CCDS6447.1																																																																																			.		0.657	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35699405	35699405	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:35699405C>A	ENST00000314888.9	-	51	7175	c.6822G>T	c.(6820-6822)aaG>aaT	p.K2274N	TLN1_ENST00000540444.1_Missense_Mutation_p.K2162N	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2274					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGCCACACGCTTTGAATGTC	0.562																																					p.K2274N		.											.	TLN1-609	0			c.G6822T						.						158.0	127.0	137.0					9																	35699405		2203	4300	6503	SO:0001583	missense	7094	exon51			CACACGCTTTGAA	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6822G>T	9.37:g.35699405C>A	ENSP00000316029:p.Lys2274Asn	97	0		99	32	NM_006289	0	1	171	286	114	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	c	18.95	3.732220	0.69189	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69926	-0.44;-0.44	5.79	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.79028	0.4377	M	0.81239	2.535	0.58432	D	0.999996	D	0.67145	0.996	P	0.61397	0.888	T	0.81519	-0.0896	10	0.72032	D	0.01	-23.9158	10.9276	0.47199	0.0:0.8574:0.0:0.1426	.	2274	Q9Y490	TLN1_HUMAN	N	2274;2162	ENSP00000316029:K2274N;ENSP00000442981:K2162N	ENSP00000316029:K2274N	K	-	3	2	TLN1	35689405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.766000	0.38491	1.472000	0.48140	0.651000	0.88453	AAG	.		0.562	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
OLFML2A	169611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	127572163	127572163	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:127572163C>T	ENST00000373580.3	+	8	1431	c.1431C>T	c.(1429-1431)taC>taT	p.Y477Y	OLFML2A_ENST00000288815.5_Silent_p.Y263Y	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	477	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						GCGCCTTCTACTACAACCGCG	0.602																																					p.Y477Y		.											.	OLFML2A-68	0			c.C1431T						.						124.0	99.0	108.0					9																	127572163		2203	4300	6503	SO:0001819	synonymous_variant	169611	exon8			CTTCTACTACAAC	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.1431C>T	9.37:g.127572163C>T		114	0		96	32	NM_182487	0	0	1	2	1	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Silent	SNP	ENST00000373580.3	37	CCDS6857.2																																																																																			.		0.602	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
CCBL1	883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131607633	131607633	+	Splice_Site	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:131607633A>T	ENST00000302586.3	-	2	214	c.52T>A	c.(52-54)Tgg>Agg	p.W18R	CCBL1_ENST00000436267.2_Splice_Site_p.W112R|CCBL1_ENST00000483599.1_5'UTR|CCBL1_ENST00000320665.6_Splice_Site_p.W18R	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	18					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	CTGGCTCACCAGGGGTTGTAG	0.602																																					p.W18R		.											.	CCBL1-91	0			c.T52A						.						53.0	62.0	59.0					9																	131607633		2053	4192	6245	SO:0001630	splice_region_variant	883	exon2			CTCACCAGGGGTT	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.53+1T>A	9.37:g.131607633A>T		88	0		48	8	NM_001122672	0	0	0	0	0	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	37	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458148	0.63401	.	.	ENSG00000171097	ENST00000302586;ENST00000372610;ENST00000320665;ENST00000436267;ENST00000451800;ENST00000416084;ENST00000427720	T;D;T;T;T	0.83075	-0.95;-1.68;-1.0;-0.87;0.85	5.28	5.28	0.74379	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.81917	0.4924	M	0.66378	2.025	0.80722	D	1	B;B;B;B;B	0.26081	0.141;0.047;0.018;0.047;0.019	B;B;B;B;B	0.24974	0.046;0.02;0.057;0.02;0.02	T	0.81256	-0.1015	10	0.72032	D	0.01	-3.8485	14.326	0.66521	1.0:0.0:0.0:0.0	.	112;18;18;18;18	B7Z4W5;A8K563;Q16773-2;Q16773;Q5T278	.;.;.;KAT1_HUMAN;.	R	18;19;18;112;18;18;19	ENSP00000302227:W18R;ENSP00000317342:W18R;ENSP00000399415:W112R;ENSP00000390377:W18R;ENSP00000412402:W18R	ENSP00000302227:W18R	W	-	1	0	CCBL1	130647454	0.996000	0.38824	0.998000	0.56505	0.955000	0.61496	3.509000	0.53386	2.120000	0.65058	0.460000	0.39030	TGG	.		0.602	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		Missense_Mutation
TRAPPC2	6399	hgsc.bcm.edu	37	X	13732606	13732606	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chrX:13732606A>G	ENST00000380579.1	-	6	535	c.343T>C	c.(343-345)Tat>Cat	p.Y115H	TRAPPC2_ENST00000358231.5_Missense_Mutation_p.Y115H|TRAPPC2_ENST00000359680.5_Missense_Mutation_p.Y115H|TRAPPC2_ENST00000453655.2_Missense_Mutation_p.Y122H|TRAPPC2_ENST00000458511.2_Missense_Mutation_p.Y149H			P0DI81	TPC2A_HUMAN	trafficking protein particle complex 2	115					ER to Golgi vesicle-mediated transport (GO:0006888)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ion channel binding (GO:0044325)|transcription factor binding (GO:0008134)			kidney(1)	1						TTGGGTTCATAAAATGGATTC	0.303																																					p.Y149H		.											.	TRAPPC2-130	0			c.T445C						.						35.0	29.0	31.0					X																	13732606		1789	4040	5829	SO:0001583	missense	6399	exon6			GTTCATAAAATGG	AF157061	CCDS48082.1, CCDS48083.1, CCDS48083.2	Xp22	2011-10-10	2005-01-26		ENSG00000196459	ENSG00000196459		"""Trafficking protein particle complex"""	23068	protein-coding gene	gene with protein product		300202	"""spondyloepiphyseal dysplasia, late"""	SEDL		14597397	Standard	NM_014563		Approved	TRS20, SEDT, MIP-2A, ZNF547L, hYP38334	uc010nej.2	P0DI81	OTTHUMG00000021157	ENST00000380579.1:c.343T>C	X.37:g.13732606A>G	ENSP00000369953:p.Tyr115His	11	0		13	2	NM_001128835	0	0	34	34	0	A6NEG0|O14582|Q9HD16	Missense_Mutation	SNP	ENST00000380579.1	37	CCDS48082.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370361	0.82573	.	.	ENSG00000196459	ENST00000453655;ENST00000359680;ENST00000380579;ENST00000358231;ENST00000458511	D;D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93;-2.93	5.68	5.68	0.88126	Longin-like (1);	0.000000	0.85682	D	0.000000	D	0.95828	0.8642	M	0.79693	2.465	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.95496	0.8573	10	0.42905	T	0.14	-25.1011	14.9504	0.71067	1.0:0.0:0.0:0.0	.	115	P0DI81	TPC2A_HUMAN	H	122;115;115;115;149	ENSP00000394629:Y122H;ENSP00000352708:Y115H;ENSP00000369953:Y115H;ENSP00000350966:Y115H;ENSP00000392495:Y149H	ENSP00000350966:Y115H	Y	-	1	0	TRAPPC2	13642527	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.251000	0.95483	1.913000	0.55393	0.417000	0.27973	TAT	.		0.303	TRAPPC2-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055805.2	NM_014563	
SUPT20HL1	100130302	broad.mit.edu	37	X	24381695	24381695	+	IGR	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chrX:24381695G>A								AC004552.1 (14672 upstream) : PDK3 (101642 downstream)																							AAAGAAGAAAGAAAAGTAGGT	0.512																																					p.R273K													.	.	0			c.G818A						.						101.0	86.0	90.0					X																	24381695		1568	3582	5150	SO:0001628	intergenic_variant	100130302	exon1			AAGAAAGAAAAGT																													X.37:g.24381695G>A		171	0		97	4	NM_001136234	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.512								
GLUD2	2747	ucsc.edu	37	X	120182436	120182436	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chrX:120182436A>G	ENST00000328078.1	+	1	975	c.898A>G	c.(898-900)Aga>Gga	p.R300G		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	300					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						ACCAGGGTTTAGAGATAAAAC	0.413																																					p.R300G													.	GLUD2-131	0			c.A898G						.						189.0	170.0	177.0					X																	120182436		2203	4300	6503	SO:0001583	missense	2747	exon1			GGGTTTAGAGATA	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.898A>G	X.37:g.120182436A>G	ENSP00000327589:p.Arg300Gly	302	0		210	1	NM_012084	0	0	4	917	913	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.462215	0.01062	.	.	ENSG00000182890	ENST00000328078	D	0.95272	-3.66	2.3	-1.33	0.09172	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.376526	0.30093	N	0.010424	T	0.76983	0.4064	N	0.02247	-0.625	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.70048	-0.4979	10	0.02654	T	1	-8.2867	4.1877	0.10405	0.2739:0.2268:0.4994:0.0	.	300	P49448	DHE4_HUMAN	G	300	ENSP00000327589:R300G	ENSP00000327589:R300G	R	+	1	2	GLUD2	120010117	1.000000	0.71417	0.578000	0.28575	0.925000	0.55904	2.644000	0.46613	-0.680000	0.05211	-0.386000	0.06593	AGA	.		0.413	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	89717645	89717646	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:89717645_89717646delAT	ENST00000371953.3	+	7	2027_2028	c.670_671delAT	c.(670-672)atafs	p.I224fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	224	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAGGTGAAGATATATTCCTCC	0.421		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.224_224del		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN-17735	48	Whole gene deletion(37)|Deletion - Frameshift(9)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.670_671del						.																																			SO:0001589	frameshift_variant	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.670_671delAT	10.37:g.89717649_89717650delAT	ENSP00000361021:p.Ile224fs	162	0		150	84	NM_000314	0	0	0	0	0	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																			.		0.421	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
ABCC2	1244	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	101606844	101606844	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:101606844delG	ENST00000370449.4	+	30	4386	c.4273delG	c.(4273-4275)gggfs	p.G1425fs		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1425	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.G1425W(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCTGCAACTTGGGTTATCCCA	0.537																																					p.G1425fs		.											.	ABCC2-91	1	Substitution - Missense(1)	lung(1)	c.4273delG						.						104.0	97.0	99.0					10																	101606844		2203	4300	6503	SO:0001589	frameshift_variant	1244	exon30			.	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.4273delG	10.37:g.101606844delG	ENSP00000359478:p.Gly1425fs	197	0		150	101	NM_000392	0	0	0	0	0	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Frame_Shift_Del	DEL	ENST00000370449.4	37	CCDS7484.1																																																																																			.		0.537	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
MMP21	118856	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	127455343	127455343	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:127455343delT	ENST00000368808.3	-	7	1597	c.1598delA	c.(1597-1599)aagfs	p.K533fs		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	533					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	TTGTTTGTCCTTGTCATTAAC	0.363																																					p.K533fs		.											.	MMP21-228	0			c.1598delA						.						131.0	131.0	131.0					10																	127455343		2203	4300	6503	SO:0001589	frameshift_variant	118856	exon7			.	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1598delA	10.37:g.127455343delT	ENSP00000357798:p.Lys533fs	138	0		119	63	NM_147191	0	0	0	0	0	Q5VZP9|Q8NG02	Frame_Shift_Del	DEL	ENST00000368808.3	37	CCDS7647.1																																																																																			.		0.363	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
DENND5A	23258	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	9173965	9173965	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:9173965delG	ENST00000328194.3	-	13	2781	c.2461delC	c.(2461-2463)ctgfs	p.L822fs	DENND5A_ENST00000527700.1_Frame_Shift_Del_p.L165fs|DENND5A_ENST00000530044.1_Frame_Shift_Del_p.L822fs	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	822	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TAATGTAACAGGTGGGACCAT	0.473																																					p.L821fs		.											.	DENND5A-91	0			c.2461delC						.						268.0	217.0	234.0					11																	9173965		2201	4296	6497	SO:0001589	frameshift_variant	23258	exon13			.	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2461delC	11.37:g.9173965delG	ENSP00000328524:p.Leu822fs	169	0		188	58	NM_015213	0	0	0	0	0	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Frame_Shift_Del	DEL	ENST00000328194.3	37	CCDS31423.1																																																																																			.		0.473	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
BAIAP3	8938	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	1398015	1398021	+	Splice_Site	DEL	ACTTGTG	ACTTGTG	-	rs112608838		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	ACTTGTG	ACTTGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:1398015_1398021delACTTGTG	ENST00000324385.5	+	32	3409_3412	c.3251_3254delACTTGTG	c.(3250-3255)tacttg>tg	p.YL1084fs	BAIAP3_ENST00000568887.1_Splice_Site_p.YL1021fs|BAIAP3_ENST00000397488.2_Splice_Site_p.YL1066fs|BAIAP3_ENST00000421665.2_Splice_Site_p.YL1013fs|BAIAP3_ENST00000562208.1_Splice_Site_p.YL1026fs|BAIAP3_ENST00000426824.3_Splice_Site_p.YL1049fs|BAIAP3_ENST00000397489.1_Splice_Site_p.YL1066fs	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1084	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				GAACTCTTCTACTTGTGAGTGTCCTAa	0.657																																					p.1084_1085del		.											.	BAIAP3-91	0			c.3251_3254del						.																																			SO:0001630	splice_region_variant	8938	exon32			.	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.3254+1ACTTGTG>-	16.37:g.1398015_1398021delACTTGTG		120	0		115	43	NM_003933	0	0	0	0	0	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Frame_Shift_Del	DEL	ENST00000324385.5	37	CCDS10434.1																																																																																			.		0.657	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		Frame_Shift_Del
ZNF200	7752	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3274128	3274128	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:3274128delG	ENST00000431561.3	-	5	1564	c.952delC	c.(952-954)cgtfs	p.R318fs	ZNF200_ENST00000575948.1_Frame_Shift_Del_p.R317fs|AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000414144.2_Frame_Shift_Del_p.R318fs|ZNF200_ENST00000396871.4_Frame_Shift_Del_p.R317fs|ZNF200_ENST00000396870.4_Frame_Shift_Del_p.R317fs|ZNF200_ENST00000396868.3_Frame_Shift_Del_p.R317fs	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GAATTCTGACGGAAGTTTTTT	0.393																																					p.R318fs		.											.	ZNF200-90	0			c.952delC						.						110.0	110.0	110.0					16																	3274128		2197	4300	6497	SO:0001589	frameshift_variant	7752	exon5			.	AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.952delC	16.37:g.3274128delG	ENSP00000395723:p.Arg318fs	186	0		233	109	NM_003454	0	0	0	0	0	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Frame_Shift_Del	DEL	ENST00000431561.3	37	CCDS10497.1																																																																																			.		0.393	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1		
ANKZF1	55139	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	220099806	220099806	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:220099806delC	ENST00000323348.5	+	10	1637	c.1463delC	c.(1462-1464)gccfs	p.A488fs	ANKZF1_ENST00000409849.1_Frame_Shift_Del_p.A278fs|GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000410034.3_Frame_Shift_Del_p.A488fs	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	488						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGCCAAAGCCCCTGGTCAG	0.587																																					p.A488fs		.											.	ANKZF1-92	0			c.1463delC						.						49.0	53.0	51.0					2																	220099806		1987	4163	6150	SO:0001589	frameshift_variant	55139	exon10			.	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1463delC	2.37:g.220099806delC	ENSP00000321617:p.Ala488fs	83	0		70	20	NM_001042410	0	0	0	0	0	Q9NVZ4	Frame_Shift_Del	DEL	ENST00000323348.5	37	CCDS42821.1																																																																																			.		0.587	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
PKDREJ	10343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	46655720	46655720	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr22:46655720delG	ENST00000253255.5	-	1	3499	c.3500delC	c.(3499-3501)cctfs	p.P1167fs		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1167					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CACAGGATTAGGGATCACAAT	0.493																																					p.P1167fs		.											.	PKDREJ-156	0			c.3500delC						.						160.0	152.0	155.0					22																	46655720		2203	4300	6503	SO:0001589	frameshift_variant	10343	exon1			.	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3500delC	22.37:g.46655720delG	ENSP00000253255:p.Pro1167fs	208	0		205	50	NM_006071	0	0	0	0	0	B1AJY3|O95850	Frame_Shift_Del	DEL	ENST00000253255.5	37	CCDS14073.1																																																																																			.		0.493	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
CLTB	1212	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	175843340	175843342	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:175843340_175843342delAGA	ENST00000310418.4	-	1	228_230	c.23_25delTCT	c.(22-27)ttctcg>tcg	p.F8del	CLTB_ENST00000345807.2_In_Frame_Del_p.F8del	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	8					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		TCCGACGACGAGAAGAAGCCAAA	0.724																																					p.8_9del		.											.	CLTB-90	0			c.23_25del						.																																			SO:0001651	inframe_deletion	1212	exon1			.	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.23_25delTCT	5.37:g.175843343_175843345delAGA	ENSP00000309415:p.Phe8del	71	0		36	15	NM_001834	0	0	0	0	0	Q53Y37|Q6FHW1	In_Frame_Del	DEL	ENST00000310418.4	37	CCDS4403.1																																																																																			.		0.724	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253153.1		
CYP21A2	1589	broad.mit.edu;bcgsc.ca	37	6	32007842	32007846	+	Frame_Shift_Del	DEL	CAGCC	CAGCC	-	rs142028935	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	CAGCC	CAGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:32007842_32007846delCAGCC	ENST00000418967.2	+	7	957_961	c.799_803delCAGCC	c.(799-804)cagccgfs	p.QP267fs	CYP21A2_ENST00000435122.2_Frame_Shift_Del_p.QP237fs	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	266					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	AGGGGTGGCGCAGCCGAGCATGGAA	0.639																																					.	Melanoma(174;1669 1998 3915 34700 46447)												.	CYP21A2-68	0			.						.																																			SO:0001589	frameshift_variant	1589	.			GTGGCGCAGCCGA	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.799_803delCAGCC	6.37:g.32007842_32007846delCAGCC	ENSP00000408860:p.Gln267fs	361	0		265	33	.	0	0	0	0	0	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Frame_Shift_Del	DEL	ENST00000418967.2	37	CCDS4735.1																																																																																			.		0.639	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500	
AGPAT1	10554	broad.mit.edu	37	6	32139261	32139268	+	Frame_Shift_Del	DEL	GCCACAAA	GCCACAAA	-	rs529759736		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	GCCACAAA	GCCACAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:32139261_32139268delGCCACAAA	ENST00000395499.1	-	2	585_592	c.6_13delTTTGTGGC	c.(4-15)gatttgtggccafs	p.LWP3fs	AGPAT1_ENST00000412465.2_5'UTR|AGPAT1_ENST00000375107.3_Frame_Shift_Del_p.LWP3fs|AGPAT1_ENST00000395496.1_Frame_Shift_Del_p.LWP3fs|AGPAT1_ENST00000336984.6_Frame_Shift_Del_p.LWP3fs|AGPAT1_ENST00000490711.1_5'UTR|AGPAT1_ENST00000395497.1_Frame_Shift_Del_p.LWP3fs|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000375104.2_Frame_Shift_Del_p.LWP3fs			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	3					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						CATGCCCCTGGCCACAAATCCATTCTGG	0.606																																					p.2_5del													.	AGPAT1-90	0			c.6_13del						.																																			SO:0001589	frameshift_variant	10554	exon2			CCCCTGGCCACAA	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.6_13delTTTGTGGC	6.37:g.32139261_32139268delGCCACAAA	ENSP00000378877:p.Leu3fs	20	0		22	9	NM_006411	0	0	0	0	0	A2BFI5|Q5BL03	Frame_Shift_Del	DEL	ENST00000395499.1	37	CCDS4744.1																																																																																			.		0.606	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
MPP6	51678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	24727063	24727075	+	Frame_Shift_Del	DEL	GACTTGAAGAAAA	GACTTGAAGAAAA	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	GACTTGAAGAAAA	GACTTGAAGAAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:24727063_24727075delGACTTGAAGAAAA	ENST00000222644.5	+	12	1703_1715	c.1453_1465delGACTTGAAGAAAA	c.(1453-1467)gacttgaagaaaacafs	p.DLKKT485fs	MPP6_ENST00000409761.1_Frame_Shift_Del_p.DLKKT373fs|MPP6_ENST00000396475.2_Frame_Shift_Del_p.DLKKT485fs			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						ACAGGACTCTGACTTGAAGAAAACAGTGGATGA	0.324																																					p.485_489del		.											.	MPP6-90	0			c.1453_1465del						.																																			SO:0001589	frameshift_variant	51678	exon13			.	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.1453_1465delGACTTGAAGAAAA	7.37:g.24727063_24727075delGACTTGAAGAAAA	ENSP00000222644:p.Asp485fs	130	0		142	50	NM_016447	0	0	0	0	0	B2RAF0	Frame_Shift_Del	DEL	ENST00000222644.5	37	CCDS5388.1																																																																																			.		0.324	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
ZMIZ2	83637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	44807159	44807159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:44807159delG	ENST00000309315.4	+	19	2823	c.2700delG	c.(2698-2700)ttgfs	p.L900fs	ZMIZ2_ENST00000433667.1_Frame_Shift_Del_p.L868fs|ZMIZ2_ENST00000413916.1_Frame_Shift_Del_p.L842fs|ZMIZ2_ENST00000463931.1_3'UTR|ZMIZ2_ENST00000265346.7_Frame_Shift_Del_p.L874fs|ZMIZ2_ENST00000441627.1_Frame_Shift_Del_p.L900fs	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	900	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TGTCCTACTTGGGCCCACCCG	0.552																																					p.L900fs	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2-137	0			c.2700delG						.						145.0	159.0	155.0					7																	44807159		2045	4190	6235	SO:0001589	frameshift_variant	83637	exon19			.	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2700delG	7.37:g.44807159delG	ENSP00000311778:p.Leu900fs	118	0		122	24	NM_031449	0	0	0	0	0	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Frame_Shift_Del	DEL	ENST00000309315.4	37	CCDS43576.1																																																																																			.		0.552	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
TRAPPC9	83696	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	141449171	141449172	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:141449171_141449172delTT	ENST00000438773.2	-	3	842_843	c.709_710delAA	c.(709-711)aatfs	p.N237fs	TRAPPC9_ENST00000389328.4_Frame_Shift_Del_p.N335fs|TRAPPC9_ENST00000389327.3_Frame_Shift_Del_p.N237fs	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	237					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CAGAAAGTCATTCACAGAACGC	0.525																																					p.335_335del		.											.	TRAPPC9-228	0			c.1003_1004del						.																																			SO:0001589	frameshift_variant	83696	exon3			.	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.709_710delAA	8.37:g.141449171_141449172delTT	ENSP00000405060:p.Asn237fs	174	0		160	72	NM_031466	0	0	0	0	0	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Frame_Shift_Del	DEL	ENST00000438773.2	37	CCDS55278.1																																																																																			.		0.525	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
RLIM	51132	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	73815805	73815805	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chrX:73815805delT	ENST00000332687.6	-	2	226	c.8delA	c.(7-9)aacfs	p.N3fs	RLIM_ENST00000349225.2_Frame_Shift_Del_p.N3fs	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	3					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGAATCTGAGTTTTCCATATT	0.358																																					p.N3fs	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM-228	0			c.8delA						.						53.0	49.0	50.0					X																	73815805		2203	4300	6503	SO:0001589	frameshift_variant	51132	exon3			.	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.8delA	X.37:g.73815805delT	ENSP00000328059:p.Asn3fs	87	0		69	31	NM_183353	0	0	0	0	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Frame_Shift_Del	DEL	ENST00000332687.6	37	CCDS14427.1																																																																																			.		0.358	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
TRAF4	9618	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	27074242	27074243	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:27074242_27074243insC	ENST00000262395.5	+	2	284_285	c.155_156insC	c.(154-159)ttcaagfs	p.K53fs	AC010761.9_ENST00000577325.1_RNA|TRAF4_ENST00000262396.6_Frame_Shift_Ins_p.K53fs|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000444415.3_Frame_Shift_Ins_p.K53fs	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	53					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			GAAGGAGTCTTCAAGTGCCCTG	0.594																																					p.F52fs		.											.	TRAF4-660	0			c.155_156insC						.																																			SO:0001589	frameshift_variant	9618	exon2			.	X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.156dupC	17.37:g.27074243_27074243dupC	ENSP00000262395:p.Lys53fs	184	0		158	82	NM_004295	0	0	0	0	0	O75615|Q14848|Q2KJU4|Q2PJN8	Frame_Shift_Ins	INS	ENST00000262395.5	37	CCDS11243.1																																																																																			.		0.594	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255944.2	NM_145751	
COL5A2	1290	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	189898818	189898819	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:189898818_189898819insTT	ENST00000374866.3	-	54	4751_4752	c.4477_4478insAA	c.(4477-4479)attfs	p.I1493fs		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1493	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AACTGGCCCAATTTCAACGCCG	0.46																																					p.I1493fs		.											.	COL5A2-92	0			c.4478_4479insAA						.																																			SO:0001589	frameshift_variant	1290	exon54			.	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.4476_4477dupAA	2.37:g.189898819_189898820dupTT	ENSP00000364000:p.Ile1493fs	66	0		68	15	NM_000393	0	0	0	0	0	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Frame_Shift_Ins	INS	ENST00000374866.3	37	CCDS33350.1																																																																																			.		0.460	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
MAT2B	27430	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	162940576	162940577	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:162940576_162940577insA	ENST00000321757.6	+	3	413_414	c.274_275insA	c.(274-276)catfs	p.H92fs	MAT2B_ENST00000280969.5_Frame_Shift_Ins_p.H81fs|MAT2B_ENST00000518095.1_Frame_Shift_Ins_p.H92fs	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	92					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	TGTTATAGTACATTGTGCAGCA	0.371																																					p.H92fs		.											.	MAT2B-91	0			c.274_275insA						.																																			SO:0001589	frameshift_variant	27430	exon3			.	AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.275dupA	5.37:g.162940577_162940577dupA	ENSP00000325425:p.His92fs	155	0		104	37	NM_013283	0	0	0	0	0	B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Frame_Shift_Ins	INS	ENST00000321757.6	37	CCDS4365.1																																																																																			.		0.371	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252749.2	NM_013283	
PRSS22	64063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2905588	2905589	+	Missense_Mutation	DNP	GC	GC	AT	rs556704172		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:2905588_2905589GC>AT	ENST00000161006.3	-	4	610_611	c.545_546GC>AT	c.(544-546)aGC>aAT	p.S182N	LA16c-325D7.1_ENST00000577140.1_RNA|PRSS22_ENST00000574768.1_5'Flank|PRSS22_ENST00000571228.1_Intron	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	182	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						CATCTTGGATGCTCCCCCAGCC	0.589																																					p.S182N		.											.	PRSS22	0			c.G545A						.																																			SO:0001583	missense	64063	exon4			TGGATGCTCCCCC	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.545_546delinsAT	16.37:g.2905588_2905589delinsAT	ENSP00000161006:p.Ser182Asn	113.0	0.0		121.0	62.0		0	0	0	0	0	O43342|Q6UXE0	Missense_Mutation	DNP	ENST00000161006.3	37	CCDS10481.1																																																																																			.		0.589	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119	
