#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NBPF1	55672	broad.mit.edu	37	1	16907371	16907371	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:16907371C>T	ENST00000430580.2	-	16	2347	c.1460G>A	c.(1459-1461)gGc>gAc	p.G487D	NBPF1_ENST00000432949.1_5'Flank	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	487	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.			G -> S (in Ref. 2; BAB21784). {ECO:0000305}.		cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTCACAAGGGCCGTGGCTATT	0.498																																					.													.	.	0			.						.						470.0	486.0	481.0					1																	16907371		2203	4298	6501	SO:0001583	missense	55672	.			CAAGGGCCGTGGC	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.1460G>A	1.37:g.16907371C>T	ENSP00000474456:p.Gly487Asp	2426	1		2347	68	.	0	0	90	94	4	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37																																																																																				.		0.498	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	
UBXN11	91544	bcgsc.ca	37	1	26608825	26608825	+	Missense_Mutation	SNP	T	T	C	rs66614970		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:26608825T>C	ENST00000374222.1	-	16	1992	c.1528A>G	c.(1528-1530)Agt>Ggt	p.S510G	UBXN11_ENST00000374217.2_Missense_Mutation_p.S477G|UBXN11_ENST00000374223.1_Missense_Mutation_p.S267G|UBXN11_ENST00000374221.3_Missense_Mutation_p.S510G|UBXN11_ENST00000357089.4_Missense_Mutation_p.S477G|UBXN11_ENST00000314675.7_Missense_Mutation_p.S390G			Q5T124	UBX11_HUMAN	UBX domain protein 11	510	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggacagggactggggccggga	0.716																																					p.S510G													.	UBXN11-91	1	Deletion - In frame(1)	ovary(1)	c.A1528G						.						15.0	18.0	17.0					1																	26608825		1744	3959	5703	SO:0001583	missense	91544	exon16			AGGGACTGGGGCC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1528A>G	1.37:g.26608825T>C	ENSP00000363339:p.Ser510Gly	69	1		87	6	NM_183008	0	0	0	0	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	.	.	.	.	.	.	.	.	.	.	-	2.154	-0.393781	0.04899	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.18502	2.21;2.22;2.49;2.48;2.48;2.49	.	.	.	.	435.379000	0.00994	U	0.003579	T	0.07007	0.0178	N	0.02539	-0.55	0.18873	N	0.999985	.	.	.	.	.	.	T	0.21690	-1.0238	6	0.42905	T	0.14	.	.	.	.	.	477;390;510	Q5T124-2;Q5T124-3;Q5T124	.;.;UBX11_HUMAN	G	390;267;477;510;510;477	ENSP00000324721:S390G;ENSP00000363340:S267G;ENSP00000349601:S477G;ENSP00000363338:S510G;ENSP00000363339:S510G;ENSP00000363334:S477G	ENSP00000324721:S390G	S	-	1	0	UBXN11	26481412	0.000000	0.05858	0.130000	0.21974	0.142000	0.21351	-0.966000	0.03825	0.056000	0.16144	0.055000	0.15244	AGT	.		0.716	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ANGPTL3	27329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	63066787	63066787	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:63066787T>A	ENST00000371129.3	+	3	721	c.641T>A	c.(640-642)aTt>aAt	p.I214N	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000340370.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	214					acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						CCCACAGAAATTTCTCTATCT	0.338																																					p.K214K		.											.	ANGPTL3-130	0			c.A641A						.						92.0	90.0	91.0					1																	63066787		2203	4298	6501	SO:0001583	missense	27329	exon3			CAGAAATTTCTCT	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.641T>A	1.37:g.63066787T>A	ENSP00000360170:p.Ile214Asn	142	0		128	18	NM_014495	0	0	1	6	5	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	37	CCDS622.1	.	.	.	.	.	.	.	.	.	.	T	6.726	0.502609	0.12822	.	.	ENSG00000132855	ENST00000371129	T	0.62498	0.02	5.36	-1.93	0.07594	.	1.409980	0.04232	N	0.335475	T	0.09555	0.0235	N	0.01576	-0.805	0.20764	N	0.999851	B	0.02656	0.0	B	0.01281	0.0	T	0.04413	-1.0953	10	0.17369	T	0.5	.	1.6612	0.02792	0.3425:0.1379:0.0856:0.4341	.	214	Q9Y5C1	ANGL3_HUMAN	N	214	ENSP00000360170:I214N	ENSP00000360170:I214N	I	+	2	0	ANGPTL3	62839375	0.740000	0.28207	0.994000	0.49952	0.801000	0.45260	0.181000	0.16880	-0.002000	0.14469	-0.649000	0.03915	ATT	.		0.338	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145562384	145562384	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:145562384G>C	ENST00000355594.4	+	10	2159	c.2072G>C	c.(2071-2073)cGg>cCg	p.R691P		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	691										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGAAGCTGCGGAAGCTCCTG	0.632																																					p.R691P	Melanoma(9;127 754 22988 51047)	.											.	ANKRD35-95	0			c.G2072C						.						33.0	38.0	36.0					1																	145562384		2203	4300	6503	SO:0001583	missense	148741	exon10			AGCTGCGGAAGCT	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2072G>C	1.37:g.145562384G>C	ENSP00000347802:p.Arg691Pro	61	0		49	7	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.376931	0.42105	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.57107	0.42	4.97	4.06	0.47325	.	0.000000	0.45361	D	0.000361	T	0.42675	0.1213	M	0.70595	2.14	0.80722	D	1	P	0.49862	0.929	P	0.46510	0.519	T	0.48186	-0.9057	10	0.52906	T	0.07	-21.9317	9.1164	0.36760	0.0988:0.0:0.9012:0.0	.	691	Q8N283	ANR35_HUMAN	P	600;691	ENSP00000347802:R691P	ENSP00000347802:R691P	R	+	2	0	ANKRD35	144273741	0.998000	0.40836	0.991000	0.47740	0.842000	0.47809	4.005000	0.57075	1.319000	0.45190	0.563000	0.77884	CGG	.		0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
ATP1B1	481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169094257	169094257	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:169094257T>G	ENST00000367816.1	+	4	891	c.362T>G	c.(361-363)aTg>aGg	p.M121R	ATP1B1_ENST00000367813.3_Missense_Mutation_p.M113R|ATP1B1_ENST00000367815.4_Missense_Mutation_p.M121R|ATP1B1_ENST00000499679.3_Missense_Mutation_p.M65R			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	121					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					AGGGATGACATGATTTTTGAA	0.373																																					p.M121R		.											.	ATP1B1-540	0			c.T362G						.						170.0	167.0	168.0					1																	169094257		2203	4300	6503	SO:0001583	missense	481	exon3			ATGACATGATTTT	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.362T>G	1.37:g.169094257T>G	ENSP00000356790:p.Met121Arg	302	0		320	60	NM_001677	1	0	266	602	335	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	37	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	T	4.424	0.078374	0.08533	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.28255	1.63;1.63;1.62;1.63	5.57	5.57	0.84162	.	0.083753	0.85682	D	0.000000	T	0.12732	0.0309	L	0.54323	1.7	0.43830	D	0.996406	B	0.28233	0.204	B	0.24269	0.052	T	0.09037	-1.0693	9	0.15952	T	0.53	-21.6982	10.9096	0.47101	0.14:0.0:0.0:0.86	.	121	P05026	AT1B1_HUMAN	R	121;121;65;113	ENSP00000356790:M121R;ENSP00000356789:M121R;ENSP00000423450:M65R;ENSP00000356787:M113R	ENSP00000356787:M113R	M	+	2	0	ATP1B1	167360881	0.023000	0.18921	1.000000	0.80357	0.432000	0.31715	1.328000	0.33758	2.114000	0.64651	0.533000	0.62120	ATG	.		0.373	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
AGT	183	hgsc.bcm.edu;broad.mit.edu	37	1	230845905	230845905	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:230845905G>T	ENST00000366667.4	-	2	906	c.692C>A	c.(691-693)aCc>aAc	p.T231N	RP11-99J16__A.2_ENST00000412344.1_RNA	NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	231					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GACCACAGGGGTATAGAGAGC	0.597																																					p.T231N		.											.	AGT-226	0			c.C692A						.						70.0	71.0	70.0					1																	230845905		2203	4300	6503	SO:0001583	missense	183	exon2			ACAGGGGTATAGA	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.692C>A	1.37:g.230845905G>T	ENSP00000355627:p.Thr231Asn	119	2		95	11	NM_000029	0	0	3	6	3	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	37	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	G	6.198	0.404694	0.11754	.	.	ENSG00000135744	ENST00000366667	D	0.84370	-1.84	5.01	4.07	0.47477	Serpin domain (3);	0.366568	0.30401	N	0.009708	T	0.77765	0.4179	L	0.40543	1.245	0.09310	N	1	B;B;B	0.30664	0.289;0.111;0.289	B;B;B	0.29785	0.107;0.069;0.107	T	0.64833	-0.6314	10	0.27082	T	0.32	.	11.3331	0.49487	0.0:0.1372:0.7205:0.1423	.	231;231;231	B0ZBE2;B2R5S1;P01019	.;.;ANGT_HUMAN	N	231	ENSP00000355627:T231N	ENSP00000355627:T231N	T	-	2	0	AGT	228912528	0.716000	0.27956	0.008000	0.14137	0.017000	0.09413	4.528000	0.60580	1.191000	0.43056	0.591000	0.81541	ACC	.		0.597	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	
ARID4B	51742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235386544	235386544	+	Silent	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr1:235386544T>C	ENST00000264183.3	-	13	1499	c.1002A>G	c.(1000-1002)ggA>ggG	p.G334G	ARID4B_ENST00000349213.3_Silent_p.G334G|ARID4B_ENST00000366603.2_Silent_p.G334G	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	334	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.|Glu-rich.				histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			AATTTCGATATCCAAGTACAG	0.299																																					p.G334G		.											.	ARID4B-228	0			c.A1002G						.						106.0	100.0	102.0					1																	235386544		2203	4298	6501	SO:0001819	synonymous_variant	51742	exon13			TCGATATCCAAGT	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1002A>G	1.37:g.235386544T>C		48	0		42	6	NM_016374	0	0	2	2	0	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	ENST00000264183.3	37	CCDS31061.1																																																																																			.		0.299	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
ENTPD7	57089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101458575	101458575	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr10:101458575G>C	ENST00000370489.4	+	10	1473	c.1295G>C	c.(1294-1296)gGt>gCt	p.G432A		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	432						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		TTGCGCATTGGTGGCCGCTAC	0.438																																					p.G432A		.											.	ENTPD7-91	0			c.G1295C						.						58.0	57.0	57.0					10																	101458575		2203	4300	6503	SO:0001583	missense	57089	exon10			GCATTGGTGGCCG	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.1295G>C	10.37:g.101458575G>C	ENSP00000359520:p.Gly432Ala	83	0		69	12	NM_020354	0	0	3	9	6	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310593	0.81358	.	.	ENSG00000198018	ENST00000370489	T	0.12879	2.64	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	M	0.71036	2.16	0.80722	D	1	D	0.60575	0.988	D	0.70935	0.971	T	0.03278	-1.1053	10	0.37606	T	0.19	-17.123	18.3825	0.90455	0.0:0.0:1.0:0.0	.	432	Q9NQZ7	ENTP7_HUMAN	A	432	ENSP00000359520:G432A	ENSP00000359520:G432A	G	+	2	0	ENTPD7	101448565	1.000000	0.71417	0.982000	0.44146	0.720000	0.41350	9.578000	0.98200	2.583000	0.87209	0.655000	0.94253	GGT	.		0.438	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354	
NFKB2	4791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104156717	104156717	+	Silent	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr10:104156717C>T	ENST00000369966.3	+	6	550	c.300C>T	c.(298-300)gaC>gaT	p.D100D	NFKB2_ENST00000428099.1_Silent_p.D100D|NFKB2_ENST00000189444.6_Silent_p.D100D	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	100	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CACACAGTGACCCACCTCGTG	0.597			T	IGH@	B-NHL																																p.D100D		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.C300T						.						78.0	84.0	82.0					10																	104156717		2080	4213	6293	SO:0001819	synonymous_variant	4791	exon6			CAGTGACCCACCT	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.300C>T	10.37:g.104156717C>T		53	0		54	7	NM_001077494	0	0	19	35	16	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			.		0.597	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
MUC2	4583	hgsc.bcm.edu	37	11	1092643	1092643	+	Missense_Mutation	SNP	A	A	C	rs149562922		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:1092643A>C	ENST00000441003.2	+	30	4489	c.4462A>C	c.(4462-4464)Aca>Cca	p.T1488P	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1489P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4223	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caGCCCTCCAACAaccaccac	0.627																																					p.T1488P		.											.	MUC2-90	0			c.A4462C						.						302.0	443.0	394.0					11																	1092643		1680	3118	4798	SO:0001583	missense	4583	exon30			CCTCCAACAACCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4462A>C	11.37:g.1092643A>C	ENSP00000415183:p.Thr1488Pro	1	0		16	6	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	-	3.842	-0.033557	0.07543	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.41;2.38	1.28	1.28	0.21552	.	0.642730	0.11935	U	0.515356	T	0.27063	0.0663	.	.	.	0.09310	N	0.999998	D	0.64830	0.994	P	0.62885	0.908	T	0.12344	-1.0551	9	0.30078	T	0.28	.	6.6385	0.22897	1.0:0.0:0.0:0.0	.	1488	E7EUV1	.	P	1488;1489	ENSP00000415183:T1488P;ENSP00000351956:T1489P	ENSP00000351956:T1489P	T	+	1	0	MUC2	1082643	0.000000	0.05858	0.005000	0.12908	0.000000	0.00434	-2.044000	0.01411	0.654000	0.30846	0.000000	0.15137	ACA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092795	1092795	+	Silent	SNP	T	T	A	rs12786761		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:1092795T>A	ENST00000441003.2	+	30	4641	c.4614T>A	c.(4612-4614)acT>acA	p.T1538T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1539T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caaccaccactcccatcacca	0.627																																					p.T1538T		.											.	MUC2-90	0			c.T4614A						.						126.0	251.0	206.0					11																	1092795		1606	2836	4442	SO:0001819	synonymous_variant	4583	exon30			CACCACTCCCATC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4614T>A	11.37:g.1092795T>A		0	0		5	4	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51T1	401665	hgsc.bcm.edu;broad.mit.edu	37	11	4904096	4904096	+	Silent	SNP	A	A	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:4904096A>C	ENST00000322049.1	+	1	967	c.967A>C	c.(967-969)Agg>Cgg	p.R323R	OR51T1_ENST00000380378.1_Silent_p.R350R|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	323						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGGGGTCTTAGGGGAAGATG	0.468																																					p.R350R		.											.	OR51T1-115	0			c.A1048C						.						56.0	56.0	56.0					11																	4904096		2201	4298	6499	SO:0001819	synonymous_variant	401665	exon1			GGTCTTAGGGGAA	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.967A>C	11.37:g.4904096A>C		110	0		116	12	NM_001004759	0	0	0	0	0	Q6IFH9	Silent	SNP	ENST00000322049.1	37																																																																																				.		0.468	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
CCKBR	887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6291417	6291417	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:6291417G>A	ENST00000334619.2	+	3	696	c.503G>A	c.(502-504)cGc>cAc	p.R168H	CCKBR_ENST00000525462.1_Missense_Mutation_p.R168H|CCKBR_ENST00000532715.1_Missense_Mutation_p.R84H|CCKBR_ENST00000525014.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	168					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TGGCAGACGCGCTCCCACGCG	0.647																																					p.R168H		.											.	CCKBR-574	0			c.G503A						.						46.0	38.0	41.0					11																	6291417		2197	4290	6487	SO:0001583	missense	887	exon3			AGACGCGCTCCCA	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.503G>A	11.37:g.6291417G>A	ENSP00000335544:p.Arg168His	52	0		51	11	NM_176875	0	0	0	0	0	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371373	0.82573	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.72725	-0.68;-0.68;-0.68	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84197	0.5419	M	0.88377	2.95	0.51012	D	0.999906	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.75020	0.937;0.975;0.985	D	0.85468	0.1171	10	0.52906	T	0.07	.	10.2312	0.43256	0.0916:0.0:0.9084:0.0	.	168;102;168	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	H	168;84;168	ENSP00000335544:R168H;ENSP00000432079:R84H;ENSP00000435534:R168H	ENSP00000335544:R168H	R	+	2	0	CCKBR	6247993	0.101000	0.21875	1.000000	0.80357	0.942000	0.58702	2.571000	0.45990	2.505000	0.84491	0.655000	0.94253	CGC	.		0.647	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
MAPK8IP1	9479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	45926284	45926284	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:45926284C>T	ENST00000241014.2	+	9	1962	c.1792C>T	c.(1792-1794)Cgg>Tgg	p.R598W	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.R588W|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	598	Interaction with VRK2.|PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		CACCACCCGCCGGCTCACCGT	0.612																																					p.R598W		.											.	MAPK8IP1-973	0			c.C1792T						.						77.0	80.0	79.0					11																	45926284		2203	4299	6502	SO:0001583	missense	9479	exon9			ACCCGCCGGCTCA		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1792C>T	11.37:g.45926284C>T	ENSP00000241014:p.Arg598Trp	149	0		116	21	NM_005456	0	0	7	14	7	D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560899	0.86335	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.14766	2.48;2.48	5.84	4.87	0.63330	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.056704	0.64402	D	0.000002	T	0.35653	0.0939	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03503	-1.1030	10	0.87932	D	0	-26.4988	16.4247	0.83810	0.0:0.8687:0.1313:0.0	.	598	Q9UQF2	JIP1_HUMAN	W	598;588	ENSP00000241014:R598W;ENSP00000378991:R588W	ENSP00000241014:R598W	R	+	1	2	MAPK8IP1	45882860	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.985000	0.29578	2.768000	0.95171	0.561000	0.74099	CGG	.		0.612	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
MADD	8567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47345285	47345285	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:47345285G>C	ENST00000311027.5	+	31	4606	c.4441G>C	c.(4441-4443)Gag>Cag	p.E1481Q	MADD_ENST00000407859.3_Missense_Mutation_p.E1399Q|MADD_ENST00000402192.2_Missense_Mutation_p.E1421Q|MADD_ENST00000349238.3_Missense_Mutation_p.E1442Q|MADD_ENST00000342922.4_Missense_Mutation_p.E1422Q|MADD_ENST00000406482.1_Missense_Mutation_p.E1379Q|MADD_ENST00000402799.1_Missense_Mutation_p.E1379Q|MADD_ENST00000405573.2_Missense_Mutation_p.E291Q|MADD_ENST00000395336.3_Missense_Mutation_p.E1481Q|MADD_ENST00000395344.3_Missense_Mutation_p.E1375Q	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CTGGTGGTACGAGAAGCTCAT	0.498																																					p.E1481Q		.											.	MADD-682	0			c.G4441C						.						223.0	167.0	186.0					11																	47345285		2201	4298	6499	SO:0001583	missense	8567	exon31			TGGTACGAGAAGC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4441G>C	11.37:g.47345285G>C	ENSP00000310933:p.Glu1481Gln	88	0		96	18	NM_130475	0	0	23	27	4		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	G	33	5.270702	0.95429	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.57436	2.85;2.72;2.75;2.83;2.86;2.72;2.72;2.87;2.85;0.4	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	L	0.53561	1.675	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.998;0.998;0.999;0.999;0.999;0.999;0.999;0.998;0.997;0.998	T	0.71724	-0.4506	10	0.87932	D	0	-24.9261	19.903	0.96995	0.0:0.0:1.0:0.0	.	291;1375;1375;1481;1379;1379;1379;1442;1399;1481;1422	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	Q	1422;1379;1379;1379;1442;1481;1399;1375;1481;1421;291	ENSP00000343902:E1422Q;ENSP00000385585:E1379Q;ENSP00000384435:E1379Q;ENSP00000304505:E1442Q;ENSP00000310933:E1481Q;ENSP00000384204:E1399Q;ENSP00000378753:E1375Q;ENSP00000378745:E1481Q;ENSP00000384287:E1421Q;ENSP00000384483:E291Q	ENSP00000310933:E1481Q	E	+	1	0	MADD	47301861	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	8.947000	0.93000	2.705000	0.92388	0.549000	0.68633	GAG	.		0.498	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
SLC22A10	387775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63064875	63064875	+	Missense_Mutation	SNP	C	C	T	rs200183991		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:63064875C>T	ENST00000332793.6	+	3	609	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000535888.1_5'UTR|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Missense_Mutation_p.R48C	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	203						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CTGTGTACTACGCTTCTTGGC	0.408																																					p.R203C		.											.	SLC22A10-92	0			c.C607T						.	C	CYS/ARG	2,4092		0,2,2045	170.0	169.0	169.0		607	2.3	0.3	11		169	0,8428		0,0,4214	yes	missense	SLC22A10	NM_001039752.3	180	0,2,6259	TT,TC,CC		0.0,0.0489,0.016	probably-damaging	203/542	63064875	2,12520	2047	4214	6261	SO:0001583	missense	387775	exon3			GTACTACGCTTCT	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.607C>T	11.37:g.63064875C>T	ENSP00000327569:p.Arg203Cys	217	0		232	31	NM_001039752	0	0	0	0	0	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306314	0.60305	4.89E-4	0.0	ENSG00000184999	ENST00000544661;ENST00000332793	D;D	0.90261	-2.64;-2.64	3.26	2.34	0.29019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.066213	0.64402	N	0.000009	D	0.93341	0.7877	M	0.92077	3.27	0.80722	D	1	P	0.50819	0.939	P	0.50352	0.638	D	0.92539	0.6040	10	0.72032	D	0.01	.	8.4548	0.32893	0.0:0.8776:0.0:0.1224	.	203	Q63ZE4	S22AA_HUMAN	C	48;203	ENSP00000445667:R48C;ENSP00000327569:R203C	ENSP00000327569:R203C	R	+	1	0	SLC22A10	62821451	0.772000	0.28567	0.265000	0.24526	0.132000	0.20833	1.238000	0.32707	0.751000	0.32900	0.447000	0.29281	CGC	.		0.408	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
MALAT1	378938	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65266413	65266413	+	lincRNA	SNP	G	G	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:65266413G>T	ENST00000534336.1	+	0	1181				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTTAACCGAAGAACTACTTTT	0.413																																					.													.	.	0			.						.						90.0	94.0	93.0					11																	65266413		874	1988	2862			378938	.			ACCGAAGAACTAC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266413G>T		101	0		110	19	.	0	0	0	0	0		RNA	SNP	ENST00000534336.1	37																																																																																				.		0.413	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
NUMA1	4926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71724282	71724282	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:71724282C>T	ENST00000393695.3	-	15	4598	c.4267G>A	c.(4267-4269)Gct>Act	p.A1423T	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.A1423T|NUMA1_ENST00000351960.6_Intron	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						AGCTGCTGAGCTGTTCGCTCC	0.672			T	RARA	APL																																p.A1423T		.		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	NUMA1-633	0			c.G4267A						.						46.0	48.0	47.0					11																	71724282		2200	4293	6493	SO:0001583	missense	4926	exon15			GCTGAGCTGTTCG	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.4267G>A	11.37:g.71724282C>T	ENSP00000377298:p.Ala1423Thr	119	0		123	25	NM_006185	0	0	60	107	47		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231361	0.39399	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T	0.13307	2.6;2.6	5.14	4.23	0.50019	.	0.000000	0.53938	D	0.000051	T	0.06645	0.0170	N	0.14661	0.345	0.20563	N	0.999885	P;B;B;P	0.39480	0.675;0.447;0.241;0.675	B;B;B;B	0.35550	0.205;0.148;0.148;0.205	T	0.25779	-1.0122	10	0.33940	T	0.23	.	5.9903	0.19456	0.1541:0.6873:0.0:0.1586	.	1429;907;1423;1423	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	T	1423;1423;986;392	ENSP00000351851:A1423T;ENSP00000377298:A1423T	ENSP00000351851:A1423T	A	-	1	0	NUMA1	71401930	0.000000	0.05858	0.838000	0.33150	0.876000	0.50452	-0.321000	0.08018	1.391000	0.46566	0.655000	0.94253	GCT	.		0.672	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
INPPL1	3636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71948376	71948376	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:71948376C>T	ENST00000298229.2	+	26	3292	c.3088C>T	c.(3088-3090)Cgg>Tgg	p.R1030W	INPPL1_ENST00000538751.1_Missense_Mutation_p.R788W|INPPL1_ENST00000541756.1_Missense_Mutation_p.R788W|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1030	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TGGGCACCACCGGCACCCTCG	0.642																																					p.R1030W		.											.	INPPL1-660	0			c.C3088T						.						70.0	76.0	74.0					11																	71948376		2200	4293	6493	SO:0001583	missense	3636	exon26			CACCACCGGCACC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3088C>T	11.37:g.71948376C>T	ENSP00000298229:p.Arg1030Trp	174	1		134	25	NM_001567	0	0	73	105	32	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	N	8.924	0.961831	0.18583	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751;ENST00000541752	D;D;D;T	0.96685	-2.99;-4.09;-4.09;1.34	5.22	2.26	0.28386	.	0.075539	0.52532	D	0.000068	D	0.89698	0.6790	N	0.14661	0.345	0.24350	N	0.994927	B	0.09022	0.002	B	0.01281	0.0	T	0.82568	-0.0392	10	0.66056	D	0.02	.	6.9513	0.24546	0.3121:0.6043:0.0:0.0835	.	1030	O15357	SHIP2_HUMAN	W	1030;788;788;43	ENSP00000298229:R1030W;ENSP00000446360:R788W;ENSP00000444619:R788W;ENSP00000441094:R43W	ENSP00000298229:R1030W	R	+	1	2	INPPL1	71626024	0.875000	0.30112	0.971000	0.41717	0.006000	0.05464	0.763000	0.26517	0.569000	0.29329	-0.217000	0.12591	CGG	.		0.642	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	73021440	73021440	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:73021440T>C	ENST00000263674.3	+	1	2107	c.1757T>C	c.(1756-1758)aTc>aCc	p.I586T	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	586					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CTGCCCCTCATCGTCCAGGAC	0.647																																					p.I586T		.											.	ARHGEF17-227	0			c.T1757C						.						48.0	50.0	49.0					11																	73021440		2200	4293	6493	SO:0001583	missense	9828	exon1			CCCTCATCGTCCA	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1757T>C	11.37:g.73021440T>C	ENSP00000263674:p.Ile586Thr	84	0		88	13	NM_014786	0	0	9	19	10	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	T	9.868	1.198064	0.22037	.	.	ENSG00000110237	ENST00000263674	T	0.55588	0.51	4.62	4.62	0.57501	.	1.144840	0.06515	N	0.738667	T	0.36608	0.0973	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.16722	0.016	T	0.20974	-1.0259	10	0.87932	D	0	-9.7864	9.3506	0.38136	0.0:0.0:0.1804:0.8196	.	586	Q96PE2	ARHGH_HUMAN	T	586	ENSP00000263674:I586T	ENSP00000263674:I586T	I	+	2	0	ARHGEF17	72699088	0.963000	0.33076	0.006000	0.13384	0.872000	0.50106	3.475000	0.53136	1.931000	0.55961	0.459000	0.35465	ATC	.		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
GDPD4	220032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76944148	76944148	+	Silent	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:76944148G>C	ENST00000376217.2	-	13	1561	c.1311C>G	c.(1309-1311)gcC>gcG	p.A437A	GDPD4_ENST00000315938.4_Silent_p.A437A			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	437	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TGGAGCACCAGGCCAGTGAGA	0.468																																					p.A437A		.											.	GDPD4-69	0			c.C1311G						.						168.0	146.0	153.0					11																	76944148		2200	4292	6492	SO:0001819	synonymous_variant	220032	exon13			GCACCAGGCCAGT	AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1311C>G	11.37:g.76944148G>C		83	0		87	9	NM_182833	0	0	0	0	0	Q7Z5B0	Silent	SNP	ENST00000376217.2	37																																																																																				.		0.468	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382075.1	NM_182833	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877690	82877690	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:82877690A>G	ENST00000298281.4	+	5	2203	c.1751A>G	c.(1750-1752)aAt>aGt	p.N584S		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	584					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CCAAAGGAGAATGTAGAAAAC	0.393																																					p.N584S		.											.	PCF11-23	0			c.A1751G						.						66.0	66.0	66.0					11																	82877690		1824	4044	5868	SO:0001583	missense	51585	exon5			AGGAGAATGTAGA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1751A>G	11.37:g.82877690A>G	ENSP00000298281:p.Asn584Ser	113	0		104	20	NM_015885	0	0	2	8	6	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172383	0.38315	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.50813	1.68;0.74;0.73	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000005	T	0.34483	0.0899	N	0.19112	0.55	0.29519	N	0.853609	P;P	0.43788	0.473;0.817	B;B	0.38500	0.091;0.275	T	0.25433	-1.0132	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	584;584	E9PQ01;O94913	.;PCF11_HUMAN	S	584	ENSP00000298281:N584S;ENSP00000434540:N584S;ENSP00000431567:N584S	.	N	+	2	0	PCF11	82555338	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	3.827000	0.55745	2.326000	0.78906	0.533000	0.62120	AAT	.		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
CASP4	837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	104825523	104825523	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:104825523C>T	ENST00000444739.2	-	2	1123	c.213G>A	c.(211-213)atG>atA	p.M71I	CASP4_ENST00000531333.1_5'UTR|CASP4_ENST00000393150.3_Missense_Mutation_p.M15I	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	71	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TTTGAAGAAGCATTTGTCCTG	0.353																																					p.M71I		.											.	CASP4-660	0			c.G213A						.						187.0	177.0	181.0					11																	104825523		2202	4299	6501	SO:0001583	missense	837	exon2			AAGAAGCATTTGT	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.213G>A	11.37:g.104825523C>T	ENSP00000388566:p.Met71Ile	222	0		224	37	NM_001225	0	0	33	50	17	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.174|0.174	-1.068340|-1.068340	0.01934|0.01934	.|.	.|.	ENSG00000196954|ENSG00000196954	ENST00000355546|ENST00000444739;ENST00000393150;ENST00000417440	.|T;T;T	.|0.18174	.|2.23;4.52;2.23	3.6|3.6	-1.75|-1.75	0.08031|0.08031	.|DEATH-like (2);Caspase Recruitment (3);	.|1.351520	.|0.05087	.|N	.|0.484541	T|T	0.06371|0.06371	0.0164|0.0164	N|N	0.12182|0.12182	0.205|0.205	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.11235	.|0.004;0.001;0.0	.|B;B;B	.|0.13407	.|0.009;0.004;0.002	T|T	0.26710|0.26710	-1.0095|-1.0095	6|10	0.02654|0.02654	T|T	1|1	.|.	0.1298|0.1298	0.00073|0.00073	0.3445:0.2198:0.1837:0.252|0.3445:0.2198:0.1837:0.252	.|.	.|71;71;71	.|B4DJH5;B4E2D2;P49662	.|.;.;CASP4_HUMAN	Y|I	25|71;15;71	.|ENSP00000388566:M71I;ENSP00000376857:M15I;ENSP00000401673:M71I	ENSP00000347741:C25Y|ENSP00000376857:M15I	C|M	-|-	2|3	0|0	CASP4|CASP4	104330733|104330733	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-2.136000|-2.136000	0.01305|0.01305	-0.231000|-0.231000	0.09825|0.09825	-0.150000|-0.150000	0.13652|0.13652	TGC|ATG	.		0.353	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
CLDN25	644672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113651037	113651037	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:113651037A>G	ENST00000453129.2	+	1	569	c.520A>G	c.(520-522)Att>Gtt	p.I174V		NM_001101389.1	NP_001094859.1	C9JDP6	CLD25_HUMAN	claudin 25	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			large_intestine(1)|lung(6)|ovary(1)|urinary_tract(2)	10						GGCTGCTGGTATTTTCCTGGC	0.557																																					p.I174V		.											.	.	0			c.A520G						.						88.0	93.0	92.0					11																	113651037		2014	4177	6191	SO:0001583	missense	644672	exon1			GCTGGTATTTTCC		CCDS44736.1	11q23.2	2009-09-22			ENSG00000228607	ENSG00000228607			37218	protein-coding gene	gene with protein product							Standard	NM_001101389		Approved		uc009yyw.1	C9JDP6	OTTHUMG00000168193	ENST00000453129.2:c.520A>G	11.37:g.113651037A>G	ENSP00000396304:p.Ile174Val	69	1		76	14	NM_001101389	0	0	0	0	0		Missense_Mutation	SNP	ENST00000453129.2	37	CCDS44736.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.253180	0.00268	.	.	ENSG00000228607	ENST00000453129	D	0.88896	-2.44	5.08	-10.2	0.00374	.	.	.	.	.	T	0.64427	0.2597	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.52442	-0.8575	9	0.06365	T	0.9	.	6.3055	0.21137	0.0807:0.1948:0.4667:0.2578	.	174	C9JDP6	CLD25_HUMAN	V	174	ENSP00000396304:I174V	ENSP00000396304:I174V	I	+	1	0	CLDN25	113156247	0.000000	0.05858	0.000000	0.03702	0.451000	0.32288	-1.048000	0.03517	-3.888000	0.00095	-0.925000	0.02716	ATT	.		0.557	CLDN25-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398706.1	NM_001101389	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2909578	2909578	+	Silent	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:2909578T>G	ENST00000001008.4	+	8	1054	c.867T>G	c.(865-867)gcT>gcG	p.A289A	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	289	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			ACAAGCAAGCTTTACTACAGT	0.483																																					p.A289A		.											.	FKBP4-226	0			c.T867G						.						76.0	69.0	71.0					12																	2909578		2203	4300	6503	SO:0001819	synonymous_variant	2288	exon8			GCAAGCTTTACTA	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.867T>G	12.37:g.2909578T>G		49	0		58	10	NM_002014	0	0	76	135	59	D3DUQ1|Q9UCP1|Q9UCV7	Silent	SNP	ENST00000001008.4	37	CCDS8512.1																																																																																			.		0.483	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
CHD4	1108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6707540	6707540	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:6707540G>A	ENST00000357008.2	-	11	1697	c.1534C>T	c.(1534-1536)Cag>Tag	p.Q512*	CHD4_ENST00000309577.6_Nonsense_Mutation_p.Q512*|CHD4_ENST00000544040.1_Nonsense_Mutation_p.Q505*|CHD4_ENST00000544484.1_Nonsense_Mutation_p.Q509*	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	512	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GATGGTGGCTGACCCCACTTC	0.547																																					p.Q512X	Colon(32;586 792 4568 16848 45314)	.											.	CHD4-228	0			c.C1534T						.						137.0	140.0	139.0					12																	6707540		2203	4300	6503	SO:0001587	stop_gained	1108	exon11			GTGGCTGACCCCA	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1534C>T	12.37:g.6707540G>A	ENSP00000349508:p.Gln512*	285	0		278	43	NM_001273	0	0	71	72	1	Q8IXZ5	Nonsense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	39	7.490672	0.98316	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	.	.	.	3.86	3.86	0.44501	.	0.127870	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	9.8645	12.2938	0.54833	0.0:0.1709:0.8291:0.0	.	.	.	.	X	509;505;512;512;486	.	ENSP00000312419:Q512X	Q	-	1	0	CHD4	6577801	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.469000	0.60169	2.149000	0.67028	0.305000	0.20034	CAG	.		0.547	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
RASSF8	11228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26217472	26217472	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:26217472A>T	ENST00000405154.2	+	3	344	c.145A>T	c.(145-147)Act>Tct	p.T49S	RASSF8_ENST00000542865.1_Missense_Mutation_p.T49S|RASSF8_ENST00000541490.1_Missense_Mutation_p.T49S|RASSF8_ENST00000282884.9_Missense_Mutation_p.T49S|RASSF8_ENST00000381352.3_Missense_Mutation_p.T49S	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	49	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				signal transduction (GO:0007165)					cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					ATGGAGAGATACTGAAAGACA	0.388																																					p.T49S		.											.	RASSF8-90	0			c.A145T						.						111.0	115.0	113.0					12																	26217472		2203	4300	6503	SO:0001583	missense	11228	exon4			AGAGATACTGAAA	U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.145A>T	12.37:g.26217472A>T	ENSP00000384491:p.Thr49Ser	164	0		179	32	NM_007211	0	0	1	1	0	A8K1Z0|O95647|Q5SCI2|Q76KB6	Missense_Mutation	SNP	ENST00000405154.2	37	CCDS53765.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826488	0.50739	.	.	ENSG00000123094	ENST00000381352;ENST00000535907;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000542004;ENST00000542315;ENST00000541218;ENST00000282884;ENST00000545413;ENST00000541934	T;T;T;T;T;T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28	5.38	4.21	0.49690	Ras-association (3);	0.046729	0.85682	D	0.000000	T	0.21674	0.0522	N	0.17723	0.515	0.58432	D	0.999995	B;D	0.63046	0.383;0.992	B;D	0.64042	0.19;0.921	T	0.03008	-1.1083	10	0.21014	T	0.42	-11.7935	11.9163	0.52767	0.8541:0.1459:0.0:0.0	.	49;49	Q8NHQ8-2;Q8NHQ8	.;RASF8_HUMAN	S	49	ENSP00000370756:T49S;ENSP00000442036:T49S;ENSP00000384491:T49S;ENSP00000439839:T49S;ENSP00000443096:T49S;ENSP00000442485:T49S;ENSP00000441294:T49S;ENSP00000445970:T49S;ENSP00000282884:T49S;ENSP00000443696:T49S	ENSP00000282884:T49S	T	+	1	0	RASSF8	26108739	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.609000	0.61148	0.970000	0.38263	0.528000	0.53228	ACT	.		0.388	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40681240	40681240	+	Missense_Mutation	SNP	A	A	T	rs555679009		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:40681240A>T	ENST00000298910.7	+	20	2646	c.2588A>T	c.(2587-2589)aAt>aTt	p.N863I	LRRK2_ENST00000343742.2_Missense_Mutation_p.N863I	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	863					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGCGATGGAAATTTTTCTGAA	0.398																																					p.N863I		.											.	LRRK2-533	0			c.A2588T						.						123.0	118.0	119.0					12																	40681240		2202	4299	6501	SO:0001583	missense	120892	exon20			ATGGAAATTTTTC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2588A>T	12.37:g.40681240A>T	ENSP00000298910:p.Asn863Ile	94	0		110	22	NM_198578	0	0	27	46	19	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	7.572	0.666963	0.14710	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.71579	2.25;-0.58	5.5	1.35	0.21983	.	0.449692	0.24999	N	0.033934	T	0.50309	0.1608	N	0.19112	0.55	0.09310	N	1	B;B	0.30455	0.28;0.121	B;B	0.30401	0.115;0.032	T	0.41016	-0.9532	10	0.46703	T	0.11	.	6.406	0.21664	0.6611:0.1269:0.212:0.0	.	863;863	E9PC85;Q5S007	.;LRRK2_HUMAN	I	863	ENSP00000341930:N863I;ENSP00000298910:N863I	ENSP00000298910:N863I	N	+	2	0	LRRK2	38967507	0.002000	0.14202	0.001000	0.08648	0.111000	0.19643	0.146000	0.16180	0.363000	0.24346	0.402000	0.26972	AAT	.		0.398	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
PRICKLE1	144165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	42858293	42858293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:42858293G>A	ENST00000455697.1	-	7	1828	c.1543C>T	c.(1543-1545)Cag>Tag	p.Q515*	PRICKLE1_ENST00000345127.3_Nonsense_Mutation_p.Q515*|PRICKLE1_ENST00000548696.1_Nonsense_Mutation_p.Q515*|PRICKLE1_ENST00000552240.1_Nonsense_Mutation_p.Q515*|PRICKLE1_ENST00000445766.2_Nonsense_Mutation_p.Q515*|RP11-328C8.4_ENST00000547824.1_RNA	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	515					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		TCATACCACTGTGTTTCATCA	0.488																																					p.Q515X		.											.	PRICKLE1-518	0			c.C1543T						.						106.0	101.0	103.0					12																	42858293		2203	4300	6503	SO:0001587	stop_gained	144165	exon7			ACCACTGTGTTTC	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1543C>T	12.37:g.42858293G>A	ENSP00000401060:p.Gln515*	131	0		157	29	NM_001144882	0	0	11	17	6	Q14C83|Q71QF8|Q96N00	Nonsense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	G	39	7.452020	0.98292	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	.	.	.	5.76	4.85	0.62838	.	0.319538	0.38959	N	0.001519	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-13.6227	16.3438	0.83116	0.0:0.0:0.8668:0.1332	.	.	.	.	X	515	.	ENSP00000345064:Q515X	Q	-	1	0	PRICKLE1	41144560	1.000000	0.71417	0.760000	0.31359	0.887000	0.51463	5.953000	0.70290	1.531000	0.49152	0.650000	0.86243	CAG	.		0.488	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu	37	12	43858498	43858498	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:43858498C>T	ENST00000389420.3	-	10	1404	c.1405G>A	c.(1405-1407)Gaa>Aaa	p.E469K	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.E469K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	469	Disintegrin.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TATATTTCTTCATCTGGTTTG	0.403																																					p.E469K		.											.	ADAMTS20-795	0			c.G1405A						.						93.0	85.0	88.0					12																	43858498		2203	4300	6503	SO:0001583	missense	80070	exon10			TTTCTTCATCTGG	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1405G>A	12.37:g.43858498C>T	ENSP00000374071:p.Glu469Lys	96	0		100	9	NM_025003	0	0	0	0	0	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	5.358	0.251329	0.10130	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.03242	4.0;4.0	4.75	4.75	0.60458	Metallopeptidase, catalytic domain (1);	0.132902	0.33650	N	0.004689	T	0.04092	0.0114	L	0.29908	0.895	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.49000	-0.8984	10	0.12766	T	0.61	.	18.6296	0.91355	0.0:1.0:0.0:0.0	.	469	P59510	ATS20_HUMAN	K	469	ENSP00000374071:E469K;ENSP00000448341:E469K	ENSP00000374068:E469K	E	-	1	0	ADAMTS20	42144765	0.952000	0.32445	0.750000	0.31169	0.068000	0.16541	2.779000	0.47734	2.563000	0.86464	0.591000	0.81541	GAA	.		0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
SCAF11	9169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46318586	46318586	+	Silent	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:46318586T>A	ENST00000369367.3	-	12	4064	c.3831A>T	c.(3829-3831)ccA>ccT	p.P1277P	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Silent_p.P962P|SCAF11_ENST00000419565.2_Silent_p.P1277P|SCAF11_ENST00000549162.1_Silent_p.P1085P	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1277	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GTGGTGGTGGTGGTAGTCCCT	0.493																																					p.P1277P		.											.	SCAF11-93	0			c.A3831T						.						99.0	85.0	90.0					12																	46318586		2203	4300	6503	SO:0001819	synonymous_variant	9169	exon12			TGGTGGTGGTAGT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.3831A>T	12.37:g.46318586T>A		127	0		92	18	NM_004719	0	0	4	7	3	A6NEU9|A6NLW5|Q8IW59	Silent	SNP	ENST00000369367.3	37	CCDS8748.2																																																																																			.		0.493	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
MBD6	114785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57922959	57922959	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:57922959C>T	ENST00000355673.3	+	13	3310	c.2954C>T	c.(2953-2955)cCt>cTt	p.P985L	MBD6_ENST00000431731.2_Missense_Mutation_p.P985L	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	985						chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						GTCCCTCTGCCTCCCCGGGCC	0.562																																					p.P985L		.											.	MBD6-516	0			c.C2954T						.						80.0	79.0	79.0					12																	57922959		2203	4300	6503	SO:0001583	missense	114785	exon13			CTCTGCCTCCCCG	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2954C>T	12.37:g.57922959C>T	ENSP00000347896:p.Pro985Leu	121	0		93	23	NM_052897	0	0	39	57	18	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	ENST00000355673.3	37	CCDS8944.1	.	.	.	.	.	.	.	.	.	.	c	15.34	2.804649	0.50315	.	.	ENSG00000166987	ENST00000355673;ENST00000431731	.	.	.	4.81	4.81	0.61882	.	0.000000	0.53938	D	0.000055	T	0.28532	0.0706	N	0.08118	0	0.49389	D	0.999785	P;P	0.46784	0.884;0.728	B;B	0.39562	0.303;0.199	T	0.28902	-1.0029	9	0.87932	D	0	-4.6123	13.5981	0.62002	0.0:1.0:0.0:0.0	.	985;985	Q6P0P0;Q96DN6	.;MBD6_HUMAN	L	985	.	ENSP00000347896:P985L	P	+	2	0	MBD6	56209226	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.576000	0.53878	2.683000	0.91414	0.558000	0.71614	CCT	.		0.562	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
USP15	9958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	62795034	62795034	+	Silent	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:62795034T>A	ENST00000280377.5	+	21	2800	c.2742T>A	c.(2740-2742)acT>acA	p.T914T	USP15_ENST00000393654.3_Silent_p.T889T|USP15_ENST00000353364.3_Silent_p.T885T	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	914	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GTGTCTCCACTGCATCTGAAG	0.323																																					p.T914T	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15-1084	0			c.T2742A						.						69.0	68.0	68.0					12																	62795034		2203	4297	6500	SO:0001819	synonymous_variant	9958	exon21			CTCCACTGCATCT	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2742T>A	12.37:g.62795034T>A		82	0		71	17	NM_001252078	0	0	3	5	2	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	37	CCDS58251.1																																																																																			.		0.323	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
ALDH1L2	160428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	105433493	105433493	+	Silent	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:105433493C>T	ENST00000258494.9	-	17	2183	c.2043G>A	c.(2041-2043)aaG>aaA	p.K681K	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	681	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						ACCAATACCTCTTCATGATCT	0.388																																					p.K681K		.											.	ALDH1L2-91	0			c.G2043A						.						148.0	136.0	140.0					12																	105433493		2203	4300	6503	SO:0001819	synonymous_variant	160428	exon17			ATACCTCTTCATG	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2043G>A	12.37:g.105433493C>T		98	0		115	17	NM_001034173	0	0	0	0	0	Q3SY68|Q68D62|Q6AI55|Q8N922	Silent	SNP	ENST00000258494.9	37	CCDS31891.1																																																																																			.		0.388	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
PXN	5829	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120653399	120653399	+	Silent	SNP	G	G	A	rs374919882	byFrequency	TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:120653399G>A	ENST00000228307.7	-	7	1038	c.897C>T	c.(895-897)ggC>ggT	p.G299G	PXN_ENST00000538144.1_Intron|PXN-AS1_ENST00000535200.1_RNA|PXN_ENST00000536957.1_Silent_p.G297G|PXN_ENST00000458477.2_Intron|PXN_ENST00000397506.3_Silent_p.G63G|PXN_ENST00000424649.2_Intron|PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000267257.7_Intron	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	299					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGCTCCGCCCGCCGTCCCGAG	0.672													G|||	4	0.000798722	0.0	0.0	5008	,	,		11205	0.0		0.0	False		,,,				2504	0.0041				p.G299G		.											.	PXN-660	0			c.C897T						.	G	,,	1,3119		0,1,1559	27.0	35.0	32.0		897,,	3.0	0.7	12		32	0,7154		0,0,3577	no	coding-synonymous,intron,intron	PXN	NM_001080855.2,NM_002859.3,NM_025157.4	,,	0,1,5136	AA,AG,GG		0.0,0.0321,0.0097	,,	299/592,,	120653399	1,10273	1560	3577	5137	SO:0001819	synonymous_variant	5829	exon7			CCGCCCGCCGTCC	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.897C>T	12.37:g.120653399G>A		110	0		75	15	NM_001080855	0	0	9	9	0	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Silent	SNP	ENST00000228307.7	37	CCDS44997.1	.	.	.	.	.	.	.	.	.	.	G	0.728	-0.780857	0.02929	3.21E-4	0.0	ENSG00000089159	ENST00000550795	.	.	.	4.89	3.03	0.35002	.	.	.	.	.	T	0.35480	0.0933	.	.	.	0.24856	N	0.992376	.	.	.	.	.	.	T	0.19976	-1.0289	4	.	.	.	.	8.1293	0.31018	0.1991:0.0:0.8009:0.0	.	.	.	.	V	48	.	.	A	-	2	0	PXN	119137782	0.004000	0.15560	0.679000	0.29978	0.009000	0.06853	0.629000	0.24538	1.209000	0.43321	-0.148000	0.13756	GCG	.		0.672	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859	
OR4N5	390437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20612708	20612708	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:20612708T>G	ENST00000333629.1	+	1	814	c.814T>G	c.(814-816)Tct>Gct	p.S272A	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CAAGGTAGTTTCTCTTTTCCA	0.418																																					p.S272A		.											.	OR4N5-69	0			c.T814G						.						165.0	167.0	167.0					14																	20612708		2203	4300	6503	SO:0001583	missense	390437	exon1			GTAGTTTCTCTTT		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.814T>G	14.37:g.20612708T>G	ENSP00000332110:p.Ser272Ala	374	0		437	79	NM_001004724	0	0	0	0	0	Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	T	1.597	-0.527459	0.04141	.	.	ENSG00000184394	ENST00000333629	T	0.00198	8.57	4.0	-2.2	0.06994	GPCR, rhodopsin-like superfamily (1);	0.172594	0.28198	N	0.016223	T	0.00109	0.0003	L	0.41492	1.28	0.09310	N	1	B	0.14012	0.009	B	0.21708	0.036	T	0.47586	-0.9106	10	0.02654	T	1	.	6.6619	0.23018	0.1429:0.0:0.4373:0.4197	.	272	Q8IXE1	OR4N5_HUMAN	A	272	ENSP00000332110:S272A	ENSP00000332110:S272A	S	+	1	0	OR4N5	19682548	0.000000	0.05858	0.534000	0.28014	0.087000	0.18053	-0.284000	0.08422	-0.115000	0.11915	-0.313000	0.08912	TCT	.		0.418	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1		
C14orf182	283551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	50472313	50472313	+	Splice_Site	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:50472313T>C	ENST00000399206.1	-	1	1925	c.205A>G	c.(205-207)Agg>Ggg	p.R69G	C14orf182_ENST00000529902.1_5'UTR	NM_001012706.1	NP_001012724.1	A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182	69										large_intestine(2)|urinary_tract(1)	3						CACACGGACCTTGGAGGCACA	0.537																																					p.R69G		.											.	C14orf182-90	0			c.A205G						.						126.0	138.0	134.0					14																	50472313		2049	4187	6236	SO:0001630	splice_region_variant	283551	exon1			CGGACCTTGGAGG	AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000399206.1:c.206+1A>G	14.37:g.50472313T>C		183	0		160	24	NM_001012706	0	0	0	0	0	A8MYX4	Missense_Mutation	SNP	ENST00000399206.1	37	CCDS41949.1	.	.	.	.	.	.	.	.	.	.	T	4.441	0.081550	0.08533	.	.	ENSG00000214900	ENST00000399206	T	0.59906	0.23	3.15	0.664	0.17890	.	.	.	.	.	T	0.43986	0.1272	.	.	.	0.09310	N	1	B	0.24426	0.103	B	0.23419	0.046	T	0.40757	-0.9546	8	0.87932	D	0	.	5.9656	0.19322	0.6219:0.0:0.0:0.3781	.	69	A1A4T8-2	.	G	69	ENSP00000382157:R69G	ENSP00000382157:R69G	R	-	1	2	C14orf182	49542063	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.033000	0.13754	0.130000	0.18549	-0.509000	0.04479	AGG	.		0.537	C14orf182-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395717.1	NM_001012706	Missense_Mutation
MLH3	27030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	75516130	75516130	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:75516130T>A	ENST00000556740.1	-	1	264	c.229A>T	c.(229-231)Aaa>Taa	p.K77*	MLH3_ENST00000355774.2_Nonsense_Mutation_p.K77*|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000238662.7_Nonsense_Mutation_p.K77*|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Nonsense_Mutation_p.K77*|MLH3_ENST00000555671.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	77					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GAGTGGCATTTACTGGTGAAA	0.448								Mismatch excision repair (MMR)																													p.K77X		.											.	MLH3-228	0			c.A229T						.						101.0	90.0	94.0					14																	75516130		2203	4300	6503	SO:0001587	stop_gained	27030	exon2			GGCATTTACTGGT	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.229A>T	14.37:g.75516130T>A	ENSP00000452316:p.Lys77*	110	0		100	17	NM_014381	0	0	1	2	1	P49751|Q56DK9|Q9P292|Q9UHC0	Nonsense_Mutation	SNP	ENST00000556740.1	37	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.646105	0.87958	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740;ENST00000553263;ENST00000557648	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7094	15.6637	0.77209	0.0:0.0:0.0:1.0	.	.	.	.	X	77	.	ENSP00000238662:K77X	K	-	1	0	MLH3	74585883	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.036000	0.88901	2.095000	0.63458	0.533000	0.62120	AAA	.		0.448	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
C14orf159	80017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	91642321	91642321	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:91642321T>A	ENST00000523771.1	+	7	1239	c.636T>A	c.(634-636)gaT>gaA	p.D212E	C14orf159_ENST00000520328.1_Missense_Mutation_p.D200E|C14orf159_ENST00000412671.2_Missense_Mutation_p.D217E|C14orf159_ENST00000518868.1_Missense_Mutation_p.D217E|C14orf159_ENST00000521077.2_Missense_Mutation_p.D217E|C14orf159_ENST00000428926.2_Missense_Mutation_p.D212E|C14orf159_ENST00000525393.2_Missense_Mutation_p.D88E|C14orf159_ENST00000256324.10_Missense_Mutation_p.D217E|C14orf159_ENST00000523816.1_Missense_Mutation_p.D212E|C14orf159_ENST00000522322.1_Missense_Mutation_p.D212E			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	212						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CCTACGGGGATGCCATGGTGT	0.527																																					p.D217E		.											.	C14orf159-92	0			c.T651A						.						102.0	90.0	94.0					14																	91642321		2203	4300	6503	SO:0001583	missense	80017	exon7			CGGGGATGCCATG	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.636T>A	14.37:g.91642321T>A	ENSP00000429655:p.Asp212Glu	94	0		102	18	NM_001102368	0	0	32	50	18	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	T	3.538	-0.094274	0.07053	.	.	ENSG00000133943	ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000517518;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	T;T;T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.06	-10.1	0.00402	.	0.938675	0.09028	N	0.859166	T	0.22166	0.0534	N	0.20807	0.61	0.09310	N	1	B;B;B;B;B;B	0.11235	0.003;0.004;0.003;0.0;0.001;0.003	B;B;B;B;B;B	0.16289	0.009;0.014;0.015;0.005;0.005;0.007	T	0.15378	-1.0439	10	0.39692	T	0.17	.	3.0379	0.06128	0.2001:0.225:0.4295:0.1454	.	212;88;217;200;217;217	Q7Z3D6;Q8NB88;B3KVU6;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	CN159_HUMAN;.;.;.;.;.	E	200;217;217;217;212;217;88;212;212;212;217	ENSP00000429453:D200E;ENSP00000256324:D217E;ENSP00000430137:D217E;ENSP00000428263:D217E;ENSP00000428974:D212E;ENSP00000428652:D217E;ENSP00000435459:D88E;ENSP00000404343:D212E;ENSP00000427953:D212E;ENSP00000429655:D212E;ENSP00000404196:D217E	ENSP00000256324:D217E	D	+	3	2	C14orf159	90712074	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.173000	0.03108	-3.740000	0.00113	0.459000	0.35465	GAT	.		0.527	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
PPP2R5C	5527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102323022	102323022	+	Splice_Site	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:102323022G>A	ENST00000334743.5	+	2	142		c.e2-1		PPP2R5C_ENST00000445439.3_Splice_Site|PPP2R5C_ENST00000350249.3_Splice_Site|PPP2R5C_ENST00000422945.2_Splice_Site|PPP2R5C_ENST00000557095.1_Splice_Site|PPP2R5C_ENST00000328724.5_Splice_Site	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTGCTTTTCAGATGTTCCTCC	0.353																																					.		.											.	PPP2R5C-659	0			c.188-1G>A						.						177.0	165.0	169.0					14																	102323022		2203	4300	6503	SO:0001630	splice_region_variant	5527	exon4			TTTTCAGATGTTC	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.95-1G>A	14.37:g.102323022G>A		353	0		311	56	NM_001161725	0	0	0	0	0	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Splice_Site	SNP	ENST00000334743.5	37	CCDS9964.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633499	0.87660	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000557621;ENST00000445439;ENST00000334743;ENST00000557095	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3772	0.94517	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPP2R5C	101392775	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.813000	0.99286	2.573000	0.86826	0.511000	0.50034	.	.		0.353	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	Intron
BAG5	9529	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	104027517	104027517	+	5'UTR	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:104027517A>T	ENST00000445922.2	-	0	231				APOPT1_ENST00000556253.2_5'Flank|RP11-894P9.2_ENST00000556332.1_RNA|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000337322.4_Silent_p.T36T|BAG5_ENST00000299204.4_5'UTR|APOPT1_ENST00000247618.4_5'Flank|RP11-73M18.2_ENST00000472726.2_5'Flank	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5						negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TGTTGTGTTCAGTTTCACAAG	0.353																																					p.T36T	NSCLC(171;1832 2055 18950 31566 41632)	.											.	BAG5-229	0			c.T108A						.						57.0	61.0	60.0					14																	104027517		2199	4285	6484	SO:0001623	5_prime_UTR_variant	9529	exon2			GTGTTCAGTTTCA	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.-16T>A	14.37:g.104027517A>T		169	0		179	34	NM_001015049	0	0	0	0	0	O94950|Q86W59	Silent	SNP	ENST00000445922.2	37	CCDS9982.1																																																																																			.		0.353	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1		
AHNAK2	113146	broad.mit.edu	37	14	105409159	105409159	+	Missense_Mutation	SNP	G	G	A	rs202233797	byFrequency	TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:105409159G>A	ENST00000333244.5	-	7	12748	c.12629C>T	c.(12628-12630)gCc>gTc	p.A4210V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4210						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A4210V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTTGAGGCCGGCTCCCTTGGG	0.642																																					p.A4210V													.	AHNAK2-47	1	Substitution - Missense(1)	lung(1)	c.C12629T						.						94.0	102.0	99.0					14																	105409159		1863	4091	5954	SO:0001583	missense	113146	exon7			AGGCCGGCTCCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12629C>T	14.37:g.105409159G>A	ENSP00000353114:p.Ala4210Val	262	0		223	4	NM_138420	0	0	10	10	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	14.25	2.480798	0.44044	.	.	ENSG00000185567	ENST00000333244	T	0.00768	5.72	3.61	-4.18	0.03846	.	0.514426	0.13911	N	0.354267	T	0.00998	0.0033	L	0.43923	1.385	0.09310	N	1	P	0.35894	0.526	P	0.48598	0.583	T	0.43426	-0.9392	10	0.26408	T	0.33	.	1.7885	0.03046	0.3986:0.2225:0.2669:0.112	.	4210	Q8IVF2	AHNK2_HUMAN	V	4210	ENSP00000353114:A4210V	ENSP00000353114:A4210V	A	-	2	0	AHNAK2	104480204	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-0.057000	0.11768	-0.718000	0.04949	0.306000	0.20318	GCC	.		0.642	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	broad.mit.edu	37	14	105413291	105413291	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:105413291C>A	ENST00000333244.5	-	7	8616	c.8497G>T	c.(8497-8499)Gag>Tag	p.E2833*	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2833						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACCGAGGCCTCGATGGACTTG	0.582																																					p.E2833X													.	AHNAK2-47	0			c.G8497T						.						207.0	226.0	220.0					14																	105413291		1969	4138	6107	SO:0001587	stop_gained	113146	exon7			AGGCCTCGATGGA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8497G>T	14.37:g.105413291C>A	ENSP00000353114:p.Glu2833*	427	0		400	7	NM_138420	12	0	45	57	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Nonsense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	49	14.983857	0.99818	.	.	ENSG00000185567	ENST00000333244	.	.	.	3.46	1.34	0.21922	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	7.3768	0.26833	0.1912:0.6238:0.185:0.0	.	.	.	.	X	2833	.	ENSP00000353114:E2833X	E	-	1	0	AHNAK2	104484336	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.660000	0.25009	0.394000	0.25230	0.306000	0.20318	GAG	.		0.582	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TYRO3	7301	hgsc.bcm.edu	37	15	41854918	41854918	+	Splice_Site	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr15:41854918T>G	ENST00000263798.3	+	4	804		c.e4+2		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATGTAACAGGTGAGCAGCCTC	0.582																																					.		.											.	TYRO3-1388	0			c.580+2T>G						.						22.0	20.0	21.0					15																	41854918		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon4			AACAGGTGAGCAG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.580+2T>G	15.37:g.41854918T>G		22	2		19	4	NM_006293	0	0	0	0	0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	t	21.2	4.113398	0.77210	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5013	0.67724	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39642210	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.037000	0.70956	2.007000	0.58848	0.387000	0.25754	.	.		0.582	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Intron
SCG3	29106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51993377	51993377	+	Silent	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr15:51993377A>G	ENST00000220478.3	+	10	1546	c.1143A>G	c.(1141-1143)ggA>ggG	p.G381G	SCG3_ENST00000542355.2_Silent_p.G149G	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	381					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		AGGAATATGGAAGCTTGAAGG	0.413																																					p.G381G		.											.	SCG3-91	0			c.A1143G						.						185.0	171.0	176.0					15																	51993377		2195	4293	6488	SO:0001819	synonymous_variant	29106	exon10			ATATGGAAGCTTG	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.1143A>G	15.37:g.51993377A>G		123	0		104	24	NM_013243	0	0	0	0	0	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Silent	SNP	ENST00000220478.3	37	CCDS10142.1																																																																																			.		0.413	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243	
SRRM2	23524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2807812	2807812	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:2807812A>T	ENST00000301740.8	+	4	930	c.381A>T	c.(379-381)ttA>ttT	p.L127F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	127					mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						tggcagaattaaatgagaaga	0.443																																					p.L127F		.											.	SRRM2-93	0			c.A381T						.						92.0	99.0	96.0					16																	2807812		2198	4300	6498	SO:0001583	missense	23524	exon4			AGAATTAAATGAG	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.381A>T	16.37:g.2807812A>T	ENSP00000301740:p.Leu127Phe	149	0		207	32	NM_016333	0	0	57	74	17	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.997285	0.35226	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000396975;ENST00000426305	T	0.23348	1.91	4.96	1.41	0.22369	.	0.000000	0.40908	D	0.000991	T	0.25232	0.0613	N	0.14661	0.345	0.28270	N	0.924446	D	0.69078	0.997	D	0.63488	0.915	T	0.04900	-1.0919	10	0.51188	T	0.08	-4.0677	7.5072	0.27551	0.3974:0.0:0.6026:0.0	.	127	Q9UQ35	SRRM2_HUMAN	F	127;127;31;92	ENSP00000301740:L127F	ENSP00000301740:L127F	L	+	3	2	SRRM2	2747813	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.918000	0.28678	0.497000	0.27926	-0.414000	0.06135	TTA	.		0.443	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
CLEC16A	23274	broad.mit.edu	37	16	11217780	11217780	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:11217780G>A	ENST00000409790.1	+	21	2680	c.2450G>A	c.(2449-2451)cGc>cAc	p.R817H	CLEC16A_ENST00000409552.3_Missense_Mutation_p.R799H|CLEC16A_ENST00000381822.2_5'Flank	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CAGGCAAGGCGCATGAAGATG	0.587																																					p.R817H													.	CLEC16A-92	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.G2450A						.						28.0	30.0	29.0					16																	11217780		2076	4216	6292	SO:0001583	missense	23274	exon20			CAAGGCGCATGAA	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.2450G>A	16.37:g.11217780G>A	ENSP00000387122:p.Arg817His	19	0		26	3	NM_015226	0	0	51	51	0		Missense_Mutation	SNP	ENST00000409790.1	37	CCDS45409.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.733694|4.733694	0.89482|0.89482	.|.	.|.	ENSG00000038532|ENSG00000038532	ENST00000428742|ENST00000409790;ENST00000542102;ENST00000409552;ENST00000436973	.|T	.|0.44083	.|0.93	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.047440	.|0.85682	.|D	.|0.000000	T|T	0.32496|0.32496	0.0831|0.0831	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	.|B;B	.|0.29805	.|0.017;0.257	.|B;B	.|0.22386	.|0.008;0.039	T|T	0.05971|0.05971	-1.0853|-1.0853	5|10	.|0.35671	.|T	.|0.21	-22.7297|-22.7297	18.5026|18.5026	0.90887|0.90887	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|817;799	.|Q2KHT3;Q2KHT3-2	.|CL16A_HUMAN;.	T|H	61|817;817;799;10	.|ENSP00000387122:R817H	.|ENSP00000386495:R799H	A|R	+|+	1|2	0|0	CLEC16A|CLEC16A	11125281|11125281	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.620000|6.620000	0.74224|0.74224	2.618000|2.618000	0.88619|0.88619	0.655000|0.655000	0.94253|0.94253	GCA|CGC	.		0.587	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
XPO6	23214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	28157419	28157419	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:28157419T>A	ENST00000304658.5	-	9	1830	c.1330A>T	c.(1330-1332)Aac>Tac	p.N444Y	XPO6_ENST00000565698.1_Missense_Mutation_p.N430Y	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	444					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GTTTACCTGTTGAGAACTGCT	0.398																																					p.N444Y		.											.	XPO6-227	0			c.A1330T						.						209.0	195.0	199.0					16																	28157419		1880	4095	5975	SO:0001583	missense	23214	exon9			ACCTGTTGAGAAC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1330A>T	16.37:g.28157419T>A	ENSP00000302790:p.Asn444Tyr	242	0		292	80	NM_015171	0	0	0	0	0	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.507676	0.44558	.	.	ENSG00000169180	ENST00000304658	T	0.47528	0.84	5.07	5.07	0.68467	Armadillo-like helical (1);Armadillo-type fold (1);	0.197221	0.52532	D	0.000061	T	0.33702	0.0872	L	0.29908	0.895	0.39270	D	0.964376	P;P	0.48162	0.906;0.79	B;B	0.41723	0.272;0.365	T	0.24012	-1.0172	10	0.42905	T	0.14	.	7.6658	0.28430	0.0:0.0948:0.0:0.9052	.	444;444	B7ZM10;Q96QU8	.;XPO6_HUMAN	Y	444	ENSP00000302790:N444Y	ENSP00000302790:N444Y	N	-	1	0	XPO6	28064920	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.790000	0.62453	1.925000	0.55765	0.524000	0.50904	AAC	.		0.398	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
MVP	9961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	29848119	29848119	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:29848119T>G	ENST00000357402.5	+	7	887	c.749T>G	c.(748-750)cTg>cGg	p.L250R	MVP_ENST00000452209.2_Silent_p.A64A|MVP_ENST00000395353.1_Missense_Mutation_p.L250R	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	250					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GAGGAGTGGCTGGTAACAGTG	0.642																																					p.L250R		.											.	MVP-93	0			c.T749G						.						49.0	48.0	48.0					16																	29848119		2196	4300	6496	SO:0001583	missense	9961	exon7			AGTGGCTGGTAAC	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.749T>G	16.37:g.29848119T>G	ENSP00000349977:p.Leu250Arg	79	0		82	6	NM_017458	0	0	665	780	115	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.550045	0.86127	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.55930	0.49;0.49	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.77671	0.4165	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83011	-0.0172	10	0.87932	D	0	-19.7942	13.7862	0.63110	0.0:0.0:0.0:1.0	.	250	Q14764	MVP_HUMAN	R	250	ENSP00000349977:L250R;ENSP00000378760:L250R	ENSP00000349977:L250R	L	+	2	0	MVP	29755620	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.236000	0.72339	2.194000	0.70268	0.379000	0.24179	CTG	.		0.642	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
ZNF646	9726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31090723	31090723	+	Silent	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:31090723G>A	ENST00000394979.2	+	1	3501	c.3078G>A	c.(3076-3078)gaG>gaA	p.E1026E	ZNF646_ENST00000300850.5_Silent_p.E1026E			O15015	ZN646_HUMAN	zinc finger protein 646	1026					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						AGTCTCAAGAGGGAGCAGGCA	0.587																																					p.E1026E		.											.	ZNF646-153	0			c.G3078A						.						121.0	118.0	119.0					16																	31090723		2197	4300	6497	SO:0001819	synonymous_variant	9726	exon2			TCAAGAGGGAGCA	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.3078G>A	16.37:g.31090723G>A		252	0		232	34	NM_014699	0	0	10	12	2	Q8IVD8	Silent	SNP	ENST00000394979.2	37																																																																																				.		0.587	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
HAS3	3038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69143465	69143465	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:69143465T>A	ENST00000306560.1	+	2	323	c.167T>A	c.(166-168)cTg>cAg	p.L56Q	HAS3_ENST00000219322.3_Missense_Mutation_p.L56Q|HAS3_ENST00000569188.1_Missense_Mutation_p.L56Q	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	56					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GGCCTGCACCTGCTCATTCAG	0.657																																					p.L56Q		.											.	HAS3-90	0			c.T167A						.						93.0	79.0	84.0					16																	69143465		2198	4300	6498	SO:0001583	missense	3038	exon2			TGCACCTGCTCAT	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.167T>A	16.37:g.69143465T>A	ENSP00000304440:p.Leu56Gln	88	0		100	13	NM_138612	0	0	1	1	0	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	37	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.778165	0.90195	.	.	ENSG00000103044	ENST00000219322;ENST00000306560	T;T	0.55930	0.49;0.63	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.959;0.999	T	0.77370	-0.2613	10	0.87932	D	0	12.4482	15.438	0.75162	0.0:0.0:0.0:1.0	.	56;56	O00219;O00219-2	HAS3_HUMAN;.	Q	56	ENSP00000219322:L56Q;ENSP00000304440:L56Q	ENSP00000219322:L56Q	L	+	2	0	HAS3	67700966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.924000	0.87555	2.143000	0.66587	0.459000	0.35465	CTG	.		0.657	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
SLC38A8	146167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84063153	84063153	+	Silent	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:84063153A>G	ENST00000299709.3	-	5	635	c.636T>C	c.(634-636)ccT>ccC	p.P212P		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	212					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TCCAGGAGGCAGGGCTGTAAA	0.493																																					p.P212P		.											.	SLC38A8-68	0			c.T636C						.						94.0	92.0	93.0					16																	84063153		2200	4300	6500	SO:0001819	synonymous_variant	146167	exon5			GGAGGCAGGGCTG		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.636T>C	16.37:g.84063153A>G		68	0		81	29	NM_001080442	0	0	0	0	0		Silent	SNP	ENST00000299709.3	37	CCDS32495.1																																																																																			.		0.493	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442	
TMEM220	388335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10626593	10626593	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:10626593G>C	ENST00000341871.3	-	5	805	c.341C>G	c.(340-342)tCc>tGc	p.S114C	TMEM220_ENST00000578345.1_Intron|TMEM220_ENST00000580186.1_5'UTR|TMEM220_ENST00000455996.2_Missense_Mutation_p.S104C	NM_001004313.1	NP_001004313.1	Q6QAJ8	TM220_HUMAN	transmembrane protein 220	114						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(1)|prostate(2)	5						TTACTTTGAGGAACTGTGGCA	0.468																																					p.S114C		.											.	TMEM220-90	0			c.C341G						.						163.0	145.0	151.0					17																	10626593		2203	4300	6503	SO:0001583	missense	388335	exon5			TTTGAGGAACTGT		CCDS32567.1	17p13.1	2008-08-08			ENSG00000187824	ENSG00000187824			33757	protein-coding gene	gene with protein product							Standard	NM_001004313		Approved		uc002gmx.3	Q6QAJ8		ENST00000341871.3:c.341C>G	17.37:g.10626593G>C	ENSP00000339830:p.Ser114Cys	117	0		125	18	NM_001004313	0	0	0	0	0	A1YRJ4|B2RNE4|B4DJ52|B9EGW3	Missense_Mutation	SNP	ENST00000341871.3	37	CCDS32567.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205169	0.58234	.	.	ENSG00000187824	ENST00000341871;ENST00000455996	.	.	.	5.63	4.66	0.58398	.	0.096587	0.41938	D	0.000796	T	0.77046	0.4073	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.948;0.998	T	0.79403	-0.1818	9	0.87932	D	0	-22.2883	11.3464	0.49563	0.0848:0.0:0.9152:0.0	.	104;114	Q6QAJ8-2;Q6QAJ8	.;TM220_HUMAN	C	114;104	.	ENSP00000339830:S114C	S	-	2	0	TMEM220	10567318	1.000000	0.71417	0.137000	0.22149	0.714000	0.41099	3.006000	0.49529	1.379000	0.46325	0.563000	0.77884	TCC	.		0.468	TMEM220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440333.1	NM_001004313	
FBXW10	10517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	18653137	18653137	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:18653137T>A	ENST00000395665.4	+	3	994	c.773T>A	c.(772-774)tTg>tAg	p.L258*	FBXW10_ENST00000301938.4_Nonsense_Mutation_p.L258*|FBXW10_ENST00000308799.4_Nonsense_Mutation_p.L258*|FBXW10_ENST00000395667.1_Nonsense_Mutation_p.L258*			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	258										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						TGCAATCTATTGGTTGACCTG	0.468																																					p.L258X		.											.	FBXW10-91	0			c.T773A						.						146.0	115.0	126.0					17																	18653137		2203	4300	6503	SO:0001587	stop_gained	10517	exon3			ATCTATTGGTTGA	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.773T>A	17.37:g.18653137T>A	ENSP00000379025:p.Leu258*	302	0		314	49	NM_001267585	0	0	0	0	0	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Nonsense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	T	37	6.578584	0.97680	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	.	.	.	2.49	2.49	0.30216	.	0.395534	0.14928	U	0.290234	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5156	0.33244	0.0:0.0:0.0:1.0	.	.	.	.	X	258	.	ENSP00000306937:L258X	L	+	2	0	FBXW10	18593862	0.026000	0.19158	0.002000	0.10522	0.803000	0.45373	1.573000	0.36472	1.144000	0.42321	0.333000	0.21579	TTG	.		0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
DHX58	79132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40262859	40262859	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:40262859T>A	ENST00000251642.3	-	5	665	c.443A>T	c.(442-444)cAg>cTg	p.Q148L		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	148	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTCTAGGTACTGGCTCATGAT	0.612																																					p.Q148L		.											.	DHX58-90	0			c.A443T						.						189.0	163.0	172.0					17																	40262859		2203	4300	6503	SO:0001583	missense	79132	exon5			AGGTACTGGCTCA	BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.443A>T	17.37:g.40262859T>A	ENSP00000251642:p.Gln148Leu	152	0		140	24	NM_024119	0	0	14	20	6	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	37	CCDS11416.1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.653438	0.47362	.	.	ENSG00000108771	ENST00000251642;ENST00000423748;ENST00000413196;ENST00000430773	T;T;T	0.33438	3.64;1.41;1.94	4.93	-2.66	0.06077	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.568788	0.18403	N	0.142315	T	0.17874	0.0429	N	0.17800	0.525	0.19575	N	0.999962	B;B	0.22746	0.074;0.007	B;B	0.27500	0.08;0.015	T	0.22487	-1.0215	10	0.36615	T	0.2	.	11.295	0.49274	0.0:0.5209:0.0:0.4791	.	141;148	B7Z455;Q96C10	.;DHX58_HUMAN	L	148;111;148;148	ENSP00000251642:Q148L;ENSP00000416389:Q148L;ENSP00000404639:Q148L	ENSP00000251642:Q148L	Q	-	2	0	DHX58	37516385	0.000000	0.05858	0.973000	0.42090	0.876000	0.50452	-0.928000	0.03980	-0.318000	0.08665	-1.063000	0.02288	CAG	.		0.612	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	NM_024119	
COL1A1	1277	hgsc.bcm.edu;bcgsc.ca	37	17	48265470	48265470	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:48265470G>C	ENST00000225964.5	-	44	3366	c.3248C>G	c.(3247-3249)gCc>gGc	p.A1083G		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1083	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GGGGCCACGGGCGCCAACAGG	0.632			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.A1083G		.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1-986	0			c.C3248G						.						22.0	19.0	20.0					17																	48265470		2195	4297	6492	SO:0001583	missense	1277	exon44			CCACGGGCGCCAA	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3248C>G	17.37:g.48265470G>C	ENSP00000225964:p.Ala1083Gly	29	1		20	3	NM_000088	0	0	0	0	0	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076520	0.36662	.	.	ENSG00000108821	ENST00000225964	D	0.93659	-3.26	5.26	4.29	0.51040	.	0.070349	0.56097	D	0.000026	D	0.91727	0.7384	L	0.45422	1.42	0.39212	D	0.963332	B	0.32302	0.363	B	0.42245	0.381	D	0.90605	0.4547	10	0.44086	T	0.13	.	11.9451	0.52924	0.085:0.0:0.915:0.0	.	1083	P02452	CO1A1_HUMAN	G	1083	ENSP00000225964:A1083G	ENSP00000225964:A1083G	A	-	2	0	COL1A1	45620469	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	3.598000	0.54038	1.216000	0.43427	0.462000	0.41574	GCC	.		0.632	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
QRICH2	84074	hgsc.bcm.edu;broad.mit.edu	37	17	74303551	74303551	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:74303551C>G	ENST00000262765.5	-	1	210	c.31G>C	c.(31-33)Gcc>Ccc	p.A11P		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	11										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CTCACCCTGGCAAAGCTGAGC	0.701																																					p.A11P		.											.	QRICH2-94	0			c.G31C						.						57.0	51.0	53.0					17																	74303551		2203	4300	6503	SO:0001583	missense	84074	exon1			CCCTGGCAAAGCT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.31G>C	17.37:g.74303551C>G	ENSP00000262765:p.Ala11Pro	48	0		49	4	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	C	9.811	1.183270	0.21870	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08984	3.03	4.13	-8.25	0.01025	.	.	.	.	.	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.36138	-0.9760	9	0.45353	T	0.12	11.3655	3.4716	0.07569	0.1651:0.1106:0.4721:0.2522	.	11	Q9H0J4	QRIC2_HUMAN	P	11	ENSP00000262765:A11P	ENSP00000262765:A11P	A	-	1	0	QRICH2	71815146	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.507000	0.02268	-3.600000	0.00134	0.411000	0.27672	GCC	.		0.701	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
MYO5B	4645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	47375980	47375980	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr18:47375980T>A	ENST00000285039.7	-	32	4571	c.4272A>T	c.(4270-4272)aaA>aaT	p.K1424N	SCARNA17_ENST00000589499.1_RNA|MYO5B_ENST00000324581.6_Missense_Mutation_p.K539N|MYO5B_ENST00000592688.1_5'UTR	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1424					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TCAGTTGCTTTTTGAGCTTCC	0.483																																					p.K1424N		.											.	MYO5B-72	0			c.A4272T						.						336.0	326.0	330.0					18																	47375980		1961	4155	6116	SO:0001583	missense	4645	exon32			TTGCTTTTTGAGC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4272A>T	18.37:g.47375980T>A	ENSP00000285039:p.Lys1424Asn	475	0		494	65	NM_001080467	0	0	48	85	37	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929283	0.73327	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.27720	1.65;1.65	4.63	-8.81	0.00813	.	0.000000	0.85682	D	0.000000	T	0.48132	0.1483	M	0.75615	2.305	0.45914	D	0.998753	D;D	0.89917	0.999;1.0	D;D	0.85130	0.986;0.997	T	0.70737	-0.4790	10	0.42905	T	0.14	.	18.1767	0.89764	0.0:0.7032:0.0:0.2968	.	1424;539	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	N	1424;539	ENSP00000285039:K1424N;ENSP00000315531:K539N	ENSP00000285039:K1424N	K	-	3	2	MYO5B	45629978	0.939000	0.31865	0.188000	0.23233	0.960000	0.62799	0.054000	0.14205	-1.861000	0.01153	-0.441000	0.05720	AAA	.		0.483	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
ABHD17A	81926	broad.mit.edu	37	19	1880041	1880041	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:1880041A>G	ENST00000292577.7	-	3	839	c.406T>C	c.(406-408)Tcc>Ccc	p.S136P	ABHD17A_ENST00000590661.1_Missense_Mutation_p.S118P|ABHD17A_ENST00000250974.9_Missense_Mutation_p.S187P	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	136						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										TGGAGGCGGGAGCCCAGGCCA	0.632																																					p.S187P													.	FAM108A1-90	0			c.T559C						.						34.0	36.0	35.0					19																	1880041		2200	4291	6491	SO:0001583	missense	81926	exon4			GGCGGGAGCCCAG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.406T>C	19.37:g.1880041A>G	ENSP00000292577:p.Ser136Pro	55	3		56	6	NM_031213	1	1	120	128	6	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Missense_Mutation	SNP	ENST00000292577.7	37	CCDS45902.1	.	.	.	.	.	.	.	.	.	.	a	15.06	2.720812	0.48728	.	.	ENSG00000129968	ENST00000250974;ENST00000292577	T;T	0.46063	0.88;0.88	4.41	-2.3	0.06785	.	0.201057	0.52532	D	0.000079	T	0.41949	0.1181	L	0.52266	1.64	0.26067	N	0.981275	B;P;B;P	0.43477	0.4;0.808;0.348;0.659	B;P;B;B	0.49799	0.427;0.622;0.301;0.301	T	0.43572	-0.9383	10	0.41790	T	0.15	-17.9715	11.1469	0.48436	0.6056:0.0:0.0:0.3944	.	136;187;136;136	Q96GS6;Q96GS6-2;Q96GS6-3;Q96GS6-4	F18A1_HUMAN;.;.;.	P	187;136	ENSP00000250974:S187P;ENSP00000292577:S136P	ENSP00000250974:S187P	S	-	1	0	FAM108A1	1831041	0.999000	0.42202	0.381000	0.26106	0.558000	0.35554	0.493000	0.22451	-0.942000	0.03695	-0.496000	0.04628	TCC	.		0.632	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
ADAMTS10	81794	broad.mit.edu	37	19	8665858	8665858	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:8665858T>C	ENST00000597188.1	-	6	1034	c.764A>G	c.(763-765)cAc>cGc	p.H255R	ADAMTS10_ENST00000270328.4_Missense_Mutation_p.H255R|ADAMTS10_ENST00000596709.1_5'UTR	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	255	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						CCGGCGCCCGTGATAGGCCAC	0.612																																					p.H255R													.	ADAMTS10-229	0			c.A764G						.						107.0	92.0	97.0					19																	8665858		2203	4300	6503	SO:0001583	missense	81794	exon6			CGCCCGTGATAGG	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.764A>G	19.37:g.8665858T>C	ENSP00000471851:p.His255Arg	119	0		117	3	NM_030957	0	0	6	6	0	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.306251	0.81247	.	.	ENSG00000142303	ENST00000270328	D	0.87179	-2.22	5.19	5.19	0.71726	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.90971	0.7161	M	0.83312	2.635	0.80722	D	1	P	0.34587	0.458	P	0.45195	0.473	D	0.91842	0.5484	10	0.87932	D	0	.	14.2288	0.65877	0.0:0.0:0.0:1.0	.	255	Q9H324	ATS10_HUMAN	R	255	ENSP00000270328:H255R	ENSP00000270328:H255R	H	-	2	0	ADAMTS10	8571858	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.539000	0.82063	1.962000	0.57031	0.374000	0.22700	CAC	.		0.612	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
EPOR	2057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11489162	11489162	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:11489162A>G	ENST00000222139.6	-	8	1129	c.1025T>C	c.(1024-1026)aTg>aCg	p.M342T	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	342					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CACTGCCTGCATCGTCCCCCA	0.627																																					p.M342T		.											.	EPOR-523	0			c.T1025C						.						39.0	39.0	39.0					19																	11489162		2203	4300	6503	SO:0001583	missense	2057	exon8			GCCTGCATCGTCC	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1025T>C	19.37:g.11489162A>G	ENSP00000222139:p.Met342Thr	82	1		66	16	NM_000121	0	0	23	24	1	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	ENST00000222139.6	37	CCDS12260.1	.	.	.	.	.	.	.	.	.	.	A	0.131	-1.113064	0.01799	.	.	ENSG00000187266	ENST00000222139	T	0.79352	-1.26	4.83	2.68	0.31781	.	1.546610	0.03465	N	0.212798	T	0.42585	0.1209	N	0.00162	-1.95	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46541	-0.9184	10	0.11794	T	0.64	-27.943	8.2133	0.31496	0.196:0.0:0.804:0.0	.	342	P19235	EPOR_HUMAN	T	342	ENSP00000222139:M342T	ENSP00000222139:M342T	M	-	2	0	EPOR	11350162	0.004000	0.15560	0.008000	0.14137	0.543000	0.35085	0.974000	0.29436	0.531000	0.28639	-0.248000	0.11899	ATG	.		0.627	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
ZNF254	9534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	24309780	24309780	+	Silent	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:24309780A>G	ENST00000357002.4	+	4	1093	c.978A>G	c.(976-978)gaA>gaG	p.E326E	ZNF254_ENST00000342944.6_Silent_p.E241E	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	326					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AGTGTGAAGAATGTGGCAAAG	0.388																																					p.E326E		.											.	ZNF254-90	0			c.A978G						.						50.0	50.0	50.0					19																	24309780		2203	4300	6503	SO:0001819	synonymous_variant	9534	exon4			TGAAGAATGTGGC	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.978A>G	19.37:g.24309780A>G		123	0		94	12	NM_203282	0	0	1	2	1	A4QPC0|Q86XL7	Silent	SNP	ENST00000357002.4	37	CCDS32983.1																																																																																			.		0.388	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
UBA2	10054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34924279	34924279	+	Missense_Mutation	SNP	G	G	A	rs370848936		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:34924279G>A	ENST00000246548.4	+	4	390	c.320G>A	c.(319-321)cGa>cAa	p.R107Q	UBA2_ENST00000439527.2_Missense_Mutation_p.R11Q	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	107					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GAATTTTTCCGACAGTTTATA	0.308																																					p.R107Q		.											.	UBA2-227	0			c.G320A						.	G	GLN/ARG	0,4404		0,0,2202	98.0	105.0	103.0		320	4.6	1.0	19		103	1,8599	1.2+/-3.3	0,1,4299	no	missense	UBA2	NM_005499.2	43	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	107/641	34924279	1,13003	2202	4300	6502	SO:0001583	missense	10054	exon4			TTTTCCGACAGTT	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.320G>A	19.37:g.34924279G>A	ENSP00000246548:p.Arg107Gln	223	0		197	36	NM_005499	0	0	11	14	3	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.582155	0.46006	0.0	1.16E-4	ENSG00000126261	ENST00000246548;ENST00000439527	T;T	0.29917	1.55;1.55	5.65	4.62	0.57501	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.111742	0.56097	D	0.000021	T	0.15132	0.0365	N	0.11000	0.08	0.47621	D	0.99947	B	0.20459	0.045	B	0.15484	0.013	T	0.09207	-1.0685	10	0.16896	T	0.51	-8.9388	9.9261	0.41494	0.1577:0.0:0.8423:0.0	.	107	Q9UBT2	SAE2_HUMAN	Q	107;11	ENSP00000246548:R107Q;ENSP00000437484:R11Q	ENSP00000246548:R107Q	R	+	2	0	UBA2	39616119	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.620000	0.67736	1.396000	0.46663	0.591000	0.81541	CGA	.		0.308	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	
CEACAM6	4680	broad.mit.edu	37	19	42260723	42260723	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:42260723G>A	ENST00000199764.6	+	2	498	c.280G>A	c.(280-282)Gca>Aca	p.A94T	CEA_ENST00000598976.1_Intron|AC011513.4_ENST00000601409.1_RNA	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	94	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A94T(1)		breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		CCCAGGGCCCGCATACAGTGG	0.463																																					p.A94T													.	CEACAM6-91	1	Substitution - Missense(1)	kidney(1)	c.G280A						.						279.0	265.0	270.0					19																	42260723		2203	4300	6503	SO:0001583	missense	4680	exon2			GGGCCCGCATACA	M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.280G>A	19.37:g.42260723G>A	ENSP00000199764:p.Ala94Thr	331	1		348	6	NM_002483	0	0	1	1	0	Q13774|Q14920|Q53XP7	Missense_Mutation	SNP	ENST00000199764.6	37	CCDS12585.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322830	0.41096	.	.	ENSG00000086548	ENST00000199764	T	0.66280	-0.2	1.92	-3.78	0.04333	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70290	0.3207	M	0.79011	2.435	0.09310	N	1	D	0.60160	0.987	D	0.65140	0.932	T	0.61441	-0.7062	9	0.62326	D	0.03	.	4.0679	0.09869	0.1812:0.4767:0.3421:0.0	.	94	P40199	CEAM6_HUMAN	T	94	ENSP00000199764:A94T	ENSP00000199764:A94T	A	+	1	0	CEACAM6	46952563	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.016000	0.13377	-0.324000	0.08589	-0.680000	0.03767	GCA	.		0.463	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
LAIR1	3903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54872527	54872527	+	Silent	SNP	C	C	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:54872527C>A	ENST00000391742.2	-	3	512	c.360G>T	c.(358-360)gtG>gtT	p.V120V	LAIR1_ENST00000434277.2_Silent_p.V119V|LAIR1_ENST00000391743.3_Silent_p.V102V|LAIR1_ENST00000463489.1_Intron|LAIR1_ENST00000474878.1_Silent_p.V119V|LAIR1_ENST00000348231.4_Silent_p.V120V|LAIR1_ENST00000313038.6_Silent_p.V113V			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	120					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CCTCACCTTTCACCAGCAGCT	0.582																																					p.V120V		.											.	LAIR1-94	0			c.G360T						.						105.0	100.0	102.0					19																	54872527		2203	4300	6503	SO:0001819	synonymous_variant	3903	exon3			ACCTTTCACCAGC	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.360G>T	19.37:g.54872527C>A		226	0		197	37	NM_021706	0	0	0	0	0		Silent	SNP	ENST00000391742.2	37	CCDS12891.1																																																																																			.		0.582	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1		
ZNF773	374928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	58018029	58018029	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:58018029G>A	ENST00000282292.4	+	4	706	c.566G>A	c.(565-567)aGg>aAg	p.R189K	ZNF773_ENST00000598770.1_Missense_Mutation_p.R188K|ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		GCTGGAAAAAGGCATTACAAA	0.473																																					p.R189K		.											.	ZNF773-91	0			c.G566A						.						48.0	48.0	48.0					19																	58018029		2203	4297	6500	SO:0001583	missense	374928	exon4			GAAAAAGGCATTA	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.566G>A	19.37:g.58018029G>A	ENSP00000282292:p.Arg189Lys	45	0		56	5	NM_198542	0	0	13	13	0	Q96DL8	Missense_Mutation	SNP	ENST00000282292.4	37	CCDS33134.1	.	.	.	.	.	.	.	.	.	.	G	1.360	-0.589074	0.03799	.	.	ENSG00000152439	ENST00000282292	T	0.21543	2.0	1.25	0.169	0.15017	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06962	0.0177	N	0.05259	-0.085	0.09310	N	1	B;B	0.28233	0.204;0.01	B;B	0.27076	0.076;0.003	T	0.36744	-0.9735	9	0.02654	T	1	.	4.9147	0.13840	0.3681:0.0:0.6319:0.0	.	188;189	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	K	189	ENSP00000282292:R189K	ENSP00000282292:R189K	R	+	2	0	ZNF773	62709841	0.000000	0.05858	0.006000	0.13384	0.429000	0.31625	-0.057000	0.11768	0.097000	0.17492	0.313000	0.20887	AGG	.		0.473	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	NM_198542	
ZNF773	374928	hgsc.bcm.edu;broad.mit.edu	37	19	58018032	58018032	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr19:58018032A>G	ENST00000282292.4	+	4	709	c.569A>G	c.(568-570)cAt>cGt	p.H190R	ZNF773_ENST00000598770.1_Missense_Mutation_p.H189R|ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		GGAAAAAGGCATTACAAATGC	0.473																																					p.H190R		.											.	ZNF773-91	0			c.A569G						.						49.0	49.0	49.0					19																	58018032		2203	4297	6500	SO:0001583	missense	374928	exon4			AAAGGCATTACAA	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.569A>G	19.37:g.58018032A>G	ENSP00000282292:p.His190Arg	45	0		61	5	NM_198542	0	0	12	12	0	Q96DL8	Missense_Mutation	SNP	ENST00000282292.4	37	CCDS33134.1	.	.	.	.	.	.	.	.	.	.	A	1.777	-0.482865	0.04383	.	.	ENSG00000152439	ENST00000282292	T	0.07327	3.2	1.25	0.141	0.14811	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04452	0.0122	N	0.13098	0.295	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.40098	-0.9581	9	0.66056	D	0.02	.	3.1074	0.06346	0.3454:0.4308:0.0:0.2238	.	189;190	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	R	190	ENSP00000282292:H190R	ENSP00000282292:H190R	H	+	2	0	ZNF773	62709844	0.000000	0.05858	0.002000	0.10522	0.468000	0.32798	-0.492000	0.06467	-0.023000	0.13963	0.260000	0.18958	CAT	.		0.473	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	NM_198542	
PSME4	23198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54135515	54135515	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:54135515T>C	ENST00000404125.1	-	24	2781	c.2726A>G	c.(2725-2727)cAt>cGt	p.H909R	PSME4_ENST00000421748.2_Missense_Mutation_p.H53R	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	909					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTCAAATTCATGCTTGTGAGA	0.338																																					p.H909R		.											.	PSME4-275	0			c.A2726G						.						57.0	57.0	57.0					2																	54135515		2203	4298	6501	SO:0001583	missense	23198	exon24			AATTCATGCTTGT	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2726A>G	2.37:g.54135515T>C	ENSP00000384211:p.His909Arg	62	0		46	8	NM_014614	0	0	20	29	9	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	10.65	1.409628	0.25465	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.10960	2.82;2.82	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.050889	0.85682	D	0.000000	T	0.09291	0.0229	L	0.29908	0.895	0.54753	D	0.999982	B;B;B	0.16603	0.007;0.001;0.018	B;B;B	0.12837	0.005;0.003;0.008	T	0.20706	-1.0267	10	0.16420	T	0.52	.	15.3474	0.74350	0.0:0.0:0.0:1.0	.	284;53;909	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	R	53;909	ENSP00000410830:H53R;ENSP00000384211:H909R	ENSP00000384211:H909R	H	-	2	0	PSME4	53989019	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.033000	0.64146	2.012000	0.59069	0.533000	0.62120	CAT	.		0.338	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
PCBP1	5093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70314950	70314950	+	Silent	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:70314950A>G	ENST00000303577.5	+	1	366	c.75A>G	c.(73-75)gtA>gtG	p.V25V	PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000432604.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	25	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						GAAAGGAAGTAGGAAGCATCA	0.567																																					p.V25V	Colon(85;1146 1307 3484 18706 25380)	.											.	PCBP1-226	0			c.A75G						.						111.0	114.0	113.0					2																	70314950		2203	4300	6503	SO:0001819	synonymous_variant	5093	exon1			GGAAGTAGGAAGC		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.75A>G	2.37:g.70314950A>G		176	0		164	40	NM_006196	0	0	266	436	170	Q13157|Q14975	Silent	SNP	ENST00000303577.5	37	CCDS1898.1																																																																																			.		0.567	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
SCN1A	6323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	166915109	166915109	+	Silent	SNP	C	C	T	rs121917959		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:166915109C>T	ENST00000303395.4	-	2	353	c.354G>A	c.(352-354)agG>agA	p.R118R	SCN1A_ENST00000409050.1_Silent_p.R118R|SCN1A_ENST00000423058.2_Silent_p.R118R|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Silent_p.R118R			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	118			R -> S (in EIEE6; dbSNP:rs121917959). {ECO:0000269|PubMed:18413471}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAGCTATTTTCCTAAGAGGAT	0.338																																					p.R118R		.											.	SCN1A-147	0			c.G354A	GRCh37	CM081422	SCN1A	M	rs121917959	.						64.0	65.0	65.0					2																	166915109		2202	4298	6500	SO:0001819	synonymous_variant	6323	exon2			TATTTTCCTAAGA	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.354G>A	2.37:g.166915109C>T		80	0		95	13	NM_001165964	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																			.		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
UBR3	130507	hgsc.bcm.edu;bcgsc.ca	37	2	170815017	170815017	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:170815017G>A	ENST00000272793.5	+	24	3665	c.3615G>A	c.(3613-3615)atG>atA	p.M1205I	UBR3_ENST00000418381.1_Missense_Mutation_p.M1205I			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1205					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AAAGCTTTATGGAAACTGCAA	0.343																																					p.M1205I		.											.	UBR3-68	0			c.G3615A						.						95.0	101.0	99.0					2																	170815017		2203	4300	6503	SO:0001583	missense	130507	exon24			CTTTATGGAAACT	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.3615G>A	2.37:g.170815017G>A	ENSP00000272793:p.Met1205Ile	123	0		134	26	NM_172070	0	0	4	6	2	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.648848|4.648848	0.87958|0.87958	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381|ENST00000392632	T;T|.	0.52983|.	0.64;0.64|.	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75391|.	0.3843|.	M|M	0.64567|0.64567	1.98|1.98	0.80722|0.80722	D|D	1|1	P;P|.	0.50528|.	0.936;0.851|.	P;P|.	0.61201|.	0.885;0.838|.	T|.	0.70880|.	-0.4752|.	10|.	0.16420|.	T|.	0.52|.	.|.	20.5801|20.5801	0.99389|0.99389	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1205;1205|.	Q6ZT12;E7EVK3|.	UBR3_HUMAN;.|.	I|X	1205|263	ENSP00000272793:M1205I;ENSP00000396068:M1205I|.	ENSP00000272793:M1205I|.	M|W	+|+	3|2	0|0	UBR3|UBR3	170523263|170523263	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.828000|9.828000	0.99408|0.99408	2.873000|2.873000	0.98535|0.98535	0.643000|0.643000	0.83706|0.83706	ATG|TGG	.		0.343	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
ZNF385B	151126	ucsc.edu;bcgsc.ca	37	2	180308133	180308133	+	Silent	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:180308133A>G	ENST00000410066.1	-	10	1863	c.1260T>C	c.(1258-1260)ccT>ccC	p.P420P	ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_Silent_p.P344P|ZNF385B_ENST00000336917.5_Silent_p.P318P|ZNF385B_ENST00000409692.1_Silent_p.P318P	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	420	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CCGCTGCGAGAGGTGAGGACA	0.602																																					p.P420P	Colon(155;204 2491 32774 51842)												.	ZNF385B-23	0			c.T1260C						.						28.0	36.0	33.0					2																	180308133		2201	4299	6500	SO:0001819	synonymous_variant	151126	exon10			TGCGAGAGGTGAG	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1260T>C	2.37:g.180308133A>G		29	0		17	4	NM_152520	0	0	2	12	10	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Silent	SNP	ENST00000410066.1	37	CCDS33339.1																																																																																			.		0.602	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
SSFA2	6744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182765433	182765433	+	Silent	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:182765433T>C	ENST00000431877.2	+	7	693	c.514T>C	c.(514-516)Ttg>Ctg	p.L172L	SSFA2_ENST00000428267.2_Silent_p.L19L|SSFA2_ENST00000409001.1_Silent_p.L172L|SSFA2_ENST00000320370.7_Silent_p.L172L	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	172						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGTTTCAGAATTGTTGGAACT	0.299																																					p.L172L		.											.	SSFA2-153	0			c.T514C						.						55.0	57.0	56.0					2																	182765433		2203	4299	6502	SO:0001819	synonymous_variant	6744	exon7			TCAGAATTGTTGG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.514T>C	2.37:g.182765433T>C		99	0		103	18	NM_001130445	0	0	0	0	0	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Silent	SNP	ENST00000431877.2	37	CCDS46467.1																																																																																			.		0.299	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
GLS	2744	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	191797555	191797555	+	Intron	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:191797555A>G	ENST00000320717.3	+	14	1908				GLS_ENST00000409215.1_Silent_p.V93V|GLS_ENST00000409626.1_Silent_p.V159V|GLS_ENST00000338435.4_Silent_p.V588V|GLS_ENST00000409428.1_Intron|GLS_ENST00000471443.1_3'UTR	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	CAACTGTAGTATATAGAATGG	0.343																																					p.V588V		.											.	GLS-92	0			c.A1764G						.						49.0	49.0	49.0					2																	191797555		876	1991	2867	SO:0001627	intron_variant	2744	exon15			TGTAGTATATAGA	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1650+1192A>G	2.37:g.191797555A>G		51	0		64	13	NM_001256310	0	0	44	77	33	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Silent	SNP	ENST00000320717.3	37	CCDS2308.1																																																																																			.		0.343	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
AOX1	316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	201478584	201478584	+	Silent	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:201478584C>T	ENST00000374700.2	+	15	1747	c.1506C>T	c.(1504-1506)tcC>tcT	p.S502S	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	502					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ATGAAGTCTCCCTTTTGGGCT	0.478																																					p.S502S		.											.	AOX1-96	0			c.C1506T						.						91.0	87.0	88.0					2																	201478584		2203	4300	6503	SO:0001819	synonymous_variant	316	exon15			AGTCTCCCTTTTG	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1506C>T	2.37:g.201478584C>T		71	0		76	17	NM_001159	0	0	38	101	63	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	ENST00000374700.2	37	CCDS33360.1																																																																																			.		0.478	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
COL4A4	1286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	227872134	227872134	+	Silent	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:227872134C>T	ENST00000396625.3	-	48	5187	c.4980G>A	c.(4978-4980)caG>caA	p.Q1660Q	COL4A4_ENST00000329662.7_Silent_p.Q1657Q	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1660	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.			LQ -> FE (in Ref. 5; BAA04214). {ECO:0000305}.	axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CAGAGGAAAACTGCAAGTCTG	0.517																																					p.Q1660Q		.											.	COL4A4-142	0			c.G4980A						.						284.0	291.0	289.0					2																	227872134		1978	4170	6148	SO:0001819	synonymous_variant	1286	exon48			GGAAAACTGCAAG		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4980G>A	2.37:g.227872134C>T		606	1		570	88	NM_000092	0	0	2	4	2	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	CCDS42828.1																																																																																			.		0.517	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
UGT1A6	54578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234652351	234652351	+	Intron	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:234652351G>A	ENST00000305139.6	+	2	1000				UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000609767.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A6_ENST00000480628.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CTCCGCCCCCGCCTCGCCATA	0.627																																					p.A71V		.											.	.	0			c.C212T						.						97.0	108.0	105.0					2																	234652351		2007	4180	6187	SO:0001627	intron_variant	414061	exon1			GCCCCCGCCTCGC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23329G>A	2.37:g.234652351G>A		220	1		197	44	NM_001001394	0	0	0	0	0	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	CCDS2507.1																																																																																			.		0.627	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
UGT1A6	54578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234652372	234652372	+	Intron	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:234652372A>G	ENST00000305139.6	+	2	1000				UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000609767.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A6_ENST00000480628.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GCGGTCATAGATATCGCGTTT	0.632																																					p.I64T		.											.	.	0			c.T191C						.						131.0	143.0	139.0					2																	234652372		2045	4204	6249	SO:0001627	intron_variant	414061	exon1			TCATAGATATCGC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23308A>G	2.37:g.234652372A>G		254	0		239	37	NM_001001394	0	0	1	1	0	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	CCDS2507.1																																																																																			.		0.632	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238234213	238234213	+	Silent	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:238234213A>T	ENST00000295550.4	-	43	9935	c.9483T>A	c.(9481-9483)gtT>gtA	p.V3161V	COL6A3_ENST00000472056.1_Silent_p.V2554V|COL6A3_ENST00000346358.4_Silent_p.V2961V|COL6A3_ENST00000347401.3_Silent_p.V2960V|COL6A3_ENST00000473258.1_5'UTR|COL6A3_ENST00000409809.1_Silent_p.V2955V|COL6A3_ENST00000353578.4_Silent_p.V2955V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	3161	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.|Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGGAGCGCAAACCTTTTCAC	0.383																																					p.V3161V		.											.	COL6A3-526	0			c.T9483A						.						178.0	181.0	180.0					2																	238234213		2203	4300	6503	SO:0001819	synonymous_variant	1293	exon43			AGCGCAAACCTTT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.9483T>A	2.37:g.238234213A>T		224	0		231	53	NM_004369	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.383	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PER2	8864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	239184526	239184526	+	Silent	SNP	A	A	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:239184526A>C	ENST00000254657.3	-	4	585	c.306T>G	c.(304-306)tcT>tcG	p.S102S	PER2_ENST00000440245.1_Silent_p.S102S|PER2_ENST00000254658.3_Silent_p.S102S|PER2_ENST00000355768.2_Silent_p.S102S	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	102					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CCACTTTCGAAGACTGGTCGC	0.502																																					p.S102S		.											.	PER2-154	0			c.T306G						.						173.0	169.0	170.0					2																	239184526		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon4			TTTCGAAGACTGG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.306T>G	2.37:g.239184526A>C		110	0		116	19	NM_022817	0	0	2	4	2	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1																																																																																			.		0.502	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
ASXL1	171023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31015986	31015986	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr20:31015986A>G	ENST00000375687.4	+	5	732	c.308A>G	c.(307-309)gAg>gGg	p.E103G	ASXL1_ENST00000470145.1_3'UTR|ASXL1_ENST00000542461.1_3'UTR|ASXL1_ENST00000306058.5_Missense_Mutation_p.E98G	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	103					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GAGGAGCCAGAGGACACGGCT	0.532			"""F, N, Mis"""		"""MDS, CMML"""																																p.E103G		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1-2057	0			c.A308G						.						128.0	121.0	123.0					20																	31015986		2203	4300	6503	SO:0001583	missense	171023	exon4			AGCCAGAGGACAC	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.308A>G	20.37:g.31015986A>G	ENSP00000364839:p.Glu103Gly	130	1		132	14	NM_015338	0	0	6	9	3	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.627522	0.87560	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.17054	2.32;2.3	4.79	4.79	0.61399	.	0.541356	0.20252	N	0.096049	T	0.37812	0.1017	L	0.56769	1.78	0.53005	D	0.999964	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.10941	-1.0608	10	0.66056	D	0.02	-21.1422	13.9731	0.64255	1.0:0.0:0.0:0.0	.	98;103	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	G	103;103;103;93;98	ENSP00000364839:E103G;ENSP00000305119:E98G	ENSP00000305119:E98G	E	+	2	0	ASXL1	30479647	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.902000	0.63266	2.152000	0.67230	0.379000	0.24179	GAG	.		0.532	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
LBP	3929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	36989402	36989402	+	Silent	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr20:36989402T>G	ENST00000217407.2	+	6	794	c.633T>G	c.(631-633)ccT>ccG	p.P211P		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	211					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				ATCTACAGCCTTATCTCCAAA	0.428																																					p.P211P		.											.	LBP-91	0			c.T633G						.						174.0	171.0	172.0					20																	36989402		2203	4300	6503	SO:0001819	synonymous_variant	3929	exon6			ACAGCCTTATCTC		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.633T>G	20.37:g.36989402T>G		231	1		209	28	NM_004139	0	0	0	0	0	B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	ENST00000217407.2	37	CCDS13304.1																																																																																			.		0.428	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
ZNF831	128611	broad.mit.edu	37	20	57769662	57769662	+	Silent	SNP	G	G	A	rs548966248		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr20:57769662G>A	ENST00000371030.2	+	1	3588	c.3588G>A	c.(3586-3588)gcG>gcA	p.A1196A		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1196							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CTCTGCCCGCGGAGCAGAAGG	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19947	0.0		0.0	False		,,,				2504	0.0				p.A1196A													.	ZNF831-126	0			c.G3588A						.						35.0	41.0	39.0					20																	57769662		2075	4218	6293	SO:0001819	synonymous_variant	128611	exon1			GCCCGCGGAGCAG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3588G>A	20.37:g.57769662G>A		56	0		47	3	NM_178457	0	0	1	1	0	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	CCDS42894.1																																																																																			.		0.637	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
COL18A1	80781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46902710	46902710	+	Splice_Site	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr21:46902710G>A	ENST00000359759.4	+	14	2942	c.2921G>A	c.(2920-2922)gGt>gAt	p.G974D	COL18A1_ENST00000400337.2_Splice_Site_p.G559D|COL18A1_ENST00000355480.5_Splice_Site_p.G739D			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	974	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TCCGTACAGGGTGAAGCAGGC	0.592																																					p.G739D		.											.	COL18A1-90	0			c.G2216A						.						116.0	125.0	122.0					21																	46902710		2050	4191	6241	SO:0001630	splice_region_variant	80781	exon14			TACAGGGTGAAGC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2920-1G>A	21.37:g.46902710G>A		126	0		98	16	NM_030582	0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	G	14.50	2.553832	0.45487	.	.	ENSG00000182871	ENST00000400337;ENST00000355480;ENST00000359759	D;D;D	0.99532	-5.77;-6.1;-6.1	2.62	2.62	0.31277	.	.	.	.	.	D	0.99651	0.9871	H	0.95294	3.65	0.39801	D	0.972573	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98225	1.0480	9	0.87932	D	0	.	8.8912	0.35434	0.0:0.0:1.0:0.0	.	974;739;559	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	D	559;739;974	ENSP00000383191:G559D;ENSP00000347665:G739D;ENSP00000352798:G974D	ENSP00000347665:G739D	G	+	2	0	COL18A1	45727138	0.971000	0.33674	0.522000	0.27862	0.058000	0.15608	1.738000	0.38207	1.799000	0.52666	0.549000	0.68633	GGT	.		0.592	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		Missense_Mutation
SLC2A11	66035	hgsc.bcm.edu;broad.mit.edu	37	22	24226511	24226511	+	Silent	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:24226511C>T	ENST00000345044.6	+	11	1453	c.1185C>T	c.(1183-1185)gcC>gcT	p.A395A	AP000350.10_ENST00000433835.3_Intron|SLC2A11_ENST00000316185.8_Silent_p.A398A|SLC2A11_ENST00000398356.2_Silent_p.A402A			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	395					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						GGATCCTGGCCACAGAGCTGT	0.652																																					p.A402A		.											.	SLC2A11-91	0			c.C1206T						.						52.0	50.0	51.0					22																	24226511		2203	4300	6503	SO:0001819	synonymous_variant	66035	exon12			CCTGGCCACAGAG	AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.1185C>T	22.37:g.24226511C>T		61	0		75	12	NM_030807	0	0	7	13	6	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Silent	SNP	ENST00000345044.6	37	CCDS46673.1	.	.	.	.	.	.	.	.	.	.	C	9.191	1.025928	0.19512	.	.	ENSG00000251357	ENST00000502845	.	.	.	3.79	1.55	0.23275	.	.	.	.	.	T	0.46483	0.1395	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	.	4.1978	0.10452	0.0:0.5781:0.1966:0.2253	.	.	.	.	L	133	.	.	P	+	2	0	AP000350.10	22556511	0.411000	0.25384	0.996000	0.52242	0.855000	0.48748	0.053000	0.14184	0.331000	0.23511	0.505000	0.49811	CCA	.		0.652	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319889.3	NM_030807	
NF2	4771	hgsc.bcm.edu;ucsc.edu	37	22	30069350	30069350	+	Silent	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:30069350T>C	ENST00000338641.4	+	12	1656	c.1215T>C	c.(1213-1215)gcT>gcC	p.A405A	NF2_ENST00000353887.4_Silent_p.A322A|NF2_ENST00000413209.2_Intron|NF2_ENST00000361166.4_Silent_p.A405A|NF2_ENST00000397789.3_Silent_p.A405A|NF2_ENST00000403435.1_Silent_p.A376A|NF2_ENST00000347330.5_Intron|NF2_ENST00000403999.3_Silent_p.A405A|NF2_ENST00000361452.4_Silent_p.A364A|NF2_ENST00000361676.4_Silent_p.A363A|NF2_ENST00000334961.7_Silent_p.A322A	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	405	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.M375fs*20(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CCGCAGAGGCTGAGCAGGAAA	0.607			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.A405A		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	4	Unknown(3)|Deletion - Frameshift(1)	large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	c.T1215C						.						54.0	46.0	49.0					22																	30069350		2203	4300	6503	SO:0001819	synonymous_variant	4771	exon12	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	AGAGGCTGAGCAG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1215T>C	22.37:g.30069350T>C		15	0		10	3	NM_000268	0	0	23	40	17	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Silent	SNP	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.607	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
MCHR1	2847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41076973	41076973	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:41076973A>T	ENST00000249016.4	+	2	1006	c.310A>T	c.(310-312)Agc>Tgc	p.S104C	MCHR1_ENST00000381433.2_Missense_Mutation_p.S104C|MCHR1_ENST00000498400.1_3'UTR	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	104					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						TCGCACGGGGAGCATCTCCTA	0.567																																					p.S104C		.											.	MCHR1-90	0			c.A310T						.						139.0	105.0	117.0					22																	41076973		2203	4300	6503	SO:0001583	missense	2847	exon2			ACGGGGAGCATCT		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.310A>T	22.37:g.41076973A>T	ENSP00000249016:p.Ser104Cys	81	0		89	12	NM_005297	0	0	1	1	0	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	37	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	A	8.701	0.909808	0.17833	.	.	ENSG00000128285	ENST00000249016;ENST00000381433	T;T	0.38077	1.16;1.16	4.87	3.77	0.43336	.	0.596448	0.17749	N	0.163281	T	0.21631	0.0521	N	0.14661	0.345	0.22866	N	0.998638	P	0.39576	0.679	B	0.37047	0.24	T	0.11421	-1.0588	10	0.59425	D	0.04	.	10.4074	0.44272	0.8375:0.1625:0.0:0.0	.	104	Q99705	MCHR1_HUMAN	C	104	ENSP00000249016:S104C;ENSP00000370841:S104C	ENSP00000249016:S104C	S	+	1	0	MCHR1	39406919	0.902000	0.30710	0.457000	0.27056	0.381000	0.30169	1.471000	0.35365	1.959000	0.56917	0.533000	0.62120	AGC	.		0.567	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
MEI1	150365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42149973	42149973	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:42149973T>G	ENST00000401548.3	+	17	1914	c.1874T>G	c.(1873-1875)gTg>gGg	p.V625G	MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000540833.1_Missense_Mutation_p.V365G|MEI1_ENST00000400107.1_5'UTR|MEI1_ENST00000540880.1_Intron	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTAAACCAGGTGTGTTCCAAT	0.458																																					p.V625G		.											.	MEI1-70	0			c.T1874G						.						194.0	171.0	178.0					22																	42149973		1926	4140	6066	SO:0001583	missense	150365	exon17			ACCAGGTGTGTTC	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1874T>G	22.37:g.42149973T>G	ENSP00000384115:p.Val625Gly	92	1		112	15	NM_152513	0	0	0	0	0		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.803218	0.31869	.	.	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.05199	3.48;3.48	5.46	1.86	0.25419	.	0.350989	0.28016	N	0.016924	T	0.04770	0.0129	L	0.51422	1.61	0.80722	D	1	P	0.45827	0.867	B	0.35770	0.21	T	0.44081	-0.9351	10	0.72032	D	0.01	-8.4146	2.1403	0.03772	0.2341:0.3123:0.0:0.4536	.	625	Q5TIA1	MEI1_HUMAN	G	625;365	ENSP00000384115:V625G;ENSP00000444225:V365G	ENSP00000384115:V625G	V	+	2	0	MEI1	40479919	0.988000	0.35896	0.997000	0.53966	0.783000	0.44284	0.555000	0.23422	0.368000	0.24481	0.533000	0.62120	GTG	.		0.458	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
PRR34	55267	broad.mit.edu	37	22	46449683	46449683	+	Silent	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:46449683G>A	ENST00000396008.2	-	1	341	c.291C>T	c.(289-291)caC>caT	p.H97H	RP6-109B7.2_ENST00000439423.1_lincRNA|FLJ27365_ENST00000381051.2_5'Flank|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.3_ENST00000451166.1_RNA|C22orf26_ENST00000333761.1_Silent_p.H97H|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA			Q9NV39	PRR34_HUMAN		97													Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		GCCTGGCACCGTGCCAGGCTC	0.751																																					p.H97H													.	C22orf26-90	0			c.C291T						.						2.0	4.0	3.0					22																	46449683		1478	3246	4724	SO:0001819	synonymous_variant	55267	exon1			GGCACCGTGCCAG																												ENST00000396008.2:c.291C>T	22.37:g.46449683G>A		10	0		4	3	NM_018280	0	0	0	0	0	B0QZ24	Silent	SNP	ENST00000396008.2	37	CCDS14071.1																																																																																			.		0.751	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46790151	46790151	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr22:46790151A>T	ENST00000262738.3	-	14	5851	c.5852T>A	c.(5851-5853)cTt>cAt	p.L1951H		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1951	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGGGCACGGAAGGTCGAGTCT	0.567																																					p.L1951H		.											.	CELSR1-525	0			c.T5852A						.						40.0	39.0	39.0					22																	46790151		2203	4300	6503	SO:0001583	missense	9620	exon14			CACGGAAGGTCGA	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5852T>A	22.37:g.46790151A>T	ENSP00000262738:p.Leu1951His	68	0		60	10	NM_014246	0	0	0	0	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	A	8.280	0.815341	0.16607	.	.	ENSG00000075275	ENST00000262738	D	0.92199	-2.99	3.47	3.47	0.39725	.	0.204155	0.30011	U	0.010631	D	0.92831	0.7720	L	0.40543	1.245	0.80722	D	1	D;B	0.76494	0.999;0.048	D;B	0.68765	0.96;0.025	D	0.92188	0.5757	10	0.48119	T	0.1	.	11.945	0.52924	1.0:0.0:0.0:0.0	.	272;1951	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	H	1951	ENSP00000262738:L1951H	ENSP00000262738:L1951H	L	-	2	0	CELSR1	45168815	0.967000	0.33354	0.996000	0.52242	0.436000	0.31835	2.258000	0.43249	1.360000	0.45960	0.379000	0.24179	CTT	.		0.567	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
NGLY1	55768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	25773885	25773885	+	Silent	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr3:25773885A>T	ENST00000280700.5	-	9	1510	c.1350T>A	c.(1348-1350)ccT>ccA	p.P450P	NGLY1_ENST00000428257.1_Silent_p.P432P|NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000417874.2_Silent_p.P408P|NGLY1_ENST00000467224.1_Intron|NGLY1_ENST00000396649.3_Silent_p.P450P	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	450					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						CTCCAGGTTTAGGGGTTTTGG	0.418																																					p.P450P		.											.	NGLY1-135	0			c.T1350A						.						102.0	108.0	106.0					3																	25773885		2203	4300	6503	SO:0001819	synonymous_variant	55768	exon9			AGGTTTAGGGGTT	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1350T>A	3.37:g.25773885A>T		152	1		138	50	NM_018297	0	0	6	37	31	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Silent	SNP	ENST00000280700.5	37	CCDS33719.1																																																																																			.		0.418	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2		
NDUFB5	4711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179334831	179334831	+	Splice_Site	SNP	A	A	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr3:179334831A>C	ENST00000259037.3	+	4	455	c.341A>C	c.(340-342)aAg>aCg	p.K114T	NDUFB5_ENST00000493866.1_Splice_Site_p.K62T|NDUFB5_ENST00000473500.1_3'UTR|NDUFB5_ENST00000472629.1_Splice_Site_p.K102T|snoU13_ENST00000459278.1_RNA	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	114					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			GAATATTATAAGGTTTGTATA	0.343																																					p.K114T		.											.	NDUFB5-91	0			c.A341C						.						79.0	78.0	78.0					3																	179334831		2203	4300	6503	SO:0001630	splice_region_variant	4711	exon4			ATTATAAGGTTTG	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.342+1A>C	3.37:g.179334831A>C		77	0		76	28	NM_002492	0	0	0	0	0	Q561V6	Missense_Mutation	SNP	ENST00000259037.3	37	CCDS3234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.66|15.66	2.899232|2.899232	0.52227|0.52227	.|.	.|.	ENSG00000136521|ENSG00000136521	ENST00000259037;ENST00000493866;ENST00000472629;ENST00000471112|ENST00000482604	T;T;T;T|.	0.55413|.	0.52;0.52;0.52;0.52|.	5.54|5.54	4.37|4.37	0.52481|0.52481	.|.	0.044583|.	0.85682|.	D|.	0.000000|.	T|T	0.74275|0.74275	0.3695|0.3695	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	D;P|.	0.63046|.	0.992;0.933|.	D;P|.	0.63703|.	0.917;0.827|.	T|T	0.74466|0.74466	-0.3656|-0.3656	10|5	0.87932|.	D|.	0|.	-13.9029|-13.9029	7.2091|7.2091	0.25923|0.25923	0.776:0.1461:0.0779:0.0|0.776:0.1461:0.0779:0.0	.|.	62;114|.	Q561V6;O43674|.	.;NDUB5_HUMAN|.	T|R	114;62;102;35|131	ENSP00000259037:K114T;ENSP00000419656:K62T;ENSP00000419248:K102T;ENSP00000419501:K35T|.	ENSP00000259037:K114T|.	K|S	+|+	2|1	0|0	NDUFB5|NDUFB5	180817525|180817525	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.531000|0.531000	0.34715|0.34715	6.924000|6.924000	0.75823|0.75823	0.923000|0.923000	0.37045|0.37045	-0.304000|-0.304000	0.09214|0.09214	AAG|AGC	.		0.343	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348937.2	NM_002492	Missense_Mutation
ABCC5	10057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183706444	183706444	+	Missense_Mutation	SNP	C	C	T	rs200810558		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr3:183706444C>T	ENST00000334444.6	-	4	599	c.359G>A	c.(358-360)cGt>cAt	p.R120H	ABCC5_ENST00000382494.2_Missense_Mutation_p.R120H|ABCC5_ENST00000392579.2_Missense_Mutation_p.R120H|ABCC5_ENST00000265586.6_Missense_Mutation_p.R120H|ABCC5_ENST00000427120.2_Missense_Mutation_p.R120H	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	120					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GTGGGCCACACGGGCCAGAGA	0.527																																					p.R120H		.											.	ABCC5-137	0			c.G359A						.						86.0	81.0	83.0					3																	183706444		2203	4300	6503	SO:0001583	missense	10057	exon4			GCCACACGGGCCA	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.359G>A	3.37:g.183706444C>T	ENSP00000333926:p.Arg120His	92	0		89	28	NM_005688	0	0	22	24	2	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.218	0.801935	0.16397	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586;ENST00000427120;ENST00000392579;ENST00000382494;ENST00000437341	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.75	1.45	0.22620	.	0.350255	0.30428	N	0.009657	T	0.81202	0.4773	M	0.62723	1.935	0.09310	N	1	B;B;B;B;B	0.16603	0.018;0.018;0.002;0.012;0.01	B;B;B;B;B	0.13407	0.007;0.007;0.003;0.004;0.009	T	0.62742	-0.6790	10	0.14656	T	0.56	-3.1865	8.6238	0.33877	0.1061:0.6423:0.0:0.2516	.	120;120;120;120;120	A5PKY6;Q29ZA9;Q86UX3;Q86W30;O15440	.;.;.;.;MRP5_HUMAN	H	120;56;120;120;120;120;120	ENSP00000333926:R120H;ENSP00000265586:R120H;ENSP00000404809:R120H;ENSP00000376358:R120H;ENSP00000371934:R120H;ENSP00000399726:R120H	ENSP00000265586:R120H	R	-	2	0	ABCC5	185189138	0.000000	0.05858	0.236000	0.24074	0.906000	0.53458	-0.323000	0.07997	0.349000	0.23975	0.655000	0.94253	CGT	C|0.999;T|0.000		0.527	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
ANKRD17	26057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	74014608	74014608	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:74014608T>A	ENST00000358602.4	-	8	1605	c.1489A>T	c.(1489-1491)Aat>Tat	p.N497Y	ANKRD17_ENST00000509867.2_Missense_Mutation_p.N384Y|ANKRD17_ENST00000330838.6_Missense_Mutation_p.N497Y|ANKRD17_ENST00000514252.1_5'UTR	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	497					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCTTCATCATTGACCTCTTCC	0.443																																					p.N497Y		.											.	ANKRD17-234	0			c.A1489T						.						115.0	97.0	103.0					4																	74014608		2203	4300	6503	SO:0001583	missense	26057	exon8			CATCATTGACCTC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1489A>T	4.37:g.74014608T>A	ENSP00000351416:p.Asn497Tyr	91	0		90	15	NM_198889	0	0	3	3	0	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.059277	0.76074	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.16897	2.31;2.31;2.31	5.43	4.25	0.50352	Ankyrin repeat-containing domain (5);	0.000000	0.64402	D	0.000002	T	0.37128	0.0992	M	0.61703	1.905	0.30866	N	0.732937	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.999;0.999;1.0;0.999	T	0.40478	-0.9561	10	0.72032	D	0.01	.	11.4205	0.49978	0.0:0.071:0.0:0.929	.	82;497;497;497;384	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	Y	497;497;497;384;497	ENSP00000351416:N497Y;ENSP00000332265:N497Y;ENSP00000427151:N384Y	ENSP00000332265:N497Y	N	-	1	0	ANKRD17	74233472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.885000	0.87282	1.002000	0.39104	0.482000	0.46254	AAT	.		0.443	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
SCD5	79966	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	83719607	83719607	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:83719607C>G	ENST00000319540.4	-	1	403	c.84G>C	c.(82-84)gaG>gaC	p.E28D	SCD5_ENST00000282709.4_Missense_Mutation_p.E28D|SCD5_ENST00000273908.4_Missense_Mutation_p.E28D	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	28					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.E28D(2)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				CGCCGCCGCCCTCAGAGCTTT	0.692																																					p.E28D		.											.	SCD5-91	2	Substitution - Missense(2)	lung(2)	c.G84C						.						21.0	23.0	22.0					4																	83719607		2200	4295	6495	SO:0001583	missense	79966	exon1			GCCGCCCTCAGAG	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.84G>C	4.37:g.83719607C>G	ENSP00000316329:p.Glu28Asp	33	0		39	5	NM_024906	0	0	2	6	4	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	37	CCDS34024.1	.	.	.	.	.	.	.	.	.	.	C	9.274	1.046479	0.19748	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	T	0.44083	0.93	4.24	2.39	0.29439	.	0.474937	0.20549	N	0.090143	T	0.16557	0.0398	N	0.08118	0	0.09310	N	1	B;B;B	0.24721	0.034;0.11;0.008	B;B;B	0.19946	0.027;0.027;0.003	T	0.11867	-1.0570	10	0.16896	T	0.51	-2.1795	2.9623	0.05896	0.1795:0.542:0.1749:0.1035	.	28;28;28	Q9BSN4;Q86SK9-2;Q86SK9	.;.;SCD5_HUMAN	D	28	ENSP00000316329:E28D	ENSP00000273908:E28D	E	-	3	2	SCD5	83938631	0.000000	0.05858	0.008000	0.14137	0.176000	0.22953	-0.141000	0.10327	0.973000	0.38340	0.471000	0.43371	GAG	.		0.692	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
GUCY1B3	2983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	156725753	156725753	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:156725753A>G	ENST00000264424.8	+	12	1645	c.1563A>G	c.(1561-1563)atA>atG	p.I521M	GUCY1B3_ENST00000503520.1_Missense_Mutation_p.I488M|GUCY1B3_ENST00000507146.1_Missense_Mutation_p.I496M|GUCY1B3_ENST00000513437.1_Missense_Mutation_p.I453M|GUCY1B3_ENST00000505764.1_Missense_Mutation_p.I501M|GUCY1B3_ENST00000505154.1_Missense_Mutation_p.I453M|GUCY1B3_ENST00000502959.1_Missense_Mutation_p.I543M	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	521	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		AGATAACAATAGGGATACACA	0.373																																					p.I521M		.											.	.	0			c.A1563G						.						114.0	117.0	116.0					4																	156725753		1863	4098	5961	SO:0001583	missense	2983	exon12			AACAATAGGGATA	AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1563A>G	4.37:g.156725753A>G	ENSP00000264424:p.Ile521Met	161	0		165	21	NM_000857	0	0	0	0	0	B7Z426|Q86WY5	Missense_Mutation	SNP	ENST00000264424.8	37	CCDS47154.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181816	0.57800	.	.	ENSG00000061918	ENST00000505154;ENST00000502959;ENST00000505764;ENST00000507146;ENST00000264424;ENST00000503520;ENST00000513437	D;D;D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05	5.54	-0.268	0.12934	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.92912	0.7745	H	0.94264	3.515	0.52501	D	0.999953	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.996;0.998;0.991;0.995	D	0.91851	0.5491	10	0.87932	D	0	.	10.0789	0.42377	0.3827:0.5019:0.0:0.1153	.	501;543;496;488;521	B7Z426;E9PCN2;D6RC99;Q02153-2;Q02153	.;.;.;.;GCYB1_HUMAN	M	453;543;501;496;521;488;453	ENSP00000427226:I453M;ENSP00000426786:I543M;ENSP00000426319:I501M;ENSP00000422313:I496M;ENSP00000264424:I521M;ENSP00000420842:I488M;ENSP00000425065:I453M	ENSP00000264424:I521M	I	+	3	3	GUCY1B3	156945203	0.972000	0.33761	0.998000	0.56505	0.987000	0.75469	0.228000	0.17814	0.045000	0.15804	-0.323000	0.08544	ATA	.		0.373	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2		
NEIL3	55247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	178243705	178243705	+	Silent	SNP	C	C	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:178243705C>G	ENST00000264596.3	+	2	367	c.249C>G	c.(247-249)ctC>ctG	p.L83L		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	83					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		GGAAGGAGCTCTTTATGTACT	0.413								Base excision repair (BER), DNA glycosylases																													p.L83L		.											.	NEIL3-660	0			c.C249G						.						196.0	193.0	194.0					4																	178243705		2203	4300	6503	SO:0001819	synonymous_variant	55247	exon2			GGAGCTCTTTATG	AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.249C>G	4.37:g.178243705C>G		194	1		243	32	NM_018248	0	0	1	2	1	Q2PPJ3|Q8NG51|Q9NV95	Silent	SNP	ENST00000264596.3	37	CCDS3828.1																																																																																			.		0.413	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248	
CCDC110	256309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186380443	186380443	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:186380443T>A	ENST00000307588.3	-	6	1373	c.1298A>T	c.(1297-1299)aAt>aTt	p.N433I	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000510617.1_Missense_Mutation_p.N433I|CCDC110_ENST00000393540.3_Missense_Mutation_p.N396I	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	433						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTTAGGTAATTCTGTAAGTA	0.318																																					p.N433I		.											.	CCDC110-90	0			c.A1298T						.						94.0	98.0	97.0					4																	186380443		2203	4297	6500	SO:0001583	missense	256309	exon6			AGGTAATTCTGTA	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1298A>T	4.37:g.186380443T>A	ENSP00000306776:p.Asn433Ile	285	0		261	51	NM_152775	0	0	0	0	0	Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	37	CCDS3843.1	.	.	.	.	.	.	.	.	.	.	T	16.17	3.046799	0.55110	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.08807	3.06;3.05;3.05	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.24699	0.0599	M	0.66939	2.045	0.30797	N	0.740247	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.12167	-1.0558	10	0.51188	T	0.08	-18.2543	10.1029	0.42515	0.1493:0.0:0.0:0.8507	.	433;396;433	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	I	396;433;433	ENSP00000377172:N396I;ENSP00000306776:N433I;ENSP00000427246:N433I	ENSP00000306776:N433I	N	-	2	0	CCDC110	186617437	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.671000	0.54576	2.161000	0.67846	0.533000	0.62120	AAT	.		0.318	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	NM_152775	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	31983432	31983432	+	Silent	SNP	C	C	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:31983432C>G	ENST00000438447.1	+	3	1036	c.648C>G	c.(646-648)acC>acG	p.T216T	PDZD2_ENST00000282493.3_Silent_p.T216T			O15018	PDZD2_HUMAN	PDZ domain containing 2	216					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAAACGAACCAGAAAGTTTG	0.557																																					p.T216T		.											.	PDZD2-563	0			c.C648G						.						87.0	85.0	85.0					5																	31983432		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon2			ACGAACCAGAAAG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.648C>G	5.37:g.31983432C>G		149	0		138	30	NM_178140	0	0	0	0	0	Q9BXD4	Silent	SNP	ENST00000438447.1	37	CCDS34137.1																																																																																			.		0.557	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
AGXT2	64902	hgsc.bcm.edu;broad.mit.edu	37	5	35026613	35026613	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:35026613A>C	ENST00000231420.6	-	8	972	c.772T>G	c.(772-774)Tgc>Ggc	p.C258G		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	258					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GCTTGGCAGCAGTCTGCAAAA	0.368																																					p.C258G		.											.	AGXT2-94	0			c.T772G						.						90.0	79.0	83.0					5																	35026613		2203	4300	6503	SO:0001583	missense	64902	exon8			GGCAGCAGTCTGC	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.772T>G	5.37:g.35026613A>C	ENSP00000231420:p.Cys258Gly	54	0		82	8	NM_031900	0	0	2	2	0	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	37	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	A	9.197	1.027582	0.19512	.	.	ENSG00000113492	ENST00000231420	D	0.81996	-1.56	5.7	3.21	0.36854	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.368655	0.34652	N	0.003790	T	0.64338	0.2589	N	0.10809	0.05	0.35502	D	0.799851	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.56866	-0.7908	10	0.21014	T	0.42	-4.9282	8.517	0.33253	0.6305:0.2497:0.0:0.1198	.	258;258	E9PDL7;Q9BYV1	.;AGT2_HUMAN	G	258	ENSP00000231420:C258G	ENSP00000231420:C258G	C	-	1	0	AGXT2	35062370	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	1.435000	0.34969	0.373000	0.24621	0.533000	0.62120	TGC	.		0.368	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
ISL1	3670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	50683584	50683584	+	Splice_Site	SNP	G	G	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:50683584G>T	ENST00000230658.7	+	3	1063		c.e3+1		ISL1_ENST00000505475.2_Splice_Site|ISL1_ENST00000511384.1_Splice_Site	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1						atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				CAAATGGCAGGTACTCCTCTG	0.637																																					.		.											.	ISL1-515	0			c.478+1G>T						.						23.0	25.0	24.0					5																	50683584		2037	4162	6199	SO:0001630	splice_region_variant	3670	exon3			TGGCAGGTACTCC	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.478+1G>T	5.37:g.50683584G>T		43	0		51	18	NM_002202	0	0	0	0	0	P20663|P47894	Splice_Site	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.649867	0.87958	.	.	ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384;ENST00000505475	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2404	0.93879	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ISL1	50719341	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.502000	0.81614	2.538000	0.85594	0.456000	0.33151	.	.		0.637	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	Intron
ZNF366	167465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	71739940	71739940	+	Nonsense_Mutation	SNP	G	G	C	rs373642159		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:71739940G>C	ENST00000318442.5	-	5	2368	c.1878C>G	c.(1876-1878)taC>taG	p.Y626*	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	626	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GCTCCACCTCGTAGCAGTTAT	0.667																																					p.Y626X		.											.	ZNF366-91	0			c.C1878G						.						94.0	108.0	103.0					5																	71739940		2203	4300	6503	SO:0001587	stop_gained	167465	exon5			CACCTCGTAGCAG	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.1878C>G	5.37:g.71739940G>C	ENSP00000313158:p.Tyr626*	343	0		372	65	NM_152625	0	0	1	1	0	Q5HYI9|Q7RTV4	Nonsense_Mutation	SNP	ENST00000318442.5	37	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	G	38	7.253100	0.98164	.	.	ENSG00000178175	ENST00000318442	.	.	.	5.78	-7.21	0.01490	.	0.868154	0.10255	N	0.696665	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.173	17.8813	0.88841	0.6695:0.0:0.3305:0.0	.	.	.	.	X	626	.	ENSP00000313158:Y626X	Y	-	3	2	ZNF366	71775696	0.385000	0.25172	0.000000	0.03702	0.206000	0.24218	-0.180000	0.09754	-1.491000	0.01840	-0.136000	0.14681	TAC	.		0.667	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
MCC	4163	broad.mit.edu;bcgsc.ca	37	5	112458403	112458403	+	Silent	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:112458403A>T	ENST00000302475.4	-	4	998	c.435T>A	c.(433-435)tcT>tcA	p.S145S	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Silent_p.S335S|MCC_ENST00000515367.2_Silent_p.S82S	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	145					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TAACCATGGTAGACTGGTTTT	0.502																																					p.S335S													.	MCC-69	0			c.T1005A						.						150.0	122.0	132.0					5																	112458403		2202	4300	6502	SO:0001819	synonymous_variant	4163	exon6			CATGGTAGACTGG		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.435T>A	5.37:g.112458403A>T		69	0		68	6	NM_001085377	0	0	7	11	4	D3DT05|Q6ZR04	Silent	SNP	ENST00000302475.4	37	CCDS4111.1																																																																																			.		0.502	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140222316	140222316	+	Silent	SNP	G	G	C	rs202126810		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:140222316G>C	ENST00000531613.1	+	1	1410	c.1410G>C	c.(1408-1410)ccG>ccC	p.P470P	PCDHA8_ENST00000378123.3_Silent_p.P470P|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAACCCGCCGGGCTGCCACA	0.672																																					p.P470P		.											.	PCDHA8-92	0			c.G1410C						.						38.0	43.0	41.0					5																	140222316		2193	4252	6445	SO:0001819	synonymous_variant	56140	exon1			CCCGCCGGGCTGC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1410G>C	5.37:g.140222316G>C		139	0		123	16	NM_031856	1	0	2	3	0	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			G|0.999;T|0.001		0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
ARHGAP26	23092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	142513635	142513635	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:142513635T>A	ENST00000274498.4	+	19	2180	c.1802T>A	c.(1801-1803)cTg>cAg	p.L601Q	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.L601Q	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	601	Ser-rich.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGAGGCCCCTGACGCTCTTC	0.582																																					p.L601Q		.											.	ARHGAP26-660	0			c.T1802A						.						129.0	110.0	116.0					5																	142513635		2203	4300	6503	SO:0001583	missense	23092	exon19			GGCCCCTGACGCT	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1802T>A	5.37:g.142513635T>A	ENSP00000274498:p.Leu601Gln	188	0		187	31	NM_015071	0	0	21	28	7	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.4|24.4	4.531454|4.531454	0.85706|0.85706	.|.	.|.	ENSG00000145819|ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668|ENST00000443674;ENST00000418236	T;T|.	0.09630|.	2.96;2.97|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55878|.	0.1948|.	L|L	0.29908|0.29908	0.895|0.895	0.51767|0.51767	D|D	0.99993|0.99993	D;D;D|.	0.76494|.	0.998;0.994;0.999|.	D;P;D|.	0.87578|.	0.995;0.852;0.998|.	T|.	0.52298|.	-0.8594|.	10|.	0.42905|.	T|.	0.14|.	.|.	15.3985|15.3985	0.74816|0.74816	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	601;174;601|.	Q9UNA1;B3KT96;Q9UNA1-2|.	RHG26_HUMAN;.;.|.	Q|R	601;601;174|220;173	ENSP00000274498:L601Q;ENSP00000367243:L601Q|.	ENSP00000274498:L601Q|.	L|X	+|+	2|1	0|0	ARHGAP26|ARHGAP26	142493828|142493828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	5.763000|5.763000	0.68818|0.68818	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	CTG|TGA	.		0.582	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
RBM27	54439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145641187	145641187	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:145641187T>G	ENST00000265271.5	+	13	2174	c.2008T>G	c.(2008-2010)Ttg>Gtg	p.L670V	RBM27_ENST00000506502.1_Missense_Mutation_p.L615V	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	670	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATTCGAGTCTTGTGGCATAG	0.478																																					p.L670V		.											.	RBM27-70	0			c.T2008G						.						174.0	156.0	161.0					5																	145641187		1568	3582	5150	SO:0001583	missense	54439	exon13			CGAGTCTTGTGGC	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2008T>G	5.37:g.145641187T>G	ENSP00000265271:p.Leu670Val	176	0		229	34	NM_018989	0	0	10	10	0	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473230	0.43942	.	.	ENSG00000091009	ENST00000265271	T	0.44083	0.93	5.5	-1.73	0.08081	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.106316	0.40222	N	0.001141	T	0.30634	0.0771	N	0.19112	0.55	0.09310	N	1	P;P	0.41748	0.568;0.761	B;P	0.45310	0.301;0.476	T	0.33701	-0.9858	10	0.66056	D	0.02	-6.6533	11.6531	0.51301	0.0:0.4781:0.0:0.5219	.	670;615	Q9P2N5;B3KY61	RBM27_HUMAN;.	V	670	ENSP00000265271:L670V	ENSP00000265271:L670V	L	+	1	2	RBM27	145621380	0.692000	0.27719	0.167000	0.22817	0.977000	0.68977	1.212000	0.32394	-0.779000	0.04560	-0.379000	0.06801	TTG	.		0.478	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
CPEB4	80315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	173370039	173370039	+	Nonsense_Mutation	SNP	T	T	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr5:173370039T>G	ENST00000265085.5	+	4	2723	c.1269T>G	c.(1267-1269)taT>taG	p.Y423*	CPEB4_ENST00000517880.1_Intron|CPEB4_ENST00000522336.1_Intron|CPEB4_ENST00000520867.1_Intron|CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000519835.1_Intron|CPEB4_ENST00000334035.5_Nonsense_Mutation_p.Y406*	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	423					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAAGGACATATGGGCGAAGGA	0.348																																					p.Y423X		.											.	CPEB4-90	0			c.T1269G						.						187.0	195.0	192.0					5																	173370039		2203	4300	6503	SO:0001587	stop_gained	80315	exon4			GACATATGGGCGA	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1269T>G	5.37:g.173370039T>G	ENSP00000265085:p.Tyr423*	266	0		328	44	NM_030627	0	0	0	0	0	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Nonsense_Mutation	SNP	ENST00000265085.5	37	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	T	41	8.729920	0.98931	.	.	ENSG00000113742	ENST00000265085;ENST00000334035	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6823	16.2484	0.82467	0.0:0.0:0.0:1.0	.	.	.	.	X	423;406	.	ENSP00000265085:Y423X	Y	+	3	2	CPEB4	173302645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.965000	0.87945	2.291000	0.77112	0.533000	0.62120	TAT	.		0.348	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
MAK	4117	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	10796389	10796389	+	Missense_Mutation	SNP	C	C	G	rs201812469	byFrequency	TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:10796389C>G	ENST00000313243.2	-	9	1367	c.985G>C	c.(985-987)Gat>Cat	p.D329H	MAK_ENST00000474039.1_Missense_Mutation_p.D329H|MAK_ENST00000354489.2_Missense_Mutation_p.D329H|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000538030.1_Missense_Mutation_p.D329H|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000536370.1_3'UTR			P20794	MAK_HUMAN	male germ cell-associated kinase	329	Glu/Pro-rich.		D -> E (in dbSNP:rs17579447).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				ACAACCTGATCGATTATATCC	0.483																																					p.D329H		.											.	MAK-335	0			c.G985C						.						120.0	124.0	123.0					6																	10796389		2203	4300	6503	SO:0001583	missense	4117	exon9			CCTGATCGATTAT		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.985G>C	6.37:g.10796389C>G	ENSP00000313021:p.Asp329His	142	0		130	26	NM_005906	0	0	0	0	0	F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	ENST00000313243.2	37	CCDS4516.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380100	0.42207	.	.	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030	T;T;T	0.72167	-0.63;-0.63;-0.63	4.96	4.09	0.47781	.	0.539095	0.20661	N	0.088033	T	0.51024	0.1650	L	0.32530	0.975	0.45108	D	0.998127	P	0.46512	0.879	P	0.47673	0.554	T	0.53878	-0.8376	10	0.42905	T	0.14	.	9.0292	0.36249	0.0:0.7735:0.1482:0.0784	.	329	P20794	MAK_HUMAN	H	329	ENSP00000313021:D329H;ENSP00000346484:D329H;ENSP00000442250:D329H	ENSP00000313021:D329H	D	-	1	0	MAK	10904375	0.415000	0.25416	0.068000	0.19968	0.049000	0.14656	1.369000	0.34227	1.220000	0.43490	0.448000	0.29417	GAT	C|0.999;T|0.000		0.483	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	
MDC1	9656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30679993	30679993	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:30679993C>T	ENST00000376406.3	-	5	2373	c.1726G>A	c.(1726-1728)Gac>Aac	p.D576N	MDC1_ENST00000376405.2_Missense_Mutation_p.D576N|MDC1_ENST00000494654.1_5'Flank|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	576					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						GTTTCACAGTCCCCATGCAGA	0.542								Other conserved DNA damage response genes																													p.D576N		.											.	MDC1-273	0			c.G1726A						.						58.0	57.0	58.0					6																	30679993		1509	2709	4218	SO:0001583	missense	9656	exon5			CACAGTCCCCATG	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1726G>A	6.37:g.30679993C>T	ENSP00000365588:p.Asp576Asn	74	0		63	15	NM_014641	0	0	5	8	3	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	C	8.320	0.824001	0.16678	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.03553	3.97;3.89	4.32	1.5	0.22942	.	.	.	.	.	T	0.00875	0.0029	L	0.44542	1.39	0.09310	N	1	B;B;P;B	0.37466	0.037;0.054;0.596;0.003	B;B;B;B	0.35470	0.049;0.028;0.203;0.018	T	0.45906	-0.9229	9	0.15499	T	0.54	-2.5972	2.8168	0.05458	0.1874:0.5287:0.1815:0.1023	.	576;448;576;576	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	N	576;576;576;448	ENSP00000365588:D576N;ENSP00000365587:D576N	ENSP00000365587:D576N	D	-	1	0	MDC1	30787972	0.031000	0.19500	0.001000	0.08648	0.006000	0.05464	1.511000	0.35801	0.106000	0.17784	-0.467000	0.05162	GAC	.		0.542	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
HSPA1L	3305	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31778274	31778274	+	Silent	SNP	G	G	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:31778274G>T	ENST00000375654.4	-	2	1665	c.1476C>A	c.(1474-1476)gcC>gcA	p.A492A	HSPA1L_ENST00000417199.3_Silent_p.A492A	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	492					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCTTGTCCGTGGCTGTGACAT	0.542																																					p.A492A		.											.	HSPA1L-230	0			c.C1476A						.						130.0	118.0	122.0					6																	31778274		2203	4300	6503	SO:0001819	synonymous_variant	3305	exon2			GTCCGTGGCTGTG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1476C>A	6.37:g.31778274G>T		217	1		197	35	NM_005527	0	0	0	0	0	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	CCDS34413.1																																																																																			.		0.542	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
SLC39A7	7922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33169242	33169242	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:33169242G>C	ENST00000374677.3	+	1	593	c.220G>C	c.(220-222)Gga>Cga	p.G74R	RXRB_ENST00000374685.4_5'Flank|SLC39A7_ENST00000374675.3_Missense_Mutation_p.G74R|RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000374680.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000413614.2_5'Flank	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	74	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CATCTGGCATGGACATACCCA	0.552																																					p.G74R		.											.	SLC39A7-67	0			c.G220C						.						122.0	123.0	122.0					6																	33169242		2134	4244	6378	SO:0001583	missense	7922	exon1			TGGCATGGACATA	AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.220G>C	6.37:g.33169242G>C	ENSP00000363809:p.Gly74Arg	115	0		100	21	NM_006979	0	0	102	189	87	B0UXF6|Q5STP8|Q9UIQ0	Missense_Mutation	SNP	ENST00000374677.3	37	CCDS43453.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840008	0.51057	.	.	ENSG00000112473	ENST00000374675;ENST00000446283;ENST00000374677	T;T	0.60920	0.15;0.15	4.75	4.75	0.60458	.	0.374050	0.27802	N	0.017796	T	0.30510	0.0767	L	0.27053	0.805	0.45946	D	0.99877	P	0.48162	0.906	B	0.44163	0.443	T	0.06643	-1.0815	10	0.13853	T	0.58	-11.1163	13.1907	0.59709	0.0:0.0:1.0:0.0	.	74	Q92504	S39A7_HUMAN	R	74;55;74	ENSP00000363807:G74R;ENSP00000363809:G74R	ENSP00000363807:G74R	G	+	1	0	SLC39A7	33277220	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.576000	0.53878	2.507000	0.84556	0.289000	0.19496	GGA	.		0.552	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076499.2	NM_006979	
MAPK14	1432	bcgsc.ca	37	6	36040750	36040750	+	Silent	SNP	C	C	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:36040750C>A	ENST00000229794.4	+	4	794	c.406C>A	c.(406-408)Cga>Aga	p.R136R	MAPK14_ENST00000229795.3_Silent_p.R136R|MAPK14_ENST00000310795.4_Silent_p.R136R|MAPK14_ENST00000468133.1_Silent_p.R59R	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						CCAAATTCTCCGAGGTCTAAA	0.373																																					p.R136R	Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)												.	MAPK14-1444	0			c.C406A						.						83.0	79.0	80.0					6																	36040750		2203	4300	6503	SO:0001819	synonymous_variant	1432	exon4			ATTCTCCGAGGTC	L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.406C>A	6.37:g.36040750C>A		53	0		57	4	NM_139012	0	0	2	2	0	A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Silent	SNP	ENST00000229794.4	37	CCDS4816.1																																																																																			.		0.373	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315	
FIG4	9896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110086287	110086287	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:110086287A>T	ENST00000230124.3	+	14	1630	c.1506A>T	c.(1504-1506)aaA>aaT	p.K502N	FIG4_ENST00000441478.2_Missense_Mutation_p.K225N	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	502	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TGGTGGGAAAATGTGCTCTGG	0.393																																					p.K502N		.											.	FIG4-69	0			c.A1506T						.						162.0	144.0	150.0					6																	110086287		2203	4300	6503	SO:0001583	missense	9896	exon14			GGGAAAATGTGCT	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1506A>T	6.37:g.110086287A>T	ENSP00000230124:p.Lys502Asn	114	0		135	25	NM_014845	0	0	21	32	11	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	A	18.84	3.709792	0.68730	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.57436	1.65;0.4	5.22	-7.1	0.01547	Synaptojanin, N-terminal (1);	0.052794	0.64402	D	0.000001	T	0.57198	0.2037	M	0.85859	2.78	0.52501	D	0.999955	D;D	0.64830	0.994;0.973	P;P	0.59424	0.857;0.496	T	0.76130	-0.3072	10	0.59425	D	0.04	-25.2243	16.78	0.85561	0.4032:0.0:0.5968:0.0	.	225;502	F5H8L9;Q92562	.;FIG4_HUMAN	N	225;502	ENSP00000399443:K225N;ENSP00000230124:K502N	ENSP00000230124:K502N	K	+	3	2	FIG4	110192980	0.983000	0.35010	0.502000	0.27614	0.869000	0.49853	0.299000	0.19138	-1.402000	0.02056	-0.924000	0.02725	AAA	.		0.393	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	20778604	20778604	+	Splice_Site	SNP	A	A	G			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:20778604A>G	ENST00000404938.2	+	24	3519		c.e24-1		ABCB5_ENST00000258738.6_Splice_Site	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5						antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATCTTTTGATAGAGTTTTTAC	0.393																																					.		.											.	ABCB5-158	0			c.2868-2A>G						.						59.0	57.0	58.0					7																	20778604		2203	4300	6503	SO:0001630	splice_region_variant	340273	exon24			TTTGATAGAGTTT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2868-1A>G	7.37:g.20778604A>G		51	0		48	7	NM_001163941	0	0	0	0	0	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Splice_Site	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.236102	0.39498	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9637	0.58472	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCB5	20745129	1.000000	0.71417	0.931000	0.37212	0.329000	0.28539	8.421000	0.90259	2.238000	0.73509	0.397000	0.26171	.	.		0.393	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Intron
SBDS	51119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	66459200	66459200	+	Splice_Site	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:66459200T>C	ENST00000246868.2	-	2	440	c.257A>G	c.(256-258)cAg>cGg	p.Q86R	TYW1_ENST00000359626.5_5'Flank	NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	86					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						GTTACCCACCTGCTTACAGAT	0.378			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																												p.Q86R		.	yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	.	SBDS-523	0			c.A257G						.						153.0	133.0	139.0					7																	66459200		2203	4300	6503	SO:0001630	splice_region_variant	51119	exon2	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	CCCACCTGCTTAC	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.258+1A>G	7.37:g.66459200T>C		151	0		188	33	NM_016038	0	0	0	0	0	A8K0P4|Q96FX0|Q9NV53	Missense_Mutation	SNP	ENST00000246868.2	37	CCDS5537.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.209588	0.58343	.	.	ENSG00000126524	ENST00000246868	D	0.96011	-3.88	4.73	4.73	0.59995	Ribosome maturation protein SBDS, N-terminal (2);	0.104529	0.64402	D	0.000002	D	0.92886	0.7737	L	0.45422	1.42	0.58432	D	0.999999	B	0.15930	0.015	B	0.31016	0.123	D	0.89696	0.3901	10	0.32370	T	0.25	-14.8213	12.2034	0.54339	0.0:0.0:0.0:1.0	.	86	Q9Y3A5	SBDS_HUMAN	R	86	ENSP00000246868:Q86R	ENSP00000246868:Q86R	Q	-	2	0	SBDS	66096635	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.470000	0.53100	1.998000	0.58463	0.459000	0.35465	CAG	.		0.378	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038	Missense_Mutation
GPR22	2845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107115465	107115465	+	Silent	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:107115465T>A	ENST00000304402.4	+	3	2303	c.960T>A	c.(958-960)tcT>tcA	p.S320S	COG5_ENST00000393603.2_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000297135.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	320					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TGATTATTTCTACATTTCTTC	0.373																																					p.S320S		.											.	GPR22-92	0			c.T960A						.						112.0	115.0	114.0					7																	107115465		2203	4300	6503	SO:0001819	synonymous_variant	2845	exon3			TATTTCTACATTT	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.960T>A	7.37:g.107115465T>A		129	0		116	22	NM_005295	0	0	0	0	0	O14554	Silent	SNP	ENST00000304402.4	37	CCDS5744.1																																																																																			.		0.373	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1		
IQUB	154865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	123136764	123136764	+	Missense_Mutation	SNP	T	T	C	rs567499713		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:123136764T>C	ENST00000466202.1	-	7	1796	c.1220A>G	c.(1219-1221)tAt>tGt	p.Y407C	IQUB_ENST00000434450.1_Missense_Mutation_p.Y407C|IQUB_ENST00000324698.6_Missense_Mutation_p.Y407C	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	407					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TAATGCATTATAAAGAAATTC	0.308													T|||	1	0.000199681	0.0008	0.0	5008	,	,		16913	0.0		0.0	False		,,,				2504	0.0				p.Y407C		.											.	IQUB-156	0			c.A1220G						.						63.0	60.0	61.0					7																	123136764		2203	4298	6501	SO:0001583	missense	154865	exon7			GCATTATAAAGAA	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1220A>G	7.37:g.123136764T>C	ENSP00000417769:p.Tyr407Cys	85	0		84	17	NM_178827	0	0	0	0	0	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.680750	0.29872	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.58652	1.37;1.37;0.32	5.17	0.946	0.19549	.	0.119152	0.64402	D	0.000016	T	0.73705	0.3621	M	0.83692	2.655	0.45295	D	0.998293	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.969	T	0.75434	-0.3319	10	0.87932	D	0	.	10.8458	0.46743	0.3381:0.0:0.0:0.6619	.	407;407	Q8NA54-2;Q8NA54	.;IQUB_HUMAN	C	407	ENSP00000417769:Y407C;ENSP00000324882:Y407C;ENSP00000388498:Y407C	ENSP00000324882:Y407C	Y	-	2	0	IQUB	122924000	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	1.936000	0.40183	0.309000	0.22966	0.533000	0.62120	TAT	.		0.308	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
BRAF	673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	140453193	140453193	+	Splice_Site	SNP	T	T	C	rs121913370		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:140453193T>C	ENST00000288602.6	-	15	1802	c.1742A>G	c.(1741-1743)aAt>aGt	p.N581S		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> D (in CFC1). {ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404, ECO:0000269|PubMed:18042262}.|N -> S (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N581S(9)|p.N581I(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AAGAAATATATCTGAGGTGTA	0.358		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.N581S	Colon(40;35 892 2973 5743 27438)	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	BRAF-92146	10	Substitution - Missense(10)	large_intestine(3)|lung(3)|skin(2)|ovary(1)|soft_tissue(1)	c.A1742G						.						86.0	83.0	84.0					7																	140453193		2203	4298	6501	SO:0001630	splice_region_variant	673	exon15	Familial Cancer Database	CFC, CFCS	AATATATCTGAGG	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1742-1A>G	7.37:g.140453193T>C		104	0		106	18	NM_004333	0	0	0	0	0	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.68|17.68	3.450518|3.450518	0.63290|0.63290	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|D	.|0.99803	.|-6.82	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99864|0.99864	0.9936|0.9936	H|H	0.96970|0.96970	3.915|3.915	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.96655|0.96655	0.9484|0.9484	5|10	.|0.59425	.|D	.|0.04	.|.	15.9326|15.9326	0.79675|0.79675	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|581	.|P15056	.|BRAF_HUMAN	V|S	189|581	.|ENSP00000288602:N581S	.|ENSP00000288602:N581S	I|N	-|-	1|2	0|0	BRAF|BRAF	140099662|140099662	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.921000|7.921000	0.87530|0.87530	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	ATA|AAT	.		0.358	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	Missense_Mutation
C9orf66	157983	bcgsc.ca	37	9	214551	214551	+	Silent	SNP	G	G	T			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:214551G>T	ENST00000382387.2	-	1	1342	c.846C>A	c.(844-846)ccC>ccA	p.P282P	DOCK8_ENST00000453981.1_5'Flank|DOCK8_ENST00000432829.2_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	282										central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CAGCTTTGTGGGGCTCCCCCG	0.602																																					p.P282P													.	C9orf66-514	0			c.C846A						.						39.0	42.0	41.0					9																	214551		2203	4300	6503	SO:0001819	synonymous_variant	157983	exon1			TTTGTGGGGCTCC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.846C>A	9.37:g.214551G>T		66	0		55	5	NM_152569	0	0	7	8	1	Q96NB0	Silent	SNP	ENST00000382387.2	37	CCDS6439.1																																																																																			.		0.602	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
KIF27	55582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86485505	86485505	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:86485505T>A	ENST00000297814.2	-	12	2829	c.2686A>T	c.(2686-2688)Aaa>Taa	p.K896*	KIF27_ENST00000334204.2_Intron|RP11-575L7.4_ENST00000586211.1_RNA|RP11-575L7.4_ENST00000590368.1_RNA|RP11-575L7.4_ENST00000589233.1_RNA|RP11-575L7.4_ENST00000591217.1_RNA|KIF27_ENST00000413982.1_Nonsense_Mutation_p.K830*|RP11-575L7.4_ENST00000421734.3_RNA|RP11-575L7.4_ENST00000589817.1_RNA	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	896					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TCCTCAGCTTTCGGTTTTAGA	0.363																																					p.K896X		.											.	KIF27-523	0			c.A2686T						.						93.0	88.0	90.0					9																	86485505		2202	4300	6502	SO:0001587	stop_gained	55582	exon12			CAGCTTTCGGTTT	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2686A>T	9.37:g.86485505T>A	ENSP00000297814:p.Lys896*	128	0		143	18	NM_017576	0	0	1	1	0	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Nonsense_Mutation	SNP	ENST00000297814.2	37	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.962159	0.92791	.	.	ENSG00000165115	ENST00000297814;ENST00000413982	.	.	.	3.74	3.74	0.42951	.	0.000000	0.52532	U	0.000067	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9954	0.36050	0.0:0.0:0.0:1.0	.	.	.	.	X	896;830	.	ENSP00000297814:K896X	K	-	1	0	KIF27	85675325	0.392000	0.25229	0.385000	0.26158	0.016000	0.09150	0.777000	0.26718	1.682000	0.51000	0.240000	0.17902	AAA	.		0.363	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
DAPK1	1612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	90254289	90254289	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:90254289G>C	ENST00000408954.3	+	5	779	c.444G>C	c.(442-444)ttG>ttC	p.L148F	DAPK1_ENST00000469640.2_Missense_Mutation_p.L148F|DAPK1_ENST00000358077.5_Missense_Mutation_p.L148F|DAPK1_ENST00000491893.1_Missense_Mutation_p.L148F|DAPK1_ENST00000472284.1_Missense_Mutation_p.L148F	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TAATGCTTTTGGATAGAAATG	0.363									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.L148F		.											.	DAPK1-359	0			c.G444C						.						86.0	82.0	83.0					9																	90254289		1807	4078	5885	SO:0001583	missense	1612	exon5	Familial Cancer Database	Familial CLL	GCTTTTGGATAGA	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.444G>C	9.37:g.90254289G>C	ENSP00000386135:p.Leu148Phe	165	0		179	27	NM_004938	0	0	27	34	7	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.264980	0.59431	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.42	3.59	0.41128	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40728	N	0.001036	T	0.61714	0.2369	N	0.17800	0.525	0.58432	D	0.999993	P;P;D	0.76494	0.838;0.93;0.999	B;P;D	0.81914	0.41;0.51;0.995	T	0.62258	-0.6892	10	0.59425	D	0.04	.	7.0523	0.25079	0.1427:0.0:0.7183:0.139	.	148;148;148	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	F	148	ENSP00000350785:L148F;ENSP00000417076:L148F;ENSP00000418885:L148F;ENSP00000386135:L148F;ENSP00000419026:L148F	ENSP00000350785:L148F	L	+	3	2	DAPK1	89444109	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.692000	0.47018	0.850000	0.35239	-0.244000	0.11960	TTG	.		0.363	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
PSMD5	5711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	123591454	123591454	+	Silent	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:123591454T>C	ENST00000210313.3	-	5	668	c.594A>G	c.(592-594)gaA>gaG	p.E198E	PSMD5-AS1_ENST00000589026.1_RNA|PSMD5_ENST00000373904.5_Silent_p.E155E	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	198					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						AGTTTAAAGATTCTGGTGACA	0.398																																					p.E198E		.											.	PSMD5-90	0			c.A594G						.						99.0	100.0	100.0					9																	123591454		2203	4300	6503	SO:0001819	synonymous_variant	5711	exon5			TAAAGATTCTGGT	AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.594A>G	9.37:g.123591454T>C		94	0		110	17	NM_005047	0	0	7	12	5	B4DZM8|Q15045|Q4VXG8	Silent	SNP	ENST00000210313.3	37	CCDS6824.1																																																																																			.		0.398	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053825.2	NM_005047	
SPTAN1	6709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131339498	131339498	+	Silent	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:131339498T>C	ENST00000372731.4	+	7	986	c.876T>C	c.(874-876)gcT>gcC	p.A292A	SPTAN1_ENST00000358161.5_Silent_p.A292A|SPTAN1_ENST00000372739.3_Silent_p.A292A	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	292					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GTGTTCAGGCTCTGCTTCGGA	0.473																																					p.A292A	NSCLC(120;833 1744 2558 35612 37579)	.											.	SPTAN1-158	0			c.T876C						.						134.0	136.0	135.0					9																	131339498		2203	4300	6503	SO:0001819	synonymous_variant	6709	exon7			TCAGGCTCTGCTT	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.876T>C	9.37:g.131339498T>C		201	0		203	43	NM_003127	0	0	41	61	20	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																			.		0.473	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
OBP2B	29989	hgsc.bcm.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000372032.2_Intron|OBP2B_ENST00000461961.1_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N		.											.	OBP2B-68	1	Substitution - Missense(1)	large_intestine(1)	c.G183C						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989	exon2			TTCCAACTTCCCA	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	57	1		25	2	NM_014581	0	0	0	0	0	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG	.		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
KCNT1	57582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	138683918	138683918	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr9:138683918G>A	ENST00000263604.3	+	31	3604	c.3604G>A	c.(3604-3606)Gtg>Atg	p.V1202M	KCNT1_ENST00000488444.2_Missense_Mutation_p.V1207M|KCNT1_ENST00000371757.2_Missense_Mutation_p.V1207M|KCNT1_ENST00000486577.2_Missense_Mutation_p.V1185M|KCNT1_ENST00000490355.2_Missense_Mutation_p.V1206M|KCNT1_ENST00000298480.5_Missense_Mutation_p.V1228M|KCNT1_ENST00000487664.1_Missense_Mutation_p.V1183M|KCNT1_ENST00000491806.2_Missense_Mutation_p.V1193M			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	1202					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CCTGGCTCACGTGGCCAGCAG	0.677																																					p.V1207M		.											.	KCNT1-137	0			c.G3619A						.						23.0	25.0	25.0					9																	138683918		2201	4299	6500	SO:0001583	missense	57582	exon31			GCTCACGTGGCCA	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.3604G>A	9.37:g.138683918G>A	ENSP00000263604:p.Val1202Met	24	0		42	7	NM_020822	0	0	0	0	0	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	G	13.10	2.136017	0.37728	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.25912	1.84;1.86;1.77;1.84	4.86	2.02	0.26589	.	0.135507	0.49305	N	0.000146	T	0.19565	0.0470	L	0.46157	1.445	0.43043	D	0.994636	B;B;B	0.32365	0.058;0.251;0.367	B;B;B	0.27500	0.027;0.037;0.08	T	0.03898	-1.0994	10	0.41790	T	0.15	-41.9415	9.4906	0.38958	0.2237:0.0:0.7763:0.0	.	1195;1207;1183	C9JYL2;B9EGP2;G5E9V0	.;.;.	M	1183;1228;1207;1187;1195;1209;1207;1202	ENSP00000417851:V1183M;ENSP00000298480:V1228M;ENSP00000360822:V1207M;ENSP00000263604:V1202M	ENSP00000263604:V1202M	V	+	1	0	KCNT1	137823739	1.000000	0.71417	0.999000	0.59377	0.475000	0.33008	2.313000	0.43735	0.132000	0.18615	0.561000	0.74099	GTG	.		0.677	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
ARSD	414	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	2826885	2826885	+	Splice_Site	SNP	T	T	C			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chrX:2826885T>C	ENST00000381154.1	-	9	1374		c.e9-2		ARSD-AS1_ENST00000414053.1_RNA	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCAATCACCCTGATTTCATGA	0.557																																					.													.	ARSD-130	0			c.1299-2A>G						.						88.0	60.0	69.0					X																	2826885		2203	4300	6503	SO:0001630	splice_region_variant	414	exon10			TCACCCTGATTTC	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1299-2A>G	X.37:g.2826885T>C		22	0		25	7	NM_001669	0	0	0	0	0	Q9UHJ8	Splice_Site	SNP	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	T	4.507	0.094091	0.08632	.	.	ENSG00000006756	ENST00000381154;ENST00000458014	.	.	.	2.53	2.53	0.30540	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2604	0.43423	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARSD	2836885	1.000000	0.71417	0.407000	0.26434	0.177000	0.22998	5.771000	0.68881	0.883000	0.36040	0.233000	0.17823	.	.		0.557	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		Intron
GRIP1	23426	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	66838463	66838463	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr12:66838463delT	ENST00000398016.3	-	12	1500	c.1432delA	c.(1432-1434)attfs	p.I478fs	GRIP1_ENST00000286445.7_Frame_Shift_Del_p.I530fs|GRIP1_ENST00000359742.4_Frame_Shift_Del_p.I530fs	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCTGTTGGAATTCCATTGATG	0.458																																					p.I478fs		.											.	GRIP1-494	0			c.1432delA						.						136.0	131.0	133.0					12																	66838463		1962	4135	6097	SO:0001589	frameshift_variant	23426	exon12			.	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1432delA	12.37:g.66838463delT	ENSP00000381098:p.Ile478fs	118	0		106	22	NM_001178074	0	0	0	0	0	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Frame_Shift_Del	DEL	ENST00000398016.3	37	CCDS41807.1																																																																																			.		0.458	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	36382392	36382396	+	Frame_Shift_Del	DEL	GGAGA	GGAGA	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	GGAGA	GGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr13:36382392_36382396delGGAGA	ENST00000360631.3	-	14	2039_2043	c.1828_1832delTCTCC	c.(1828-1833)tctccafs	p.SP610fs	DCLK1_ENST00000255448.4_Frame_Shift_Del_p.SP610fs|DCLK1_ENST00000379893.1_Frame_Shift_Del_p.SP303fs			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	610	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.P611S(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ATCCCAGTATGGAGAAGGAAAGTCC	0.424																																					p.610_611del		.											.	DCLK1-826	1	Substitution - Missense(1)	skin(1)	c.1828_1832del						.																																			SO:0001589	frameshift_variant	9201	exon14			.	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1828_1832delTCTCC	13.37:g.36382392_36382396delGGAGA	ENSP00000353846:p.Ser610fs	170	0		175	35	NM_004734	0	0	0	0	0	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Frame_Shift_Del	DEL	ENST00000360631.3	37																																																																																				.		0.424	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
F10	2159	broad.mit.edu;bcgsc.ca	37	13	113803360	113803360	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr13:113803360delC	ENST00000375559.3	+	8	1034	c.996delC	c.(994-996)atcfs	p.I332fs	F10_ENST00000375551.3_Frame_Shift_Del_p.S329fs|F10_ENST00000409306.1_Frame_Shift_Del_p.S331fs	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	332	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	AGACCCCCATCACCTTCCGCA	0.632																																					p.I332fs													.	F10-227	0			c.996delC						.						154.0	120.0	132.0					13																	113803360		2203	4300	6503	SO:0001589	frameshift_variant	2159	exon8			CCCCATCACCTTC		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.996delC	13.37:g.113803360delC	ENSP00000364709:p.Ile332fs	166	0		184	26	NM_000504	0	0	0	0	0	Q14340	Frame_Shift_Del	DEL	ENST00000375559.3	37	CCDS9530.1																																																																																			.		0.632	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	45667882	45667882	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr14:45667882delT	ENST00000267430.5	+	22	5837	c.5752delT	c.(5752-5754)tatfs	p.Y1918fs	FANCM_ENST00000542564.2_Frame_Shift_Del_p.Y1892fs	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1918	Interaction with FAAP24 and EME1.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AACAAAGAGCTATGACAGCCT	0.363								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Y1918fs		.											.	FANCM-569	0			c.5752delT						.						84.0	83.0	83.0					14																	45667882		2203	4300	6503	SO:0001589	frameshift_variant	57697	exon22	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	.	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5752delT	14.37:g.45667882delT	ENSP00000267430:p.Tyr1918fs	126	0		107	22	NM_020937	0	0	0	0	0	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Frame_Shift_Del	DEL	ENST00000267430.5	37	CCDS32070.1																																																																																			.		0.363	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30723210	30723210	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:30723210delA	ENST00000262518.4	+	12	1932	c.1547delA	c.(1546-1548)gaafs	p.E516fs	SRCAP_ENST00000395059.2_Frame_Shift_Del_p.E516fs|SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Frame_Shift_Del_p.E516fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	516	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAGGAGGAAGAAACAAGTGGA	0.473																																					p.E516fs		.											.	SRCAP-94	0			c.1547delA						.						74.0	71.0	72.0					16																	30723210		2197	4300	6497	SO:0001589	frameshift_variant	10847	exon12			.	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1547delA	16.37:g.30723210delA	ENSP00000262518:p.Glu516fs	73	0		78	13	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Del	DEL	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.473	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SH3BP4	23677	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	235962373	235962373	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr2:235962373delC	ENST00000409212.1	+	6	3312	c.2805delC	c.(2803-2805)ctcfs	p.L935fs	SH3BP4_ENST00000344528.4_Frame_Shift_Del_p.L935fs|SH3BP4_ENST00000392011.2_Frame_Shift_Del_p.L935fs			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	935					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGAAGCACCTCACTGGGACTC	0.592																																					p.L935fs		.											.	SH3BP4-94	0			c.2805delC						.						173.0	164.0	167.0					2																	235962373		2203	4300	6503	SO:0001589	frameshift_variant	23677	exon6			.	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.2805delC	2.37:g.235962373delC	ENSP00000386862:p.Leu935fs	247	0		163	34	NM_014521	0	0	0	0	0	O95082|Q309A3|Q53QD0|Q53TD1	Frame_Shift_Del	DEL	ENST00000409212.1	37	CCDS2513.1																																																																																			.		0.592	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	38891987	38891988	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr3:38891987_38891988delGC	ENST00000302328.3	-	25	4509_4510	c.4311_4312delGC	c.(4309-4314)gtgcttfs	p.L1439fs	SCN11A_ENST00000450244.1_Frame_Shift_Del_p.L1439fs|SCN11A_ENST00000444237.2_Frame_Shift_Del_p.L1439fs|SCN11A_ENST00000456224.3_Frame_Shift_Del_p.L1401fs	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1439					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGAAAGAAGCACGACCACAC	0.347																																					p.1437_1438del		.											.	SCN11A-99	0			c.4311_4312del						.																																			SO:0001589	frameshift_variant	11280	exon25			.	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4311_4312delGC	3.37:g.38891987_38891988delGC	ENSP00000307599:p.Leu1439fs	121	0		136	39	NM_014139	0	0	0	0	0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Frame_Shift_Del	DEL	ENST00000302328.3	37	CCDS33737.1																																																																																			.		0.347	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
CABS1	85438	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	71201158	71201158	+	Frame_Shift_Del	DEL	T	T	-	rs367634444		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr4:71201158delT	ENST00000273936.5	+	1	476	c.402delT	c.(400-402)gatfs	p.D134fs		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	134					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTTTAATAGATTTTTCCACTG	0.383																																					p.D134fs		.											.	CABS1-93	0			c.402delT						.						54.0	54.0	54.0					4																	71201158		2203	4298	6501	SO:0001589	frameshift_variant	85438	exon1			.	AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.402delT	4.37:g.71201158delT	ENSP00000273936:p.Asp134fs	95	0		116	23	NM_033122	0	0	0	0	0	B2RCB5|Q86UE0|Q96M17	Frame_Shift_Del	DEL	ENST00000273936.5	37	CCDS3539.1																																																																																			.		0.383	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122	
TPBG	7162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	83075159	83075159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:83075159delG	ENST00000369750.3	+	2	1098	c.481delG	c.(481-483)gctfs	p.A161fs	TPBG_ENST00000543496.1_Frame_Shift_Del_p.A161fs|TPBG_ENST00000535040.1_Frame_Shift_Del_p.A161fs			Q13641	TPBG_HUMAN	trophoblast glycoprotein	161					cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CAGTCCCTTCGCTTTCTCGGG	0.667																																					p.A161fs		.											.	TPBG-514	0			c.481delG						.						76.0	82.0	80.0					6																	83075159		2203	4300	6503	SO:0001589	frameshift_variant	7162	exon2			.	AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.481delG	6.37:g.83075159delG	ENSP00000358765:p.Ala161fs	245	0		204	31	NM_001166392	0	0	0	0	0	A8K555	Frame_Shift_Del	DEL	ENST00000369750.3	37	CCDS4995.1																																																																																			.		0.667	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041340.1		
OR8I2	120586	broad.mit.edu	37	11	55861307	55861308	+	Frame_Shift_Ins	INS	-	-	T	rs201548817|rs112181516|rs144690814	byFrequency	TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:55861307_55861308insT	ENST00000302124.2	+	1	555_556	c.524_525insT	c.(523-528)cattttfs	p.HF175fs		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H175fs*10(1)|p.C178fs*2(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					AGCATCAATCATTTTTTTTGTG	0.441																																					p.H175fs													.	OR8I2-113	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	ovary(1)|large_intestine(1)	c.524_525insT						.			0,4264		0,0,2132						3.2	1.0		dbSNP_132	145	1,8253		0,1,4126	no	frameshift	OR8I2	NM_001003750.1		0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12517				SO:0001589	frameshift_variant	120586	exon1			TCAATCATTTTTT	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.532dupT	11.37:g.55861315_55861315dupT	ENSP00000303864:p.His175fs	226	0		207	7	NM_001003750	0	0	0	0	0	B2RNN4|Q6IFC0|Q96RC5	Frame_Shift_Ins	INS	ENST00000302124.2	37	CCDS31517.1																																																																																			-|0.500;T|0.500		0.441	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
CNOT1	23019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	58633189	58633190	+	Frame_Shift_Ins	INS	-	-	CCAC			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr16:58633189_58633190insCCAC	ENST00000317147.5	-	2	384_385	c.52_53insGTGG	c.(52-54)gacfs	p.D18fs	CNOT1_ENST00000569240.1_Frame_Shift_Ins_p.D18fs|CNOT1_ENST00000441024.2_Frame_Shift_Ins_p.D18fs	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	18				D -> G (in Ref. 1; CAD97851). {ECO:0000305}.	gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGTTAAATTGTCCACCAGGTAG	0.49																																					p.D18fs		.											.	CNOT1-95	0			c.53_54insGTGG						.																																			SO:0001589	frameshift_variant	23019	exon2			.	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.49_52dupGTGG	16.37:g.58633190_58633193dupCCAC	ENSP00000320949:p.Asp18fs	95	0		121	25	NM_016284	0	0	0	0	0	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Ins	INS	ENST00000317147.5	37	CCDS10799.1																																																																																			.		0.490	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
LMBRD1	55788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	70451754	70451755	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr6:70451754_70451755insAA	ENST00000370577.3	-	6	717_718	c.488_489insTT	c.(487-489)ttgfs	p.L163fs	LMBRD1_ENST00000370570.1_Frame_Shift_Ins_p.L90fs	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	163					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TGGGAACATTCAATGGAACAAA	0.267																																					p.L163fs		.											.	LMBRD1-91	0			c.489_490insTT						.																																			SO:0001589	frameshift_variant	55788	exon6			.	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.487_488dupTT	6.37:g.70451755_70451756dupAA	ENSP00000359609:p.Leu163fs	95	0		90	14	NM_018368	0	0	0	0	0	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Frame_Shift_Ins	INS	ENST00000370577.3	37	CCDS4969.1																																																																																			.		0.267	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
RHOBTB1	9886	hgsc.bcm.edu;broad.mit.edu	37	10	62648933	62648934	+	Nonsense_Mutation	DNP	TC	TC	AG			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr10:62648933_62648934TC>AG	ENST00000337910.5	-	6	829_830	c.492_493GA>CT	c.(490-495)aaGAga>aaCTga	p.164_165KR>N*	RHOBTB1_ENST00000357917.4_Nonsense_Mutation_p.164_165KR>N*	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	164	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					ATATCCCCTCTCTTTATGGGCC	0.391																																					p.KR164N*		.											.	RHOBTB1	0			c.G492C						.																																			SO:0001587	stop_gained	9886	exon6			CCCTCTCTTTATG	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.492_493delinsAG	10.37:g.62648933_62648934delinsAG	ENSP00000338671:p.K164_R165delinsN*	107.0	1.0		119.0	13.0		0	0	0	0	0		Nonsense_Mutation	DNP	ENST00000337910.5	37	CCDS7261.1																																																																																			.		0.391	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
OR5D14	219436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55563325	55563326	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr11:55563325_55563326CT>AA	ENST00000335605.1	+	1	294_295	c.294_295CT>AA	c.(292-297)agCTgc>agAAgc	p.98_99SC>RS		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TCTACTTTAGCTGCATGATGCA	0.455																																					p.SC98RS		.											.	OR5D14	0			c.T295A						.																																			SO:0001583	missense	219436	exon1			TTTAGCTGCATGA	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	Exception_encountered	11.37:g.55563325_55563326delinsAA	ENSP00000334456:p.S98_C99delinsRS	91.0	0.0		81.0	7.0		0	0	0	0	0	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	DNP	ENST00000335605.1	37	CCDS31508.1																																																																																			.		0.455	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
NPEPPS	9520	hgsc.bcm.edu;broad.mit.edu	37	17	45699223	45699224	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr17:45699223_45699224GC>TT	ENST00000322157.4	+	23	2934_2935	c.2697_2698GC>TT	c.(2695-2700)aaGCga>aaTTga	p.899_900KR>N*	RP11-580I16.2_ENST00000582066.1_RNA|NPEPPS_ENST00000530173.1_Nonsense_Mutation_p.895_896KR>N*|RP11-580I16.2_ENST00000582389.1_RNA|NPEPPS_ENST00000544660.1_Nonsense_Mutation_p.819_820KR>N*|RP11-580I16.2_ENST00000584391.1_RNA	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	899					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						CCTGGCTAAAGCGAGATGCTGA	0.54																																					p.KR899N*		.											.	NPEPPS	0			c.C2698T						.																																			SO:0001587	stop_gained	9520	exon23			CTAAAGCGAGATG	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	Exception_encountered	17.37:g.45699223_45699224delinsTT	ENSP00000320324:p.K899_R900delinsN*	60.0	0.0		54.0	4.0		0	0	0	0	0	B7Z463|Q6P145|Q9NP16|Q9UEM2	Nonsense_Mutation	DNP	ENST00000322157.4	37	CCDS45721.1																																																																																			.		0.540	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
AGR2	10551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	16837318	16837319	+	Splice_Site	DNP	AC	AC	GA	rs571596748		TCGA-B1-5398-01A-02D-1589-08	TCGA-B1-5398-10A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	de6c652a-86c7-4cc3-b7ad-db199a1c4c7a	b2dcd77d-e773-4e2b-9af9-173ffcc421d0	g.chr7:16837318_16837319AC>GA	ENST00000419304.2	-	6	483	c.331_331GT>TC	c.(331-333)GTta>TCtta	p.V111S	AGR2_ENST00000419572.2_Splice_Site_p.V131S|AGR2_ENST00000401412.1_Splice_Site_p.V111S	NM_006408.3	NP_006399.1	O95994	AGR2_HUMAN	anterior gradient 2	111					lung goblet cell differentiation (GO:0060480)|mucus secretion (GO:0070254)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	dystroglycan binding (GO:0002162)			endometrium(2)|lung(1)|prostate(1)|skin(2)	6	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		GTTGTTTCATACTAAAATAAAA	0.381																																					.		.											.	AGR2	0			c.331-1G>T						.																																			SO:0001630	splice_region_variant	10551	exon7			TTCATACTAAAAT	AF038451	CCDS5364.1	7p21.3	2013-07-31	2013-07-31		ENSG00000106541	ENSG00000106541		"""Protein disulfide isomerases"""	328	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 17"""	606358	"""anterior gradient 2 homolog (Xenopus laevis)"""			9790916	Standard	NM_006408		Approved	XAG-2, HAG-2, AG2, PDIA17	uc003str.3	O95994	OTTHUMG00000023446	ENST00000419304.2:c.331_331delinsGA	7.37:g.16837318_16837319delinsGA		64.0	0.0		59.0	13.0		0	0	0	0	0		Splice_Site	DNP	ENST00000419304.2	37	CCDS5364.1																																																																																			.		0.381	AGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207594.2	NM_006408	Missense_Mutation
