#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MYOM3	127294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	24416117	24416117	+	Missense_Mutation	SNP	C	C	G	rs201031583		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:24416117C>G	ENST00000374434.3	-	14	1687	c.1525G>C	c.(1525-1527)Gcc>Ccc	p.A509P	MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000330966.7_Missense_Mutation_p.A510P|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000329601.7_Missense_Mutation_p.A509P	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	509	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		ATCTCGCTGGCATGGACATTG	0.602																																					p.A509P		.											.	MYOM3-93	0			c.G1525C						.						34.0	38.0	37.0					1																	24416117		2019	4174	6193	SO:0001583	missense	127294	exon14			CGCTGGCATGGAC	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.1525G>C	1.37:g.24416117C>G	ENSP00000363557:p.Ala509Pro	16	0		6	3	NM_152372	0	0	0	0	0	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139059	0.56936	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.60548	0.18;0.18;0.18	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.155897	0.56097	D	0.000027	T	0.72510	0.3469	M	0.67953	2.075	0.38183	D	0.939678	P;D;D	0.69078	0.784;0.997;0.994	P;D;D	0.71184	0.782;0.972;0.928	T	0.74057	-0.3787	10	0.40728	T	0.16	.	14.6425	0.68737	0.0:0.9282:0.0:0.0718	.	166;509;509	Q6ZU56;Q5VTT5-2;Q5VTT5	.;.;MYOM3_HUMAN	P	509;510;509	ENSP00000363557:A509P;ENSP00000332670:A510P;ENSP00000328415:A509P	ENSP00000328415:A509P	A	-	1	0	MYOM3	24288704	1.000000	0.71417	0.966000	0.40874	0.226000	0.24999	6.278000	0.72614	2.600000	0.87896	0.655000	0.94253	GCC	.		0.602	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372	
L1TD1	54596	hgsc.bcm.edu	37	1	62675665	62675665	+	Missense_Mutation	SNP	G	G	A	rs532563709		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:62675665G>A	ENST00000498273.1	+	4	1514	c.1219G>A	c.(1219-1221)Gag>Aag	p.E407K	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	407	Glu-rich.									breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						ggaggaggaggaggaagagcc	0.552																																					p.E407K		.											.	L1TD1-92	0			c.G1219A						.						36.0	40.0	38.0					1																	62675665		2200	4299	6499	SO:0001583	missense	54596	exon5			GAGGAGGAGGAAG	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1219G>A	1.37:g.62675665G>A	ENSP00000419901:p.Glu407Lys	69	0		30	2	NM_001164835	0	0	0	0	0	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	37	CCDS619.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064442	0.36470	.	.	ENSG00000240563	ENST00000498273	T	0.10192	2.9	3.4	1.41	0.22369	.	.	.	.	.	T	0.06508	0.0167	N	0.24115	0.695	0.09310	N	1	B	0.25235	0.121	B	0.19148	0.024	T	0.35001	-0.9806	9	0.56958	D	0.05	.	3.8632	0.09005	0.1308:0.0:0.6037:0.2655	.	407	Q5T7N2	LITD1_HUMAN	K	407	ENSP00000419901:E407K	ENSP00000419901:E407K	E	+	1	0	L1TD1	62448253	0.054000	0.20591	0.000000	0.03702	0.033000	0.12548	0.260000	0.18424	0.403000	0.25479	0.448000	0.29417	GAG	.		0.552	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
RBM15	64783	broad.mit.edu	37	1	110883162	110883162	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:110883162G>T	ENST00000369784.3	+	1	2035	c.1135G>T	c.(1135-1137)Ggc>Tgc	p.G379C	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.G379C|RBM15_ENST00000602849.1_Missense_Mutation_p.G379C	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	379	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTCTTCTTGGGCAACCTAGA	0.522			T	MKL1	acute megakaryocytic leukemia																																p.G379C				Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15-661	0			c.G1135T						.						49.0	47.0	48.0					1																	110883162		2203	4300	6503	SO:0001583	missense	64783	exon1			TTCTTGGGCAACC	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1135G>T	1.37:g.110883162G>T	ENSP00000358799:p.Gly379Cys	51	0		43	3	NM_022768	0	0	0	0	0	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	CCDS822.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842591	0.71488	.	.	ENSG00000162775	ENST00000369784	T	0.11712	2.75	4.69	4.69	0.59074	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.45126	D	0.000395	T	0.27134	0.0665	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.97110	0.937;1.0	T	0.04307	-1.0961	10	0.87932	D	0	-12.0588	17.7957	0.88570	0.0:0.0:1.0:0.0	.	379;379	Q96T37-3;Q96T37	.;RBM15_HUMAN	C	379	ENSP00000358799:G379C	ENSP00000358799:G379C	G	+	1	0	RBM15	110684685	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.232000	0.95325	2.446000	0.82766	0.655000	0.94253	GGC	.		0.522	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
Unknown	0	broad.mit.edu	37	1	144615252	144615252	+	IGR	SNP	T	T	A	rs202192397		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:144615252T>A								RP11-640M9.2 (9361 upstream) : NBPF9 (196491 downstream)																							CTCAAAGAGATGTTTTCTAAC	0.463																																					.													.	.	0			.						.																																			SO:0001628	intergenic_variant	400818	.			AAGAGATGTTTTC																													1.37:g.144615252T>A		263	1		172	6	.	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				A|0.500;G|0.500	0	0.463								
ITGA10	8515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145532515	145532515	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:145532515G>A	ENST00000369304.3	+	9	1143	c.968G>A	c.(967-969)aGa>aAa	p.R323K	ITGA10_ENST00000539363.1_Missense_Mutation_p.R180K|ITGA10_ENST00000538811.1_Missense_Mutation_p.R192K|ITGA10_ENST00000481236.1_3'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	323	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGAGAAATTAGAACTATTGCC	0.473																																					p.R323K		.											.	ITGA10-231	0			c.G968A						.						144.0	138.0	140.0					1																	145532515		2203	4300	6503	SO:0001583	missense	8515	exon9			AAATTAGAACTAT	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.968G>A	1.37:g.145532515G>A	ENSP00000358310:p.Arg323Lys	143	0		170	66	NM_003637	0	0	0	0	0	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	7.649	0.682583	0.14907	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	D;D;D	0.83914	-1.78;-1.78;-1.78	5.27	4.34	0.51931	von Willebrand factor, type A (3);	0.060779	0.64402	D	0.000004	T	0.34600	0.0903	N	0.01771	-0.73	0.35261	D	0.779612	B;B;B;B	0.18741	0.024;0.024;0.024;0.03	B;B;B;B	0.23150	0.021;0.021;0.044;0.036	T	0.39292	-0.9621	10	0.02654	T	1	.	7.3767	0.26833	0.1809:0.0:0.8191:0.0	.	289;192;180;323	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	K	323;289;180;192	ENSP00000358310:R323K;ENSP00000439894:R180K;ENSP00000440011:R192K	ENSP00000358310:R323K	R	+	2	0	ITGA10	144243872	1.000000	0.71417	0.974000	0.42286	0.966000	0.64601	5.786000	0.69006	2.653000	0.90120	0.561000	0.74099	AGA	.		0.473	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
SEMA6C	10500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151109386	151109386	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:151109386C>T	ENST00000341697.3	-	11	2612	c.921G>A	c.(919-921)gtG>gtA	p.V307V				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	307	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATGCAGGTTCACAGGCCCAG	0.542																																					p.V307V		.											.	SEMA6C-92	0			c.G921A						.						101.0	108.0	106.0					1																	151109386		2203	4300	6503	SO:0001819	synonymous_variant	10500	exon11			CAGGTTCACAGGC	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.921G>A	1.37:g.151109386C>T		184	0		165	47	NM_001178061	0	0	0	0	0	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Silent	SNP	ENST00000341697.3	37	CCDS984.1																																																																																			.		0.542	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
HRNR	388697	hgsc.bcm.edu	37	1	152190382	152190382	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:152190382A>C	ENST00000368801.2	-	3	3798	c.3723T>G	c.(3721-3723)caT>caG	p.H1241Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1241					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCTAGGGGAATGGCCAGATC	0.632																																					p.H1241Q		.											.	HRNR-93	0			c.T3723G						.						11.0	1.0	7.0					1																	152190382		591	491	1082	SO:0001583	missense	388697	exon3			AGGGGAATGGCCA	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3723T>G	1.37:g.152190382A>C	ENSP00000357791:p.His1241Gln	30	1		31	3	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	8.219	0.802011	0.16397	.	.	ENSG00000197915	ENST00000368801	T	0.01787	4.64	2.97	0.73	0.18271	.	.	.	.	.	T	0.00328	0.0010	N	0.03154	-0.405	0.53005	P	3.2999999999949736E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.26189	-1.0110	8	0.12766	T	0.61	.	9.7029	0.40198	0.5136:0.4864:0.0:0.0	.	1241	Q86YZ3	HORN_HUMAN	Q	1241	ENSP00000357791:H1241Q	ENSP00000357791:H1241Q	H	-	3	2	HRNR	150457006	0.000000	0.05858	0.075000	0.20258	0.012000	0.07955	-1.453000	0.02383	0.036000	0.15547	-0.232000	0.12228	CAT	.		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
PEAR1	375033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156877993	156877993	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:156877993C>T	ENST00000338302.3	+	10	1201	c.976C>T	c.(976-978)Cgt>Tgt	p.R326C	PEAR1_ENST00000292357.7_Missense_Mutation_p.R326C			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	326	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCGGACGCCCGTTGCTTCCC	0.692																																					p.R326C		.											.	PEAR1-71	0			c.C976T						.						21.0	26.0	24.0					1																	156877993		2202	4296	6498	SO:0001583	missense	375033	exon9			GACGCCCGTTGCT	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.976C>T	1.37:g.156877993C>T	ENSP00000344465:p.Arg326Cys	31	0		22	11	NM_001080471	0	0	0	0	0	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373658	0.82573	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.18016	2.24;2.24	4.33	4.33	0.51752	EGF-like, laminin (2);Epidermal growth factor-like, type 3 (1);	0.152429	0.30920	N	0.008604	T	0.30603	0.0770	M	0.72479	2.2	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.70016	0.953;0.967	T	0.05582	-1.0876	10	0.62326	D	0.03	.	14.3643	0.66795	0.0:1.0:0.0:0.0	.	127;326	Q8N780;Q5VY43	.;PEAR1_HUMAN	C	326	ENSP00000344465:R326C;ENSP00000292357:R326C	ENSP00000292357:R326C	R	+	1	0	PEAR1	155144617	0.978000	0.34361	1.000000	0.80357	0.896000	0.52359	2.495000	0.45337	2.230000	0.72887	0.561000	0.74099	CGT	.		0.692	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
DUSP27	92235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167096129	167096129	+	Silent	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:167096129A>G	ENST00000361200.2	+	6	1927	c.1761A>G	c.(1759-1761)acA>acG	p.T587T	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Silent_p.T587T|DUSP27_ENST00000271385.5_Silent_p.T587T			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	587					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TCAGCCTGACAGCCTACCAGG	0.597																																					p.T587T		.											.	DUSP27-71	0			c.A1761G						.						45.0	45.0	45.0					1																	167096129		2203	4300	6503	SO:0001819	synonymous_variant	92235	exon5			CCTGACAGCCTAC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1761A>G	1.37:g.167096129A>G		68	0		63	29	NM_001080426	0	0	0	0	0	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																			.		0.597	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
C1orf112	55732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169806133	169806133	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:169806133C>T	ENST00000286031.6	+	17	2305	c.1605C>T	c.(1603-1605)tcC>tcT	p.S535S	C1orf112_ENST00000359326.4_Silent_p.S535S|C1orf112_ENST00000498289.1_3'UTR	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	535										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AACATATTTCCTTCCAGGCGT	0.438																																					p.S535S		.											.	C1orf112-90	0			c.C1605T						.						73.0	69.0	71.0					1																	169806133		2203	4300	6503	SO:0001819	synonymous_variant	55732	exon17			TATTTCCTTCCAG	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1605C>T	1.37:g.169806133C>T		63	0		65	23	NM_018186	0	0	0	0	0	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Silent	SNP	ENST00000286031.6	37	CCDS1285.1																																																																																			.		0.438	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
PPFIA4	8497	hgsc.bcm.edu	37	1	203025587	203025587	+	Silent	SNP	C	C	A	rs549873910		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:203025587C>A	ENST00000447715.2	+	23	2566	c.2125C>A	c.(2125-2127)Cgg>Agg	p.R709R	PPFIA4_ENST00000599966.1_Silent_p.R225R|PPFIA4_ENST00000367240.2_Silent_p.R710R|PPFIA4_ENST00000414050.2_Silent_p.R438R|PPFIA4_ENST00000295706.4_Silent_p.R225R|PPFIA4_ENST00000272198.6_Silent_p.R225R			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	709					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.R856W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CAGGACGCTGCGGCTAGAGAA	0.567																																					p.R225R		.											.	PPFIA4-230	1	Substitution - Missense(1)	large_intestine(1)	c.C673A						.						37.0	43.0	41.0					1																	203025587		2040	4173	6213	SO:0001819	synonymous_variant	8497	exon5			ACGCTGCGGCTAG	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2125C>A	1.37:g.203025587C>A		51	0		47	3	NM_015053	0	0	0	0	0	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Silent	SNP	ENST00000447715.2	37																																																																																				.		0.567	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204219693	204219693	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:204219693A>G	ENST00000272203.3	-	10	1890	c.1574T>C	c.(1573-1575)tTa>tCa	p.L525S	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.L545S	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	525										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTGCTCGTTTAACTTGTAGGT	0.602																																					p.L525S		.											.	PLEKHA6-654	0			c.T1574C						.						153.0	138.0	143.0					1																	204219693		2203	4300	6503	SO:0001583	missense	22874	exon10			TCGTTTAACTTGT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1574T>C	1.37:g.204219693A>G	ENSP00000272203:p.Leu525Ser	44	0		37	2	NM_014935	0	0	0	0	0	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711789	0.30322	.	.	ENSG00000143850	ENST00000272203;ENST00000414478;ENST00000450705;ENST00000543129;ENST00000454206;ENST00000367191;ENST00000430806	T;T	0.30981	1.51;1.51	5.68	5.68	0.88126	.	0.270585	0.30999	N	0.008448	T	0.26195	0.0639	N	0.25647	0.755	0.32133	N	0.586553	P;P;B;P;P;P	0.52842	0.763;0.828;0.215;0.804;0.493;0.956	B;B;B;B;B;P	0.47528	0.229;0.371;0.075;0.292;0.219;0.549	T	0.07158	-1.0787	10	0.07644	T	0.81	-2.4712	15.5805	0.76432	1.0:0.0:0.0:0.0	.	88;106;545;115;133;525	A5XEJ7;A5XEJ6;Q5VTI5;A5XEJ3;A5XEJ2;Q9Y2H5	.;.;.;.;.;PKHA6_HUMAN	S	525;545;133;115;106;88;86	ENSP00000272203:L525S;ENSP00000402046:L545S	ENSP00000272203:L525S	L	-	2	0	PLEKHA6	202486316	1.000000	0.71417	0.996000	0.52242	0.595000	0.36748	5.584000	0.67490	2.166000	0.68216	0.523000	0.50628	TTA	.		0.602	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
SLC18A3	6572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	50819621	50819621	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:50819621G>C	ENST00000374115.3	+	1	1275	c.835G>C	c.(835-837)Ggc>Cgc	p.G279R	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	279					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CCTGCCAGTGGGCACTCCCAT	0.647																																					p.G279R		.											.	SLC18A3-92	0			c.G835C						.						45.0	42.0	43.0					10																	50819621		2202	4300	6502	SO:0001583	missense	6572	exon1			CCAGTGGGCACTC	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.835G>C	10.37:g.50819621G>C	ENSP00000363229:p.Gly279Arg	120	0		126	31	NM_003055	0	0	0	0	0	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749750	0.89753	.	.	ENSG00000187714	ENST00000374115	T	0.80393	-1.37	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	U	0.000001	D	0.91408	0.7289	M	0.86420	2.815	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.92566	0.6062	10	0.87932	D	0	0.7852	19.2158	0.93778	0.0:0.0:1.0:0.0	.	279	Q16572	VACHT_HUMAN	R	279	ENSP00000363229:G279R	ENSP00000363229:G279R	G	+	1	0	SLC18A3	50489627	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.824000	0.99380	2.552000	0.86080	0.561000	0.74099	GGC	.		0.647	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70450862	70450862	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:70450862T>G	ENST00000373644.4	+	12	5911	c.5702T>G	c.(5701-5703)aTt>aGt	p.I1901S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1901					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GGCCCTGGCATTTCACAGCTT	0.572																																					p.I1901S		.											.	TET1-663	0			c.T5702G						.						70.0	66.0	67.0					10																	70450862		2203	4300	6503	SO:0001583	missense	80312	exon12			CTGGCATTTCACA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5702T>G	10.37:g.70450862T>G	ENSP00000362748:p.Ile1901Ser	118	0		167	91	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	9.058	0.993658	0.19043	.	.	ENSG00000138336	ENST00000373644	T	0.06849	3.25	5.34	2.89	0.33648	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	5.533840	0.00166	N	0.000001	T	0.11024	0.0269	L	0.41710	1.295	0.09310	N	1	P	0.38729	0.644	B	0.40329	0.326	T	0.22382	-1.0218	10	0.49607	T	0.09	.	5.5383	0.17023	0.0:0.152:0.1458:0.7022	.	1901	Q8NFU7	TET1_HUMAN	S	1901	ENSP00000362748:I1901S	ENSP00000362748:I1901S	I	+	2	0	TET1	70120868	0.002000	0.14202	0.006000	0.13384	0.050000	0.14768	0.124000	0.15728	0.300000	0.22699	0.533000	0.62120	ATT	.		0.572	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
H2AFY2	55506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	71868875	71868875	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:71868875C>A	ENST00000373255.4	+	8	1129	c.865C>A	c.(865-867)Cag>Aag	p.Q289K	AIFM2_ENST00000373248.1_Intron	NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	289	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						ATGTGAAGAACAGCTTGAAGA	0.557																																					p.Q289K		.											.	H2AFY2-91	0			c.C865A						.						89.0	82.0	84.0					10																	71868875		2203	4300	6503	SO:0001583	missense	55506	exon8			GAAGAACAGCTTG	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.865C>A	10.37:g.71868875C>A	ENSP00000362352:p.Gln289Lys	92	0		167	24	NM_018649	0	0	0	0	0	Q5SQT2	Missense_Mutation	SNP	ENST00000373255.4	37	CCDS7296.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119095	0.77323	.	.	ENSG00000099284	ENST00000373255;ENST00000395046;ENST00000455786	T;T	0.21031	2.03;2.03	6.03	6.03	0.97812	Appr-1-p processing (2);	0.000000	0.85682	D	0.000000	T	0.16769	0.0403	N	0.17723	0.515	0.80722	D	1	P	0.43231	0.801	B	0.38842	0.283	T	0.02553	-1.1142	10	0.25751	T	0.34	.	20.177	0.98182	0.0:1.0:0.0:0.0	.	289	Q9P0M6	H2AW_HUMAN	K	289;223;223	ENSP00000362352:Q289K;ENSP00000404584:Q223K	ENSP00000362352:Q289K	Q	+	1	0	H2AFY2	71538881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.830000	0.62745	2.854000	0.98071	0.655000	0.94253	CAG	.		0.557	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649	
TRIM8	81603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	104415049	104415049	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:104415049G>A	ENST00000302424.7	+	3	1001	c.879G>A	c.(877-879)acG>acA	p.T293T	TRIM8_ENST00000487927.1_3'UTR	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	293					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TTGATAAGACGGAGGATGTCA	0.597																																					p.T293T		.											.	TRIM8-227	0			c.G879A						.						31.0	34.0	33.0					10																	104415049		2202	4300	6502	SO:0001819	synonymous_variant	81603	exon3			TAAGACGGAGGAT	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.879G>A	10.37:g.104415049G>A		74	0		92	8	NM_030912	0	0	0	0	0	A6NI31|Q9C028	Silent	SNP	ENST00000302424.7	37	CCDS31274.1																																																																																			.		0.597	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
NRAP	4892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115372127	115372127	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:115372127C>G	ENST00000359988.3	-	30	3608	c.3364G>C	c.(3364-3366)Gcc>Ccc	p.A1122P	NRAP_ENST00000369360.3_Missense_Mutation_p.A1095P|NRAP_ENST00000369358.4_Missense_Mutation_p.A1130P|NRAP_ENST00000360478.3_Missense_Mutation_p.A1087P	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.A1122T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGCACCAGGGCGGCCATGTCC	0.532																																					p.A1122P		.											.	NRAP-522	1	Substitution - Missense(1)	large_intestine(1)	c.G3364C						.						106.0	93.0	97.0					10																	115372127		2203	4300	6503	SO:0001583	missense	4892	exon30			CCAGGGCGGCCAT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3364G>C	10.37:g.115372127C>G	ENSP00000353078:p.Ala1122Pro	99	0		157	44	NM_001261463	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467717	0.26335	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.62	4.42	0.53409	.	0.222981	0.47852	D	0.000215	T	0.18923	0.0454	L	0.27053	0.805	0.19775	N	0.999954	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.16335	-1.0406	10	0.30078	T	0.28	.	6.6353	0.22879	0.0:0.0846:0.2726:0.6428	.	1122;1087;1122	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	P	1130;1095;1122;1087	ENSP00000358365:A1130P;ENSP00000358367:A1095P;ENSP00000353078:A1122P;ENSP00000353666:A1087P	ENSP00000353078:A1122P	A	-	1	0	NRAP	115362117	0.827000	0.29292	0.788000	0.31933	0.559000	0.35586	1.269000	0.33074	0.978000	0.38470	-0.345000	0.07892	GCC	.		0.532	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
NELL1	4745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	21594920	21594920	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:21594920A>T	ENST00000357134.5	+	19	2499	c.2347A>T	c.(2347-2349)Atg>Ttg	p.M783L	NELL1_ENST00000325319.5_Missense_Mutation_p.M726L|NELL1_ENST00000298925.5_Missense_Mutation_p.M811L|NELL1_ENST00000532434.1_Missense_Mutation_p.M736L|NELL1_ENST00000529218.1_3'UTR	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	783					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						AGTGTGGACGATGGCTGGATC	0.488																																					p.M783L		.											.	NELL1-155	0			c.A2347T						.						165.0	145.0	152.0					11																	21594920		2203	4300	6503	SO:0001583	missense	4745	exon19			TGGACGATGGCTG	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2347A>T	11.37:g.21594920A>T	ENSP00000349654:p.Met783Leu	211	0		211	75	NM_006157	0	0	0	0	0	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	A	5.365	0.252558	0.10185	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.78481	-1.18;-1.15;-1.07;-1.06	5.73	4.59	0.56863	.	0.047962	0.85682	N	0.000000	T	0.66655	0.2811	L	0.46157	1.445	0.34190	D	0.671993	P;B;B;B;P	0.37370	0.592;0.0;0.001;0.001;0.457	B;B;B;B;B	0.33254	0.16;0.0;0.002;0.007;0.077	T	0.68561	-0.5376	10	0.10636	T	0.68	-16.3644	12.2052	0.54348	0.872:0.0:0.0:0.1279	.	726;811;328;736;783	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	L	811;783;726;736	ENSP00000298925:M811L;ENSP00000349654:M783L;ENSP00000317837:M726L;ENSP00000437170:M736L	ENSP00000298925:M811L	M	+	1	0	NELL1	21551496	1.000000	0.71417	0.995000	0.50966	0.203000	0.24098	5.967000	0.70403	0.983000	0.38602	0.454000	0.30748	ATG	.		0.488	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
IMMP1L	196294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	31482191	31482191	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:31482191T>C	ENST00000278200.1	-	4	371	c.176A>G	c.(175-177)cAt>cGt	p.H59R	IMMP1L_ENST00000532287.1_Missense_Mutation_p.H59R|IMMP1L_ENST00000526776.1_Intron|IMMP1L_ENST00000528161.1_Intron|IMMP1L_ENST00000533642.1_Intron|IMMP1L_ENST00000534812.1_Intron	NM_144981.1	NP_659418.1	Q96LU5	IMP1L_HUMAN	IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)	59					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	serine-type peptidase activity (GO:0008236)			breast(1)|cervix(1)|large_intestine(1)|lung(4)	7	Lung SC(675;0.225)					ACCATAAAAATGTCGACTAAG	0.318																																					p.H59R		.											.	IMMP1L-90	0			c.A176G						.						67.0	69.0	68.0					11																	31482191		2202	4295	6497	SO:0001583	missense	196294	exon4			TAAAAATGTCGAC		CCDS7874.1	11p13	2014-07-30			ENSG00000148950	ENSG00000148950			26317	protein-coding gene	gene with protein product		612323					Standard	NM_144981		Approved	FLJ25059	uc001msy.1	Q96LU5	OTTHUMG00000166226	ENST00000278200.1:c.176A>G	11.37:g.31482191T>C	ENSP00000278200:p.His59Arg	59	0		36	11	NM_144981	0	0	0	0	0	D3DQZ7|Q96SH9	Missense_Mutation	SNP	ENST00000278200.1	37	CCDS7874.1	.	.	.	.	.	.	.	.	.	.	T	8.728	0.915998	0.17907	.	.	ENSG00000148950	ENST00000532287;ENST00000278200;ENST00000529749;ENST00000530023	.	.	.	5.58	5.58	0.84498	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.046287	0.85682	D	0.000000	T	0.32102	0.0818	N	0.02403	-0.565	0.80722	D	1	P;B	0.38300	0.626;0.0	P;B	0.45232	0.474;0.006	T	0.36187	-0.9758	9	0.02654	T	1	-14.2458	16.0334	0.80603	0.0:0.0:0.0:1.0	.	59;59	E9PIG6;Q96LU5	.;IMP1L_HUMAN	R	59	.	ENSP00000278200:H59R	H	-	2	0	IMMP1L	31438767	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.245000	0.65405	2.243000	0.73865	0.533000	0.62120	CAT	.		0.318	IMMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388496.1	NM_144981	
CCDC73	493860	hgsc.bcm.edu	37	11	32676507	32676507	+	Silent	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:32676507T>C	ENST00000335185.5	-	10	700	c.657A>G	c.(655-657)aaA>aaG	p.K219K	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	219										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					CTGAGGCTGCTTTTTTTAGTT	0.303																																					p.D219E		.											.	CCDC73-91	0			c.T657G						.						80.0	67.0	71.0					11																	32676507		1809	4051	5860	SO:0001819	synonymous_variant	493860	exon10			GGCTGCTTTTTTT	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.657A>G	11.37:g.32676507T>C		42	0		25	2	NM_001008391	0	0	0	0	0	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1																																																																																			.		0.303	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
PRR5L	79899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	36472765	36472765	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:36472765C>T	ENST00000378867.3	+	9	947	c.592C>T	c.(592-594)Cac>Tac	p.H198Y	PRR5L_ENST00000527487.1_Intron|PRR5L_ENST00000530639.1_Missense_Mutation_p.H198Y|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000311599.5_Missense_Mutation_p.H125Y	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	198					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)	p.H198Y(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						CCAGAGTGTTCACGAGCCCAC	0.502																																					p.H198Y		.											.	PRR5L-91	1	Substitution - Missense(1)	cervix(1)	c.C592T						.						170.0	157.0	162.0					11																	36472765		2202	4298	6500	SO:0001583	missense	79899	exon9			AGTGTTCACGAGC		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.592C>T	11.37:g.36472765C>T	ENSP00000368144:p.His198Tyr	145	0		156	67	NM_024841	0	0	0	0	0	A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	ENST00000378867.3	37	CCDS31463.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049026	0.75846	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867	T;T;T	0.36157	1.27;1.5;1.27	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.80982	2.52	0.58432	D	0.999995	D;D	0.71674	0.989;0.998	D;D	0.77557	0.979;0.99	T	0.69815	-0.5043	10	0.87932	D	0	-17.9831	17.9793	0.89136	0.0:1.0:0.0:0.0	.	70;198	Q6MZQ0-3;Q6MZQ0	.;PRR5L_HUMAN	Y	198;125;198	ENSP00000435050:H198Y;ENSP00000310103:H125Y;ENSP00000368144:H198Y	ENSP00000310103:H125Y	H	+	1	0	PRR5L	36429341	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.758000	0.68776	2.345000	0.79718	0.313000	0.20887	CAC	.		0.502	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	NM_024841	
CKAP5	9793	broad.mit.edu	37	11	46804912	46804912	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:46804912A>G	ENST00000529230.1	-	18	2207	c.2161T>C	c.(2161-2163)Tca>Cca	p.S721P	CKAP5_ENST00000312055.5_Missense_Mutation_p.S721P|CKAP5_ENST00000354558.3_Missense_Mutation_p.S721P|CKAP5_ENST00000415402.1_Missense_Mutation_p.S721P			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	721					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AAAGCCATTGACACAACCTGA	0.348																																					p.S721P	Ovarian(4;85 273 2202 4844 13323)												.	CKAP5-92	0			c.T2161C						.						80.0	77.0	78.0					11																	46804912		2201	4299	6500	SO:0001583	missense	9793	exon18			CCATTGACACAAC		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.2161T>C	11.37:g.46804912A>G	ENSP00000432768:p.Ser721Pro	67	0		43	3	NM_001008938	0	0	0	0	0	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.920823	0.33908	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.25	5.25	0.73442	Armadillo-type fold (1);	0.184073	0.49305	D	0.000149	T	0.56337	0.1978	L	0.34521	1.04	0.53005	D	0.999962	B;P;B	0.39883	0.305;0.693;0.214	B;B;B	0.41332	0.162;0.354;0.063	T	0.55749	-0.8092	10	0.32370	T	0.25	-4.3512	10.7838	0.46393	0.8291:0.1709:0.0:0.0	.	721;721;721	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	P	721	ENSP00000432768:S721P;ENSP00000395302:S721P;ENSP00000310227:S721P;ENSP00000346566:S721P	ENSP00000310227:S721P	S	-	1	0	CKAP5	46761488	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	5.799000	0.69101	1.989000	0.58080	0.528000	0.53228	TCA	.		0.348	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
GSTP1	2950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67352235	67352235	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:67352235G>A	ENST00000398606.3	+	4	473	c.224G>A	c.(223-225)cGc>cAc	p.R75H	GSTP1_ENST00000398603.1_Missense_Mutation_p.R75H|GSTP1_ENST00000498765.1_3'UTR	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	75	GST N-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CACCTGGGCCGCACCCTTGGT	0.617																																					p.R75H		.											.	GSTP1-91	0			c.G224A						.						65.0	72.0	70.0					11																	67352235		1984	4154	6138	SO:0001583	missense	2950	exon4			TGGGCCGCACCCT	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.224G>A	11.37:g.67352235G>A	ENSP00000381607:p.Arg75His	109	1		125	59	NM_000852	0	0	0	0	0	O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	ENST00000398606.3	37	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827181	0.32329	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.08634	3.07;3.07	5.55	2.56	0.30785	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (1);	0.225561	0.37623	N	0.002005	T	0.10337	0.0253	M	0.79614	2.46	0.41117	D	0.985788	P	0.35700	0.516	B	0.33521	0.165	T	0.06232	-1.0838	9	0.52906	T	0.07	-16.5031	5.4855	0.16747	0.1699:0.0:0.6726:0.1576	.	75	P09211	GSTP1_HUMAN	H	75	ENSP00000381607:R75H;ENSP00000381604:R75H	ENSP00000381604:R75H	R	+	2	0	GSTP1	67108811	1.000000	0.71417	0.910000	0.35882	0.001000	0.01503	5.167000	0.64972	0.721000	0.32231	-0.142000	0.14014	CGC	.		0.617	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852	
AAMDC	28971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	77580812	77580812	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:77580812G>A	ENST00000526415.1	+	4	350	c.177G>A	c.(175-177)gaG>gaA	p.E59E	AAMDC_ENST00000525034.1_Silent_p.E78E|AAMDC_ENST00000525409.1_Intron|RP11-91P24.7_ENST00000525594.1_RNA|AAMDC_ENST00000527134.1_Silent_p.E59E|AAMDC_ENST00000393427.2_Silent_p.E59E|AAMDC_ENST00000533193.1_Silent_p.E105E|RP11-91P24.6_ENST00000530972.1_RNA|AAMDC_ENST00000532481.1_Silent_p.E59E|AAMDC_ENST00000304716.8_Silent_p.E59E			Q9H7C9	AAMDC_HUMAN	adipogenesis associated, Mth938 domain containing	59	MTH138-like domain. {ECO:0000250}.				negative regulation of apoptotic process (GO:0043066)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)											AAGTTGTTGAGAAGGGTGTAC	0.493																																					p.E59E		.											.	.	0			c.G177A						.						349.0	322.0	331.0					11																	77580812		2200	4292	6492	SO:0001819	synonymous_variant	28971	exon3			TGTTGAGAAGGGT	BC016854	CCDS8254.1	11q14.1	2012-10-08	2012-10-08	2012-10-08	ENSG00000087884	ENSG00000087884			30205	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 67"""	C11orf67		12477932	Standard	NM_024684		Approved	PTD015, FLJ21035, CK067	uc001oyq.3	Q9H7C9	OTTHUMG00000166651	ENST00000526415.1:c.177G>A	11.37:g.77580812G>A		338	0		264	91	NM_024684	0	0	0	0	0	Q96AQ4|Q9Y6B1	Silent	SNP	ENST00000526415.1	37	CCDS8254.1																																																																																			.		0.493	AAMDC-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390976.1	NM_024684	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877724	82877724	+	Silent	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:82877724A>G	ENST00000298281.4	+	5	2237	c.1785A>G	c.(1783-1785)aaA>aaG	p.K595K		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	595					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AGTCTGCCAAAAGATGGAAAT	0.348																																					p.K595K		.											.	PCF11-23	0			c.A1785G						.						73.0	75.0	74.0					11																	82877724		1755	3856	5611	SO:0001819	synonymous_variant	51585	exon5			TGCCAAAAGATGG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1785A>G	11.37:g.82877724A>G		142	0		125	55	NM_015885	0	0	0	0	0	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	CCDS44689.1																																																																																			.		0.348	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PCF11	51585	hgsc.bcm.edu	37	11	82878487	82878487	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:82878487A>G	ENST00000298281.4	+	7	2484	c.2032A>G	c.(2032-2034)Aca>Gca	p.T678A		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	678					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TGGTGAAATTACACAGGATGA	0.333																																					p.T678A		.											.	PCF11-23	0			c.A2032G						.						67.0	58.0	61.0					11																	82878487		1857	4097	5954	SO:0001583	missense	51585	exon7			GAAATTACACAGG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2032A>G	11.37:g.82878487A>G	ENSP00000298281:p.Thr678Ala	33	0		36	2	NM_015885	0	0	0	0	0	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607403	0.28623	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.50277	1.71;0.78;0.75	5.98	3.51	0.40186	.	0.214364	0.33144	N	0.005224	T	0.33381	0.0861	L	0.27053	0.805	0.36008	D	0.837853	P;B	0.44090	0.826;0.089	B;B	0.40825	0.341;0.037	T	0.36089	-0.9762	9	.	.	.	.	11.0037	0.47622	0.7513:0.0:0.0:0.2487	.	678;678	E9PQ01;O94913	.;PCF11_HUMAN	A	678	ENSP00000298281:T678A;ENSP00000434540:T678A;ENSP00000431567:T678A	.	T	+	1	0	PCF11	82556135	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.208000	0.58486	1.056000	0.40484	-0.468000	0.05107	ACA	.		0.333	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PCSK7	9159	hgsc.bcm.edu	37	11	117077797	117077797	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:117077797G>A	ENST00000320934.3	-	15	2496	c.1866C>T	c.(1864-1866)atC>atT	p.I622I	PCSK7_ENST00000540028.1_3'UTR|PCSK7_ENST00000529458.1_Intron	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	622					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GTCTGTCCCTGATGTCTACTG	0.607			T	IGH@	MLCLS																																p.I622I		.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	.	PCSK7-658	0			c.C1866T						.						79.0	72.0	74.0					11																	117077797		2201	4293	6494	SO:0001819	synonymous_variant	9159	exon15			GTCCCTGATGTCT	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1866C>T	11.37:g.117077797G>A		248	0		239	45	NM_004716	0	0	0	0	0	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Silent	SNP	ENST00000320934.3	37	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	G	9.730	1.161985	0.21538	.	.	ENSG00000160613	ENST00000543900	.	.	.	5.01	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-31.6552	3.4196	0.07388	0.0833:0.1475:0.4652:0.304	.	.	.	.	X	574	.	ENSP00000445538:Q574X	Q	-	1	0	PCSK7	116583007	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	1.991000	0.40727	0.698000	0.31739	-0.183000	0.12914	CAG	.		0.607	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
ARHGAP32	9743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	128840894	128840894	+	Missense_Mutation	SNP	C	C	T	rs530219324		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:128840894C>T	ENST00000310343.9	-	22	4171	c.4172G>A	c.(4171-4173)cGg>cAg	p.R1391Q	ARHGAP32_ENST00000527272.1_Missense_Mutation_p.R1042Q|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.R1042Q	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1391	Interaction with GAB2.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CAGCGGGACCCGGGCACCGTC	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		17039	0.0		0.001	False		,,,				2504	0.0				p.R1391Q		.											.	ARHGAP32-231	0			c.G4172A						.						45.0	47.0	47.0					11																	128840894		2201	4297	6498	SO:0001583	missense	9743	exon22			GGGACCCGGGCAC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4172G>A	11.37:g.128840894C>T	ENSP00000310561:p.Arg1391Gln	58	0		61	25	NM_001142685	0	0	0	0	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168938	0.78339	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.11712	2.77;2.75;2.75	5.71	5.71	0.89125	.	0.112572	0.56097	D	0.000024	T	0.19805	0.0476	M	0.69823	2.125	0.32214	N	0.576128	D	0.58620	0.983	P	0.44422	0.449	T	0.09207	-1.0685	10	0.37606	T	0.19	.	19.8599	0.96779	0.0:1.0:0.0:0.0	.	1391	A7KAX9	RHG32_HUMAN	Q	1391;1042;1042	ENSP00000310561:R1391Q;ENSP00000376425:R1042Q;ENSP00000432862:R1042Q	ENSP00000310561:R1391Q	R	-	2	0	ARHGAP32	128346104	0.998000	0.40836	0.932000	0.37286	0.291000	0.27294	3.773000	0.55333	2.710000	0.92621	0.655000	0.94253	CGG	.		0.632	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
AKAP3	10566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	4737430	4737430	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr12:4737430T>G	ENST00000545990.2	-	5	1162	c.638A>C	c.(637-639)aAa>aCa	p.K213T	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.K213T	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	213					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						GGACTTGTATTTCAAATTTGG	0.468																																					p.K213T		.											.	AKAP3-292	0			c.A638C						.						99.0	99.0	99.0					12																	4737430		2203	4300	6503	SO:0001583	missense	10566	exon4			TTGTATTTCAAAT	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.638A>C	12.37:g.4737430T>G	ENSP00000440994:p.Lys213Thr	173	0		202	121	NM_006422	0	0	0	0	0	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	37	CCDS8531.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.224438	0.39300	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.09255	3.0;3.0	4.87	1.27	0.21489	A-kinase anchor 110kDa, C-terminal (1);	0.332965	0.25968	N	0.027150	T	0.20861	0.0502	M	0.63428	1.95	0.09310	N	1	D	0.63046	0.992	P	0.60415	0.874	T	0.03651	-1.1016	10	0.87932	D	0	-14.2358	6.9349	0.24461	0.0:0.2845:0.0:0.7155	.	213	O75969	AKAP3_HUMAN	T	213	ENSP00000228850:K213T;ENSP00000440994:K213T	ENSP00000228850:K213T	K	-	2	0	AKAP3	4607691	0.949000	0.32298	0.109000	0.21407	0.693000	0.40251	1.094000	0.30951	0.121000	0.18284	0.528000	0.53228	AAA	.		0.468	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
GTSF1	121355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54856511	54856511	+	Splice_Site	SNP	T	T	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr12:54856511T>A	ENST00000552397.1	-	5	1141		c.e5-2		GTSF1_ENST00000305879.5_Splice_Site|RP11-753H16.3_ENST00000550474.1_RNA|GTSF1_ENST00000552395.1_Splice_Site|RP11-753H16.5_ENST00000552785.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1							cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				TTTGGTTGACTGCAAGACAAT	0.483																																					.		.											.	GTSF1-90	0			c.245-2A>T						.						92.0	91.0	92.0					12																	54856511		2203	4300	6503	SO:0001630	splice_region_variant	121355	exon6			GTTGACTGCAAGA	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.245-2A>T	12.37:g.54856511T>A		93	0		168	46	NM_144594	0	0	0	0	0	B3KQ60|Q0VGM4|Q8N778	Splice_Site	SNP	ENST00000552397.1	37	CCDS8881.1	.	.	.	.	.	.	.	.	.	.	T	9.953	1.220561	0.22457	.	.	ENSG00000170627	ENST00000552397;ENST00000305879	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3935	0.55373	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTSF1	53142778	1.000000	0.71417	0.971000	0.41717	0.231000	0.25187	4.551000	0.60740	2.183000	0.69458	0.533000	0.62120	.	.		0.483	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1	NM_144594	Intron
WIF1	11197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	65460514	65460514	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr12:65460514G>T	ENST00000286574.4	-	6	1011	c.637C>A	c.(637-639)Ctt>Att	p.L213I		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	213	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		GGGGTACAAAGGGCTTATAGG	0.433			T	HMGA2	pleomorphic salivary gland adenoma																																p.L213I	Esophageal Squamous(148;1595 1816 48559 49439 49664)	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1-1110	0			c.C637A						.						75.0	72.0	73.0					12																	65460514		2203	4300	6503	SO:0001583	missense	11197	exon6			TACAAAGGGCTTA	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.637C>A	12.37:g.65460514G>T	ENSP00000286574:p.Leu213Ile	44	0		54	14	NM_007191	0	0	0	0	0	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572822	0.45798	.	.	ENSG00000156076	ENST00000286574	T	0.03035	4.07	5.23	4.34	0.51931	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.068823	0.64402	D	0.000016	T	0.02455	0.0075	N	0.05306	-0.075	0.53688	D	0.999978	B	0.19935	0.04	B	0.25291	0.059	T	0.54675	-0.8258	9	.	.	.	.	14.326	0.66521	0.0722:0.0:0.9278:0.0	.	213	Q9Y5W5	WIF1_HUMAN	I	213	ENSP00000286574:L213I	.	L	-	1	0	WIF1	63746781	1.000000	0.71417	0.998000	0.56505	0.123000	0.20343	4.824000	0.62701	1.530000	0.49136	0.655000	0.94253	CTT	.		0.433	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
DDX51	317781	hgsc.bcm.edu	37	12	132628412	132628412	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr12:132628412C>T	ENST00000397333.3	-	2	385	c.347G>A	c.(346-348)aGc>aAc	p.S116N	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	116					rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		CGCCTCCTCGCTGCTCCCTGC	0.766																																					p.S116N		.											.	DDX51-227	0			c.G347A						.						2.0	3.0	3.0					12																	132628412		1500	3477	4977	SO:0001583	missense	317781	exon2			TCCTCGCTGCTCC	BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.347G>A	12.37:g.132628412C>T	ENSP00000380495:p.Ser116Asn	4	1		16	2	NM_175066	0	0	0	0	0	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	ENST00000397333.3	37	CCDS41865.1	.	.	.	.	.	.	.	.	.	.	c	3.403	-0.121875	0.06795	.	.	ENSG00000185163	ENST00000397333	T	0.01933	4.55	1.88	-2.2	0.06994	.	0.671970	0.14773	U	0.299291	T	0.01287	0.0042	N	0.22421	0.69	0.09310	N	1	B	0.22604	0.072	B	0.16722	0.016	T	0.47911	-0.9080	10	0.16896	T	0.51	.	3.3245	0.07062	0.0:0.274:0.2471:0.4789	.	116	Q8N8A6	DDX51_HUMAN	N	116	ENSP00000380495:S116N	ENSP00000380495:S116N	S	-	2	0	DDX51	131194365	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.480000	0.22244	-0.320000	0.08640	-1.201000	0.01664	AGC	.		0.766	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398978.1	NM_175066	
PARP4	143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	25029240	25029240	+	Silent	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr13:25029240T>C	ENST00000381989.3	-	22	2778	c.2673A>G	c.(2671-2673)acA>acG	p.T891T	PARP4_ENST00000480576.1_5'Flank	NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	891	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CTTGCAAGAATGTCACACCCT	0.502																																					p.T891T		.											.	PARP4-94	0			c.A2673G						.						261.0	222.0	235.0					13																	25029240		2203	4300	6503	SO:0001819	synonymous_variant	143	exon22			CAAGAATGTCACA	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2673A>G	13.37:g.25029240T>C		257	0		286	104	NM_006437	0	0	0	0	0	O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																			.		0.502	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
CPB2	1361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	46658419	46658419	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr13:46658419A>C	ENST00000181383.4	-	3	226	c.210T>G	c.(208-210)ttT>ttG	p.F70L	CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000606351.1_RNA|CPB2_ENST00000439329.3_Missense_Mutation_p.F70L	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	70					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		CATTTACAAAAAAATGGACTT	0.368																																					p.F70L		.											.	CPB2-92	0			c.T210G						.						151.0	139.0	143.0					13																	46658419		2203	4300	6503	SO:0001583	missense	1361	exon3			TACAAAAAAATGG	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.210T>G	13.37:g.46658419A>C	ENSP00000181383:p.Phe70Leu	166	0		171	74	NM_001872	0	0	0	0	0	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	37	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.740893	0.49151	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.13538	2.58;2.58	5.41	-2.81	0.05805	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.050842	0.85682	D	0.000000	T	0.12646	0.0307	L	0.42245	1.32	0.40335	D	0.978972	B;P	0.49253	0.337;0.921	B;P	0.46320	0.162;0.512	T	0.03875	-1.0996	10	0.44086	T	0.13	.	10.4812	0.44695	0.4897:0.0:0.5103:0.0	.	70;70	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	L	70	ENSP00000181383:F70L;ENSP00000400714:F70L	ENSP00000181383:F70L	F	-	3	2	CPB2	45556420	0.999000	0.42202	0.991000	0.47740	0.819000	0.46315	0.355000	0.20163	-0.389000	0.07786	-0.263000	0.10527	TTT	.		0.368	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872	
AP1G2	8906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24032848	24032848	+	Splice_Site	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr14:24032848C>T	ENST00000308724.5	-	12	1988		c.e12-1		AP1G2_ENST00000397120.3_Splice_Site|AP1G2_ENST00000556277.1_5'Flank|RP11-66N24.3_ENST00000555968.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TGGAGCAAACCTAGGGGATAT	0.567											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	AP1G2-45	0			c.1233-1G>A						.						138.0	109.0	119.0					14																	24032848		2203	4300	6503	SO:0001630	splice_region_variant	8906	exon14			GCAAACCTAGGGG	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1233-1G>A	14.37:g.24032848C>T		103	0	768	68	46	NM_003917	0	0	0	0	0	D3DS51|O75504	Splice_Site	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691409	0.48097	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7542	0.69552	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AP1G2	23102688	1.000000	0.71417	0.997000	0.53966	0.613000	0.37349	4.964000	0.63701	2.314000	0.78098	0.557000	0.71058	.	.		0.567	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	Intron
TGM1	7051	hgsc.bcm.edu	37	14	24718666	24718666	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr14:24718666G>T	ENST00000206765.6	-	15	2430	c.2307C>A	c.(2305-2307)agC>agA	p.S769R	TGM1_ENST00000544573.1_Missense_Mutation_p.S327R	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	769					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGCTGTCCAAGCTGGCAATGA	0.622																																					p.S769R		.											.	TGM1-91	0			c.C2307A						.						65.0	58.0	61.0					14																	24718666		2203	4300	6503	SO:0001583	missense	7051	exon15			GTCCAAGCTGGCA	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.2307C>A	14.37:g.24718666G>T	ENSP00000206765:p.Ser769Arg	76	0		57	3	NM_000359	0	0	0	0	0	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631726	0.67015	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	T;T	0.69435	-0.4;-0.4	4.97	0.986	0.19784	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.106857	0.64402	D	0.000006	T	0.78227	0.4250	M	0.80982	2.52	0.39093	D	0.961146	D	0.89917	1.0	D	0.77557	0.99	T	0.77811	-0.2449	10	0.66056	D	0.02	-37.3875	8.3138	0.32088	0.4692:0.0:0.5308:0.0	.	769	P22735	TGM1_HUMAN	R	769;327	ENSP00000206765:S769R;ENSP00000439446:S327R	ENSP00000206765:S769R	S	-	3	2	TGM1	23788506	0.988000	0.35896	0.998000	0.56505	0.996000	0.88848	0.096000	0.15147	0.277000	0.22141	0.655000	0.94253	AGC	.		0.622	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
MIS18BP1	55320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	45711249	45711249	+	Silent	SNP	A	A	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr14:45711249A>C	ENST00000310806.4	-	4	1589	c.1131T>G	c.(1129-1131)ctT>ctG	p.L377L	MIS18BP1_ENST00000492652.1_5'UTR	NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	377					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						GATTTTTTTTAAGTCCATTTG	0.308																																					p.L377L		.											.	MIS18BP1-90	0			c.T1131G						.						57.0	66.0	63.0					14																	45711249		2202	4294	6496	SO:0001819	synonymous_variant	55320	exon4			TTTTTTAAGTCCA	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.1131T>G	14.37:g.45711249A>C		110	0		47	30	NM_018353	0	0	0	0	0	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Silent	SNP	ENST00000310806.4	37	CCDS9684.1																																																																																			.		0.308	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
NEK9	91754	hgsc.bcm.edu	37	14	75593497	75593497	+	Missense_Mutation	SNP	C	C	G	rs78524303	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr14:75593497C>G	ENST00000238616.5	-	1	286	c.128G>C	c.(127-129)gGc>gCc	p.G43A	RP11-950C14.7_ENST00000556236.1_RNA	NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	43					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		CTccgccgcgccgccgccggc	0.721													C|||	90	0.0179712	0.0666	0.0029	5008	,	,		13180	0.0		0.0	False		,,,				2504	0.0				p.G43A		.											.	NEK9-359	0			c.G128C						.	C	ALA/GLY	99,3617		1,97,1760	5.0	7.0	7.0		128	3.3	1.0	14	dbSNP_131	7	1,7139		0,1,3569	no	missense	NEK9	NM_033116.4	60	1,98,5329	GG,GC,CC		0.014,2.6642,0.9211	benign	43/980	75593497	100,10756	1858	3570	5428	SO:0001583	missense	91754	exon1			GCCGCGCCGCCGC	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.128G>C	14.37:g.75593497C>G	ENSP00000238616:p.Gly43Ala	2	0		2	2	NM_033116	0	0	0	0	0	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	37	CCDS9839.1	45	0.020604395604395604	44	0.08943089430894309	1	0.0027624309392265192	0	0.0	0	0.0	C	16.06	3.016730	0.54468	0.026642	1.4E-4	ENSG00000119638	ENST00000238616	T	0.70986	-0.53	3.34	3.34	0.38264	.	0.228496	0.38217	N	0.001761	T	0.03053	0.0090	N	0.14661	0.345	0.33726	D	0.617613	B	0.10296	0.003	B	0.12156	0.007	T	0.25710	-1.0124	10	0.20519	T	0.43	.	12.956	0.58427	0.0:1.0:0.0:0.0	.	43	Q8TD19	NEK9_HUMAN	A	43	ENSP00000238616:G43A	ENSP00000238616:G43A	G	-	2	0	NEK9	74663250	0.995000	0.38212	1.000000	0.80357	0.974000	0.67602	0.878000	0.28126	1.837000	0.53436	0.462000	0.41574	GGC	C|0.979;G|0.021		0.721	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
AHNAK2	113146	ucsc.edu	37	14	105410343	105410343	+	Silent	SNP	C	C	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr14:105410343C>A	ENST00000333244.5	-	7	11564	c.11445G>T	c.(11443-11445)gtG>gtT	p.V3815V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3815						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGGGGCAGACACCCCAAATG	0.587																																					p.V3815V													.	AHNAK2-47	0			c.G11445T						.						238.0	236.0	236.0					14																	105410343		1996	4157	6153	SO:0001819	synonymous_variant	113146	exon7			GGCAGACACCCCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11445G>T	14.37:g.105410343C>A		392	0		263	5	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.587	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
SERINC4	619189	ucsc.edu;bcgsc.ca	37	15	44090645	44090645	+	Silent	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr15:44090645A>T	ENST00000319327.6	-	4	750	c.516T>A	c.(514-516)atT>atA	p.I172I	HYPK_ENST00000458412.1_5'Flank|SERF2_ENST00000600633.1_5'Flank|SERINC4_ENST00000249714.3_5'UTR|SERINC4_ENST00000299969.6_Silent_p.I172I|SERF2_ENST00000409646.1_Intron|HYPK_ENST00000442995.2_5'Flank|SERF2_ENST00000409291.1_Intron|SERF2_ENST00000594896.1_Intron|RP11-296A16.1_ENST00000417761.2_Intron|HYPK_ENST00000406925.1_5'UTR	NM_001258031.1	NP_001244960.1	A6NH21	SERC4_HUMAN	serine incorporator 4	172					phospholipid biosynthetic process (GO:0008654)	integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	6		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		GCTCATCAGGAATGCAGAAGG	0.483																																					p.I172I													.	SERINC4-90	0			c.T516A						.						115.0	106.0	109.0					15																	44090645		2198	4298	6496	SO:0001819	synonymous_variant	619189	exon4			ATCAGGAATGCAG	DQ103711	CCDS58360.1	15q15.3	2013-09-25			ENSG00000184716	ENSG00000184716			32237	protein-coding gene	gene with protein product		614550					Standard	NM_001258031		Approved	FLJ40363	uc031qrp.1	A6NH21	OTTHUMG00000060144	ENST00000319327.6:c.516T>A	15.37:g.44090645A>T		98	0		89	43	NM_001258031	0	0	0	0	0	B2RN41|Q3YL75	Silent	SNP	ENST00000319327.6	37	CCDS58360.1																																																																																			.		0.483	SERINC4-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133485.2		
CSPG4	1464	hgsc.bcm.edu	37	15	75985432	75985432	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr15:75985432C>A	ENST00000308508.5	-	2	323	c.231G>T	c.(229-231)caG>caT	p.Q77H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	77	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CAGAGTAGAGCTGCAGCAGGA	0.627																																					p.Q77H		.											.	CSPG4-229	0			c.G231T						.						10.0	8.0	9.0					15																	75985432		2185	4240	6425	SO:0001583	missense	1464	exon2			GTAGAGCTGCAGC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.231G>T	15.37:g.75985432C>A	ENSP00000312506:p.Gln77His	18	0		35	6	NM_001897	0	0	0	0	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	19.47	3.833556	0.71258	.	.	ENSG00000173546	ENST00000308508	T	0.76709	-1.04	4.78	-2.86	0.05717	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.384482	0.21631	N	0.071486	T	0.80904	0.4713	L	0.58101	1.795	0.42024	D	0.990993	D	0.67145	0.996	D	0.64877	0.93	T	0.79591	-0.1740	10	0.72032	D	0.01	.	10.2802	0.43534	0.0:0.415:0.0:0.585	.	77	Q6UVK1	CSPG4_HUMAN	H	77	ENSP00000312506:Q77H	ENSP00000312506:Q77H	Q	-	3	2	CSPG4	73772487	0.236000	0.23804	0.916000	0.36221	0.977000	0.68977	-0.283000	0.08433	-0.376000	0.07943	-0.266000	0.10368	CAG	.		0.627	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
LRRK1	79705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101529603	101529603	+	Splice_Site	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr15:101529603A>G	ENST00000388948.3	+	6	1121	c.762A>G	c.(760-762)acA>acG	p.T254T	LRRK1_ENST00000532029.2_Silent_p.T254T|LRRK1_ENST00000284395.5_Splice_Site_p.T251T	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CGGGAAAAACAGTGAGTAGTC	0.433																																					p.T254T		.											.	LRRK1-602	0			c.A762G						.						80.0	79.0	79.0					15																	101529603		1890	4124	6014	SO:0001630	splice_region_variant	79705	exon6			AAAAACAGTGAGT	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.762+1A>G	15.37:g.101529603A>G		59	0		64	30	NM_024652	0	0	0	0	0		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																			.		0.433	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	Silent
RAB11FIP3	9727	hgsc.bcm.edu	37	16	570232	570232	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:570232C>T	ENST00000262305.4	+	12	2359	c.1971C>T	c.(1969-1971)cgC>cgT	p.R657R	RAB11FIP3_ENST00000457159.1_Silent_p.R702R|RAB11FIP3_ENST00000450428.1_Silent_p.R361R	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	657					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				ACCACAGCCGCGCCCGGGAGA	0.682																																					p.R657R	Melanoma(160;2366 2595 4474 8099)	.											.	RAB11FIP3-90	0			c.C1971T						.						5.0	9.0	8.0					16																	570232		2086	4138	6224	SO:0001819	synonymous_variant	9727	exon12			CAGCCGCGCCCGG	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1971C>T	16.37:g.570232C>T		8	0		11	6	NM_014700	0	0	0	0	0	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Silent	SNP	ENST00000262305.4	37	CCDS32351.1																																																																																			.		0.682	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	NM_014700	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	15880497	15880497	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:15880497G>T	ENST00000300036.5	-	5	732	c.623C>A	c.(622-624)aCa>aAa	p.T208K	MYH11_ENST00000452625.2_Missense_Mutation_p.T208K|MYH11_ENST00000396324.3_Missense_Mutation_p.T208K|MYH11_ENST00000576790.2_Missense_Mutation_p.T208K	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	208	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGTGATACTTGTGTCTTTCTT	0.527			T	CBFB	AML																																p.T208K		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11-666	0			c.C623A						.						210.0	155.0	173.0					16																	15880497		2197	4300	6497	SO:0001583	missense	4629	exon5			ATACTTGTGTCTT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.623C>A	16.37:g.15880497G>T	ENSP00000300036:p.Thr208Lys	64	1		63	23	NM_001040114	0	0	0	0	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	4.212	0.038077	0.08148	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.71461	-0.57;-0.57;-0.56;-0.56	5.25	3.25	0.37280	Myosin head, motor domain (2);	0.379952	0.28322	N	0.015761	T	0.46367	0.1389	N	0.05177	-0.1	0.40126	D	0.97666	B;B;B;B;B	0.10296	0.001;0.0;0.0;0.0;0.003	B;B;B;B;B	0.11329	0.002;0.002;0.002;0.002;0.006	T	0.27365	-1.0076	10	0.37606	T	0.19	.	8.2051	0.31449	0.0889:0.1663:0.7448:0.0	.	208;208;208;208;208	Q4G140;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	K	208	ENSP00000300036:T208K;ENSP00000345136:T208K;ENSP00000379616:T208K;ENSP00000407821:T208K	ENSP00000300036:T208K	T	-	2	0	MYH11	15787998	1.000000	0.71417	0.610000	0.28997	0.808000	0.45660	3.511000	0.53400	0.584000	0.29591	0.549000	0.68633	ACA	.		0.527	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
ARL6IP1	23204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	18810023	18810023	+	Splice_Site	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:18810023A>G	ENST00000304414.7	-	2	381	c.170T>C	c.(169-171)cTg>cCg	p.L57P	ARL6IP1_ENST00000562819.1_Intron|ARL6IP1_ENST00000546206.2_Splice_Site_p.L28P|RP11-1035H13.3_ENST00000567078.2_Splice_Site_p.L57P	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	57					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						GCTCACTTACAGAAACACCAA	0.413																																					p.L57P		.											.	ARL6IP1-90	0			c.T170C						.						132.0	115.0	121.0					16																	18810023		2197	4300	6497	SO:0001630	splice_region_variant	23204	exon2			ACTTACAGAAACA	BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.170+1T>C	16.37:g.18810023A>G		147	0		168	63	NM_015161	0	0	0	0	0		Missense_Mutation	SNP	ENST00000304414.7	37	CCDS10572.1	.	.	.	.	.	.	.	.	.	.	a	23.3	4.394667	0.83011	.	.	ENSG00000170540	ENST00000304414;ENST00000545430;ENST00000546206	T;T	0.52754	0.65;0.65	5.07	5.07	0.68467	.	0.320357	0.30930	N	0.008581	T	0.64182	0.2575	M	0.65498	2.005	0.80722	D	1	D	0.58970	0.984	D	0.64237	0.923	T	0.64841	-0.6312	9	.	.	.	-0.7325	14.7838	0.69787	1.0:0.0:0.0:0.0	.	57	Q15041	AR6P1_HUMAN	P	57;9;28	ENSP00000306788:L57P;ENSP00000440048:L28P	.	L	-	2	0	ARL6IP1	18717524	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.476000	0.81055	2.016000	0.59253	0.533000	0.62120	CTG	.		0.413	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254156.2	NM_015161	Missense_Mutation
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	18882177	18882177	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:18882177G>A	ENST00000446231.2	-	17	2748	c.2336C>T	c.(2335-2337)gCa>gTa	p.A779V	snoU13_ENST00000459248.1_RNA|SMG1_ENST00000389467.3_Missense_Mutation_p.A779V			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	779	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ACTGCTGCATGCCTGCAGACA	0.373																																					p.A779V		.											.	SMG1-1160	0			c.C2336T						.						7.0	6.0	7.0					16																	18882177		1113	2424	3537	SO:0001583	missense	23049	exon17			CTGCATGCCTGCA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2336C>T	16.37:g.18882177G>A	ENSP00000402515:p.Ala779Val	18	0		19	8	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120890	0.37436	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.73575	-0.76;-0.76	5.42	5.42	0.78866	Armadillo-type fold (1);	0.000000	0.52532	U	0.000061	T	0.52709	0.1751	N	0.12569	0.235	0.37999	D	0.934166	P	0.39809	0.689	B	0.28553	0.091	T	0.59521	-0.7439	10	0.09843	T	0.71	.	19.2253	0.93816	0.0:0.0:1.0:0.0	.	779	Q96Q15	SMG1_HUMAN	V	779	ENSP00000402515:A779V;ENSP00000374118:A779V	ENSP00000374118:A779V	A	-	2	0	SMG1	18789678	1.000000	0.71417	0.983000	0.44433	0.913000	0.54294	7.379000	0.79691	2.555000	0.86185	0.555000	0.69702	GCA	.		0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
SEPHS2	22928	broad.mit.edu	37	16	30456699	30456699	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:30456699A>T	ENST00000478753.2	-	1	803	c.350T>A	c.(349-351)aTc>aAc	p.I117N	SEPHS2_ENST00000542752.1_Missense_Mutation_p.I60N|SEPHS2_ENST00000500504.2_Missense_Mutation_p.I117N			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	117					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						GTCCATCCCGATGCCCAGGGC	0.677																																					.	Esophageal Squamous(81;1142 1261 11202 24614 35697)												.	SEPHS2-138	0			.						.						16.0	18.0	17.0					16																	30456699		1874	4092	5966	SO:0001583	missense	22928	.			ATCCCGATGCCCA	BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.350T>A	16.37:g.30456699A>T	ENSP00000418669:p.Ile117Asn	26	0		27	10	.	0	0	0	0	0	Q9BUQ2	Missense_Mutation	SNP	ENST00000478753.2	37		.	.	.	.	.	.	.	.	.	.	A	18.26	3.583754	0.65992	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.51071	0.72;0.8;0.75	5.64	4.54	0.55810	PurM, N-terminal-like (1);	0.087451	0.49305	D	0.000154	T	0.45397	0.1340	N	0.08118	0	0.80722	D	1	D;D	0.65815	0.992;0.995	P;D	0.65140	0.899;0.932	T	0.53913	-0.8371	10	0.87932	D	0	-18.3636	11.3411	0.49533	0.8474:0.1526:0.0:0.0	.	117;60	Q99611;F5H8F9	SPS2_HUMAN;.	N	117;60;68;117	ENSP00000418669:I117N;ENSP00000443601:I60N;ENSP00000426234:I117N	ENSP00000390233:I68N	I	-	2	0	SEPHS2	30364200	1.000000	0.71417	0.977000	0.42913	0.796000	0.44982	8.813000	0.91963	1.059000	0.40554	-0.313000	0.08912	ATC	.		0.677	SEPHS2-001	KNOWN	basic|seleno	protein_coding	protein_coding	OTTHUMT00000109640.11	NM_012248	
PRSS53	339105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31098021	31098021	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:31098021C>T	ENST00000280606.6	-	4	594	c.441G>A	c.(439-441)caG>caA	p.Q147Q		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	147	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						GATGGGCGGGCTGGGGCAGGC	0.657																																					p.Q147Q		.											.	PRSS53-68	0			c.G441A						.						30.0	38.0	35.0					16																	31098021		1927	4114	6041	SO:0001819	synonymous_variant	339105	exon4			GGCGGGCTGGGGC		CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.441G>A	16.37:g.31098021C>T		78	0		94	44	NM_001039503	0	0	0	0	0		Silent	SNP	ENST00000280606.6	37	CCDS42153.1																																																																																			.		0.657	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108580.4	NM_001081268	
OGFOD1	55239	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	56485680	56485680	+	Splice_Site	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:56485680T>C	ENST00000566157.1	+	1	277		c.e1+2		NUDT21_ENST00000300291.5_5'Flank|OGFOD1_ENST00000568397.1_Splice_Site	NM_018233.3	NP_060703.3	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 1						cell proliferation (GO:0008283)|peptidyl-proline hydroxylation (GO:0019511)|protein hydroxylation (GO:0018126)|regulation of translational termination (GO:0006449)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 3-dioxygenase activity (GO:0031544)|peptidyl-proline dioxygenase activity (GO:0031543)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8					Vitamin C(DB00126)	TCAGTCACGGTAACCGGGTGC	0.632																																					.		.											.	OGFOD1-69	0			c.154+2T>C						.						28.0	31.0	30.0					16																	56485680		2198	4300	6498	SO:0001630	splice_region_variant	55239	exon1			TCACGGTAACCGG	BC032919	CCDS10761.2	16q12.2	2010-11-23			ENSG00000087263	ENSG00000087263			25585	protein-coding gene	gene with protein product	"""TPA1, termination and polyadenylation 1, homolog (S. cerevisiae)"""	615857				10997877	Standard	NM_018233		Approved	KIAA1612, FLJ10826, TPA1	uc002ejb.3	Q8N543	OTTHUMG00000133237	ENST00000566157.1:c.154+2T>C	16.37:g.56485680T>C		55	0		57	21	NM_018233	0	0	0	0	0	H3BUQ2|Q9H7U5|Q9H9J9|Q9HA87|Q9HCG0|Q9NVB6	Splice_Site	SNP	ENST00000566157.1	37	CCDS10761.2	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952175	0.73787	.	.	ENSG00000087263	ENST00000336111	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6838	0.62504	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	OGFOD1	55043181	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	4.939000	0.63526	2.227000	0.72691	0.460000	0.39030	.	.		0.632	OGFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256976.3	NM_018233	Intron
DDX19B	11269	hgsc.bcm.edu	37	16	70346536	70346536	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:70346536G>C	ENST00000288071.6	+	2	327	c.82G>C	c.(82-84)Gag>Cag	p.E28Q	DDX19B_ENST00000393657.2_Intron|DDX19B_ENST00000355992.3_Missense_Mutation_p.E28Q|DDX19B_ENST00000563206.1_Missense_Mutation_p.E33Q|DDX19B_ENST00000568625.1_Intron|RP11-529K1.3_ENST00000567706.1_Missense_Mutation_p.E28Q|DDX19B_ENST00000563392.1_Intron|DDX19B_ENST00000451014.3_Missense_Mutation_p.E33Q|DDX19B_ENST00000570055.1_3'UTR	NM_007242.5	NP_009173.1	Q9UMR2	DD19B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B	28	N-terminal lobe.				mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)	9		Ovarian(137;0.0694)				TCTTAAGGAAGAGAAAATCAA	0.378																																					p.E33Q	Esophageal Squamous(26;382 757 1343 9728 15939)	.											.	DDX19B-226	0			c.G97C						.						100.0	94.0	96.0					16																	70346536		2198	4300	6498	SO:0001583	missense	11269	exon2			AAGGAAGAGAAAA	AJ237946	CCDS10888.1, CCDS32475.1, CCDS42187.1, CCDS58478.1	16q22.3	2012-02-23	2012-02-23	2005-07-13	ENSG00000157349	ENSG00000157349		"""DEAD-boxes"""	2742	protein-coding gene	gene with protein product		605812	"""DEAD (Asp-Glu-Ala-As) box polypeptide 19"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19 (Dbp5, yeast, homolog)"""	DDX19		10428971	Standard	NM_007242		Approved	DBP5	uc002eyo.4	Q9UMR2	OTTHUMG00000137577	ENST00000288071.6:c.82G>C	16.37:g.70346536G>C	ENSP00000288071:p.Glu28Gln	55	0		35	2	NM_001257172	0	0	0	0	0	B3KNE9|B4DXS6|E7EMK4|Q6FIB7|Q6IAE0|Q96KE7|Q9H0U0	Missense_Mutation	SNP	ENST00000288071.6	37	CCDS10888.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714638	0.48622	.	.	ENSG00000157349	ENST00000451014;ENST00000355992;ENST00000288071	T;T;T	0.62639	3.73;0.01;0.01	5.24	5.24	0.73138	.	0.047526	0.85682	D	0.000000	T	0.50360	0.1611	L	0.31845	0.965	0.43000	D	0.994511	B;B;P;B	0.36535	0.085;0.259;0.557;0.006	B;B;B;B	0.33620	0.015;0.11;0.167;0.01	T	0.53436	-0.8439	10	0.42905	T	0.14	.	14.1874	0.65614	0.0:0.0:1.0:0.0	.	33;28;28;28	E7EMK4;Q7Z4W5;Q9UMR2-2;Q9UMR2	.;.;.;DD19B_HUMAN	Q	33;28;28	ENSP00000392639:E33Q;ENSP00000348271:E28Q;ENSP00000288071:E28Q	ENSP00000288071:E28Q	E	+	1	0	DDX19B	68904037	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.261000	0.65496	2.732000	0.93576	0.655000	0.94253	GAG	.		0.378	DDX19B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268965.3	NM_007242	
TXNL4B	54957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72120699	72120699	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:72120699G>T	ENST00000268483.3	-	4	608	c.287C>A	c.(286-288)tCt>tAt	p.S96Y	TXNL4B_ENST00000423037.1_Missense_Mutation_p.S96Y|TXNL4B_ENST00000426362.2_Missense_Mutation_p.S96Y|RP11-384M15.3_ENST00000561827.1_RNA	NM_001142318.1|NM_017853.2	NP_001135790.1|NP_060323.1	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	96					mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)				cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)	8						GTGATCTGGAGATCTAGACAG	0.358																																					p.S96Y		.											.	TXNL4B-91	0			c.C287A						.						68.0	65.0	66.0					16																	72120699		2198	4300	6498	SO:0001583	missense	54957	exon4			TCTGGAGATCTAG	BC009646	CCDS10906.1	16q22.2	2012-11-19			ENSG00000140830	ENSG00000140830			26041	protein-coding gene	gene with protein product						15161931	Standard	NM_017853		Approved	FLJ20511, DLP, Dim2	uc010vmn.2	Q9NX01	OTTHUMG00000173453	ENST00000268483.3:c.287C>A	16.37:g.72120699G>T	ENSP00000268483:p.Ser96Tyr	68	0		61	26	NM_001142318	0	0	0	0	0	D3DWS6	Missense_Mutation	SNP	ENST00000268483.3	37	CCDS10906.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824185	0.90955	.	.	ENSG00000140830	ENST00000268483;ENST00000426362;ENST00000423037	.	.	.	5.87	5.87	0.94306	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.65365	0.2684	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	P	0.60345	0.873	T	0.66594	-0.5884	9	0.87932	D	0	.	18.0718	0.89410	0.0:0.0:1.0:0.0	.	96	Q9NX01	TXN4B_HUMAN	Y	96	.	ENSP00000268483:S96Y	S	-	2	0	TXNL4B	70678200	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	TCT	.		0.358	TXNL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269007.2	NM_017853	
HSBP1	3281	hgsc.bcm.edu	37	16	83842931	83842931	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:83842931T>C	ENST00000433866.2	+	3	368	c.134T>C	c.(133-135)aTt>aCt	p.I45T	HSBP1_ENST00000570259.1_Missense_Mutation_p.I45T|RP11-483P21.2_ENST00000561599.1_RNA	NM_001537.3	NP_001528.1	O75506	HSBP1_HUMAN	heat shock factor binding protein 1	45					muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)						all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)		AGTAGTCGCATTGATGATCTG	0.468																																					p.I45T		.											.	.	0			c.T134C						.						71.0	67.0	69.0					16																	83842931		1993	4159	6152	SO:0001583	missense	3281	exon3			GTCGCATTGATGA	AF068754	CCDS45534.1	16q23.3	2008-02-05				ENSG00000230989			5203	protein-coding gene	gene with protein product		604553				9649501, 9493008	Standard	NM_001537		Approved		uc002fgy.2	O75506		ENST00000433866.2:c.134T>C	16.37:g.83842931T>C	ENSP00000392896:p.Ile45Thr	11	0		20	2	NM_001537	0	0	0	0	0	Q53XA8|Q7Z5Z3	Missense_Mutation	SNP	ENST00000433866.2	37	CCDS45534.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936726	0.52972	.	.	ENSG00000230989	ENST00000433866	.	.	.	4.82	3.7	0.42460	Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	T	0.61627	0.2362	.	.	.	0.80722	D	1	B	0.24675	0.109	B	0.37451	0.25	T	0.61108	-0.7129	8	0.66056	D	0.02	-9.5504	10.0348	0.42122	0.1511:0.0:0.0:0.8488	.	45	O75506	HSBP1_HUMAN	T	45	.	ENSP00000392896:I45T	I	+	2	0	HSBP1	82400432	1.000000	0.71417	0.977000	0.42913	0.922000	0.55478	6.881000	0.75584	0.771000	0.33359	0.460000	0.39030	ATT	.		0.468	HSBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433004.1	NM_001537	
SLC2A4	6517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7189210	7189210	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:7189210G>C	ENST00000317370.8	+	10	1577	c.1309G>C	c.(1309-1311)Ggt>Cgt	p.G437R	SLC2A4_ENST00000424875.2_Missense_Mutation_p.G427R|RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000571308.1_Missense_Mutation_p.G437R	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	437					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						CATTGGCATGGGTTTCCAGTA	0.627																																					p.G437R		.											.	SLC2A4-90	0			c.G1309C						.						88.0	72.0	77.0					17																	7189210		2203	4300	6503	SO:0001583	missense	6517	exon10			GGCATGGGTTTCC	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.1309G>C	17.37:g.7189210G>C	ENSP00000320935:p.Gly437Arg	62	0		71	24	NM_001042	0	0	0	0	0	Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	37	CCDS11097.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851854	0.51270	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.74002	-0.8;-0.8	5.09	1.72	0.24424	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.256239	0.39834	N	0.001255	T	0.72162	0.3426	M	0.67569	2.06	0.46654	D	0.999149	P;P	0.40144	0.539;0.704	P;B	0.48488	0.579;0.443	T	0.65463	-0.6162	10	0.30854	T	0.27	.	3.2542	0.06826	0.2014:0.0:0.4319:0.3667	.	437;427	P14672;F5H081	GTR4_HUMAN;.	R	437;427	ENSP00000320935:G437R;ENSP00000396887:G427R	ENSP00000320935:G437R	G	+	1	0	SLC2A4	7129934	0.224000	0.23674	0.998000	0.56505	0.998000	0.95712	-0.437000	0.06914	0.677000	0.31305	0.563000	0.77884	GGT	.		0.627	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
POLR2A	5430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7399344	7399344	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:7399344C>G	ENST00000322644.6	+	2	577	c.178C>G	c.(178-180)Ccg>Gcg	p.P60A	POLR2A_ENST00000572844.1_Missense_Mutation_p.P60A	NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	60					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GCTGATGGACCCGAGGCAGGG	0.612																																					p.P60A		.											.	POLR2A-91	0			c.C178G						.						42.0	48.0	46.0					17																	7399344		2202	4299	6501	SO:0001583	missense	5430	exon2			ATGGACCCGAGGC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.178C>G	17.37:g.7399344C>G	ENSP00000314949:p.Pro60Ala	79	0		100	36	NM_000937	0	0	0	0	0	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134164	0.77662	.	.	ENSG00000181222	ENST00000322644	T	0.21734	1.99	5.33	5.33	0.75918	RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	T	0.48927	-0.8991	10	0.87932	D	0	.	17.783	0.88529	0.0:1.0:0.0:0.0	.	60;60	P24928;Q6NX41	RPB1_HUMAN;.	A	60	ENSP00000314949:P60A	ENSP00000314949:P60A	P	+	1	0	SLC35G6	7340068	1.000000	0.71417	0.995000	0.50966	0.853000	0.48598	7.142000	0.77339	2.499000	0.84300	0.467000	0.42956	CCG	.		0.612	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
GAS2L2	246176	hgsc.bcm.edu;broad.mit.edu	37	17	34077159	34077159	+	Silent	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:34077159G>C	ENST00000254466.6	-	2	591	c.564C>G	c.(562-564)ccC>ccG	p.P188P	GAS2L2_ENST00000587565.1_Intron	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	188					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCGAGGGGTCGGGCGGGGGCA	0.746																																					p.P188P		.											.	GAS2L2-227	0			c.C564G						.						22.0	29.0	26.0					17																	34077159		2190	4283	6473	SO:0001819	synonymous_variant	246176	exon2			GGGGTCGGGCGGG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.564C>G	17.37:g.34077159G>C		86	1		84	26	NM_139285	0	0	0	0	0	Q8NHY4	Silent	SNP	ENST00000254466.6	37	CCDS11298.1																																																																																			.		0.746	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
TAF15	8148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34172014	34172014	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:34172014G>T	ENST00000588240.1	+	15	1826	c.1711G>T	c.(1711-1713)Ggt>Tgt	p.G571C	TAF15_ENST00000592237.1_Missense_Mutation_p.E375D|TAF15_ENST00000311979.3_Missense_Mutation_p.G568C	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AGGAGACCGAGGTGGCTATGG	0.527			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.G571C		.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15-723	0			c.G1711T						.						76.0	89.0	85.0					17																	34172014		2203	4300	6503	SO:0001583	missense	8148	exon15			GACCGAGGTGGCT	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1711G>T	17.37:g.34172014G>T	ENSP00000466950:p.Gly571Cys	168	0		165	55	NM_139215	0	0	0	0	0	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	37	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911288	0.52439	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	D	0.94862	-3.54	5.07	4.09	0.47781	.	.	.	.	.	D	0.94424	0.8206	L	0.34521	1.04	0.39114	D	0.961521	D;D	0.89917	1.0;1.0	D;D	0.69479	0.92;0.964	D	0.94444	0.7661	9	0.87932	D	0	-3.2622	10.8882	0.46978	0.0922:0.0:0.9078:0.0	.	571;568	Q92804;Q92804-2	RBP56_HUMAN;.	C	571;374	ENSP00000309558:G571C	ENSP00000309558:G571C	G	+	1	0	TAF15	31196127	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.652000	0.61454	2.520000	0.84964	0.591000	0.81541	GGT	.		0.527	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
RPRML	388394	hgsc.bcm.edu;broad.mit.edu	37	17	45056017	45056017	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:45056017C>T	ENST00000322329.3	-	1	597	c.357G>A	c.(355-357)ctG>ctA	p.L119L	GOSR2_ENST00000439730.2_Intron|RP11-156P1.2_ENST00000571841.1_Intron|LRRC37A17P_ENST00000570478.1_RNA	NM_203400.4	NP_981945.1	Q8N4K4	RPRML_HUMAN	reprimo-like	119						integral component of membrane (GO:0016021)				lung(1)	1						GCGCTCAGTACAGCCCCAGGA	0.682																																					p.L119L		.											.	RPRML-68	0			c.G357A						.						18.0	19.0	19.0					17																	45056017		2200	4299	6499	SO:0001819	synonymous_variant	388394	exon1			TCAGTACAGCCCC	BC033942	CCDS11508.1	17q21.32	2006-09-26				ENSG00000179673			32422	protein-coding gene	gene with protein product							Standard	NM_203400		Approved	MGC43894	uc002ilb.3	Q8N4K4		ENST00000322329.3:c.357G>A	17.37:g.45056017C>T		16	0		20	8	NM_203400	0	0	0	0	0		Silent	SNP	ENST00000322329.3	37	CCDS11508.1																																																																																			.		0.682	RPRML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440919.1	NM_203400	
LRRC46	90506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45914207	45914207	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:45914207G>A	ENST00000269025.4	+	8	1050	c.687G>A	c.(685-687)atG>atA	p.M229I		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	229										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						GGATGGAGATGCAGCCCACCC	0.667																																					p.M229I		.											.	LRRC46-91	0			c.G687A						.						54.0	56.0	55.0					17																	45914207		2203	4300	6503	SO:0001583	missense	90506	exon8			GGAGATGCAGCCC		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.687G>A	17.37:g.45914207G>A	ENSP00000269025:p.Met229Ile	97	0		132	38	NM_033413	0	0	0	0	0	A8K9Q0	Missense_Mutation	SNP	ENST00000269025.4	37	CCDS11518.1	.	.	.	.	.	.	.	.	.	.	G	6.561	0.471736	0.12461	.	.	ENSG00000141294	ENST00000269025	T	0.72167	-0.63	5.53	-11.1	0.00147	.	1.132520	0.06682	N	0.768096	T	0.41558	0.1164	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47623	-0.9103	10	0.37606	T	0.19	0.4736	6.5183	0.22260	0.1084:0.4274:0.3331:0.131	.	229;229	A8K9Q0;Q96FV0	.;LRC46_HUMAN	I	229	ENSP00000269025:M229I	ENSP00000269025:M229I	M	+	3	0	LRRC46	43269206	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-6.635000	0.00058	-4.674000	0.00036	-1.325000	0.01285	ATG	.		0.667	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441377.1	NM_033413	
ACSF2	80221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48549793	48549793	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:48549793G>A	ENST00000300441.4	+	12	1432	c.1328G>A	c.(1327-1329)cGg>cAg	p.R443Q	ACSF2_ENST00000504392.1_Missense_Mutation_p.R400Q|ACSF2_ENST00000502667.1_Missense_Mutation_p.R430Q|ACSF2_ENST00000427954.2_Missense_Mutation_p.R468Q|ACSF2_ENST00000541920.1_Missense_Mutation_p.R283Q|ACSF2_ENST00000506085.1_Intron	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	443					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TCCCAGGCCCGGATCATGAAC	0.612																																					p.R443Q		.											.	ACSF2-68	0			c.G1328A						.						50.0	48.0	49.0					17																	48549793		2203	4300	6503	SO:0001583	missense	80221	exon12			AGGCCCGGATCAT	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1328G>A	17.37:g.48549793G>A	ENSP00000300441:p.Arg443Gln	34	0		53	31	NM_025149	0	0	0	0	0	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	ENST00000300441.4	37	CCDS11567.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851859	0.32699	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.09	1.7	0.24286	AMP-dependent synthetase/ligase (1);	0.312695	0.37393	N	0.002103	T	0.26810	0.0656	L	0.28192	0.835	0.24361	N	0.994876	B;B;B;B	0.15930	0.003;0.015;0.003;0.003	B;B;B;B	0.12156	0.007;0.007;0.007;0.007	T	0.18085	-1.0348	10	0.52906	T	0.07	-5.2723	7.7408	0.28841	0.7438:0.0:0.2562:0.0	.	430;468;400;443	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	Q	443;283;400;468;430	ENSP00000300441:R443Q;ENSP00000437987:R283Q;ENSP00000425964:R400Q;ENSP00000401831:R468Q;ENSP00000421884:R430Q	ENSP00000300441:R443Q	R	+	2	0	ACSF2	45904792	1.000000	0.71417	0.994000	0.49952	0.237000	0.25408	4.324000	0.59228	0.295000	0.22570	-0.378000	0.06908	CGG	.		0.612	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149	
PITPNC1	26207	hgsc.bcm.edu;broad.mit.edu	37	17	65665781	65665781	+	Splice_Site	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:65665781T>C	ENST00000581322.1	+	7	618		c.e7+2		PITPNC1_ENST00000580974.1_Splice_Site|PITPNC1_ENST00000299954.9_Splice_Site|PITPNC1_ENST00000335257.6_Splice_Site			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1						phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			GTACACAAGGTAAGTGGTCCA	0.468																																					.		.											.	PITPNC1-226	0			c.618+2T>C						.						64.0	68.0	67.0					17																	65665781		1987	4159	6146	SO:0001630	splice_region_variant	26207	exon7			ACAAGGTAAGTGG	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.618+2T>C	17.37:g.65665781T>C		10	0		20	12	NM_181671	0	0	0	0	0	A8K473|J3QR20|Q96I07	Splice_Site	SNP	ENST00000581322.1	37	CCDS58588.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709581	0.68730	.	.	ENSG00000154217	ENST00000335257;ENST00000299954	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0556	0.80801	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PITPNC1	63096243	1.000000	0.71417	0.955000	0.39395	0.604000	0.37047	7.880000	0.87243	2.239000	0.73571	0.533000	0.62120	.	.		0.468	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417	Intron
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76491997	76491997	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:76491997C>G	ENST00000585328.1	-	38	5972	c.5848G>C	c.(5848-5850)Gga>Cga	p.G1950R	DNAH17_ENST00000389840.5_Missense_Mutation_p.G1941R|RP11-559N14.5_ENST00000591373.1_RNA|RP11-559N14.5_ENST00000585969.1_RNA|DNAH17-AS1_ENST00000598378.1_5'Flank	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1941	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TCCGCGCGTCCGGCGTACCCA	0.557																																					p.G1955R		.											.	DNAH17-142	0			c.G5863C						.						93.0	94.0	94.0					17																	76491997		2059	4237	6296	SO:0001583	missense	8632	exon38			CGCGTCCGGCGTA	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.5848G>C	17.37:g.76491997C>G	ENSP00000465516:p.Gly1950Arg	77	0		82	20	NM_173628	0	0	0	0	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	c	16.89	3.247501	0.59103	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.17528	2.27	4.49	4.49	0.54785	.	.	.	.	.	T	0.57902	0.2085	H	0.96833	3.89	0.58432	D	0.999995	.	.	.	.	.	.	T	0.74910	-0.3503	7	0.87932	D	0	.	17.7846	0.88533	0.0:1.0:0.0:0.0	.	.	.	.	R	1950;1941	ENSP00000374490:G1941R	ENSP00000300671:G1950R	G	-	1	0	DNAH17	74003592	1.000000	0.71417	0.121000	0.21740	0.087000	0.18053	7.472000	0.80996	2.501000	0.84356	0.537000	0.68136	GGA	.		0.557	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
GNAL	2774	hgsc.bcm.edu	37	18	11689823	11689823	+	Silent	SNP	G	G	A	rs181443061	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr18:11689823G>A	ENST00000334049.6	+	1	869	c.261G>A	c.(259-261)gaG>gaA	p.E87E		NM_182978.3	NP_892023.1	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	88					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						AGGAGCGCGAGGCGGCCAAGG	0.706													G|||	93	0.0185703	0.0666	0.0072	5008	,	,		8793	0.0		0.0	False		,,,				2504	0.0				p.E87E		.											.	GNAL-228	0			c.G261A						.	G		169,3865		3,163,1851	6.0	5.0	5.0		261	3.3	1.0	18		5	3,8023		0,3,4010	no	coding-synonymous	GNAL	NM_182978.2		3,166,5861	AA,AG,GG		0.0374,4.1894,1.4262		87/459	11689823	172,11888	2017	4013	6030	SO:0001819	synonymous_variant	2774	exon1			GCGCGAGGCGGCC	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000334049.6:c.261G>A	18.37:g.11689823G>A		5	1		10	6	NM_182978	0	0	0	0	0	B7ZA26|Q86XU3	Silent	SNP	ENST00000334049.6	37	CCDS11851.1																																																																																			G|0.989;A|0.011		0.706	GNAL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254560.2	NM_182978, NM_002071	
TJP3	27134	ucsc.edu	37	19	3730391	3730391	+	Silent	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:3730391C>G	ENST00000541714.2	+	5	762	c.300C>G	c.(298-300)acC>acG	p.T100T	TJP3_ENST00000539908.2_Silent_p.T64T|TJP3_ENST00000262968.9_Silent_p.T119T|TJP3_ENST00000589378.1_Silent_p.T109T|TJP3_ENST00000587686.1_Silent_p.T119T|TJP3_ENST00000382008.3_Silent_p.T100T	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	100					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCCGCCACCAAAGCCAGCC	0.672																																					p.T109T													.	TJP3-92	0			c.C327G						.						14.0	17.0	16.0					19																	3730391		2176	4276	6452	SO:0001819	synonymous_variant	27134	exon5			CGCCACCAAAGCC	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.300C>G	19.37:g.3730391C>G		10	0		11	3	NM_001267561	0	0	0	0	0	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Silent	SNP	ENST00000541714.2	37	CCDS32873.2																																																																																			.		0.672	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
PNPLA6	10908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7615223	7615223	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:7615223G>A	ENST00000221249.6	+	18	2168	c.1737G>A	c.(1735-1737)gcG>gcA	p.A579A	PNPLA6_ENST00000450331.3_Silent_p.A579A|PNPLA6_ENST00000600737.1_Silent_p.A618A|PNPLA6_ENST00000414982.3_Silent_p.A627A|PNPLA6_ENST00000594864.1_3'UTR|PNPLA6_ENST00000545201.2_Silent_p.A553A	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	618					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						TGAGTGCGGCGCACACGGTGG	0.637																																					p.A627A		.											.	PNPLA6-47	0			c.G1881A						.						61.0	58.0	59.0					19																	7615223		2202	4290	6492	SO:0001819	synonymous_variant	10908	exon17			TGCGGCGCACACG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.1737G>A	19.37:g.7615223G>A		113	0		149	53	NM_001166111	0	0	0	0	0	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			.		0.637	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
STXBP2	6813	hgsc.bcm.edu	37	19	7712339	7712339	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:7712339G>C	ENST00000221283.5	+	18	1669	c.1638G>C	c.(1636-1638)gaG>gaC	p.E546D	STXBP2_ENST00000441779.2_Missense_Mutation_p.E557D|STXBP2_ENST00000602355.1_Missense_Mutation_p.E81D|STXBP2_ENST00000414284.2_Missense_Mutation_p.E543D	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	546					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CCATGTCAGAGATGAGGGCCG	0.647																																					p.E557D		.											.	STXBP2-91	0			c.G1671C						.						23.0	26.0	25.0					19																	7712339		2202	4300	6502	SO:0001583	missense	6813	exon18			GTCAGAGATGAGG	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1638G>C	19.37:g.7712339G>C	ENSP00000221283:p.Glu546Asp	28	0		28	2	NM_001272034	0	0	0	0	0	B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	37	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437346	0.83885	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	D;D;D	0.99129	-5.46;-5.46;-5.46	5.26	0.768	0.18487	.	0.112267	0.64402	D	0.000015	D	0.99187	0.9718	M	0.91972	3.26	0.52501	D	0.999954	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99387	1.0924	10	0.87932	D	0	7.1221	8.2082	0.31467	0.3433:0.0:0.6567:0.0	.	557;512;543;546	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	D	546;543;557;546	ENSP00000221283:E546D;ENSP00000409471:E543D;ENSP00000413606:E557D	ENSP00000221283:E546D	E	+	3	2	STXBP2	7618339	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	2.075000	0.41538	-0.005000	0.14395	0.555000	0.69702	GAG	.		0.647	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949	
JUNB	3726	hgsc.bcm.edu;broad.mit.edu	37	19	12902787	12902787	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:12902787T>C	ENST00000302754.4	+	1	478	c.202T>C	c.(202-204)Tac>Cac	p.Y68H		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	68					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						TGGCGGCAGCTACTTTTCTGG	0.672																																					p.Y68H		.											.	JUNB-846	0			c.T202C						.						12.0	13.0	13.0					19																	12902787		2200	4294	6494	SO:0001583	missense	3726	exon1			GGCAGCTACTTTT	M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.202T>C	19.37:g.12902787T>C	ENSP00000303315:p.Tyr68His	15	0		31	13	NM_002229	0	0	0	0	0	Q96GH3	Missense_Mutation	SNP	ENST00000302754.4	37	CCDS12280.1	.	.	.	.	.	.	.	.	.	.	T	13.29	2.192125	0.38707	.	.	ENSG00000171223	ENST00000302754	T	0.29142	1.58	4.97	4.97	0.65823	Jun-like transcription factor (1);	1.243760	0.05788	U	0.609862	T	0.21103	0.0508	N	0.22421	0.69	0.34616	D	0.718126	B	0.18166	0.026	B	0.11329	0.006	T	0.28681	-1.0036	10	0.15499	T	0.54	-6.7954	6.385	0.21556	0.0:0.1805:0.0:0.8195	.	68	P17275	JUNB_HUMAN	H	68	ENSP00000303315:Y68H	ENSP00000303315:Y68H	Y	+	1	0	JUNB	12763787	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.617000	0.36943	1.865000	0.54081	0.448000	0.29417	TAC	.		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451015.1	NM_002229	
ZNF681	148213	hgsc.bcm.edu	37	19	23927139	23927139	+	Missense_Mutation	SNP	T	T	G	rs1852431		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:23927139T>G	ENST00000402377.3	-	4	1354	c.1213A>C	c.(1213-1215)Aag>Cag	p.K405Q	ZNF681_ENST00000395385.3_Missense_Mutation_p.K336Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTGAGGACTTGTTAAAAGCT	0.403																																					p.K405Q		.											.	.	0			c.A1213C						.						69.0	73.0	72.0					19																	23927139		2203	4300	6503	SO:0001583	missense	148213	exon4			AGGACTTGTTAAA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1213A>C	19.37:g.23927139T>G	ENSP00000384000:p.Lys405Gln	46	1		59	3	NM_138286	0	0	0	0	0	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0	-2.720447	0.00092	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07444	3.19;3.19	1.51	-3.01	0.05463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	N	0.02275	-0.615	0.09310	N	1	B	0.17465	0.022	B	0.15870	0.014	T	0.33033	-0.9884	9	0.02654	T	1	.	5.6438	0.17579	0.151:0.0:0.5623:0.2867	rs1852431	405	Q96N22	ZN681_HUMAN	Q	405;336	ENSP00000384000:K405Q;ENSP00000378783:K336Q	ENSP00000378783:K336Q	K	-	1	0	ZNF681	23718979	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.510000	0.00063	-2.559000	0.00474	-2.453000	0.00207	AAG	.		0.403	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
LSM14A	26065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34712486	34712486	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:34712486G>T	ENST00000433627.5	+	9	1286	c.1211G>T	c.(1210-1212)cGt>cTt	p.R404L	LSM14A_ENST00000540746.2_Missense_Mutation_p.R363L|LSM14A_ENST00000544216.3_Missense_Mutation_p.R404L	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	404					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CGTCCAAACCGTGGCCGTGGG	0.507																																					p.R404L		.											.	LSM14A-91	0			c.G1211T						.						96.0	71.0	79.0					19																	34712486		2203	4300	6503	SO:0001583	missense	26065	exon9			CAAACCGTGGCCG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.1211G>T	19.37:g.34712486G>T	ENSP00000413964:p.Arg404Leu	87	0		63	20	NM_001114093	0	0	0	0	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	37	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	g	28.6	4.933243	0.92458	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.18657	2.2;2.2;2.2	5.96	4.93	0.64822	.	0.104479	0.64402	D	0.000004	T	0.40297	0.1111	M	0.76002	2.32	0.80722	D	1	P;D;D	0.56287	0.889;0.958;0.975	B;P;P	0.55824	0.396;0.614;0.785	T	0.26503	-1.0101	10	0.37606	T	0.19	-9.5825	15.0274	0.71680	0.0679:0.0:0.9321:0.0	.	363;404;404	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	L	404;404;363	ENSP00000446271:R404L;ENSP00000413964:R404L;ENSP00000446451:R363L	ENSP00000314768:R404L	R	+	2	0	LSM14A	39404326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.382000	0.97209	1.533000	0.49186	0.655000	0.94253	CGT	.		0.507	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
SIPA1L3	23094	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38572702	38572702	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:38572702T>C	ENST00000222345.6	+	3	1006	c.497T>C	c.(496-498)cTt>cCt	p.L166P		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	166					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TTCCTCCCCCTTCGGCACCGC	0.711																																					p.L166P		.											.	SIPA1L3-91	0			c.T497C						.						46.0	56.0	53.0					19																	38572702		2203	4299	6502	SO:0001583	missense	23094	exon3			TCCCCCTTCGGCA	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.497T>C	19.37:g.38572702T>C	ENSP00000222345:p.Leu166Pro	105	0		125	52	NM_015073	0	0	0	0	0	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	T	18.67	3.672868	0.67928	.	.	ENSG00000105738	ENST00000222345	T	0.80994	-1.44	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000006	D	0.83737	0.5319	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.85925	0.1448	10	0.87932	D	0	-15.4086	14.0813	0.64925	0.0:0.0:0.0:1.0	.	166	O60292	SI1L3_HUMAN	P	166	ENSP00000222345:L166P	ENSP00000222345:L166P	L	+	2	0	SIPA1L3	43264542	0.433000	0.25562	0.937000	0.37676	0.960000	0.62799	3.929000	0.56514	1.971000	0.57363	0.460000	0.39030	CTT	.		0.711	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
SPTBN4	57731	hgsc.bcm.edu	37	19	41018832	41018832	+	Silent	SNP	A	A	G	rs814533	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:41018832A>G	ENST00000352632.3	+	14	2222	c.2136A>G	c.(2134-2136)cgA>cgG	p.R712R	SPTBN4_ENST00000598249.1_Silent_p.R712R|SPTBN4_ENST00000344104.3_Silent_p.R712R|SPTBN4_ENST00000338932.3_Silent_p.R712R|SPTBN4_ENST00000595535.1_Silent_p.R712R			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	712					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGGGCGGCGAGCGTTGCTGC	0.751													G|||	1110	0.221645	0.4758	0.1239	5008	,	,		9743	0.1052		0.1372	False		,,,				2504	0.1544				p.R712R		.											.	SPTBN4-94	0			c.A2136G						.	G		502,1916		17,468,724	1.0	2.0	2.0		2136	3.2	1.0	19	dbSNP_86	2	282,4934		4,274,2330	no	coding-synonymous	SPTBN4	NM_020971.2		21,742,3054	GG,GA,AA		5.4064,20.761,10.2698		712/2565	41018832	784,6850	1209	2608	3817	SO:0001819	synonymous_variant	57731	exon14			GCGGCGAGCGTTG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2136A>G	19.37:g.41018832A>G		3	0		6	6	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			A|0.806;G|0.194		0.751	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
FKRP	79147	hgsc.bcm.edu	37	19	47259238	47259238	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:47259238G>A	ENST00000318584.5	+	4	828	c.531G>A	c.(529-531)gaG>gaA	p.E177E	FKRP_ENST00000391909.3_Silent_p.E177E|FKRP_ENST00000600646.1_Intron	NM_001039885.2|NM_024301.4	NP_001034974.1|NP_077277.1	Q9H9S5	FKRP_HUMAN	fukutin related protein	177					glycoprotein biosynthetic process (GO:0009101)|protein processing (GO:0016485)	dystrophin-associated glycoprotein complex (GO:0016010)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)	transferase activity (GO:0016740)			NS(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		GCCTGCGAGAGTGGACCGCCC	0.731																																					p.E177E		.											.	FKRP-91	0			c.G531A						.						4.0	4.0	4.0					19																	47259238		1916	3734	5650	SO:0001819	synonymous_variant	79147	exon4			GCGAGAGTGGACC	AJ314847	CCDS12691.1	19q13.32	2014-09-17			ENSG00000181027	ENSG00000181027			17997	protein-coding gene	gene with protein product		606596				11592034, 11741828	Standard	NM_024301		Approved	LGMD2I, MDC1C	uc002pfp.2	Q9H9S5		ENST00000318584.5:c.531G>A	19.37:g.47259238G>A		3	1		9	5	NM_024301	0	0	0	0	0	A8K5G7	Silent	SNP	ENST00000318584.5	37	CCDS12691.1																																																																																			.		0.731	FKRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465473.1	NM_024301	
RUVBL2	10856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49510337	49510337	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:49510337T>C	ENST00000595090.1	+	5	792	c.328T>C	c.(328-330)Tcc>Ccc	p.S110P	RUVBL2_ENST00000601968.1_Missense_Mutation_p.S65P|RUVBL2_ENST00000413176.2_Missense_Mutation_p.S65P	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	110					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		TGAAATCTTCTCCCTGGAGAT	0.657																																					p.S110P		.											.	RUVBL2-227	0			c.T328C						.						41.0	46.0	44.0					19																	49510337		2026	4182	6208	SO:0001583	missense	10856	exon5			ATCTTCTCCCTGG	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.328T>C	19.37:g.49510337T>C	ENSP00000473172:p.Ser110Pro	109	1		116	43	NM_006666	0	0	0	0	0	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Missense_Mutation	SNP	ENST00000595090.1	37	CCDS42588.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.040844	0.93685	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	T;T	0.68903	-0.36;0.06	5.61	5.61	0.85477	TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.89336	0.6686	H	0.99225	4.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93330	0.6700	10	0.87932	D	0	-29.1189	14.0551	0.64764	0.0:0.0:0.0:1.0	.	110;110;76	B4DW30;Q9Y230;B3KNL2	.;RUVB2_HUMAN;.	P	110;65	ENSP00000221413:S110P;ENSP00000413890:S65P	ENSP00000221413:S110P	S	+	1	0	RUVBL2	54202149	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.598000	0.67585	2.271000	0.75665	0.459000	0.35465	TCC	.		0.657	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466235.1		
SYT3	84258	hgsc.bcm.edu	37	19	51133415	51133415	+	Missense_Mutation	SNP	G	G	A	rs371022999		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr19:51133415G>A	ENST00000338916.4	-	3	1321	c.688C>T	c.(688-690)Ccc>Tcc	p.P230S	SYT3_ENST00000544769.1_Missense_Mutation_p.P230S|SYT3_ENST00000593901.1_Missense_Mutation_p.P230S|SYT3_ENST00000600079.1_Missense_Mutation_p.P230S	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	230					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		AGGGGTCGGGGCAGGGCTGGG	0.657																																					p.P230S		.											.	SYT3-155	0			c.C688T						.						11.0	13.0	12.0					19																	51133415		2200	4286	6486	SO:0001583	missense	84258	exon3			GTCGGGGCAGGGC	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.688C>T	19.37:g.51133415G>A	ENSP00000340914:p.Pro230Ser	28	0		22	2	NM_032298	0	0	0	0	0	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467406	0.43839	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.58797	0.31;0.31	4.29	4.29	0.51040	.	0.226024	0.27072	U	0.021075	T	0.40570	0.1122	N	0.19112	0.55	0.41103	D	0.985685	P	0.43477	0.808	B	0.36244	0.22	T	0.49872	-0.8893	10	0.54805	T	0.06	.	14.1182	0.65169	0.0:0.0:1.0:0.0	.	230	Q9BQG1	SYT3_HUMAN	S	230	ENSP00000340914:P230S;ENSP00000438883:P230S	ENSP00000340914:P230S	P	-	1	0	SYT3	55825227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.435000	0.52849	2.382000	0.81193	0.655000	0.94253	CCC	.		0.657	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
MAPRE3	22924	bcgsc.ca	37	2	27248500	27248500	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:27248500C>T	ENST00000233121.2	+	5	717	c.519C>T	c.(517-519)ggC>ggT	p.G173G	MAPRE3_ENST00000405074.3_Silent_p.G158G|MAPRE3_ENST00000402218.1_Silent_p.G158G			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	173					mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGACCTCTGGCCGGCTGAGCA	0.577																																					p.G173G													.	MAPRE3-91	0			c.C519T						.						62.0	60.0	61.0					2																	27248500		2203	4300	6503	SO:0001819	synonymous_variant	22924	exon5			CTCTGGCCGGCTG	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.519C>T	2.37:g.27248500C>T		114	0		97	5	NM_012326	0	0	0	0	0	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	CCDS1731.1																																																																																			.		0.577	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	
EIF2AK2	5610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37365711	37365711	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:37365711G>A	ENST00000233057.4	-	7	856	c.534C>T	c.(532-534)tcC>tcT	p.S178S	EIF2AK2_ENST00000405334.1_Silent_p.S178S|EIF2AK2_ENST00000395127.2_Silent_p.S178S	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	178					activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				AAGAACCAGAGGACAGGTAGT	0.363																																					p.S178S		.											.	EIF2AK2-794	0			c.C534T						.						90.0	93.0	92.0					2																	37365711		2203	4300	6503	SO:0001819	synonymous_variant	5610	exon5			ACCAGAGGACAGG	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.534C>T	2.37:g.37365711G>A		75	0		71	32	NM_001135652	0	0	0	0	0	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Silent	SNP	ENST00000233057.4	37	CCDS1786.1																																																																																			.		0.363	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	NM_002759	
ATOH8	84913	hgsc.bcm.edu	37	2	85981696	85981696	+	Silent	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:85981696G>T	ENST00000306279.3	+	1	680	c.384G>T	c.(382-384)ccG>ccT	p.P128P		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	128	Pro-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGCCGCCGCCGCCTCCTGCGC	0.766																																					p.P128P		.											.	ATOH8-90	0			c.G384T						.						2.0	2.0	2.0					2																	85981696		1216	2628	3844	SO:0001819	synonymous_variant	84913	exon1			GCCGCCGCCTCCT	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.384G>T	2.37:g.85981696G>T		1	0		2	2	NM_032827	0	0	0	0	0	Q504S2|Q659B0	Silent	SNP	ENST00000306279.3	37	CCDS1985.1																																																																																			.		0.766	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
GPAT2	150763	hgsc.bcm.edu	37	2	96687959	96687959	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:96687959A>T	ENST00000434632.1	-	23	2795	c.2336T>A	c.(2335-2337)cTg>cAg	p.L779Q	GPAT2_ENST00000453542.1_Missense_Mutation_p.L708Q|GPAT2_ENST00000359548.4_Missense_Mutation_p.L779Q|GPAT2_ENST00000377137.3_3'UTR|FAHD2CP_ENST00000607780.1_RNA			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	779					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.L779Q(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGATTGTCCAGGCTGGCAAA	0.567																																					p.L779Q		.											.	GPAT2-90	2	Substitution - Missense(2)	skin(2)	c.T2336A						.						30.0	30.0	30.0					2																	96687959		1847	4102	5949	SO:0001583	missense	150763	exon22			TTGTCCAGGCTGG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2336T>A	2.37:g.96687959A>T	ENSP00000389395:p.Leu779Gln	34	0		35	2	NM_207328	0	0	0	0	0	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	t	0.005	-2.199373	0.00299	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.74526	-0.85;-0.85;0.16	4.97	-1.85	0.07784	.	.	.	.	.	T	0.31857	0.0810	N	0.00483	-1.445	0.09310	N	0.999997	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.39187	-0.9626	9	0.02654	T	1	-26.1951	5.7343	0.18057	0.1497:0.2636:0.0:0.5866	.	708;785;779;708	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	Q	779;779;708	ENSP00000352547:L779Q;ENSP00000389395:L779Q;ENSP00000393770:L708Q	ENSP00000352547:L779Q	L	-	2	0	GPAT2	96051686	0.001000	0.12720	0.375000	0.26029	0.081000	0.17604	-0.019000	0.12546	-0.483000	0.06772	-0.751000	0.03497	CTG	.		0.567	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328	
CNNM4	26504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97428127	97428127	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:97428127A>G	ENST00000377075.2	+	1	1489	c.1391A>G	c.(1390-1392)gAg>gGg	p.E464G		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	464	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						ATGCTGGAGGAGTTCAAGAAG	0.517																																					p.E464G		.											.	CNNM4-154	0			c.A1391G						.						87.0	83.0	85.0					2																	97428127		2203	4300	6503	SO:0001583	missense	26504	exon1			TGGAGGAGTTCAA	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1391A>G	2.37:g.97428127A>G	ENSP00000366275:p.Glu464Gly	82	0		81	36	NM_020184	0	0	0	0	0	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937929	0.73557	.	.	ENSG00000158158	ENST00000377075	D	0.93712	-3.27	5.26	5.26	0.73747	Cystathionine beta-synthase, core (2);	0.000000	0.85682	D	0.000000	D	0.96623	0.8898	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97084	0.9786	10	0.66056	D	0.02	-1.1101	14.1805	0.65572	1.0:0.0:0.0:0.0	.	464	Q6P4Q7	CNNM4_HUMAN	G	464	ENSP00000366275:E464G	ENSP00000366275:E464G	E	+	2	0	CNNM4	96791854	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.281000	0.95811	1.996000	0.58369	0.533000	0.62120	GAG	.		0.517	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
TMEM131	23505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	98413329	98413329	+	Silent	SNP	T	T	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:98413329T>A	ENST00000186436.5	-	27	3219	c.2991A>T	c.(2989-2991)gcA>gcT	p.A997A		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	997						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CTTTTAACAATGCTTCCGTGA	0.393																																					p.A997A		.											.	TMEM131-74	0			c.A2991T						.						109.0	108.0	109.0					2																	98413329		1899	4122	6021	SO:0001819	synonymous_variant	23505	exon27			TAACAATGCTTCC	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.2991A>T	2.37:g.98413329T>A		59	0		65	23	NM_015348	0	0	0	0	0		Silent	SNP	ENST00000186436.5	37	CCDS46368.1																																																																																			.		0.393	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
RGPD3	653489	broad.mit.edu;bcgsc.ca	37	2	107032393	107032393	+	Silent	SNP	G	G	A	rs554062950		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:107032393G>A	ENST00000409886.3	-	21	5064	c.4977C>T	c.(4975-4977)ctC>ctT	p.L1659L	RGPD3_ENST00000304514.7_Silent_p.L1659L	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1659					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TGGTGGAACTGAGCTTCTGAA	0.388																																					p.L1659L													.	RGPD3-23	0			c.C4977T						.						72.0	67.0	68.0					2																	107032393		678	1556	2234	SO:0001819	synonymous_variant	653489	exon21			GGAACTGAGCTTC		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.4977C>T	2.37:g.107032393G>A		262	3		256	16	NM_001144013	0	0	0	0	0	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1																																																																																			.		0.388	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
TTN	7273	hgsc.bcm.edu	37	2	179460425	179460425	+	Missense_Mutation	SNP	T	T	A	rs201541213		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:179460425T>A	ENST00000591111.1	-	245	52957	c.52733A>T	c.(52732-52734)tAt>tTt	p.Y17578F	TTN_ENST00000342175.6_Missense_Mutation_p.Y10346F|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Y10154F|TTN_ENST00000359218.5_Missense_Mutation_p.Y10279F|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y19219F|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Y16651F|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17578	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAATGACATAATTGGTGAT	0.463																																					p.Y19219F		.											.	TTN-636	0			c.A57656T						.	T	PHE/TYR,PHE/TYR,PHE/TYR,PHE/TYR	0,3818		0,0,1909	82.0	75.0	77.0		30461,49952,30836,31037	6.1	1.0	2		77	7,8255		0,7,4124	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	22,22,22,22	0,7,6033	AA,AT,TT		0.0847,0.0,0.0579	probably-damaging,probably-damaging,probably-damaging,probably-damaging	10154/26927,16651/33424,10279/27052,10346/27119	179460425	7,12073	1909	4131	6040	SO:0001583	missense	7273	exon295			ATGACATAATTGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52733A>T	2.37:g.179460425T>A	ENSP00000465570:p.Tyr17578Phe	14	2		22	9	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	18.46	3.628597	0.67015	0.0	8.47E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	6.05	6.05	0.98169	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89581	0.6756	M	0.73753	2.245	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	D	0.90542	0.4503	9	0.87932	D	0	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	10154;10279;10346;17578	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	16651;10154;10346;10279;10152	ENSP00000343764:Y16651F;ENSP00000434586:Y10154F;ENSP00000340554:Y10346F;ENSP00000352154:Y10279F	ENSP00000340554:Y10346F	Y	-	2	0	TTN	179168671	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.991000	0.88244	2.320000	0.78422	0.528000	0.53228	TAT	.		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL6A3	1293	ucsc.edu;bcgsc.ca	37	2	238280361	238280361	+	Intron	SNP	C	C	T	rs373893821		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:238280361C>T	ENST00000295550.4	-	9	4738				COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000392003.2_Silent_p.A1026A|COL6A3_ENST00000347401.3_Intron|COL6A3_ENST00000346358.4_Intron|COL6A3_ENST00000392004.3_Silent_p.A1227A|COL6A3_ENST00000353578.4_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A1227A(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GAACCTCCGACGCCCCCATCT	0.473																																					p.A1227A													.	COL6A3-526	1	Substitution - coding silent(1)	lung(1)	c.G3681A						.	C	,,,,	1,4405	2.1+/-5.4	0,1,2202	69.0	78.0	75.0		,3078,3681,,	-1.3	0.0	2		75	0,8600		0,0,4300	no	intron,coding-synonymous,coding-synonymous,intron,intron	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,	,1026/1037,1227/1238,,	238280361	1,13005	2203	4300	6503	SO:0001627	intron_variant	1293	exon8			CTCCGACGCCCCC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4285+13G>A	2.37:g.238280361C>T		138	0		165	52	NM_057165	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.473	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
ADRA1D	146	hgsc.bcm.edu	37	20	4229281	4229281	+	Silent	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr20:4229281A>G	ENST00000379453.4	-	1	440	c.324T>C	c.(322-324)ctT>ctC	p.L108L		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	108					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CCACGGCCATAAGGATGAAGG	0.672																																					p.L108L		.											.	ADRA1D-522	0			c.T324C						.						34.0	36.0	36.0					20																	4229281		2203	4299	6502	SO:0001819	synonymous_variant	146	exon1			GGCCATAAGGATG	U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.324T>C	20.37:g.4229281A>G		25	0		39	2	NM_000678	0	0	0	0	0	Q9NPY0	Silent	SNP	ENST00000379453.4	37	CCDS13079.1																																																																																			.		0.672	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077812.2	NM_000678	
MYL9	10398	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35177592	35177592	+	Silent	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr20:35177592C>T	ENST00000279022.2	+	4	563	c.459C>T	c.(457-459)aaC>aaT	p.N153N	RP5-977B1.11_ENST00000561134.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA|MYL9_ENST00000346786.2_Silent_p.N99N	NM_006097.4	NP_006088.2	P24844	MYL9_HUMAN	myosin, light chain 9, regulatory	153	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|platelet aggregation (GO:0070527)|regulation of muscle contraction (GO:0006937)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)	8	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AGAAAGGCAACTTCAACTACG	0.592																																					p.N153N		.											.	MYL9-90	0			c.C459T						.						112.0	95.0	101.0					20																	35177592		2203	4300	6503	SO:0001819	synonymous_variant	10398	exon4			AGGCAACTTCAAC	J02854	CCDS13276.1, CCDS13277.1	20q11.23	2013-01-10	2006-09-29		ENSG00000101335	ENSG00000101335		"""Myosins / Light chain"", ""EF-hand domain containing"""	15754	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2, smooth muscle isoform"", ""myosin regulatory light chain 1"""	609905	"""myosin, light polypeptide 9, regulatory"""			2526655	Standard	NM_006097		Approved	MYRL2, MLC2, LC20, MRLC1	uc002xfl.2	P24844	OTTHUMG00000032387	ENST00000279022.2:c.459C>T	20.37:g.35177592C>T		49	0		69	20	NM_006097	0	0	0	0	0	E1P5T6|Q9BQL9|Q9BUF9|Q9H136	Silent	SNP	ENST00000279022.2	37	CCDS13276.1																																																																																			.		0.592	MYL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079015.2	NM_006097	
RRP1	8568	hgsc.bcm.edu	37	21	45209575	45209575	+	Missense_Mutation	SNP	A	A	G	rs530432421	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr21:45209575A>G	ENST00000497547.1	+	1	182	c.65A>G	c.(64-66)cAg>cGg	p.Q22R		NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		GGGAATGAGCAGGTGACCCGG	0.711													A|||	2	0.000399361	0.0015	0.0	5008	,	,		12178	0.0		0.0	False		,,,				2504	0.0				p.Q22R		.											.	RRP1-90	0			c.A65G						.																																			SO:0001583	missense	8568	exon1			ATGAGCAGGTGAC	U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.65A>G	21.37:g.45209575A>G	ENSP00000417464:p.Gln22Arg	4	1		8	5	NM_003683	0	0	0	0	0	A6NIB2	Missense_Mutation	SNP	ENST00000497547.1	37	CCDS42951.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.746588	0.69418	.	.	ENSG00000160214	ENST00000497547;ENST00000400387	T	0.41400	1.0	4.41	4.41	0.53225	.	0.195056	0.47455	D	0.000238	T	0.27349	0.0671	N	0.15975	0.35	0.34121	D	0.664176	P;B	0.34462	0.454;0.309	B;B	0.34931	0.192;0.138	T	0.47724	-0.9095	10	0.87932	D	0	.	11.1628	0.48526	1.0:0.0:0.0:0.0	.	22;22	B4DZM3;P56182	.;RRP1_HUMAN	R	22	ENSP00000417464:Q22R	ENSP00000383237:Q22R	Q	+	2	0	RRP1	44034003	0.996000	0.38824	1.000000	0.80357	0.869000	0.49853	2.387000	0.44389	1.624000	0.50355	0.402000	0.26972	CAG	.		0.711	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195680.1	NM_003683	
TPST2	8459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	26937461	26937461	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr22:26937461G>A	ENST00000338754.4	-	3	406	c.136C>T	c.(136-138)Cgg>Tgg	p.R46W	TPST2_ENST00000403880.1_Missense_Mutation_p.R46W|TPST2_ENST00000398110.2_Missense_Mutation_p.R46W	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	46					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			central_nervous_system(1)|large_intestine(1)|lung(5)	7						TGCTCAGGCCGCATGGCCCCC	0.701																																					p.R46W		.											.	TPST2-90	0			c.C136T						.						45.0	39.0	41.0					22																	26937461		2185	4257	6442	SO:0001583	missense	8459	exon3			CAGGCCGCATGGC	AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.136C>T	22.37:g.26937461G>A	ENSP00000339813:p.Arg46Trp	54	1		39	5	NM_001008566	0	0	0	0	0	B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	ENST00000338754.4	37	CCDS13839.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299440	0.23650	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000442495;ENST00000454778;ENST00000440953;ENST00000453117;ENST00000450022	.	.	.	4.95	1.41	0.22369	.	0.398194	0.20982	N	0.082188	T	0.38374	0.1038	N	0.24115	0.695	0.38148	D	0.938657	B	0.06786	0.001	B	0.01281	0.0	T	0.26744	-1.0094	9	0.66056	D	0.02	-23.8602	6.5609	0.22485	0.0907:0.0:0.3942:0.5151	.	46	O60704	TPST2_HUMAN	W	46	.	ENSP00000339813:R46W	R	-	1	2	TPST2	25267461	0.999000	0.42202	0.997000	0.53966	0.209000	0.24338	1.285000	0.33261	0.479000	0.27511	-0.192000	0.12808	CGG	.		0.701	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320820.3	NM_003595	
RFPL2	10739	hgsc.bcm.edu	37	22	32598365	32598365	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr22:32598365C>G	ENST00000400237.1	-	2	1009	c.74G>C	c.(73-75)tGt>tCt	p.C25S	RP1-90G24.10_ENST00000434942.1_RNA|RFPL2_ENST00000248983.4_5'UTR|RFPL2_ENST00000400236.3_5'UTR			O75678	RFPL2_HUMAN	ret finger protein-like 2	25							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						ccagtggccacacaatacagc	0.517																																					p.C25S		.											.	RFPL2-91	0			c.G74C						.						93.0	83.0	86.0					22																	32598365		1568	3582	5150	SO:0001583	missense	10739	exon2			TGGCCACACAATA	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.74G>C	22.37:g.32598365C>G	ENSP00000383096:p.Cys25Ser	15	0		12	2	NM_001098527	0	0	0	0	0		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	C	7.446	0.641751	0.14451	.	.	ENSG00000128253	ENST00000400237	T	0.55930	0.49	.	.	.	.	.	.	.	.	T	0.27866	0.0686	N	0.08118	0	0.22240	N	0.999265	P	0.34662	0.462	B	0.32762	0.152	T	0.17653	-1.0362	7	0.87932	D	0	.	.	.	.	.	25	O75678	RFPL2_HUMAN	S	25	ENSP00000383096:C25S	ENSP00000383096:C25S	C	-	2	0	RFPL2	30928365	0.011000	0.17503	0.259000	0.24435	0.261000	0.26267	0.571000	0.23669	0.088000	0.17205	0.089000	0.15464	TGT	.		0.517	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
CAPN7	23473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	15288921	15288921	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:15288921A>G	ENST00000253693.2	+	19	2414	c.2161A>G	c.(2161-2163)Ata>Gta	p.I721V		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	721	Domain N.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						CCAATTCCATATAGAAAAGAC	0.363																																					p.I721V		.											.	CAPN7-91	0			c.A2161G						.						84.0	84.0	84.0					3																	15288921		2203	4300	6503	SO:0001583	missense	23473	exon19			TTCCATATAGAAA	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.2161A>G	3.37:g.15288921A>G	ENSP00000253693:p.Ile721Val	121	0		116	46	NM_014296	0	0	0	0	0		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	A	7.495	0.651423	0.14516	.	.	ENSG00000131375	ENST00000253693	D	0.85629	-2.01	5.57	-3.39	0.04868	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.669254	0.16098	N	0.229700	T	0.62816	0.2459	N	0.16266	0.395	0.21105	N	0.999789	B	0.02656	0.0	B	0.12837	0.008	T	0.49244	-0.8960	10	0.15066	T	0.55	-2.6499	1.3262	0.02126	0.3616:0.1918:0.2926:0.154	.	721	Q9Y6W3	CAN7_HUMAN	V	721	ENSP00000253693:I721V	ENSP00000253693:I721V	I	+	1	0	CAPN7	15263925	0.062000	0.20869	0.564000	0.28396	0.978000	0.69477	-0.068000	0.11561	-0.127000	0.11661	0.533000	0.62120	ATA	.		0.363	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
ARPP21	10777	bcgsc.ca	37	3	35756938	35756938	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:35756938G>T	ENST00000187397.4	+	12	1361	c.905G>T	c.(904-906)tGc>tTc	p.C302F	ARPP21_ENST00000337271.5_Missense_Mutation_p.C268F|ARPP21_ENST00000444190.1_Missense_Mutation_p.C268F|ARPP21_ENST00000458225.1_Missense_Mutation_p.C268F|ARPP21_ENST00000417925.1_Missense_Mutation_p.C268F	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	302					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CAGTCAGTTTGCTCCCAGGAA	0.363																																					p.C302F													.	ARPP21-93	0			c.G905T						.						122.0	121.0	122.0					3																	35756938		2202	4300	6502	SO:0001583	missense	10777	exon12			CAGTTTGCTCCCA	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.905G>T	3.37:g.35756938G>T	ENSP00000187397:p.Cys302Phe	95	0		68	4	NM_016300	0	0	0	0	0	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060897	0.76074	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925;ENST00000425289	T;T;T;T;T	0.25912	1.86;1.83;1.83;1.77;1.86	5.92	5.92	0.95590	.	0.253759	0.42682	D	0.000679	T	0.49949	0.1587	M	0.61703	1.905	0.58432	D	0.999999	D;D;D	0.69078	0.996;0.997;0.996	D;P;P	0.65010	0.931;0.795;0.899	T	0.37798	-0.9690	10	0.56958	D	0.05	-14.633	20.3343	0.98733	0.0:0.0:1.0:0.0	.	268;302;268	Q9UBL0-3;Q9UBL0;Q9UBL0-4	.;ARP21_HUMAN;.	F	268;268;268;302;268;73	ENSP00000414351:C268F;ENSP00000337792:C268F;ENSP00000405276:C268F;ENSP00000187397:C302F;ENSP00000412326:C268F	ENSP00000187397:C302F	C	+	2	0	ARPP21	35731942	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.098000	0.76974	2.822000	0.97130	0.650000	0.86243	TGC	.		0.363	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
ACAA1	30	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38168151	38168151	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:38168151T>G	ENST00000333167.8	-	8	839	c.667A>C	c.(667-669)Att>Ctt	p.I223L	ACAA1_ENST00000444607.2_3'UTR|ACAA1_ENST00000450296.1_Missense_Mutation_p.I182L|ACAA1_ENST00000301810.7_Missense_Mutation_p.I190L|ACAA1_ENST00000544624.1_Missense_Mutation_p.I71L|Y_RNA_ENST00000365095.1_RNA|ACAA1_ENST00000480865.1_5'UTR	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	223					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		ACAGGCACAATCTCAGCTTGG	0.612																																					p.I223L		.											.	ACAA1-91	0			c.A667C						.						146.0	120.0	129.0					3																	38168151		2203	4300	6503	SO:0001583	missense	30	exon8			GCACAATCTCAGC	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.667A>C	3.37:g.38168151T>G	ENSP00000333664:p.Ile223Leu	117	0		125	54	NM_001607	0	0	0	0	0	G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	37	CCDS2673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.183188|5.183188	0.94885|0.94885	.|.	.|.	ENSG00000060971|ENSG00000060971	ENST00000333167;ENST00000301810;ENST00000450296;ENST00000358122;ENST00000544624|ENST00000452171;ENST00000421218	D;D;D;D|.	0.93547|.	-3.11;-3.11;-3.24;-3.24|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78892|0.78892	0.4355|0.4355	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	P;D;D;D|.	0.71674|.	0.911;0.997;0.998;0.993|.	D;D;D;D|.	0.85130|.	0.926;0.914;0.997;0.956|.	T|T	0.81484|0.81484	-0.0912|-0.0912	10|5	0.87932|.	D|.	0|.	-10.3475|-10.3475	15.5417|15.5417	0.76057|0.76057	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	155;182;190;223|.	F5GXL8;C9JDE9;G5E935;P09110|.	.;.;.;THIK_HUMAN|.	L|S	223;190;182;155;71|95;112	ENSP00000333664:I223L;ENSP00000301810:I190L;ENSP00000395183:I182L;ENSP00000445710:I71L|.	ENSP00000301810:I190L|.	I|R	-|-	1|3	0|2	ACAA1|ACAA1	38143155|38143155	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.998000|0.998000	0.95712|0.95712	6.148000|6.148000	0.71788|0.71788	2.072000|2.072000	0.62099|0.62099	0.533000|0.533000	0.62120|0.62120	ATT|AGA	.		0.612	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
TGM4	7047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	44926858	44926858	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:44926858G>T	ENST00000296125.4	+	2	129	c.61G>T	c.(61-63)Gcc>Tcc	p.A21S		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	21					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TCAGGACAACGCCGTTTCTCA	0.522																																					p.A21S		.											.	TGM4-91	0			c.G61T						.						102.0	93.0	96.0					3																	44926858		2203	4300	6503	SO:0001583	missense	7047	exon2			GACAACGCCGTTT	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.61G>T	3.37:g.44926858G>T	ENSP00000296125:p.Ala21Ser	48	0		44	13	NM_003241	0	0	0	0	0	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	G	9.481	1.098065	0.20552	.	.	ENSG00000163810	ENST00000296125	D	0.84873	-1.91	2.77	-1.63	0.08345	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.329666	0.20233	U	0.096458	T	0.70850	0.3271	L	0.33245	0.995	0.09310	N	1	B;P	0.36027	0.448;0.533	B;B	0.37047	0.24;0.1	T	0.62296	-0.6884	10	0.10902	T	0.67	.	6.6582	0.22998	0.4424:0.0:0.5576:0.0	.	21;21	P49221;B4YUQ1	TGM4_HUMAN;.	S	21	ENSP00000296125:A21S	ENSP00000296125:A21S	A	+	1	0	TGM4	44901862	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.711000	0.05019	-0.425000	0.07371	0.467000	0.42956	GCC	.		0.522	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47127778	47127778	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:47127778C>A	ENST00000409792.3	-	11	5346	c.5304G>T	c.(5302-5304)aaG>aaT	p.K1768N	SETD2_ENST00000492397.1_5'Flank|snoU13_ENST00000516129.1_RNA	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1768					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCAGAAAGGACTTCAGGCAGG	0.512			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.K1768N		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.G5304T						.						127.0	110.0	116.0					3																	47127778		2203	4300	6503	SO:0001583	missense	29072	exon11			AAAGGACTTCAGG	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5304G>T	3.37:g.47127778C>A	ENSP00000386759:p.Lys1768Asn	72	0		57	22	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988848	0.74589	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.90504	-2.68	5.47	4.52	0.55395	.	0.000000	0.56097	D	0.000025	D	0.93220	0.7840	M	0.62723	1.935	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.91914	0.5542	10	0.42905	T	0.14	.	9.269	0.37659	0.0:0.8236:0.0:0.1764	.	1768;1768	F2Z317;Q9BYW2	.;SETD2_HUMAN	N	1768	ENSP00000386759:K1768N	ENSP00000386759:K1768N	K	-	3	2	SETD2	47102782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.865000	0.39479	1.167000	0.42706	0.650000	0.86243	AAG	.		0.512	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
CADPS	8618	hgsc.bcm.edu	37	3	62499343	62499343	+	Intron	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr3:62499343A>G	ENST00000383710.4	-	17	2931				CADPS_ENST00000283269.9_Silent_p.L874L|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TGGGAGGCCAAGCAGAAGACA	0.423																																					p.L874L		.											.	CADPS-281	0			c.T2620C						.						122.0	96.0	105.0					3																	62499343		2203	4299	6502	SO:0001627	intron_variant	8618	exon17			AGGCCAAGCAGAA	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2582-900T>C	3.37:g.62499343A>G		25	0		12	2	NM_183394	0	0	0	0	0	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	37	CCDS46858.1																																																																																			.		0.423	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
ZNF595	152687	bcgsc.ca	37	4	86145	86145	+	3'UTR	SNP	A	A	G	rs200927625		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:86145A>G	ENST00000339368.6	+	0	954							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GAAAATTCATACTGGAGAGAA	0.393																																					.													.	.	0			.						.						33.0	35.0	34.0					4																	86145		2130	4261	6391	SO:0001624	3_prime_UTR_variant	152687	.			ATTCATACTGGAG	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*951A>G	4.37:g.86145A>G		48	0		44	6	.	0	0	0	0	0		RNA	SNP	ENST00000339368.6	37																																																																																				.		0.393	ZNF595-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000357814.2	NM_182524	
TMEM175	84286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	947053	947053	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:947053C>G	ENST00000264771.4	+	8	723	c.538C>G	c.(538-540)Ctg>Gtg	p.L180V	TMEM175_ENST00000504180.1_3'UTR|TMEM175_ENST00000508204.1_Missense_Mutation_p.L98V|TMEM175_ENST00000515740.1_Missense_Mutation_p.L64V	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	180						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCACAGGGCTCTGTACCGACG	0.617																																					p.L180V		.											.	TMEM175-90	0			c.C538G						.						120.0	100.0	107.0					4																	947053		2203	4300	6503	SO:0001583	missense	84286	exon8			AGGGCTCTGTACC	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.538C>G	4.37:g.947053C>G	ENSP00000264771:p.Leu180Val	52	0		65	33	NM_032326	0	0	0	0	0	D3DVN4|Q8ND13	Missense_Mutation	SNP	ENST00000264771.4	37	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	c	0.044	-1.272845	0.01421	.	.	ENSG00000127419	ENST00000264771;ENST00000514453;ENST00000515492;ENST00000359768;ENST00000509508;ENST00000515740;ENST00000508204;ENST00000510493	T;T;T;T	0.46819	1.44;0.94;1.49;0.86	4.71	-0.169	0.13339	.	0.217286	0.39083	N	0.001461	T	0.31263	0.0791	L	0.54323	1.7	0.09310	N	1	B;B;B	0.20887	0.001;0.049;0.031	B;B;B	0.19666	0.001;0.026;0.005	T	0.11251	-1.0595	10	0.15499	T	0.54	-27.4926	1.8457	0.03158	0.1956:0.2847:0.3858:0.1339	.	98;180;98	D6RBE5;Q9BSA9;B3KR27	.;TM175_HUMAN;.	V	180;167;98;98;86;64;98;98	ENSP00000264771:L180V;ENSP00000425181:L167V;ENSP00000427039:L64V;ENSP00000423669:L98V	ENSP00000264771:L180V	L	+	1	2	TMEM175	937053	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.647000	0.24812	0.040000	0.15660	-0.322000	0.08575	CTG	.		0.617	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326	
DRD5	1816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	9784197	9784197	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:9784197A>T	ENST00000304374.2	+	1	940	c.544A>T	c.(544-546)Agg>Tgg	p.R182W		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	182					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CAACTGGCACAGGGACCAGGC	0.617																																					p.R182W		.											.	DRD5-91	0			c.A544T						.						35.0	36.0	35.0					4																	9784197		2203	4299	6502	SO:0001583	missense	1816	exon1			TGGCACAGGGACC	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.544A>T	4.37:g.9784197A>T	ENSP00000306129:p.Arg182Trp	92	0		84	33	NM_000798	0	0	0	0	0	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	a	16.35	3.098148	0.56183	.	.	ENSG00000169676	ENST00000304374	T	0.73047	-0.71	4.53	-6.0	0.02206	GPCR, rhodopsin-like superfamily (1);	0.214762	0.44483	D	0.000455	T	0.80088	0.4559	M	0.74881	2.28	0.37769	D	0.926595	D	0.71674	0.998	D	0.70935	0.971	T	0.82639	-0.0358	10	0.87932	D	0	.	17.6446	0.88145	0.2761:0.7239:0.0:0.0	.	182	P21918	DRD5_HUMAN	W	182	ENSP00000306129:R182W	ENSP00000306129:R182W	R	+	1	2	DRD5	9393295	1.000000	0.71417	0.162000	0.22713	0.673000	0.39480	3.173000	0.50839	-1.286000	0.02384	-0.973000	0.02599	AGG	.		0.617	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
TMPRSS11F	389208	hgsc.bcm.edu	37	4	68939702	68939702	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:68939702G>C	ENST00000356291.2	-	4	367	c.308C>G	c.(307-309)tCt>tGt	p.S103C	UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	103	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						ACCGCCTACAGAAGAATGTCG	0.239																																					p.S103C		.											.	TMPRSS11F-91	0			c.C308G						.						33.0	32.0	32.0					4																	68939702		2197	4294	6491	SO:0001583	missense	389208	exon4			CCTACAGAAGAAT	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.308C>G	4.37:g.68939702G>C	ENSP00000348639:p.Ser103Cys	36	0		23	2	NM_207407	0	0	0	0	0	A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771982	0.49680	.	.	ENSG00000198092	ENST00000356291	T	0.40476	1.03	5.23	5.23	0.72850	SEA (3);	0.105172	0.43260	D	0.000593	T	0.59985	0.2234	M	0.72118	2.19	0.34918	D	0.748179	D	0.59767	0.986	P	0.61533	0.89	T	0.71368	-0.4614	10	0.52906	T	0.07	.	14.3036	0.66371	0.0:0.0:1.0:0.0	.	103	Q6ZWK6	TM11F_HUMAN	C	103	ENSP00000348639:S103C	ENSP00000348639:S103C	S	-	2	0	TMPRSS11F	68622297	0.999000	0.42202	1.000000	0.80357	0.446000	0.32137	2.553000	0.45837	2.457000	0.83068	0.655000	0.94253	TCT	.		0.239	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	114232517	114232517	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:114232517T>A	ENST00000357077.4	+	24	2708	c.2655T>A	c.(2653-2655)aaT>aaA	p.N885K	ANK2_ENST00000264366.6_Missense_Mutation_p.N885K|ANK2_ENST00000509550.1_Missense_Mutation_p.N94K|ANK2_ENST00000506722.1_Missense_Mutation_p.N864K|ANK2_ENST00000394537.3_Missense_Mutation_p.N885K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	885					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATGGTATGAATTACCTGCGAT	0.438																																					p.N885K		.											.	ANK2-583	0			c.T2655A						.						163.0	134.0	144.0					4																	114232517		2203	4300	6503	SO:0001583	missense	287	exon24			TATGAATTACCTG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2655T>A	4.37:g.114232517T>A	ENSP00000349588:p.Asn885Lys	95	0		73	39	NM_001148	0	0	0	0	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	11.00	1.511662	0.27036	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T;T	0.75154	-0.04;0.07;-0.13;-0.04;-0.12;-0.17;-0.2;-0.91	5.15	-2.52	0.06346	.	0.000000	0.53938	D	0.000056	T	0.53932	0.1827	L	0.27053	0.805	0.80722	D	1	B;P;B;P;B;B	0.44627	0.0;0.839;0.372;0.835;0.026;0.288	B;B;B;B;B;B	0.36719	0.001;0.231;0.058;0.228;0.029;0.081	T	0.51810	-0.8658	10	0.21014	T	0.42	.	14.3697	0.66830	0.0:0.6687:0.0:0.3313	.	94;885;885;885;864;864	E9PCH6;Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.	K	864;831;864;900;885;885;885;864;94	ENSP00000423799:N864K;ENSP00000421011:N831K;ENSP00000421067:N864K;ENSP00000424722:N900K;ENSP00000378044:N885K;ENSP00000349588:N885K;ENSP00000264366:N885K;ENSP00000426944:N94K	ENSP00000264366:N885K	N	+	3	2	ANK2	114451966	0.711000	0.27906	0.990000	0.47175	0.999000	0.98932	-0.123000	0.10611	-0.397000	0.07691	0.533000	0.62120	AAT	.		0.438	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
TRPC3	7222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	122825594	122825594	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:122825594A>C	ENST00000379645.3	-	8	2209	c.2136T>G	c.(2134-2136)gaT>gaG	p.D712E	TRPC3_ENST00000264811.5_Missense_Mutation_p.D639E|TRPC3_ENST00000513531.1_Missense_Mutation_p.D584E	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	627					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGAATTTGTGATCATATTTGA	0.308																																					p.D712E		.											.	TRPC3-92	0			c.T2136G						.						89.0	86.0	87.0					4																	122825594		2203	4298	6501	SO:0001583	missense	7222	exon8			TTTGTGATCATAT	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2136T>G	4.37:g.122825594A>C	ENSP00000368966:p.Asp712Glu	74	0		52	20	NM_001130698	0	0	0	0	0	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.982982	0.53827	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.75938	-0.76;-0.98;-0.92	5.77	0.478	0.16789	Ion transport (1);	0.000000	0.85682	D	0.000000	T	0.59622	0.2207	L	0.35487	1.065	0.43187	D	0.995017	B;B;B	0.19935	0.002;0.018;0.04	B;B;B	0.30716	0.057;0.057;0.119	T	0.39121	-0.9629	10	0.10111	T	0.7	-24.2756	9.899	0.41335	0.7445:0.0:0.2555:0.0	.	627;584;712	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	E	639;712;584	ENSP00000264811:D639E;ENSP00000368966:D712E;ENSP00000426899:D584E	ENSP00000264811:D639E	D	-	3	2	TRPC3	123045044	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	1.041000	0.30291	-0.050000	0.13356	0.533000	0.62120	GAT	.		0.308	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
SPOCK3	50859	hgsc.bcm.edu	37	4	167656109	167656109	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:167656109T>C	ENST00000357154.3	-	12	1411	c.1274A>G	c.(1273-1275)gAt>gGt	p.D425G	SPOCK3_ENST00000534949.1_Missense_Mutation_p.D329G|SPOCK3_ENST00000512681.1_Missense_Mutation_p.D327G|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D425G|SPOCK3_ENST00000541637.1_Missense_Mutation_p.D327G|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D293G|SPOCK3_ENST00000511269.1_Missense_Mutation_p.D422G|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D305G|SPOCK3_ENST00000510741.1_Missense_Mutation_p.D382G|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D425G|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D425G|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D422G|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D374G|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D422G	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	425	Asp-rich.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		accatcatcatcatccccttc	0.323																																					p.D425G		.											.	SPOCK3-136	0			c.A1274G						.						170.0	161.0	164.0					4																	167656109		2203	4300	6503	SO:0001583	missense	50859	exon12			TCATCATCATCCC	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1274A>G	4.37:g.167656109T>C	ENSP00000349677:p.Asp425Gly	64	0		33	2	NM_016950	0	0	0	0	0	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.298672	0.23650	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.1	5.1	0.69264	.	0.134505	0.47852	D	0.000214	T	0.80396	0.4615	L	0.32530	0.975	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	0.993;0.996;1.0;1.0;1.0;0.996;0.993	D;D;D;D;D;D;D	0.80764	0.984;0.993;0.994;0.994;0.994;0.993;0.984	T	0.75531	-0.3285	10	0.13108	T	0.6	-23.1417	14.9101	0.70749	0.0:0.0:0.0:1.0	.	327;329;374;434;382;422;425	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	G	425;422;422;425;425;425;382;305;327;422;293;374;327;329	ENSP00000349677:D425G;ENSP00000350153:D422G;ENSP00000425570:D422G;ENSP00000420920:D425G;ENSP00000423421:D425G;ENSP00000423606:D425G;ENSP00000426716:D382G;ENSP00000444789:D305G;ENSP00000426318:D327G;ENSP00000425502:D422G;ENSP00000441396:D293G;ENSP00000411344:D374G;ENSP00000445430:D327G;ENSP00000438142:D329G	ENSP00000349677:D425G	D	-	2	0	SPOCK3	167892684	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	4.684000	0.61686	2.060000	0.61445	0.514000	0.50259	GAT	.		0.323	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
MARCH6	10299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	10411600	10411600	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:10411600G>A	ENST00000274140.5	+	19	1979	c.1847G>A	c.(1846-1848)gGg>gAg	p.G616E	MARCH6_ENST00000503788.1_Missense_Mutation_p.G511E|MARCH6_ENST00000449913.2_Missense_Mutation_p.G568E|MARCH6_ENST00000510792.1_Missense_Mutation_p.G314E	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	616					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CAGCAGGGAGGGCCTGTTGGC	0.453																																					p.G616E		.											.	MARCH6-501	0			c.G1847A						.						73.0	70.0	71.0					5																	10411600		2203	4300	6503	SO:0001583	missense	10299	exon19			AGGGAGGGCCTGT	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1847G>A	5.37:g.10411600G>A	ENSP00000274140:p.Gly616Glu	79	1		166	50	NM_005885	0	0	0	0	0	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249847	0.59212	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.42337	0.1198	L	0.40543	1.245	0.80722	D	1	P;P;D;D	0.76494	0.545;0.75;0.999;0.994	B;B;D;P	0.65987	0.136;0.154;0.94;0.795	T	0.08659	-1.0711	10	0.02654	T	1	-20.4936	19.599	0.95552	0.0:0.0:1.0:0.0	.	511;568;196;616	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	E	568;511;616;314	ENSP00000414643:G568E;ENSP00000425930:G511E;ENSP00000274140:G616E;ENSP00000424512:G314E	ENSP00000274140:G616E	G	+	2	0	MARCH6	10464600	1.000000	0.71417	0.688000	0.30117	0.992000	0.81027	9.368000	0.97152	2.708000	0.92522	0.563000	0.77884	GGG	.		0.453	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
GFM2	84340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	74026107	74026107	+	Silent	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:74026107G>T	ENST00000296805.3	-	17	2161	c.1704C>A	c.(1702-1704)atC>atA	p.I568I	GFM2_ENST00000345239.2_Silent_p.I521I|GFM2_ENST00000515125.1_Intron|GFM2_ENST00000509430.1_Silent_p.I568I	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		CTGAGTTTAGGATGGTCTCTC	0.413																																					p.I568I		.											.	GFM2-90	0			c.C1704A						.						106.0	100.0	102.0					5																	74026107		2203	4300	6503	SO:0001819	synonymous_variant	84340	exon17			GTTTAGGATGGTC	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1704C>A	5.37:g.74026107G>T		69	0		114	32	NM_032380	0	0	0	0	0		Silent	SNP	ENST00000296805.3	37	CCDS4023.1																																																																																			.		0.413	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
POC5	134359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	74981182	74981182	+	Silent	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:74981182G>C	ENST00000428202.2	-	10	1446	c.1257C>G	c.(1255-1257)tcC>tcG	p.S419S	POC5_ENST00000380475.2_Silent_p.S302S|POC5_ENST00000446329.2_Silent_p.S394S|POC5_ENST00000510798.1_Silent_p.S302S|POC5_ENST00000514838.2_Silent_p.S391S	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	419					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGCTGGTGGGGATGGCAGCA	0.557																																					p.S419S		.											.	POC5-45	0			c.C1257G						.						100.0	118.0	112.0					5																	74981182		2058	4209	6267	SO:0001819	synonymous_variant	134359	exon10			TGGTGGGGATGGC	AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.1257C>G	5.37:g.74981182G>C		120	0		199	47	NM_001099271	0	0	0	0	0	B4DJG7|Q494X7|Q494X9|Q6P085	Silent	SNP	ENST00000428202.2	37	CCDS47236.1																																																																																			.		0.557	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369124.1	NM_152408	
CHD1	1105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	98195710	98195710	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:98195710T>C	ENST00000284049.3	-	32	4639	c.4490A>G	c.(4489-4491)tAt>tGt	p.Y1497C		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1497					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AGCATGCTTATATAATTTATG	0.274																																					p.Y1497C		.											.	CHD1-274	0			c.A4490G						.						37.0	42.0	40.0					5																	98195710		2193	4275	6468	SO:0001583	missense	1105	exon32			TGCTTATATAATT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.4490A>G	5.37:g.98195710T>C	ENSP00000284049:p.Tyr1497Cys	62	0		67	42	NM_001270	0	0	0	0	0	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.048523	0.75846	.	.	ENSG00000153922	ENST00000422663;ENST00000284049	D	0.97041	-4.22	5.09	5.09	0.68999	.	0.000000	0.31233	U	0.008011	D	0.98378	0.9461	M	0.83384	2.64	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99620	1.0983	10	0.87932	D	0	.	15.1564	0.72746	0.0:0.0:0.0:1.0	.	1497	O14646	CHD1_HUMAN	C	87;1497	ENSP00000284049:Y1497C	ENSP00000284049:Y1497C	Y	-	2	0	CHD1	98223610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.671000	0.83941	2.036000	0.60181	0.533000	0.62120	TAT	.		0.274	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
GIN1	54826	hgsc.bcm.edu	37	5	102442521	102442521	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:102442521G>A	ENST00000399004.2	-	3	326	c.232C>T	c.(232-234)Cat>Tat	p.H78Y	GIN1_ENST00000508629.1_Missense_Mutation_p.H78Y|GIN1_ENST00000511400.1_5'Flank	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	78					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		TCATTTTCATGGCATTCTCTT	0.358																																					p.H78Y		.											.	GIN1-92	0			c.C232T						.						103.0	95.0	97.0					5																	102442521		1844	4093	5937	SO:0001583	missense	54826	exon3			TTTCATGGCATTC	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.232C>T	5.37:g.102442521G>A	ENSP00000381970:p.His78Tyr	51	0		44	11	NM_017676	0	0	0	0	0	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	37	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511057	0.85389	.	.	ENSG00000145723	ENST00000399004;ENST00000508629	T;T	0.34859	1.34;1.34	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000007	T	0.43523	0.1251	N	0.08118	0	0.50813	D	0.999895	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.53528	-0.8426	10	0.72032	D	0.01	-23.322	18.8203	0.92094	0.0:0.0:1.0:0.0	.	78;78	Q9NXP7-3;Q9NXP7	.;GIN1_HUMAN	Y	78	ENSP00000381970:H78Y;ENSP00000427162:H78Y	ENSP00000381970:H78Y	H	-	1	0	GIN1	102470420	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.069000	0.71209	2.880000	0.98712	0.650000	0.86243	CAT	.		0.358	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
PCDHGA3	56112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140724210	140724210	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:140724210A>T	ENST00000253812.6	+	1	610	c.610A>T	c.(610-612)Aaa>Taa	p.K204*	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	204	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACCGTGAGAAAAAAGAAAT	0.537																																					p.K204X		.											.	PCDHGA3-68	0			c.A610T						.						48.0	51.0	50.0					5																	140724210		2151	4270	6421	SO:0001587	stop_gained	56112	exon1			CGTGAGAAAAAAG	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.610A>T	5.37:g.140724210A>T	ENSP00000253812:p.Lys204*	111	0		136	39	NM_032011	0	0	0	0	0	Q9Y5D4	Nonsense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	16.89	3.246840	0.59103	.	.	ENSG00000254245	ENST00000253812	.	.	.	5.65	1.35	0.21983	.	0.498029	0.14302	U	0.328230	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	5.4155	0.16372	0.3545:0.1525:0.4931:0.0	.	.	.	.	X	204	.	ENSP00000253812:K204X	K	+	1	0	PCDHGA3	140704394	0.000000	0.05858	0.941000	0.38009	0.356000	0.29392	0.140000	0.16056	0.282000	0.22254	0.533000	0.62120	AAA	.		0.537	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PCDH1	5097	hgsc.bcm.edu	37	5	141233788	141233788	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:141233788C>T	ENST00000287008.3	-	5	3680	c.3533G>A	c.(3532-3534)cGg>cAg	p.R1178Q	PCDH1_ENST00000503492.1_3'UTR	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TTTGGTGTTCCGGTCTTCCGG	0.652																																					p.R1178Q	Ovarian(132;1609 1739 4190 14731 45037)	.											.	PCDH1-95	0			c.G3533A						.						20.0	22.0	21.0					5																	141233788		2202	4299	6501	SO:0001583	missense	5097	exon5			GTGTTCCGGTCTT	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3533G>A	5.37:g.141233788C>T	ENSP00000287008:p.Arg1178Gln	18	0		39	3	NM_032420	0	0	0	0	0	Q8IUP2	Missense_Mutation	SNP	ENST00000287008.3	37	CCDS4267.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490764	0.44249	.	.	ENSG00000156453	ENST00000287008	T	0.53423	0.62	4.78	3.9	0.45041	.	1.032420	0.07798	U	0.956009	T	0.40886	0.1135	L	0.40543	1.245	0.80722	D	1	P	0.50443	0.935	B	0.38755	0.281	T	0.20472	-1.0274	10	0.41790	T	0.15	.	13.0535	0.58967	0.0:0.8367:0.1633:0.0	.	1178	Q08174-2	.	Q	1178	ENSP00000287008:R1178Q	ENSP00000287008:R1178Q	R	-	2	0	PCDH1	141213972	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.887000	0.48586	1.131000	0.42111	0.448000	0.29417	CGG	.		0.652	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320587.2	NM_032420	
CANX	821	hgsc.bcm.edu	37	5	179160185	179160185	+	IGR	SNP	C	C	T	rs76621265	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:179160185C>T	ENST00000247461.4	+	0	4260				MAML1_ENST00000292599.3_Silent_p.R24R	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin						aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	AGCGCCTTCGCCGGCGCATCG	0.756													C|||	115	0.0229633	0.0862	0.0014	5008	,	,		6237	0.0		0.0	False		,,,				2504	0.0				p.R24R		.											.	MAML1-848	0			c.C72T						.	C		163,3143		1,161,1491	3.0	2.0	2.0		72	3.8	1.0	5	dbSNP_131	2	5,6517		0,5,3256	no	coding-synonymous	MAML1	NM_014757.4		1,166,4747	TT,TC,CC		0.0767,4.9304,1.7094		24/1017	179160185	168,9660	1653	3261	4914	SO:0001628	intergenic_variant	9794	exon1			CCTTCGCCGGCGC	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910		5.37:g.179160185C>T		3	0		8	7	NM_014757	0	0	0	0	0	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Silent	SNP	ENST00000247461.4	37	CCDS4447.1	40	0.018315018315018316	36	0.07317073170731707	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	C	13.00	2.107428	0.37145	0.049304	7.67E-4	ENSG00000161021	ENST00000376951	.	.	.	3.79	3.79	0.43588	.	.	.	.	.	T	0.17323	0.0416	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53556	-0.8422	5	0.66056	D	0.02	-10.5307	11.6476	0.51269	0.0:0.9087:0.0:0.0913	.	.	.	.	V	107	.	ENSP00000366150:A107V	A	+	2	0	MAML1	179092791	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.489000	0.45285	1.958000	0.56883	0.465000	0.42564	GCC	C|0.982;T|0.018		0.756	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
SLC22A7	10864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43266249	43266249	+	Silent	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:43266249G>A	ENST00000372585.5	+	1	248	c.153G>A	c.(151-153)ctG>ctA	p.L51L	SLC22A7_ENST00000372589.3_Silent_p.L51L|SLC22A7_ENST00000372574.3_Silent_p.L51L|SLC22A7_ENST00000487175.1_Intron	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	51					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GATGTGCCCTGCCGGGTGCCC	0.662																																					p.L51L		.											.	SLC22A7-90	0			c.G153A						.						51.0	51.0	51.0					6																	43266249		2203	4300	6503	SO:0001819	synonymous_variant	10864	exon1			TGCCCTGCCGGGT	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.153G>A	6.37:g.43266249G>A		116	0		89	35	NM_006672	0	0	0	0	0	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Silent	SNP	ENST00000372585.5	37	CCDS4893.2																																																																																			G|1.000;T|0.000		0.662	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
LRRC1	55227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53660212	53660212	+	Splice_Site	SNP	A	A	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:53660212A>T	ENST00000370888.1	+	1	435	c.158A>T	c.(157-159)gAg>gTg	p.E53V	LRRC1_ENST00000370882.1_Splice_Site_p.E53V|RP13-476E20.1_ENST00000429053.1_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	53						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		GAGCTGCCCGAGGTAAGGGTC	0.682																																					p.E53V		.											.	LRRC1-91	0			c.A158T						.						28.0	28.0	28.0					6																	53660212		2203	4300	6503	SO:0001630	splice_region_variant	55227	exon1			TGCCCGAGGTAAG	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.159+1A>T	6.37:g.53660212A>T		26	0		31	9	NM_018214	0	0	0	0	0	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	A	18.98	3.737840	0.69304	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.58797	0.31;0.31	4.88	3.68	0.42216	.	0.264852	0.37623	N	0.002013	T	0.35008	0.0917	N	0.25380	0.74	0.39279	D	0.96452	B	0.32467	0.372	B	0.42319	0.383	T	0.38373	-0.9664	10	0.87932	D	0	.	9.613	0.39674	0.914:0.0:0.086:0.0	.	53	Q9BTT6	LRRC1_HUMAN	V	53	ENSP00000359925:E53V;ENSP00000359919:E53V	ENSP00000359919:E53V	E	+	2	0	LRRC1	53768171	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	8.227000	0.89787	0.660000	0.30964	0.460000	0.39030	GAG	.		0.682	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	Missense_Mutation
CD109	135228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	74407130	74407130	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:74407130T>C	ENST00000287097.5	+	2	194	c.82T>C	c.(82-84)Ttt>Ctt	p.F28L	RP11-553A21.3_ENST00000428865.2_RNA|CD109_ENST00000422508.2_Missense_Mutation_p.F28L|CD109_ENST00000437994.2_Missense_Mutation_p.F28L			Q6YHK3	CD109_HUMAN	CD109 molecule	28					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TAGGCCTCGGTTTCTGGTGAC	0.507																																					p.F28L		.											.	CD109-155	0			c.T82C						.						103.0	101.0	102.0					6																	74407130		2203	4300	6503	SO:0001583	missense	135228	exon2			CCTCGGTTTCTGG	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.82T>C	6.37:g.74407130T>C	ENSP00000287097:p.Phe28Leu	113	0		118	49	NM_133493	0	0	0	0	0	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.192857	0.78902	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.35421	1.86;1.31;1.86	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000004	T	0.29850	0.0746	N	0.19112	0.55	0.23555	N	0.997424	D;D;D;D	0.69078	0.965;0.997;0.986;0.985	P;D;P;P	0.66716	0.63;0.946;0.84;0.873	T	0.19516	-1.0303	10	0.72032	D	0.01	.	12.8889	0.58058	0.0:0.0:0.0:1.0	.	28;28;28;28	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	L	28	ENSP00000388062:F28L;ENSP00000404475:F28L;ENSP00000287097:F28L	ENSP00000287097:F28L	F	+	1	0	CD109	74463851	0.998000	0.40836	0.964000	0.40570	0.607000	0.37147	4.263000	0.58853	2.243000	0.73865	0.533000	0.62120	TTT	.		0.507	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
PHIP	55023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	79724879	79724879	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:79724879G>A	ENST00000275034.4	-	15	1611	c.1444C>T	c.(1444-1446)Ctc>Ttc	p.L482F		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	482					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		GCAGAAAAGAGAACTCTAGGA	0.358																																					p.L482F		.											.	PHIP-579	0			c.C1444T						.						101.0	94.0	96.0					6																	79724879		2203	4300	6503	SO:0001583	missense	55023	exon15			AAAAGAGAACTCT	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.1444C>T	6.37:g.79724879G>A	ENSP00000275034:p.Leu482Phe	93	0		82	10	NM_017934	0	0	0	0	0	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033289	0.75504	.	.	ENSG00000146247	ENST00000275034	T	0.68479	-0.33	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.52532	D	0.000061	T	0.60586	0.2280	N	0.21194	0.64	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.61093	-0.7132	9	.	.	.	-5.5196	11.6141	0.51078	0.0821:0.0:0.9179:0.0	.	482;482	A7J992;Q8WWQ0	.;PHIP_HUMAN	F	482	ENSP00000275034:L482F	.	L	-	1	0	PHIP	79781598	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.663000	0.54518	2.586000	0.87340	0.460000	0.39030	CTC	.		0.358	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
DNAH11	8701	broad.mit.edu;bcgsc.ca	37	7	21908512	21908512	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:21908512G>T	ENST00000409508.3	+	73	11901	c.11870G>T	c.(11869-11871)gGa>gTa	p.G3957V	DNAH11_ENST00000328843.6_Missense_Mutation_p.G3964V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3964	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATTGACTCTGGAAAATTCCAC	0.498									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						120.0	117.0	118.0					7																	21908512		1914	4130	6044	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ACTCTGGAAAATT	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.11870G>T	7.37:g.21908512G>T	ENSP00000475939:p.Gly3957Val	118	0		121	11	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	28.7	4.945078	0.92593	.	.	ENSG00000105877	ENST00000328843	T	0.08370	3.1	5.85	5.85	0.93711	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00161	-1.1972	9	0.30078	T	0.28	.	20.1527	0.98091	0.0:0.0:1.0:0.0	.	3964	Q96DT5	DYH11_HUMAN	V	3964	ENSP00000330671:G3964V	ENSP00000330671:G3964V	G	+	2	0	DNAH11	21875037	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.770000	0.95276	0.579000	0.79373	GGA	.		0.498	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
GPNMB	10457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	23306207	23306207	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:23306207C>A	ENST00000381990.2	+	7	1287	c.1126C>A	c.(1126-1128)Cac>Aac	p.H376N	GPNMB_ENST00000258733.4_Missense_Mutation_p.H364N|GPNMB_ENST00000453162.2_Missense_Mutation_p.H318N|GPNMB_ENST00000539136.1_Missense_Mutation_p.H265N	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	376					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			CAGATATGGCCACTTTCAAGC	0.478																																					p.H376N		.											.	GPNMB-580	0			c.C1126A						.						82.0	71.0	75.0					7																	23306207		2203	4300	6503	SO:0001583	missense	10457	exon7			TATGGCCACTTTC	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1126C>A	7.37:g.23306207C>A	ENSP00000371420:p.His376Asn	52	0		52	19	NM_001005340	0	0	0	0	0	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	C	6.226	0.409829	0.11812	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	T;T;T;T	0.13657	2.58;2.58;2.57;2.58	5.89	-0.668	0.11392	PKD/Chitinase domain (1);	0.606085	0.16307	N	0.220182	T	0.12518	0.0304	L	0.47716	1.5	0.09310	N	0.999998	D;P;P;P	0.53745	0.962;0.82;0.913;0.744	B;B;B;B	0.43990	0.438;0.351;0.345;0.275	T	0.29212	-1.0019	10	0.22706	T	0.39	-12.8359	11.5467	0.50698	0.0:0.5539:0.0:0.4461	.	265;318;376;364	F6SKP1;F5GY20;Q14956;Q14956-2	.;.;GPNMB_HUMAN;.	N	364;411;376;259;265;318	ENSP00000258733:H364N;ENSP00000371420:H376N;ENSP00000445266:H265N;ENSP00000405586:H318N	ENSP00000258733:H364N	H	+	1	0	GPNMB	23272732	0.759000	0.28416	0.042000	0.18584	0.021000	0.10359	1.106000	0.31098	-0.061000	0.13110	-0.781000	0.03364	CAC	.		0.478	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	42063171	42063171	+	Missense_Mutation	SNP	C	C	T	rs35488756	byFrequency	TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:42063171C>T	ENST00000395925.3	-	10	1477	c.1393G>A	c.(1393-1395)Ggg>Agg	p.G465R	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	465					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TCTTTGTCCCCTTCCTCCTTG	0.542									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.G465R		.											.	GLI3-1149	0			c.G1393A						.						152.0	118.0	129.0					7																	42063171		2203	4300	6503	SO:0001583	missense	2737	exon10	Familial Cancer Database	;	TGTCCCCTTCCTC		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1393G>A	7.37:g.42063171C>T	ENSP00000379258:p.Gly465Arg	103	0		102	41	NM_000168	0	0	0	0	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727028	0.69074	.	.	ENSG00000106571	ENST00000395925	T	0.69306	-0.39	5.81	5.81	0.92471	.	0.043845	0.85682	D	0.000000	T	0.66713	0.2817	L	0.57536	1.79	0.80722	D	1	B	0.16396	0.017	B	0.14023	0.01	T	0.60762	-0.7199	10	0.42905	T	0.14	.	20.0912	0.97820	0.0:1.0:0.0:0.0	.	465	P10071	GLI3_HUMAN	R	465	ENSP00000379258:G465R	ENSP00000379258:G465R	G	-	1	0	GLI3	42029696	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.975000	0.70475	2.746000	0.94184	0.591000	0.81541	GGG	C|0.997;G|0.003		0.542	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
PILRA	29992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99971777	99971777	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:99971777T>G	ENST00000198536.2	+	2	387	c.175T>G	c.(175-177)Tgg>Ggg	p.W59G	PILRA_ENST00000350573.2_Missense_Mutation_p.W59G|PILRA_ENST00000474013.1_3'UTR|PILRA_ENST00000453419.1_Missense_Mutation_p.W59G|PILRA_ENST00000394000.2_Missense_Mutation_p.W59G	NM_013439.2	NP_038467.2	Q9UKJ1	PILRA_HUMAN	paired immunoglobin-like type 2 receptor alpha	59	Ig-like V-type.				signal transduction (GO:0007165)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	15	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTATTACCCCTGGGAGTTAGC	0.547																																					p.W59G		.											.	PILRA-91	0			c.T175G						.						65.0	73.0	70.0					7																	99971777		2203	4300	6503	SO:0001583	missense	29992	exon2			TACCCCTGGGAGT	AF161080	CCDS5691.1, CCDS5692.1, CCDS47660.1	7q22.1	2013-01-11			ENSG00000085514	ENSG00000085514		"""Immunoglobulin superfamily / V-set domain containing"""	20396	protein-coding gene	gene with protein product		605341				10660620	Standard	NM_178272		Approved	FDF03	uc003uuo.1	Q9UKJ1	OTTHUMG00000155248	ENST00000198536.2:c.175T>G	7.37:g.99971777T>G	ENSP00000198536:p.Trp59Gly	76	1		101	9	NM_013439	0	0	0	0	0	Q8NHI1	Missense_Mutation	SNP	ENST00000198536.2	37	CCDS5691.1	.	.	.	.	.	.	.	.	.	.	T	7.824	0.718406	0.15372	.	.	ENSG00000085514	ENST00000432297;ENST00000198536;ENST00000453419;ENST00000394000;ENST00000350573	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	3.28	0.423	0.16463	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.575166	0.14763	N	0.299864	T	0.36220	0.0959	L	0.35542	1.07	0.09310	N	1	P;B;B;B;P	0.47841	0.465;0.091;0.074;0.014;0.901	B;B;B;B;P	0.49421	0.166;0.046;0.047;0.014;0.61	T	0.18903	-1.0322	9	.	.	.	.	8.3067	0.32047	0.0:0.0:0.5403:0.4597	.	59;59;59;59;59	C9JJ79;C9JGG1;Q9UKJ1-4;Q9UKJ1-3;Q9UKJ1	.;.;.;.;PILRA_HUMAN	G	59	ENSP00000415111:W59G;ENSP00000198536:W59G;ENSP00000390026:W59G;ENSP00000377569:W59G;ENSP00000340109:W59G	.	W	+	1	0	PILRA	99809713	0.011000	0.17503	0.078000	0.20375	0.106000	0.19336	0.017000	0.13399	0.052000	0.16007	0.260000	0.18958	TGG	.		0.547	PILRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339016.1	NM_013439	
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	121651018	121651018	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:121651018G>C	ENST00000393386.2	+	12	2329	c.1918G>C	c.(1918-1920)Gaa>Caa	p.E640Q	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.E640Q	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	640					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ATCAGGTTCAGAAGAATCACT	0.418																																					p.E640Q		.											.	PTPRZ1-699	0			c.G1918C						.						60.0	58.0	59.0					7																	121651018		2203	4300	6503	SO:0001583	missense	5803	exon12			GGTTCAGAAGAAT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1918G>C	7.37:g.121651018G>C	ENSP00000377047:p.Glu640Gln	113	0		105	45	NM_001206838	0	0	0	0	0	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.952906	0.34471	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.50548	0.8;0.74	5.87	5.87	0.94306	.	0.470308	0.21679	N	0.070741	T	0.61274	0.2334	M	0.67953	2.075	0.27751	N	0.944151	P;P;D	0.63880	0.779;0.671;0.993	B;B;P	0.55713	0.277;0.143;0.782	T	0.60182	-0.7313	10	0.59425	D	0.04	.	14.976	0.71273	0.0:0.0:0.8573:0.1427	.	640;640;640	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	Q	640	ENSP00000377047:E640Q;ENSP00000410000:E640Q	ENSP00000377047:E640Q	E	+	1	0	PTPRZ1	121438254	0.993000	0.37304	0.945000	0.38365	0.967000	0.64934	3.265000	0.51561	2.778000	0.95560	0.655000	0.94253	GAA	.		0.418	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
PPP1R42	286187	hgsc.bcm.edu	37	8	67900719	67900719	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr8:67900719G>C	ENST00000324682.5	-	6	730	c.586C>G	c.(586-588)Ctg>Gtg	p.L196V	PPP1R42_ENST00000522909.1_Missense_Mutation_p.L196V	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	196					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										ATTTTCCACAGCTTCATCAAC	0.333																																					p.L196V		.											.	.	0			c.C586G						.						63.0	60.0	61.0					8																	67900719		2202	4298	6500	SO:0001583	missense	286187	exon6			TCCACAGCTTCAT	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.586C>G	8.37:g.67900719G>C	ENSP00000315035:p.Leu196Val	46	0		32	2	NM_001013626	0	0	0	0	0		Missense_Mutation	SNP	ENST00000324682.5	37	CCDS34902.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137817	0.56936	.	.	ENSG00000178125	ENST00000522909;ENST00000421742;ENST00000324682	T;T	0.65178	1.11;-0.14	5.37	-9.13E-4	0.14036	.	0.067900	0.64402	D	0.000010	T	0.79684	0.4488	H	0.94264	3.515	0.45366	D	0.998359	D	0.76494	0.999	D	0.73708	0.981	T	0.75964	-0.3132	10	0.72032	D	0.01	-0.3165	6.0082	0.19559	0.2809:0.0:0.5996:0.1195	.	196	Q7Z4L9-2	.	V	196	ENSP00000429721:L196V;ENSP00000315035:L196V	ENSP00000315035:L196V	L	-	1	2	LRRC67	68063273	0.998000	0.40836	0.889000	0.34880	0.908000	0.53690	1.394000	0.34509	-0.222000	0.09958	-0.355000	0.07637	CTG	.		0.333	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626	
DENND3	22898	hgsc.bcm.edu	37	8	142146788	142146788	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr8:142146788C>G	ENST00000262585.2	+	2	321	c.43C>G	c.(43-45)Cag>Gag	p.Q15E	DENND3_ENST00000519811.1_Missense_Mutation_p.Q95E|DENND3_ENST00000424248.1_Missense_Mutation_p.Q15E|DENND3_ENST00000518347.1_Missense_Mutation_p.Q95E	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	15	UDENN.				cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGACCAGAGCAGTGGAAGGG	0.647																																					p.Q15E		.											.	DENND3-91	0			c.C43G						.						18.0	22.0	20.0					8																	142146788		2203	4300	6503	SO:0001583	missense	22898	exon2			CCAGAGCAGTGGA	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.43C>G	8.37:g.142146788C>G	ENSP00000262585:p.Gln15Glu	26	0		30	2	NM_014957	0	0	0	0	0	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.940|2.940	-0.219046|-0.219046	0.06101|0.06101	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000518668|ENST00000519291;ENST00000518347;ENST00000262585;ENST00000424248;ENST00000519811;ENST00000520986;ENST00000523058	.|T;T;T;T;T;T	.|0.40756	.|1.02;3.03;2.62;1.02;1.02;1.02	5.61|5.61	0.916|0.916	0.19373|0.19373	.|uDENN (1);	.|2.092340	.|0.01515	.|N	.|0.018084	T|T	0.21145|0.21145	0.0509|0.0509	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.19817	.|0.026;0.012;0.039;0.017	.|B;B;B;B	.|0.14023	.|0.001;0.001;0.01;0.004	T|T	0.14896|0.14896	-1.0456|-1.0456	5|10	.|0.09843	.|T	.|0.71	-11.1125|-11.1125	4.0219|4.0219	0.09670|0.09670	0.1871:0.4918:0.2347:0.0864|0.1871:0.4918:0.2347:0.0864	.|.	.|95;15;95;95	.|E9PF32;A2RUS2;E5RHH2;E5RIR7	.|.;DEND3_HUMAN;.;.	G|E	71|28;95;15;15;95;95;95	.|ENSP00000430695:Q95E;ENSP00000262585:Q15E;ENSP00000410594:Q15E;ENSP00000428714:Q95E;ENSP00000429780:Q95E;ENSP00000430786:Q95E	.|ENSP00000262585:Q15E	A|Q	+|+	2|1	0|0	DENND3|DENND3	142215970|142215970	0.007000|0.007000	0.16637|0.16637	0.004000|0.004000	0.12327|0.12327	0.004000|0.004000	0.04260|0.04260	0.021000|0.021000	0.13489|0.13489	0.204000|0.204000	0.20548|0.20548	0.650000|0.650000	0.86243|0.86243	GCA|CAG	.		0.647	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	144942527	144942527	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr8:144942527C>G	ENST00000525985.1	-	2	4966	c.4895G>C	c.(4894-4896)gGa>gCa	p.G1632A				P58107	EPIPL_HUMAN	epiplakin 1	1632						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCGAACATTCCTGCTTTGAA	0.627																																					p.G1632A		.											.	EPPK1-25	0			c.G4895C						.						74.0	83.0	80.0					8																	144942527		2037	4184	6221	SO:0001583	missense	83481	exon1			AACATTCCTGCTT	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4895G>C	8.37:g.144942527C>G	ENSP00000436337:p.Gly1632Ala	104	0		128	42	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	13.25	2.180920	0.38511	.	.	ENSG00000227184	ENST00000525985	D	0.85411	-1.98	4.41	4.41	0.53225	.	.	.	.	.	D	0.93798	0.8017	M	0.92317	3.295	0.09310	N	1	D	0.89917	1.0	D	0.72338	0.977	D	0.87143	0.2204	9	0.72032	D	0.01	.	14.5607	0.68133	0.0:1.0:0.0:0.0	.	1632	E9PPU0	.	A	1632	ENSP00000436337:G1632A	ENSP00000436337:G1632A	G	-	2	0	EPPK1	145014515	0.004000	0.15560	0.114000	0.21550	0.403000	0.30841	1.625000	0.37029	2.280000	0.76307	0.591000	0.81541	GGA	.		0.627	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
CNTRL	11064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	123900898	123900898	+	Missense_Mutation	SNP	T	T	G	rs566495778		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr9:123900898T>G	ENST00000373855.1	+	16	2538	c.2278T>G	c.(2278-2280)Ttc>Gtc	p.F760V	CNTRL_ENST00000373850.1_Missense_Mutation_p.F208V|CNTRL_ENST00000238341.5_Missense_Mutation_p.F760V|CNTRL_ENST00000373847.1_Missense_Mutation_p.F208V			Q7Z7A1	CNTRL_HUMAN	centriolin	760					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AAAAGCCCAGTTCTCAGAAGA	0.418																																					p.F760V		.											.	CNTRL-661	0			c.T2278G						.						97.0	98.0	98.0					9																	123900898		2203	4300	6503	SO:0001583	missense	11064	exon14			GCCCAGTTCTCAG	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.2278T>G	9.37:g.123900898T>G	ENSP00000362962:p.Phe760Val	93	0		101	42	NM_007018	0	0	0	0	0	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.248769	0.39797	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.76	2.4	0.29515	.	.	.	.	.	T	0.24236	0.0587	N	0.14661	0.345	0.23731	N	0.996993	B;B;B	0.24483	0.049;0.082;0.104	B;B;B	0.21708	0.016;0.036;0.024	T	0.20338	-1.0278	9	0.27082	T	0.32	.	8.6368	0.33953	0.0:0.3003:0.0:0.6997	.	760;760;760	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	V	760;760;760;242;208;208	ENSP00000362962:F760V;ENSP00000238341:F760V;ENSP00000362956:F208V;ENSP00000362953:F208V	ENSP00000238341:F760V	F	+	1	0	CNTRL	122940719	0.982000	0.34865	0.996000	0.52242	0.970000	0.65996	0.049000	0.14099	0.269000	0.21961	0.533000	0.62120	TTC	.		0.418	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
DNM1	1759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130985083	130985083	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr9:130985083T>A	ENST00000372923.3	+	9	1232	c.1140T>A	c.(1138-1140)gaT>gaA	p.D380E	DNM1_ENST00000393594.3_Missense_Mutation_p.D380E|DNM1_ENST00000486160.1_Missense_Mutation_p.D380E|DNM1_ENST00000341179.7_Missense_Mutation_p.D380E|DNM1_ENST00000475805.1_Missense_Mutation_p.D380E	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	380					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TGGAGTTTGATGAGAAGGAAC	0.547																																					.	GBM(113;146 1575 2722 28670 29921)												.	DNM1-228	0			.						.						91.0	93.0	93.0					9																	130985083		2203	4300	6503	SO:0001583	missense	1759	.			GTTTGATGAGAAG	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1140T>A	9.37:g.130985083T>A	ENSP00000362014:p.Asp380Glu	86	0		115	43	.	0	0	0	0	0	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803679	0.50315	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160	T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72	5.74	-7.32	0.01436	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	T	0.78874	0.4352	M	0.71871	2.18	0.80722	D	1	D;D;D	0.69078	0.997;0.996;0.974	D;D;P	0.80764	0.994;0.99;0.84	T	0.83247	-0.0055	10	0.54805	T	0.06	-2.1403	16.7993	0.85610	0.0:0.4642:0.0:0.5358	.	380;380;380	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	E	380;380;380;375;380;380	ENSP00000419225:D380E;ENSP00000345680:D380E;ENSP00000362014:D380E;ENSP00000377219:D380E;ENSP00000420045:D380E	ENSP00000345680:D380E	D	+	3	2	DNM1	130024904	0.950000	0.32346	0.481000	0.27354	0.831000	0.47069	0.027000	0.13621	-2.077000	0.00874	-1.447000	0.01057	GAT	.		0.547	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
ADAMTS13	11093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136305499	136305499	+	Silent	SNP	G	G	T	rs371209152		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr9:136305499G>T	ENST00000371929.3	+	16	2265	c.1821G>T	c.(1819-1821)ggG>ggT	p.G607G	ADAMTS13_ENST00000355699.2_Silent_p.G607G|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Silent_p.G576G|ADAMTS13_ENST00000536611.1_Silent_p.G279G	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	607	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TCGTGGCTGGGAAGATGAGCA	0.642																																					p.G607G		.											.	ADAMTS13-229	0			c.G1821T						.						138.0	98.0	111.0					9																	136305499		2203	4300	6503	SO:0001819	synonymous_variant	11093	exon16			GGCTGGGAAGATG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1821G>T	9.37:g.136305499G>T		107	0		103	32	NM_139027	0	0	0	0	0	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	CCDS6970.1																																																																																			.		0.642	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
NOTCH1	4851	hgsc.bcm.edu	37	9	139391440	139391440	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr9:139391440C>T	ENST00000277541.6	-	34	6826	c.6751G>A	c.(6751-6753)Gcc>Acc	p.A2251T		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2251					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K2182fs*61(1)|p.S2163_T2283del(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGGGCTTGGCCGCCACGTTC	0.706			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.A2251T		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	2	Deletion - Frameshift(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(2)	c.G6751A						.						12.0	15.0	14.0					9																	139391440		1983	4126	6109	SO:0001583	missense	4851	exon34			GCTTGGCCGCCAC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.6751G>A	9.37:g.139391440C>T	ENSP00000277541:p.Ala2251Thr	34	0		35	2	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	4.536	0.099550	0.08681	.	.	ENSG00000148400	ENST00000277541	D	0.81821	-1.54	5.55	2.72	0.32119	.	0.379586	0.27841	N	0.017627	T	0.60261	0.2255	N	0.15975	0.35	0.30523	N	0.768211	B	0.12013	0.005	B	0.09377	0.004	T	0.49670	-0.8915	10	0.12766	T	0.61	.	8.1541	0.31158	0.0:0.693:0.0:0.307	.	2251	P46531	NOTC1_HUMAN	T	2251	ENSP00000277541:A2251T	ENSP00000277541:A2251T	A	-	1	0	NOTCH1	138511261	.	.	0.413000	0.26509	0.292000	0.27327	.	.	0.390000	0.25115	0.655000	0.94253	GCC	.		0.706	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
UBA1	7317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47069022	47069022	+	Splice_Site	SNP	T	T	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chrX:47069022T>G	ENST00000335972.6	+	17	2122	c.1939T>G	c.(1939-1941)Tgg>Ggg	p.W647G	UBA1_ENST00000377269.3_Missense_Mutation_p.W95G|UBA1_ENST00000377351.4_Splice_Site_p.W647G	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	647					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTGTCTGCAGTGGGCTCGGGA	0.498																																					p.W647G		.											.	UBA1-227	0			c.T1939G						.						122.0	93.0	103.0					X																	47069022		2203	4300	6503	SO:0001630	splice_region_variant	7317	exon17			CTGCAGTGGGCTC	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1939-1T>G	X.37:g.47069022T>G		21	0		32	26	NM_153280	0	0	0	0	0	Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009850	0.75046	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.51817	0.69;0.69;0.69	5.22	5.22	0.72569	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-activating enzyme (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.111594	0.64402	D	0.000003	T	0.79782	0.4505	H	0.98577	4.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86491	0.1797	10	0.87932	D	0	-10.8017	11.8816	0.52579	0.0:0.0:0.0:1.0	.	95;647	Q5JRR6;P22314	.;UBA1_HUMAN	G	647;647;95	ENSP00000366568:W647G;ENSP00000338413:W647G;ENSP00000366481:W95G	ENSP00000338413:W647G	W	+	1	0	UBA1	46953966	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.580000	0.82523	1.860000	0.53959	0.427000	0.28365	TGG	.		0.498	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	Missense_Mutation
FAAH2	158584	hgsc.bcm.edu	37	X	57313330	57313330	+	Silent	SNP	A	A	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chrX:57313330A>G	ENST00000374900.4	+	1	192	c.72A>G	c.(70-72)gtA>gtG	p.V24V		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	24						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						TAGGCTTAGTAGGCCGAGCAG	0.567										HNSCC(52;0.14)																											p.V24V		.											.	FAAH2-133	0			c.A72G						.						41.0	36.0	38.0					X																	57313330		2203	4299	6502	SO:0001819	synonymous_variant	158584	exon1			CTTAGTAGGCCGA	AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.72A>G	X.37:g.57313330A>G		18	0		17	2	NM_174912	0	0	0	0	0	Q86VT2|Q96N98	Silent	SNP	ENST00000374900.4	37	CCDS14375.1																																																																																			.		0.567	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
PLXNB3	5365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153037078	153037078	+	Missense_Mutation	SNP	G	G	C	rs375202688		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chrX:153037078G>C	ENST00000361971.5	+	14	2599	c.2485G>C	c.(2485-2487)Gag>Cag	p.E829Q	PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538282.1_Missense_Mutation_p.E439Q|PLXNB3_ENST00000538966.1_Missense_Mutation_p.E852Q|PLXNB3_ENST00000538776.1_Missense_Mutation_p.E482Q	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	829	PSI 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGGGCTGTGGAGCTGCTGTG	0.692																																					p.E852Q		.											.	PLXNB3-130	0			c.G2554C						.						20.0	20.0	20.0					X																	153037078		2180	4292	6472	SO:0001583	missense	5365	exon15			GCTGTGGAGCTGC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2485G>C	X.37:g.153037078G>C	ENSP00000355378:p.Glu829Gln	14	0		12	12	NM_001163257	0	0	0	0	0	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404697	0.25378	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.66460	5.33;5.29;4.71;-0.21	5.01	-0.321	0.12717	.	.	.	.	.	T	0.59945	0.2231	L	0.55103	1.725	0.09310	N	1	B;B;B;B	0.23128	0.001;0.08;0.009;0.003	B;B;B;B	0.17098	0.005;0.017;0.008;0.005	T	0.43718	-0.9374	9	0.12103	T	0.63	.	17.8542	0.88758	0.0:0.6872:0.3128:0.0	.	482;511;852;829	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	Q	852;829;482;439	ENSP00000442736:E852Q;ENSP00000355378:E829Q;ENSP00000445569:E482Q;ENSP00000441919:E439Q	ENSP00000355378:E829Q	E	+	1	0	PLXNB3	152690272	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.736000	0.26130	-0.636000	0.05524	-0.347000	0.07816	GAG	.		0.692	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
PLXNB3	5365	hgsc.bcm.edu	37	X	153037467	153037467	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chrX:153037467C>T	ENST00000361971.5	+	15	2780	c.2666C>T	c.(2665-2667)gCc>gTc	p.A889V	PLXNB3_ENST00000538543.1_3'UTR|PLXNB3_ENST00000538282.1_Missense_Mutation_p.A499V|PLXNB3_ENST00000538966.1_Missense_Mutation_p.A912V|PLXNB3_ENST00000538776.1_Missense_Mutation_p.A542V	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	889	IPT/TIG 1.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCACGTCGGCCCGGTGAGGC	0.672																																					p.A912V		.											.	PLXNB3-130	0			c.C2735T						.						35.0	35.0	35.0					X																	153037467		2195	4292	6487	SO:0001583	missense	5365	exon16			CGTCGGCCCGGTG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2666C>T	X.37:g.153037467C>T	ENSP00000355378:p.Ala889Val	48	0		46	3	NM_001163257	0	0	0	0	0	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809753	0.31961	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	4.96	4.96	0.65561	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.469786	0.22002	N	0.065995	T	0.60958	0.2309	N	0.10782	0.045	0.22354	N	0.999179	B;P;B;B	0.36483	0.188;0.555;0.257;0.343	B;B;B;B	0.39935	0.314;0.257;0.149;0.314	T	0.53885	-0.8375	10	0.27082	T	0.32	.	9.9877	0.41852	0.2018:0.7982:0.0:0.0	.	542;571;912;889	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	V	912;889;542;499	ENSP00000442736:A912V;ENSP00000355378:A889V;ENSP00000445569:A542V;ENSP00000441919:A499V	ENSP00000355378:A889V	A	+	2	0	PLXNB3	152690661	0.013000	0.17824	0.441000	0.26858	0.020000	0.10135	1.775000	0.38584	2.035000	0.60131	0.513000	0.50165	GCC	.		0.672	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
ATP1B1	481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169100749	169100768	+	Frame_Shift_Del	DEL	CGTTTTCAGGGACGTTTTGA	CGTTTTCAGGGACGTTTTGA	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	CGTTTTCAGGGACGTTTTGA	CGTTTTCAGGGACGTTTTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr1:169100749_169100768delCGTTTTCAGGGACGTTTTGA	ENST00000367816.1	+	7	1397_1416	c.868_887delCGTTTTCAGGGACGTTTTGA	c.(868-888)cgttttcagggacgttttgatfs	p.RFQGRFD290fs	ATP1B1_ENST00000367813.3_Frame_Shift_Del_p.RFQGRFD282fs|ATP1B1_ENST00000367815.4_Frame_Shift_Del_p.RFQGRFD290fs|ATP1B1_ENST00000499679.3_Frame_Shift_Del_p.RFQGRFD234fs			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	290	immunoglobulin-like.				blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.R290S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					TGAGAAAGACCGTTTTCAGGGACGTTTTGATGTAAAAATT	0.4																																					p.290_296del		.											.	ATP1B1-540	1	Substitution - Missense(1)	lung(1)	c.868_887del						.																																			SO:0001589	frameshift_variant	481	exon6			.	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.868_887delCGTTTTCAGGGACGTTTTGA	1.37:g.169100749_169100768delCGTTTTCAGGGACGTTTTGA	ENSP00000356790:p.Arg290fs	113	0		79	26	NM_001677	0	0	0	0	0	Q5TGZ3	Frame_Shift_Del	DEL	ENST00000367816.1	37	CCDS1276.1																																																																																			.		0.400	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
FAM208B	54906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	5790239	5790239	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr10:5790239delT	ENST00000328090.5	+	15	5480	c.4855delT	c.(4855-4857)tttfs	p.F1619fs		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1619																	GAACCATCTCTTTCCCGGTGA	0.453																																					p.F1619fs		.											.	.	0			c.4855delT						.						65.0	65.0	65.0					10																	5790239		1964	4151	6115	SO:0001589	frameshift_variant	54906	exon15			.	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4855delT	10.37:g.5790239delT	ENSP00000328426:p.Phe1619fs	91	0		133	29	NM_017782	0	0	0	0	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Frame_Shift_Del	DEL	ENST00000328090.5	37	CCDS41485.1																																																																																			.		0.453	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
UEVLD	55293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18568448	18568448	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:18568448delG	ENST00000396197.3	-	8	893	c.865delC	c.(865-867)ctgfs	p.L290fs	UEVLD_ENST00000379387.4_Frame_Shift_Del_p.L268fs|UEVLD_ENST00000540666.1_5'UTR|UEVLD_ENST00000543987.1_Frame_Shift_Del_p.L290fs|UEVLD_ENST00000535484.1_Frame_Shift_Del_p.L252fs|UEVLD_ENST00000541984.1_Intron|UEVLD_ENST00000320750.6_Frame_Shift_Del_p.L268fs	NM_001040697.2|NM_001261384.1	NP_001035787.1|NP_001248313.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						GCAACGAGCAGGACACTGTGT	0.403																																					p.L289fs		.											.	UEVLD-226	0			c.865delC						.						142.0	133.0	136.0					11																	18568448		2199	4293	6492	SO:0001589	frameshift_variant	55293	exon8			.	AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000396197.3:c.865delC	11.37:g.18568448delG	ENSP00000379500:p.Leu290fs	125	0		98	35	NM_001040697	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000396197.3	37	CCDS41624.1																																																																																			.		0.403	UEVLD-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395923.2	NM_018314	
NF2	4771	broad.mit.edu	37	22	30069467	30069470	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	AGAG	AGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr22:30069467_30069470delAGAG	ENST00000338641.4	+	12	1773_1776	c.1332_1335delAGAG	c.(1330-1335)tcagagfs	p.SE444fs	NF2_ENST00000403435.1_Frame_Shift_Del_p.SE415fs|NF2_ENST00000334961.7_Frame_Shift_Del_p.SE361fs|NF2_ENST00000361166.4_Frame_Shift_Del_p.SE444fs|NF2_ENST00000347330.5_Intron|NF2_ENST00000403999.3_Frame_Shift_Del_p.SE444fs|NF2_ENST00000397789.3_Frame_Shift_Del_p.SE444fs|NF2_ENST00000361452.4_Frame_Shift_Del_p.SE403fs|NF2_ENST00000361676.4_Frame_Shift_Del_p.SE402fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000353887.4_Frame_Shift_Del_p.SE361fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	444	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(4)|p.E445fs*9(3)|p.R446fs*48(1)|p.R446fs*49(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CTGAGGAGTCAGAGAGGAGGTGAG	0.637			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.444_445del			yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	9	Unknown(4)|Deletion - Frameshift(4)|Insertion - Frameshift(1)	meninges(4)|soft_tissue(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.1332_1335del	GRCh37	CD962110|CI983171	NF2	D|I		.																																			SO:0001589	frameshift_variant	4771	exon12	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GGAGTCAGAGAGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1332_1335delAGAG	22.37:g.30069467_30069470delAGAG	ENSP00000344666:p.Ser444fs	15	0		8	5	NM_000268	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.637	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
CENPH	64946	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	68505552	68505552	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:68505552delA	ENST00000283006.2	+	9	757	c.670delA	c.(670-672)aaafs	p.K224fs	CENPH_ENST00000515001.1_Frame_Shift_Del_p.K205fs	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		TTTGGGGAGTAAAGTCAATTG	0.289																																					p.K224fs		.											.	CENPH-153	0			c.670delA						.						78.0	78.0	78.0					5																	68505552		2203	4300	6503	SO:0001589	frameshift_variant	64946	exon9			.	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.670delA	5.37:g.68505552delA	ENSP00000283006:p.Lys224fs	57	0		57	31	NM_022909	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000283006.2	37	CCDS3998.1																																																																																			.		0.289	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1		
SLC26A8	116369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	35923086	35923086	+	Frame_Shift_Del	DEL	T	T	-	rs200648238		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:35923086delT	ENST00000490799.1	-	17	2428	c.2075delA	c.(2074-2076)aacfs	p.N692fs	SLC26A8_ENST00000394602.2_Frame_Shift_Del_p.N587fs|SLC26A8_ENST00000355574.2_Frame_Shift_Del_p.N692fs	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TGGTGAGCTGTTTCTTGATGA	0.507																																					p.N692fs		.											.	SLC26A8-92	0			c.2075delA						.						194.0	187.0	190.0					6																	35923086		2203	4300	6503	SO:0001589	frameshift_variant	116369	exon17			.	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.2075delA	6.37:g.35923086delT	ENSP00000417638:p.Asn692fs	122	0		108	45	NM_052961	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000490799.1	37	CCDS4813.1																																																																																			.		0.507	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
UFL1	23376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	96996102	96996102	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr6:96996102delC	ENST00000369278.4	+	13	1531	c.1465delC	c.(1465-1467)cacfs	p.H489fs		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	489					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										TTTAAGAAAACACATACAAGA	0.308																																					p.H489fs		.											.	.	0			c.1465delC						.						57.0	59.0	58.0					6																	96996102		2202	4300	6502	SO:0001589	frameshift_variant	23376	exon13			.	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1465delC	6.37:g.96996102delC	ENSP00000358283:p.His489fs	45	0		35	17	NM_015323	0	0	0	0	0	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Frame_Shift_Del	DEL	ENST00000369278.4	37	CCDS5034.1																																																																																			.		0.308	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041557.1	NM_015323	
CLIP2	7461	broad.mit.edu	37	7	73790237	73790239	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:73790237_73790239delGTC	ENST00000395060.1	+	9	1506_1508	c.1506_1508delGTC	c.(1504-1509)aagtcg>aag	p.S503del	CLIP2_ENST00000361545.5_In_Frame_Del_p.S468del|CLIP2_ENST00000223398.6_In_Frame_Del_p.S503del			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	503						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TGGCCGAGAAGTCGCGCGTGCTG	0.67																																					p.502_503del													.	CLIP2-93	0			c.1506_1508del						.																																			SO:0001651	inframe_deletion	7461	exon10			CGAGAAGTCGCGC	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1506_1508delGTC	7.37:g.73790237_73790239delGTC	ENSP00000378500:p.Ser503del	18	0		14	5	NM_003388	0	0	0	0	0	O14527|O43611	In_Frame_Del	DEL	ENST00000395060.1	37	CCDS5569.1																																																																																			.		0.670	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	123211859	123211862	+	Frame_Shift_Del	DEL	AGAT	AGAT	-			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	AGAT	AGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chrX:123211859_123211862delAGAT	ENST00000371160.1	+	27	3016_3019	c.2726_2729delAGAT	c.(2725-2730)cagatafs	p.QI909fs	STAG2_ENST00000354548.5_Frame_Shift_Del_p.QI840fs|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371145.3_Frame_Shift_Del_p.QI909fs|STAG2_ENST00000218089.9_Frame_Shift_Del_p.QI909fs|STAG2_ENST00000371157.3_Frame_Shift_Del_p.QI909fs|STAG2_ENST00000371144.3_Frame_Shift_Del_p.QI909fs	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	909					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AAAACAAGGCAGATAGACAAAATT	0.314																																					p.909_910del		.											.	STAG2-134	0			c.2726_2729del						.																																			SO:0001589	frameshift_variant	10735	exon27			.	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2726_2729delAGAT	X.37:g.123211859_123211862delAGAT	ENSP00000360202:p.Gln909fs	69	0		58	45	NM_001042749	0	0	0	0	0	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	37	CCDS14607.1																																																																																			.		0.314	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
LGR4	55366	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	27412675	27412676	+	In_Frame_Ins	INS	-	-	AAG			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr11:27412675_27412676insAAG	ENST00000379214.4	-	4	809_810	c.366_367insCTT	c.(364-369)agtgaa>agtCTTgaa	p.122_123SE>SLE	LGR4_ENST00000389858.4_In_Frame_Ins_p.98_99SE>SLE|LGR4_ENST00000480977.2_Intron	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	122					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						CGAATGGCTTCACTGGGTACTG	0.366																																					p.E123delinsLE		.											.	LGR4-91	0			c.367_368insCTT						.																																			SO:0001652	inframe_insertion	55366	exon4			.	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.366_367insCTT	11.37:g.27412675_27412676insAAG	ENSP00000368516:p.Ser122_Glu123insLeu	85	0		82	21	NM_018490	0	0	0	0	0	A6NCH3|G5E9B3|Q8N537|Q9NYD1	In_Frame_Ins	INS	ENST00000379214.4	37	CCDS31449.1																																																																																			.		0.366	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
AP1G1	164	broad.mit.edu	37	16	71768532	71768533	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr16:71768532_71768533insA	ENST00000299980.4	-	22	2787_2788	c.2346_2347insT	c.(2344-2349)attaaafs	p.K783fs	AP1G1_ENST00000564155.1_Frame_Shift_Ins_p.K208fs|AP1G1_ENST00000423132.2_Frame_Shift_Ins_p.K786fs|AP1G1_ENST00000433195.2_Frame_Shift_Ins_p.K806fs|AP1G1_ENST00000569748.1_Frame_Shift_Ins_p.K783fs|AP1G1_ENST00000393512.3_Frame_Shift_Ins_p.K786fs	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	783	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TTCAGAACTTTAATGACTTGTG	0.45																																					p.K786_V787delinsX													.	AP1G1-92	0			c.2356_2357insT						.																																			SO:0001589	frameshift_variant	164	exon23			GAACTTTAATGAC	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2347dupT	16.37:g.71768534_71768534dupA	ENSP00000299980:p.Lys783fs	465	0		477	7	NM_001030007	0	0	0	0	0	O75709|O75842|Q9UG09|Q9Y3U4	Nonsense_Mutation	INS	ENST00000299980.4	37	CCDS32480.1																																																																																			.		0.450	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
OTOF	9381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	26693573	26693574	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:26693573_26693574insC	ENST00000272371.2	-	32	4036_4037	c.3910_3911insG	c.(3910-3912)gagfs	p.E1304fs	OTOF_ENST00000403946.3_Frame_Shift_Ins_p.E1304fs|OTOF_ENST00000339598.3_Frame_Shift_Ins_p.E537fs|OTOF_ENST00000338581.6_Frame_Shift_Ins_p.E537fs|OTOF_ENST00000402415.3_Frame_Shift_Ins_p.E614fs	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1304	Poly-Lys.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					cttcttcttctccttctcctcc	0.584																																					p.E1304fs	GBM(102;732 1451 20652 24062 31372)	.											.	OTOF-135	0			c.3911_3912insG						.																																			SO:0001589	frameshift_variant	9381	exon32			.	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3911dupG	2.37:g.26693575_26693575dupC	ENSP00000272371:p.Glu1304fs	76	0		84	14	NM_194248	0	0	0	0	0	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Frame_Shift_Ins	INS	ENST00000272371.2	37	CCDS1725.1																																																																																			.		0.584	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
GALNT5	11227	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	158115698	158115699	+	Frame_Shift_Ins	INS	-	-	T	rs141648249		TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr2:158115698_158115699insT	ENST00000259056.4	+	1	1589_1590	c.1104_1105insT	c.(1105-1107)tctfs	p.S369fs		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	369					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						AGATGTCTTCCTCTTCACTTGC	0.416																																					p.S368fs		.											.	GALNT5-290	0			c.1104_1105insT						.																																			SO:0001589	frameshift_variant	11227	exon1			.	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1105dupT	2.37:g.158115699_158115699dupT	ENSP00000259056:p.Ser369fs	186	0		147	49	NM_014568	0	0	0	0	0	A5PKZ1|Q9UGK7|Q9UHL6	Frame_Shift_Ins	INS	ENST00000259056.4	37	CCDS2203.1																																																																																			.		0.416	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
TGIF2	60436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	35219568	35219569	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr20:35219568_35219569insA	ENST00000373874.2	+	3	647_648	c.448_449insA	c.(448-450)gagfs	p.E150fs	RP5-977B1.11_ENST00000561134.1_RNA|TGIF2_ENST00000373872.4_Frame_Shift_Ins_p.E150fs|TGIF2-C20orf24_ENST00000558530.1_Intron	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	150	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CCCACGTGGGGAGCTGGAGTCT	0.629																																					p.E150fs		.											.	TGIF2-92	0			c.448_449insA						.																																			SO:0001589	frameshift_variant	60436	exon3			.	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.449dupA	20.37:g.35219569_35219569dupA	ENSP00000362981:p.Glu150fs	101	0		104	42	NM_021809	0	0	0	0	0	B2R9U3|E1P5T9|H0YNI0	Frame_Shift_Ins	INS	ENST00000373874.2	37	CCDS13278.1																																																																																			.		0.629	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	
ADAM29	11086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	175898831	175898832	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:175898831_175898832insA	ENST00000359240.3	+	5	2825_2826	c.2155_2156insA	c.(2155-2157)gaafs	p.E719fs	ADAM29_ENST00000445694.1_Frame_Shift_Ins_p.E719fs|ADAM29_ENST00000404450.4_Frame_Shift_Ins_p.E719fs|ADAM29_ENST00000514159.1_Frame_Shift_Ins_p.E719fs|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	719					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E719K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AAAAGAAGAGGAAAAAATTCAG	0.406																																					p.E719fs	Ovarian(140;1727 1835 21805 25838 41440)	.											.	ADAM29-729	1	Substitution - Missense(1)	NS(1)	c.2155_2156insA						.																																			SO:0001589	frameshift_variant	11086	exon4			.	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2161dupA	4.37:g.175898837_175898837dupA	ENSP00000352177:p.Glu719fs	101	0		73	46	NM_001130703	0	0	0	0	0	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Frame_Shift_Ins	INS	ENST00000359240.3	37	CCDS3823.1																																																																																			.		0.406	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	80160742	80160743	+	Frame_Shift_Ins	INS	-	-	GAAA			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr5:80160742_80160743insGAAA	ENST00000265081.6	+	22	3191_3192	c.3111_3112insGAAA	c.(3112-3114)gaafs	p.-1038fs		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		TCAGTGAGGATGAAAGCAAACT	0.396								Mismatch excision repair (MMR)																													p.D1037fs	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.3111_3112insGAAA						.																																			SO:0001589	frameshift_variant	4437	exon22			.	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.3112_3115dupGAAA	5.37:g.80160743_80160746dupGAAA	ENSP00000265081:p.Glu1038fs	143	0		171	38	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Frame_Shift_Ins	INS	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.396	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
TNRC18	84629	broad.mit.edu	37	7	5396802	5396803	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr7:5396802_5396803insG	ENST00000430969.1	-	16	5286_5287	c.4938_4939insC	c.(4936-4941)ttcaagfs	p.K1647fs	TNRC18_ENST00000399537.4_Frame_Shift_Ins_p.K1647fs	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1647							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TCCGAAAACTTGAAGGGCGACT	0.559																																					p.K1647fs													.	TNRC18-46	0			c.4939_4940insC						.																																			SO:0001589	frameshift_variant	84629	exon16			AAAACTTGAAGGG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4939dupC	7.37:g.5396803_5396803dupG	ENSP00000395538:p.Lys1647fs	15	0		13	6	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Frame_Shift_Ins	INS	ENST00000430969.1	37	CCDS47534.1																																																																																			.		0.559	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
NCOA2	10499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	71039066	71039067	+	Frame_Shift_Ins	INS	-	-	AAAC			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr8:71039066_71039067insAAAC	ENST00000452400.2	-	19	4078_4079	c.3897_3898insGTTT	c.(3895-3900)tttccafs	p.P1300fs	NCOA2_ENST00000267974.4_Frame_Shift_Ins_p.P388fs	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1300					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GGAGGAAATGGAAACTGCTGTG	0.53			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P1300fs		.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2-639	0			c.3898_3899insGTTT						.																																			SO:0001589	frameshift_variant	10499	exon19			.	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3894_3897dupGTTT	8.37:g.71039067_71039070dupAAAC	ENSP00000399968:p.Pro1300fs	43	0		50	11	NM_006540	0	0	0	0	0	Q14CD2	Frame_Shift_Ins	INS	ENST00000452400.2	37	CCDS47872.1																																																																																			.		0.530	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
MRPL1	65008	hgsc.bcm.edu	37	4	78804410	78804411	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr4:78804410_78804411CA>AC	ENST00000315567.8	+	3	487_488	c.158_159CA>AC	c.(157-159)aCA>aAC	p.T53N	MRPL1_ENST00000506674.1_3'UTR	NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	53					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						GCAAAGAAAACAAAAAAAGGTG	0.282																																					p.T53N		.											.	MRPL1	0			c.A159C						.																																			SO:0001583	missense	65008	exon3			GAAAACAAAAAAA	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	Exception_encountered	4.37:g.78804410_78804411delinsAC	ENSP00000315017:p.Thr53Asn	29.0	0.0		24.0	2.0		0	0	0	0	0	A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Missense_Mutation	DNP	ENST00000315567.8	37	CCDS3583.2																																																																																			.		0.282	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236	
KRTAP4-16P	85354	bcgsc.ca	37	17	39258290	39258291	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-A4-8098-01A-11D-2396-08	TCGA-A4-8098-10A-01D-2396-08	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9c049bb8-3842-44e4-9961-ea59a3f347de	aea72058-4351-46a9-a314-5d54f681d649	g.chr17:39258290_39258291AC>TT	ENST00000440582.1	-	1	170_171	c.171_172GT>AA	c.(169-174)gtGTgc>gtAAgc	p.C58S						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						GGCTGGCAGCACACGGAATGGC	0.653																																					p.C58S													.	.	0			.						.																																			SO:0001583	missense	0	.			GCAGCACACGGAA	AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.171_172delinsTT	17.37:g.39258290_39258291delinsTT	ENSP00000411198:p.Cys58Ser	82	0		75	24	.	0	0	0	0	0		Missense_Mutation	DNP	ENST00000440582.1	37																																																																																				.		0.653	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257694.1	NG_005311	
