#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZCCHC17	51538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	31836979	31836979	+	Missense_Mutation	SNP	A	A	C	rs111803813		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:31836979A>C	ENST00000373714.1	+	8	926	c.665A>C	c.(664-666)gAc>gCc	p.D222A	ZCCHC17_ENST00000422613.2_Missense_Mutation_p.D224A|ZCCHC17_ENST00000344147.5_Missense_Mutation_p.D222A|FABP3_ENST00000497275.1_5'Flank|ZCCHC17_ENST00000546109.1_Missense_Mutation_p.D214A	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	222	Lys-rich.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		ACATCAAAAGACAGCAAGGCA	0.433																																					p.D222A		.											.	ZCCHC17-91	0			c.A665C						.						82.0	86.0	85.0					1																	31836979		2203	4300	6503	SO:0001583	missense	51538	exon8			CAAAAGACAGCAA	AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.665A>C	1.37:g.31836979A>C	ENSP00000362819:p.Asp222Ala	99	0		133	23	NM_016505	0	0	32	41	9	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	37	CCDS341.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025038	0.54683	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	.	.	.	5.08	5.08	0.68730	.	0.376195	0.32055	N	0.006643	T	0.41488	0.1161	N	0.19112	0.55	0.25685	N	0.98575	D;B;B	0.69078	0.997;0.023;0.008	D;B;B	0.75484	0.986;0.007;0.001	T	0.23904	-1.0175	9	0.66056	D	0.02	.	9.0275	0.36239	0.814:0.186:0.0:0.0	.	224;214;222	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	A	222;222;214;224	.	ENSP00000343557:D222A	D	+	2	0	ZCCHC17	31609566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.513000	0.45494	2.135000	0.66039	0.528000	0.53228	GAC	G|1.000;|0.000		0.433	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505	
ADAM30	11085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120436921	120436921	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:120436921C>T	ENST00000369400.1	-	1	2197	c.2039G>A	c.(2038-2040)gGg>gAg	p.G680E		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	680					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GGGAATCGCCCCTCTGAGCAG	0.473																																					p.G680E		.											.	ADAM30-228	0			c.G2039A						.						65.0	64.0	64.0					1																	120436921		2203	4300	6503	SO:0001583	missense	11085	exon1			ATCGCCCCTCTGA	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2039G>A	1.37:g.120436921C>T	ENSP00000358407:p.Gly680Glu	65	0		95	31	NM_021794	0	0	0	0	0	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.021307	0.00414	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01126	5.3	5.05	-10.1	0.00402	.	3.564080	0.01402	N	0.013659	T	0.00109	0.0003	N	0.05031	-0.125	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.47394	-0.9121	10	0.02654	T	1	.	1.9545	0.03373	0.4755:0.1902:0.2118:0.1224	.	680	Q9UKF2	ADA30_HUMAN	E	680	ENSP00000358407:G680E	ENSP00000358407:G680E	G	-	2	0	ADAM30	120238444	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-4.800000	0.00031	-1.047000	0.02352	GGG	.		0.473	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
AIM2	9447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	159033450	159033450	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:159033450C>G	ENST00000368130.4	-	5	1119	c.831G>C	c.(829-831)aaG>aaC	p.K277N	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	277	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					ATATGTTTTTCTTCTTTTCTG	0.398																																					p.K277N		.											.	AIM2-93	0			c.G831C						.						117.0	121.0	120.0					1																	159033450		2203	4300	6503	SO:0001583	missense	9447	exon5			GTTTTTCTTCTTT	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.831G>C	1.37:g.159033450C>G	ENSP00000357112:p.Lys277Asn	167	0		199	60	NM_004833	0	0	2	2	0	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	ENST00000368130.4	37	CCDS1181.1	.	.	.	.	.	.	.	.	.	.	C	2.160	-0.392489	0.04899	.	.	ENSG00000163568	ENST00000368130;ENST00000368129	T;T	0.14266	2.52;2.52	3.92	-4.82	0.03171	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	1.433050	0.05063	N	0.480252	T	0.01558	0.0050	N	0.17723	0.515	0.09310	N	1	B	0.21606	0.058	B	0.19391	0.025	T	0.42816	-0.9429	10	0.14252	T	0.57	-0.6466	1.0125	0.01500	0.1428:0.2093:0.2823:0.3657	.	277	O14862	AIM2_HUMAN	N	277;140	ENSP00000357112:K277N;ENSP00000357111:K140N	ENSP00000357111:K140N	K	-	3	2	AIM2	157300074	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.991000	0.03728	-0.739000	0.04809	-1.099000	0.02127	AAG	.		0.398	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833	
GLUL	2752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	182356292	182356292	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:182356292A>T	ENST00000331872.6	-	3	842	c.302T>A	c.(301-303)gTt>gAt	p.V101D	GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000339526.4_Missense_Mutation_p.V101D|GLUL_ENST00000311223.5_Missense_Mutation_p.V101D|GLUL_ENST00000417584.2_Missense_Mutation_p.V101D	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	101					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GTACTTGAAAACTTCACATAA	0.493																																					p.V101D		.											.	GLUL-90	0			c.T302A						.						112.0	101.0	105.0					1																	182356292		2203	4300	6503	SO:0001583	missense	2752	exon3			TTGAAAACTTCAC	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.302T>A	1.37:g.182356292A>T	ENSP00000356537:p.Val101Asp	109	0		106	10	NM_001033056	0	0	164	194	30	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	ENST00000331872.6	37	CCDS1344.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704904	0.88924	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526;ENST00000435013	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	4.79	4.79	0.61399	Glutamine synthetase, beta-Grasp (3);	0.057690	0.64402	D	0.000002	T	0.78534	0.4298	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84301	0.0505	10	0.72032	D	0.01	-23.933	13.4137	0.60956	1.0:0.0:0.0:0.0	.	101	P15104	GLNA_HUMAN	D	101	ENSP00000356537:V101D;ENSP00000307900:V101D;ENSP00000398320:V101D;ENSP00000344958:V101D	ENSP00000307900:V101D	V	-	2	0	GLUL	180622915	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	8.881000	0.92415	1.897000	0.54924	0.533000	0.62120	GTT	.		0.493	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1099777	1099777	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr11:1099777T>C	ENST00000441003.2	+	40	7401	c.7374T>C	c.(7372-7374)ccT>ccC	p.P2458P		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4820					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GTGTGGGACCTGACAATGTGC	0.572																																					p.P2454P		.											.	MUC2-90	0			c.T7362C						.						140.0	152.0	148.0					11																	1099777		2080	4206	6286	SO:0001819	synonymous_variant	4583	exon41			GGGACCTGACAAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7374T>C	11.37:g.1099777T>C		174	0		137	54	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.572	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
A2ML1	144568	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	9000291	9000291	+	Silent	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:9000291C>T	ENST00000299698.7	+	15	2010	c.1830C>T	c.(1828-1830)cgC>cgT	p.R610R	A2ML1_ENST00000540049.1_3'UTR|A2ML1_ENST00000539547.1_Silent_p.R119R	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGAGCAACCGCTCTGTGAGTA	0.557																																					p.R610R		.											.	A2ML1-93	0			c.C1830T						.						78.0	77.0	78.0					12																	9000291		1955	4145	6100	SO:0001819	synonymous_variant	144568	exon15			CAACCGCTCTGTG	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1830C>T	12.37:g.9000291C>T		173	0		199	15	NM_144670	0	0	0	0	0		Silent	SNP	ENST00000299698.7	37	CCDS8596.2																																																																																			.		0.557	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
DDX12P	440081	ucsc.edu	37	12	9578146	9578146	+	IGR	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:9578146G>A								RP13-735L24.1 (27933 upstream) : SNORA75 (19507 downstream)																							GCATCAGTGGGGAAGCTGGTT	0.617																																					.													.	.	0			.						.						67.0	76.0	73.0					12																	9578146		692	1591	2283	SO:0001628	intergenic_variant	440081	.			CAGTGGGGAAGCT																													12.37:g.9578146G>A		86	3		81	2	.	0	0	8	8	0		RNA	SNP		37																																																																																				.	0	0.617								
TMEM5	10329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	64174892	64174892	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:64174892T>G	ENST00000261234.6	+	2	421	c.263T>G	c.(262-264)tTa>tGa	p.L88*	TMEM5_ENST00000537982.1_3'UTR|TMEM5_ENST00000537373.1_5'UTR|RP11-415I12.3_ENST00000509615.2_RNA	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	88						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		CTTCAAATATTAGATAAATCC	0.363																																					p.L88X		.											.	TMEM5-90	0			c.T263G						.						82.0	89.0	86.0					12																	64174892		2203	4300	6503	SO:0001587	stop_gained	10329	exon2			AAATATTAGATAA	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.263T>G	12.37:g.64174892T>G	ENSP00000261234:p.Leu88*	163	0		247	85	NM_014254	0	0	14	23	9	A8K017|Q6PKD6	Nonsense_Mutation	SNP	ENST00000261234.6	37	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051948	0.75960	.	.	ENSG00000118600	ENST00000261234	.	.	.	4.34	4.34	0.51931	.	0.447903	0.20965	N	0.082490	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.428	10.4561	0.44550	0.0:0.0:0.0:1.0	.	.	.	.	X	88	.	.	L	+	2	0	TMEM5	62461159	0.996000	0.38824	0.945000	0.38365	0.457000	0.32468	4.615000	0.61190	1.897000	0.54924	0.402000	0.26972	TTA	.		0.363	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
PPP1R12A	4659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	80203769	80203769	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:80203769T>G	ENST00000450142.2	-	10	1527	c.1261A>C	c.(1261-1263)Att>Ctt	p.I421L	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.I421L|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.I421L|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.I421L|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.I334L	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	421					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TTGGGAGAAATTTTTGTAGCT	0.363																																					p.I421L		.											.	PPP1R12A-273	0			c.A1261C						.						86.0	76.0	79.0					12																	80203769		1802	4069	5871	SO:0001583	missense	4659	exon10			GAGAAATTTTTGT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1261A>C	12.37:g.80203769T>G	ENSP00000389168:p.Ile421Leu	45	0		70	21	NM_002480	0	0	22	31	9	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	CCDS44947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.128|2.128	-0.399892|-0.399892	0.04865|0.04865	.|.	.|.	ENSG00000058272|ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000547131|ENST00000553081	T;T;T;T;T;T;T|T	0.39997|0.34667	1.43;1.43;1.45;1.49;1.44;1.44;1.05|1.35	5.86|5.86	0.0418|0.0418	0.14214|0.14214	.|.	0.725412|.	0.14249|.	N|.	0.331574|.	T|T	0.18045|0.18045	0.0433|0.0433	N|N	0.03608|0.03608	-0.345|-0.345	0.26994|0.26994	N|N	0.965072|0.965072	B;B;B;B|.	0.24823|.	0.112;0.002;0.0;0.0|.	B;B;B;B|.	0.20384|.	0.029;0.001;0.0;0.0|.	T|T	0.26224|0.26224	-1.0109|-1.0109	10|7	0.08381|0.54805	T|T	0.77|0.06	.|.	9.6186|9.6186	0.39708|0.39708	0.0:0.558:0.0:0.442|0.0:0.558:0.0:0.442	.|.	421;421;421;421|.	F8W8Q6;O14974-2;O14974-3;O14974|.	.;.;.;MYPT1_HUMAN|.	L|N	421;421;421;421;421;421;421;334;421;421;116|24	ENSP00000261207:I421L;ENSP00000389168:I421L;ENSP00000416769:I421L;ENSP00000449514:I334L;ENSP00000446855:I421L;ENSP00000446816:I421L;ENSP00000450061:I116L|ENSP00000447144:K24N	ENSP00000261207:I421L|ENSP00000447144:K24N	I|K	-|-	1|3	0|2	PPP1R12A|PPP1R12A	78727900|78727900	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.852000|0.852000	0.48524|0.48524	0.848000|0.848000	0.27710|0.27710	0.016000|0.016000	0.14998|0.14998	0.467000|0.467000	0.42956|0.42956	ATT|AAA	.		0.363	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
P2RX7	5027	hgsc.bcm.edu	37	12	121622232	121622232	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:121622232A>G	ENST00000546057.1	+	13	1558	c.1415A>G	c.(1414-1416)gAt>gGt	p.D472G	P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000535250.1_Missense_Mutation_p.D382G|P2RX7_ENST00000541446.1_Missense_Mutation_p.D183G|P2RX7_ENST00000328963.5_Missense_Mutation_p.D302G	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	472					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGATCCAGGGATAGCCCCGTC	0.617																																					p.D472G		.											.	P2RX7-268	0			c.A1415G						.						67.0	63.0	64.0					12																	121622232		2203	4300	6503	SO:0001583	missense	5027	exon13			CCAGGGATAGCCC	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.1415A>G	12.37:g.121622232A>G	ENSP00000442349:p.Asp472Gly	77	0		68	4	NM_002562	0	0	13	13	0	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	37	CCDS9213.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.721694	0.48728	.	.	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250;ENST00000541446	T;T;T;T	0.05081	4.39;4.01;4.18;3.5	5.21	-0.0551	0.13811	.	1.055260	0.07477	N	0.903142	T	0.06188	0.0160	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.08055	0.003;0.002;0.003;0.002	T	0.41980	-0.9478	10	0.38643	T	0.18	.	5.215	0.15338	0.6048:0.1445:0.2507:0.0	.	302;183;382;472	F8W951;F5H6P2;F5H7E8;Q99572	.;.;.;P2RX7_HUMAN	G	472;302;382;183	ENSP00000442349:D472G;ENSP00000330696:D302G;ENSP00000442572:D382G;ENSP00000437471:D183G	ENSP00000330696:D302G	D	+	2	0	P2RX7	120106615	0.000000	0.05858	0.091000	0.20842	0.830000	0.47004	-0.143000	0.10296	0.321000	0.23259	0.482000	0.46254	GAT	.		0.617	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	NM_002562	
PCDH8	5100	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	53422307	53422307	+	Missense_Mutation	SNP	C	C	T	rs570624635	byFrequency	TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr13:53422307C>T	ENST00000377942.3	-	1	468	c.265G>A	c.(265-267)Ggc>Agc	p.G89S	PCDH8_ENST00000338862.4_Missense_Mutation_p.G89S	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	89	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGGTCCAGGCCGGCGTCCCCG	0.657																																					p.G89S	GBM(36;25 841 9273 49207)	.											.	PCDH8-153	0			c.G265A						.						35.0	38.0	37.0					13																	53422307		2201	4296	6497	SO:0001583	missense	5100	exon1			CCAGGCCGGCGTC	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.265G>A	13.37:g.53422307C>T	ENSP00000367177:p.Gly89Ser	91	0		96	35	NM_032949	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724665	0.68959	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.26373	1.74;1.74	4.99	4.99	0.66335	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.41605	D	0.000846	T	0.33702	0.0872	N	0.20530	0.585	0.32118	N	0.588379	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.28650	-1.0037	10	0.32370	T	0.25	.	13.1397	0.59428	0.0:0.84:0.1599:0.0	.	89;89	O95206-2;O95206	.;PCDH8_HUMAN	S	89	ENSP00000367177:G89S;ENSP00000341350:G89S	ENSP00000341350:G89S	G	-	1	0	PCDH8	52320308	0.981000	0.34729	0.997000	0.53966	0.948000	0.59901	2.542000	0.45744	2.337000	0.79520	0.561000	0.74099	GGC	.		0.657	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
CCDC88C	440193	hgsc.bcm.edu	37	14	91776235	91776235	+	Silent	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr14:91776235C>G	ENST00000389857.6	-	16	2918	c.2832G>C	c.(2830-2832)ctG>ctC	p.L944L		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	944					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCTGCAACAGCAGCTCCCTGT	0.612																																					p.L944L		.											.	CCDC88C-25	0			c.G2832C						.						49.0	56.0	53.0					14																	91776235		2098	4211	6309	SO:0001819	synonymous_variant	440193	exon16			CAACAGCAGCTCC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2832G>C	14.37:g.91776235C>G		42	0		31	2	NM_001080414	0	0	1	1	0	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																			.		0.612	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
MAGEL2	54551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	23890238	23890238	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr15:23890238C>G	ENST00000532292.1	-	1	937	c.843G>C	c.(841-843)aaG>aaC	p.K281N		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	164					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TCCGGGTGGCCTTGCCGGAGC	0.637																																					p.K884N		.											.	.	0			c.G2652C						.						42.0	49.0	47.0					15																	23890238		2189	4294	6483	SO:0001583	missense	54551	exon1			GGTGGCCTTGCCG	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.843G>C	15.37:g.23890238C>G	ENSP00000433433:p.Lys281Asn	107	0		111	13	NM_019066	0	0	0	0	0		Missense_Mutation	SNP	ENST00000532292.1	37		.	.	.	.	.	.	.	.	.	.	C	15.19	2.758766	0.49468	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.22	0.668	0.17912	.	.	.	.	.	T	0.23688	0.0573	N	0.24115	0.695	0.24891	N	0.99217	.	.	.	.	.	.	T	0.26916	-1.0089	5	.	.	.	.	7.2244	0.26007	0.0:0.461:0.0:0.539	.	.	.	.	T	313	.	.	R	-	2	0	MAGEL2	21441331	0.347000	0.24853	0.771000	0.31576	0.872000	0.50106	-0.733000	0.04898	0.092000	0.17331	-0.302000	0.09304	AGG	.		0.637	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MGRN1	23295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4700468	4700468	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr16:4700468G>T	ENST00000399577.5	+	2	284	c.191G>T	c.(190-192)gGc>gTc	p.G64V	MGRN1_ENST00000588994.1_Missense_Mutation_p.G64V|MGRN1_ENST00000262370.7_Missense_Mutation_p.G64V|MGRN1_ENST00000415496.1_Missense_Mutation_p.G64V|MGRN1_ENST00000586183.1_Missense_Mutation_p.G64V	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	64					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						AACTTCCTGGGCAGCCGCCCG	0.597																																					p.G64V		.											.	MGRN1-92	0			c.G191T						.						76.0	81.0	80.0					16																	4700468		1892	4125	6017	SO:0001583	missense	23295	exon2			TCCTGGGCAGCCG	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.191G>T	16.37:g.4700468G>T	ENSP00000382487:p.Gly64Val	182	0		140	46	NM_001142291	0	0	34	54	20	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518548	0.85495	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.4	5.4	0.78164	.	0.099811	0.64402	D	0.000001	T	0.62183	0.2407	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.998;0.979;0.996;0.991;1.0	T	0.68907	-0.5285	10	0.87932	D	0	-46.144	16.6736	0.85273	0.0:0.0:1.0:0.0	.	64;64;64;64;64;64	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	V	64	ENSP00000262370:G64V;ENSP00000382487:G64V;ENSP00000393311:G64V;ENSP00000443810:G64V	ENSP00000262370:G64V	G	+	2	0	MGRN1	4640469	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	9.785000	0.99042	2.537000	0.85549	0.561000	0.74099	GGC	.		0.597	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
CMTM1	113540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66612903	66612903	+	Silent	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr16:66612903G>A	ENST00000457188.2	+	4	630	c.509G>A	c.(508-510)tGa>tAa	p.*170*	CMTM1_ENST00000379500.2_Silent_p.*287*|CMTM2_ENST00000268595.2_5'Flank|CMTM1_ENST00000533666.1_3'UTR|CMTM1_ENST00000529506.1_Silent_p.*71*|CMTM1_ENST00000528324.1_3'UTR|CMTM2_ENST00000379486.2_5'Flank|CMTM1_ENST00000328020.6_3'UTR|CMTM1_ENST00000531885.1_3'UTR|CMTM1_ENST00000336328.6_Silent_p.*117*|CMTM1_ENST00000533953.1_Silent_p.*239*|CKLF-CMTM1_ENST00000527729.1_Silent_p.*116*|RP11-403P17.2_ENST00000568430.1_RNA|CMTM1_ENST00000332695.7_Silent_p.*123*	NM_181269.2	NP_851786.1	Q8IZ96	CKLF1_HUMAN	CKLF-like MARVEL transmembrane domain containing 1	0					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		AGGCCCGCCTGAAGCCAGCCC	0.627																																					p.X287X		.											.	CMTM1-90	0			c.G860A						.						34.0	41.0	38.0					16																	66612903		2201	4299	6500	SO:0001819	synonymous_variant	113540	exon4			CCGCCTGAAGCCA	AF278577	CCDS10810.1, CCDS10811.1, CCDS10812.2, CCDS45503.1, CCDS45504.1, CCDS54019.1, CCDS54020.1, CCDS54021.1	16q22.1	2009-10-06	2005-11-08	2005-11-08	ENSG00000089505	ENSG00000089505			19172	protein-coding gene	gene with protein product		607884	"""chemokine-like factor super family 1"", ""chemokine-like factor superfamily 1"""	CKLFSF1		12782130	Standard	NM_181268		Approved	CKLFH1a, CKLFH	uc002epr.4	Q8IZ96	OTTHUMG00000137502	ENST00000457188.2:c.509G>A	16.37:g.66612903G>A		95	0		101	38	NM_052999	0	0	0	0	0	Q2PPY5|Q6PEV5|Q8IU76|Q8IU83|Q8IU86|Q8IU93|Q8IZ87|Q8IZ88|Q8IZ89|Q8IZ90|Q8IZ91|Q8IZ92|Q8IZ93|Q8IZ94|Q8IZ95|Q96JC2|Q96JC3	Silent	SNP	ENST00000457188.2	37	CCDS45503.1																																																																																			.		0.627	CMTM1-015	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390261.2	NM_052999	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	351	57		456	68	NM_145301	0	0	8	46	38	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
TTLL6	284076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	46862380	46862380	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr17:46862380T>G	ENST00000393382.3	-	13	2086	c.1945A>C	c.(1945-1947)Aat>Cat	p.N649H	TTLL6_ENST00000433608.2_Missense_Mutation_p.N342H	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CTGCTGAGATTGATATTCCTC	0.547																																					p.N649H		.											.	TTLL6-90	0			c.A1945C						.						143.0	142.0	142.0					17																	46862380		2203	4300	6503	SO:0001583	missense	284076	exon13			TGAGATTGATATT	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1945A>C	17.37:g.46862380T>G	ENSP00000377043:p.Asn649His	222	1		228	94	NM_001130918	0	0	15	34	19		Missense_Mutation	SNP	ENST00000393382.3	37	CCDS45724.1	.	.	.	.	.	.	.	.	.	.	T	7.206	0.594532	0.13875	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	4.39	0.921	0.19403	.	7739.210000	0.00166	N	0.000000	T	0.40473	0.1118	L	0.29908	0.895	0.09310	N	1	B;B;D	0.54964	0.0;0.006;0.969	B;B;P	0.54100	0.001;0.001;0.742	T	0.19712	-1.0297	9	0.51188	T	0.08	.	6.212	0.20633	0.0:0.3168:0.0:0.6832	.	601;402;342	Q8N841;D3DTW0;G5E937	TTLL6_HUMAN;.;.	H	649;342;327;601	.	ENSP00000302547:N342H	N	-	1	0	TTLL6	44217379	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.518000	0.06267	0.029000	0.15352	0.379000	0.24179	AAT	.		0.547	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
EPX	8288	broad.mit.edu;bcgsc.ca	37	17	56274480	56274480	+	Missense_Mutation	SNP	C	C	T	rs143329228	byFrequency	TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr17:56274480C>T	ENST00000225371.5	+	7	1092	c.982C>T	c.(982-984)Cgg>Tgg	p.R328W		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	328					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	GCTCCGCAACCGGACCAACTA	0.617													C|||	13	0.00259585	0.0	0.0	5008	,	,		18343	0.0099		0.0	False		,,,				2504	0.0031				p.R328W													.	EPX-92	0			c.C982T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	119.0	113.0	115.0		982	-3.8	0.0	17	dbSNP_134	115	0,8600		0,0,4300	no	missense	EPX	NM_000502.4	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	328/716	56274480	1,13005	2203	4300	6503	SO:0001583	missense	8288	exon7			CGCAACCGGACCA	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.982C>T	17.37:g.56274480C>T	ENSP00000225371:p.Arg328Trp	148	0		214	11	NM_000502	0	0	0	0	0	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	37	CCDS11602.1	.	.	.	.	.	.	.	.	.	.	C	3.883	-0.025552	0.07589	2.27E-4	0.0	ENSG00000121053	ENST00000225371	T	0.73152	-0.72	4.86	-3.76	0.04359	.	1.473130	0.03548	N	0.225033	T	0.51787	0.1695	N	0.05031	-0.125	0.09310	N	0.999991	B	0.13594	0.008	B	0.09377	0.004	T	0.37526	-0.9702	10	0.27082	T	0.32	-2.6526	16.444	0.83910	0.7426:0.2574:0.0:0.0	.	328	P11678	PERE_HUMAN	W	328	ENSP00000225371:R328W	ENSP00000225371:R328W	R	+	1	2	EPX	53629479	0.000000	0.05858	0.002000	0.10522	0.039000	0.13416	-0.004000	0.12878	-0.381000	0.07882	-0.475000	0.04921	CGG	C|1.000;T|0.000		0.617	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
C17orf62	79415	ucsc.edu	37	17	80405455	80405455	+	Splice_Site	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr17:80405455C>T	ENST00000437807.2	-	4	445		c.e4+1		C17orf62_ENST00000306645.5_Splice_Site|C17orf62_ENST00000585080.1_Splice_Site|C17orf62_ENST00000342572.8_Intron|C17orf62_ENST00000434650.2_Intron|C17orf62_ENST00000585064.1_Splice_Site|C17orf62_ENST00000336995.7_Splice_Site|C17orf62_ENST00000577732.1_Splice_Site|C17orf62_ENST00000583359.1_Splice_Site|C17orf62_ENST00000577436.1_Intron|C17orf62_ENST00000583617.1_Splice_Site|C17orf62_ENST00000578913.1_Splice_Site|C17orf62_ENST00000578919.1_Splice_Site	NM_001193653.1|NM_001193657.1	NP_001180582.1|NP_001180586.1	Q9BQA9	CQ062_HUMAN	chromosome 17 open reading frame 62							integral component of membrane (GO:0016021)				breast(2)|large_intestine(2)|skin(2)|urinary_tract(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GGGTGCTTTACCTCCGCTGTA	0.547																																					.													.	C17orf62-90	0			c.127+1G>A						.						20.0	18.0	19.0					17																	80405455		2199	4291	6490	SO:0001630	splice_region_variant	79415	exon5			GCTTTACCTCCGC	AK074950	CCDS32776.1, CCDS45817.1	17q25.3	2014-06-09			ENSG00000178927	ENSG00000178927			28672	protein-coding gene	gene with protein product							Standard	NM_001100407		Approved	MGC4368, FLJ90469	uc021ufr.1	Q9BQA9		ENST00000437807.2:c.127+1G>A	17.37:g.80405455C>T		56	0		85	1	NM_001100407	0	0	3	3	0	E1B6X3|Q96NR1	Splice_Site	SNP	ENST00000437807.2	37	CCDS32776.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487722	0.64074	.	.	ENSG00000178927	ENST00000437807;ENST00000306645	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0014	0.80294	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C17orf62	77998744	1.000000	0.71417	0.996000	0.52242	0.860000	0.49131	6.284000	0.72652	2.113000	0.64589	0.561000	0.74099	.	.		0.547	C17orf62-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443260.1	NM_001033046	Intron
MTIF2	4528	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55473595	55473595	+	Silent	SNP	G	G	A	rs540448511		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:55473595G>A	ENST00000263629.4	-	10	1299	c.984C>T	c.(982-984)ggC>ggT	p.G328G	MTIF2_ENST00000394600.3_Silent_p.G328G|MTIF2_ENST00000403721.1_Silent_p.G328G	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	328	tr-type G.				formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TCAGATTATCGCCCTTTAACA	0.353																																					p.G328G													.	MTIF2-91	0			c.C984T						.						113.0	101.0	105.0					2																	55473595		2203	4300	6503	SO:0001819	synonymous_variant	4528	exon10			ATTATCGCCCTTT	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.984C>T	2.37:g.55473595G>A		62	0		83	10	NM_002453	0	0	0	0	0	D6W5D0	Silent	SNP	ENST00000263629.4	37	CCDS1853.1																																																																																			.		0.353	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
ZDBF2	57683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	207171574	207171574	+	Silent	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:207171574G>A	ENST00000374423.3	+	5	2708	c.2322G>A	c.(2320-2322)cgG>cgA	p.R774R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	774							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GAAAAGAACGGCACATTGACC	0.428																																					p.R774R		.											.	ZDBF2-3	0			c.G2322A						.						174.0	175.0	175.0					2																	207171574		1927	4125	6052	SO:0001819	synonymous_variant	57683	exon5			AGAACGGCACATT	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2322G>A	2.37:g.207171574G>A		263	0		340	54	NM_020923	0	0	2	5	3	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	CCDS46501.1																																																																																			.		0.428	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	215865517	215865517	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:215865517C>G	ENST00000272895.7	-	22	3310	c.3091G>C	c.(3091-3093)Gca>Cca	p.A1031P	ABCA12_ENST00000389661.4_Missense_Mutation_p.A713P	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1031					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCAATGATTGCTCTTTCAATA	0.428																																					p.A1031P	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12-99	0			c.G3091C						.						125.0	131.0	129.0					2																	215865517		2203	4300	6503	SO:0001583	missense	26154	exon22			TGATTGCTCTTTC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3091G>C	2.37:g.215865517C>G	ENSP00000272895:p.Ala1031Pro	191	0		226	78	NM_173076	0	0	6	13	7	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864070	0.91511	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.88046	-2.33;-2.33	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	D	0.94896	0.8350	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95165	0.8285	10	0.87932	D	0	.	19.9082	0.97015	0.0:1.0:0.0:0.0	.	1031;713	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	P	1031;713	ENSP00000272895:A1031P;ENSP00000374312:A713P	ENSP00000272895:A1031P	A	-	1	0	ABCA12	215573762	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.594000	0.82698	2.705000	0.92388	0.555000	0.69702	GCA	.		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SIRPG	55423	ucsc.edu	37	20	1629910	1629910	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr20:1629910C>G	ENST00000303415.3	-	2	282	c.218G>C	c.(217-219)gGc>gCc	p.G73A	SIRPG_ENST00000216927.4_Missense_Mutation_p.G73A|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000344103.4_Missense_Mutation_p.G73A|SIRPG_ENST00000381583.2_Missense_Mutation_p.G73A|SIRPG_ENST00000381580.1_Missense_Mutation_p.G40A	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	73	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TAATTCCCGGCCTGGTCCAAC	0.517																																					p.G73A													.	SIRPG-23	0			c.G218C						.						171.0	156.0	161.0					20																	1629910		2203	4300	6503	SO:0001583	missense	55423	exon2			TCCCGGCCTGGTC	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.218G>C	20.37:g.1629910C>G	ENSP00000305529:p.Gly73Ala	127	0		135	2	NM_001039508	0	0	0	0	0	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	4.988	0.183566	0.09495	.	.	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	1.93	-3.09	0.05331	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.255760	0.05163	N	0.498210	T	0.56949	0.2020	L	0.56280	1.765	0.09310	N	1	B;B;B	0.14438	0.01;0.004;0.003	B;B;B	0.10450	0.005;0.001;0.003	T	0.32824	-0.9892	10	0.26408	T	0.33	.	6.3533	0.21387	0.0:0.3641:0.0:0.6359	.	73;73;73	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	A	40;73;73;73;73	ENSP00000370992:G40A;ENSP00000342759:G73A;ENSP00000305529:G73A;ENSP00000370995:G73A;ENSP00000216927:G73A	ENSP00000216927:G73A	G	-	2	0	SIRPG	1577910	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.760000	0.04756	-0.812000	0.04363	0.195000	0.17529	GGC	.		0.517	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
COL20A1	57642	hgsc.bcm.edu	37	20	61944243	61944243	+	Missense_Mutation	SNP	A	A	G	rs143321165	byFrequency	TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr20:61944243A>G	ENST00000358894.6	+	16	2133	c.2033A>G	c.(2032-2034)tAc>tGc	p.Y678C	COL20A1_ENST00000326996.6_Missense_Mutation_p.Y678C|COL20A1_ENST00000435874.1_Missense_Mutation_p.Y685C|COL20A1_ENST00000422202.1_Missense_Mutation_p.Y685C	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	678	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GTGCTTGTCTACCAGATCACG	0.677													A|||	26	0.00519169	0.0015	0.0187	5008	,	,		15792	0.0		0.0089	False		,,,				2504	0.002				p.Y678C		.											.	COL20A1-90	0			c.A2033G						.	A	CYS/TYR	2,3854		0,2,1926	19.0	27.0	24.0		2033	4.2	0.5	20	dbSNP_134	24	40,8128		0,40,4044	yes	missense	COL20A1	NM_020882.2	194	0,42,5970	GG,GA,AA		0.4897,0.0519,0.3493	probably-damaging	678/1285	61944243	42,11982	1928	4084	6012	SO:0001583	missense	57642	exon16			TTGTCTACCAGAT	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2033A>G	20.37:g.61944243A>G	ENSP00000351767:p.Tyr678Cys	5	1		6	5	NM_020882	0	0	0	0	0	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	13	0.005952380952380952	0	0.0	9	0.024861878453038673	0	0.0	4	0.005277044854881266	A	13.73	2.322939	0.41096	5.19E-4	0.004897	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	4.25	4.25	0.50352	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.234827	0.36932	N	0.002333	T	0.79799	0.4508	M	0.84948	2.725	0.36447	D	0.865874	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.87437	0.2392	10	0.87932	D	0	.	9.82	0.40876	1.0:0.0:0.0:0.0	.	685;678	Q9P218-2;Q9P218	.;COKA1_HUMAN	C	678;678;685;685	ENSP00000351767:Y678C;ENSP00000323077:Y678C;ENSP00000408690:Y685C;ENSP00000414753:Y685C	ENSP00000323077:Y678C	Y	+	2	0	COL20A1	61414688	0.342000	0.24809	0.510000	0.27712	0.059000	0.15707	3.141000	0.50593	1.583000	0.49898	0.254000	0.18369	TAC	A|0.994;G|0.006		0.677	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
GART	2618	broad.mit.edu	37	21	34877874	34877874	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:34877874A>C	ENST00000381831.3	-	20	2982	c.2719T>G	c.(2719-2721)Tgg>Ggg	p.W907G	GART_ENST00000381815.4_Missense_Mutation_p.W907G|GART_ENST00000543717.1_Missense_Mutation_p.W459G|GART_ENST00000381839.3_Missense_Mutation_p.W907G	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	907	GART.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	TTACCATTCCACTTTTGGACA	0.398																																					p.W907G													.	GART-91	0			c.T2719G						.						81.0	78.0	79.0					21																	34877874		2203	4300	6503	SO:0001583	missense	2618	exon20			CATTCCACTTTTG	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2719T>G	21.37:g.34877874A>C	ENSP00000371253:p.Trp907Gly	74	0		90	4	NM_001136005	0	0	0	0	0	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.406578	0.62399	.	.	ENSG00000159131	ENST00000414353;ENST00000381815;ENST00000381831;ENST00000381839;ENST00000543717	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.59	5.59	0.84812	Formyl transferase, N-terminal (3);	0.121520	0.64402	D	0.000012	D	0.91640	0.7358	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94012	0.7285	10	0.87932	D	0	-2.7596	16.1134	0.81278	1.0:0.0:0.0:0.0	.	907	P22102	PUR2_HUMAN	G	171;907;907;907;459	ENSP00000371236:W907G;ENSP00000371253:W907G;ENSP00000371261:W907G;ENSP00000443579:W459G	ENSP00000371236:W907G	W	-	1	0	GART	33799744	1.000000	0.71417	0.999000	0.59377	0.448000	0.32197	8.515000	0.90548	2.266000	0.75297	0.456000	0.33151	TGG	.		0.398	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
ZBTB21	49854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43413770	43413770	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:43413770T>C	ENST00000310826.5	-	3	618	c.435A>G	c.(433-435)caA>caG	p.Q145Q	ZBTB21_ENST00000398499.1_Silent_p.Q145Q|ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398505.3_Silent_p.Q145Q|ZBTB21_ENST00000398511.3_Silent_p.Q145Q	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	145					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										CACTTCTCTTTTGAGAACTGT	0.403																																					p.Q145Q		.											.	.	0			c.A435G						.						98.0	88.0	91.0					21																	43413770		2203	4300	6503	SO:0001819	synonymous_variant	49854	exon3			TCTCTTTTGAGAA	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.435A>G	21.37:g.43413770T>C		112	0		130	56	NM_001098402	0	0	3	4	1	Q5R2W1|Q5R2W2|Q6P4R0	Silent	SNP	ENST00000310826.5	37	CCDS13678.1																																																																																			.		0.403	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
KRTAP10-10	353333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46057373	46057373	+	Silent	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:46057373C>T	ENST00000380095.1	+	1	101	c.39C>T	c.(37-39)tgC>tgT	p.C13C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	13						keratin filament (GO:0045095)		p.C13C(1)		NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CCAGCGCCTGCACTGACTCTT	0.652																																					p.C13C		.											.	KRTAP10-10-90	1	Substitution - coding silent(1)	endometrium(1)	c.C39T						.						104.0	109.0	108.0					21																	46057373		2203	4300	6503	SO:0001819	synonymous_variant	353333	exon1			CGCCTGCACTGAC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.39C>T	21.37:g.46057373C>T		219	0		201	37	NM_181688	0	0	0	0	0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																			.		0.652	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
NGLY1	55768	ucsc.edu	37	3	25770623	25770623	+	Splice_Site	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr3:25770623C>T	ENST00000280700.5	-	10	1772		c.e10+1		NGLY1_ENST00000428257.1_Splice_Site|NGLY1_ENST00000417874.2_Splice_Site|NGLY1_ENST00000396649.3_Splice_Site|NGLY1_ENST00000467224.1_Splice_Site|NGLY1_ENST00000422724.2_Splice_Site	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1						glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						CATTAAGTTACCATGTGCCAG	0.308																																					.													.	NGLY1-135	0			c.1611+1G>A						.						110.0	102.0	105.0					3																	25770623		2202	4299	6501	SO:0001630	splice_region_variant	55768	exon11			AAGTTACCATGTG	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1611+1G>A	3.37:g.25770623C>T		97	0		133	1	NM_001145295	0	0	0	0	0	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Splice_Site	SNP	ENST00000280700.5	37	CCDS33719.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469638	0.84533	.	.	ENSG00000151092	ENST00000428257;ENST00000280700;ENST00000396649;ENST00000308710;ENST00000417874	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1006	0.97874	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NGLY1	25745627	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.172000	0.77604	2.757000	0.94681	0.561000	0.74099	.	.		0.308	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2		Intron
TRIM71	131405	ucsc.edu	37	3	32932841	32932841	+	Silent	SNP	G	G	A	rs200564131	byFrequency	TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr3:32932841G>A	ENST00000383763.5	+	4	2208	c.2145G>A	c.(2143-2145)ctG>ctA	p.L715L		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	715					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCAAGATCCTGGTCTCAGACA	0.532													G|||	14	0.00279553	0.0	0.0043	5008	,	,		18823	0.0		0.0	False		,,,				2504	0.0112				p.L715L													.	TRIM71-92	0			c.G2145A						.	G		0,4078		0,0,2039	44.0	50.0	48.0		2145	-2.0	1.0	3		48	13,8363		0,13,4175	no	coding-synonymous	TRIM71	NM_001039111.1		0,13,6214	AA,AG,GG		0.1552,0.0,0.1044		715/869	32932841	13,12441	2039	4188	6227	SO:0001819	synonymous_variant	131405	exon4			GATCCTGGTCTCA		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.2145G>A	3.37:g.32932841G>A		52	1		45	4	NM_001039111	0	0	6	6	0		Silent	SNP	ENST00000383763.5	37	CCDS43060.1																																																																																			G|0.999;A|0.001		0.532	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
HTT	3064	hgsc.bcm.edu	37	4	3076696	3076696	+	Silent	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:3076696T>G	ENST00000355072.5	+	1	289	c.144T>G	c.(142-144)ccT>ccG	p.P48P	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	48	Poly-Pro.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		cgccgccgcctcctcagcttc	0.771																																					p.P48P		.											.	HTT-281	0			c.T144G						.																																			SO:0001819	synonymous_variant	3064	exon1			GCCGCCTCCTCAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.144T>G	4.37:g.3076696T>G		0	0		3	2	NM_002111	0	0	0	0	0	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.771	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PTPN13	5783	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	87691259	87691259	+	Silent	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:87691259C>T	ENST00000411767.2	+	30	4773	c.4710C>T	c.(4708-4710)gtC>gtT	p.V1570V	PTPN13_ENST00000316707.6_Silent_p.V1379V|PTPN13_ENST00000511467.1_Silent_p.V1575V|PTPN13_ENST00000436978.1_Silent_p.V1575V|PTPN13_ENST00000427191.2_Silent_p.V1551V			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1570	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CCCAGGAAGTCATATCTGCTC	0.443																																					p.V1575V													.	PTPN13-230	0			c.C4725T						.						71.0	70.0	70.0					4																	87691259		1883	4110	5993	SO:0001819	synonymous_variant	5783	exon30			GGAAGTCATATCT		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4710C>T	4.37:g.87691259C>T		44	0		36	9	NM_080685	0	0	0	0	0	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	ENST00000411767.2	37	CCDS47094.1																																																																																			.		0.443	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
DAPP1	27071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	100787246	100787246	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:100787246G>C	ENST00000512369.1	+	8	810	c.742G>C	c.(742-744)Gat>Cat	p.D248H	DAPP1_ENST00000296414.7_Missense_Mutation_p.D248H	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	248	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		AGTAGAAGCTGATGAGTGGAT	0.343																																					p.D248H		.											.	DAPP1-93	0			c.G742C						.						91.0	83.0	86.0					4																	100787246		1863	4100	5963	SO:0001583	missense	27071	exon8			GAAGCTGATGAGT	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.742G>C	4.37:g.100787246G>C	ENSP00000423602:p.Asp248His	52	0		63	13	NM_014395	0	0	3	3	0	Q8TCK5|Q9UHF2	Missense_Mutation	SNP	ENST00000512369.1	37	CCDS47112.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773356	0.90108	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	T;T	0.75589	-0.95;-0.95	6.07	6.07	0.98685	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.83362	0.5238	L	0.55834	1.745	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.68943	0.956;0.961	T	0.79329	-0.1848	10	0.31617	T	0.26	-8.6315	19.4308	0.94765	0.0:0.0:1.0:0.0	.	248;248	Q9UN19-2;Q9UN19	.;DAPP1_HUMAN	H	248	ENSP00000296414:D248H;ENSP00000423602:D248H	ENSP00000296414:D248H	D	+	1	0	DAPP1	101006269	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.197000	0.89727	2.885000	0.99019	0.655000	0.94253	GAT	.		0.343	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1		
LRBA	987	hgsc.bcm.edu	37	4	151231474	151231474	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:151231474G>C	ENST00000357115.3	-	53	8032	c.7789C>G	c.(7789-7791)Cat>Gat	p.H2597D	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.H2586D|LRBA_ENST00000510413.1_Missense_Mutation_p.H2586D	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2597						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CACTGGGAATGCACTTGAATA	0.408																																					p.H2597D		.											.	LRBA-157	0			c.C7789G						.						118.0	114.0	115.0					4																	151231474		2203	4300	6503	SO:0001583	missense	987	exon53			GGGAATGCACTTG	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7789C>G	4.37:g.151231474G>C	ENSP00000349629:p.His2597Asp	69	0		44	3	NM_006726	0	0	39	39	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.74|14.74	2.624395|2.624395	0.46840|0.46840	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115	.|T;T;T	.|0.70986	.|-0.53;-0.53;-0.53	4.88|4.88	4.88|4.88	0.63580|0.63580	.|WD40 repeat-like-containing domain (1);	.|0.402141	.|0.27581	.|N	.|0.018725	T|T	0.60637|0.60637	0.2284|0.2284	N|N	0.22421|0.22421	0.69|0.69	0.49915|0.49915	D|D	0.999837|0.999837	.|P;B;B;B	.|0.43231	.|0.801;0.321;0.007;0.061	.|B;B;B;B	.|0.40782	.|0.34;0.138;0.003;0.028	T|T	0.61917|0.61917	-0.6964|-0.6964	5|10	.|0.33141	.|T	.|0.24	.|.	18.4099|18.4099	0.90548|0.90548	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2597;2586;2586;492	.|P50851;F5H1X8;P50851-2;Q68D03	.|LRBA_HUMAN;.;.;.	W|D	1238|2586;2586;2597	.|ENSP00000446299:H2586D;ENSP00000421552:H2586D;ENSP00000349629:H2597D	.|ENSP00000349629:H2597D	C|H	-|-	3|1	2|0	LRBA|LRBA	151450924|151450924	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.078000|6.078000	0.71282|0.71282	2.411000|2.411000	0.81874|0.81874	0.563000|0.563000	0.77884|0.77884	TGC|CAT	.		0.408	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
GALNT7	51809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	174225146	174225146	+	Splice_Site	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:174225146G>A	ENST00000265000.4	+	8	1349		c.e8-1			NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTCCTTCATAGATATGGCAGT	0.343																																					.		.											.	GALNT7-90	0			c.1267-1G>A						.						137.0	126.0	130.0					4																	174225146		2203	4300	6503	SO:0001630	splice_region_variant	51809	exon8			TTCATAGATATGG	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1267-1G>A	4.37:g.174225146G>A		135	0		178	57	NM_017423	0	0	0	0	0	B3KQU3|Q7Z5W7|Q9UJ28	Splice_Site	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313963	0.60414	.	.	ENSG00000109586	ENST00000265000;ENST00000505308;ENST00000458613	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9439	0.97175	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT7	174461721	1.000000	0.71417	0.997000	0.53966	0.593000	0.36681	9.476000	0.97823	2.706000	0.92434	0.561000	0.74099	.	.		0.343	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	Intron
ARSK	153642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	94922371	94922371	+	Missense_Mutation	SNP	A	A	G	rs201849642		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr5:94922371A>G	ENST00000380009.4	+	5	1010	c.805A>G	c.(805-807)Aaa>Gaa	p.K269E		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	269					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		AAGATTTACAAAAAAAGAAAT	0.338																																					p.K269E		.											.	ARSK-91	0			c.A805G						.						61.0	65.0	64.0					5																	94922371		2201	4297	6498	SO:0001583	missense	153642	exon5			TTTACAAAAAAAG		CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.805A>G	5.37:g.94922371A>G	ENSP00000369346:p.Lys269Glu	53	0		86	20	NM_198150	0	0	2	2	0	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	ENST00000380009.4	37	CCDS4073.1	.	.	.	.	.	.	.	.	.	.	A	3.355	-0.131627	0.06753	.	.	ENSG00000164291	ENST00000380009	D	0.99891	-7.56	5.93	-1.94	0.07571	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.568944	0.20517	N	0.090774	D	0.97851	0.9294	N	0.03016	-0.435	0.30818	N	0.738095	B	0.06786	0.001	B	0.06405	0.002	D	0.99988	1.3720	10	0.02654	T	1	-0.6336	8.1825	0.31319	0.5545:0.1084:0.3371:0.0	.	269	Q6UWY0	ARSK_HUMAN	E	269	ENSP00000369346:K269E	ENSP00000369346:K269E	K	+	1	0	ARSK	94948127	0.982000	0.34865	0.741000	0.31004	0.871000	0.50021	0.596000	0.24044	-0.248000	0.09583	-0.132000	0.14878	AAA	A|0.999;G|0.001		0.338	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150	
C1QTNF2	114898	broad.mit.edu;bcgsc.ca	37	5	159781881	159781881	+	Silent	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr5:159781881G>A	ENST00000393975.3	-	2	276	c.273C>T	c.(271-273)ggC>ggT	p.G91G		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	46	Collagen-like.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCTGGGGGGCCGGGTGGGC	0.682																																					p.G91G													.	C1QTNF2-91	0			c.C273T						.						11.0	13.0	12.0					5																	159781881		2195	4292	6487	SO:0001819	synonymous_variant	114898	exon2			TGGGGGGCCGGGT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.273C>T	5.37:g.159781881G>A		29	0		23	10	NM_031908	0	0	1	1	0		Silent	SNP	ENST00000393975.3	37	CCDS4351.2																																																																																			.		0.682	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
DNAH11	8701	ucsc.edu	37	7	21856097	21856097	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr7:21856097C>A	ENST00000409508.3	+	64	10376	c.10345C>A	c.(10345-10347)Cta>Ata	p.L3449I	DNAH11_ENST00000328843.6_Missense_Mutation_p.L3456I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3456					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTCCATTCCACTAACCGAAGG	0.433									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						66.0	59.0	61.0					7																	21856097		1939	4139	6078	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ATTCCACTAACCG	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.10345C>A	7.37:g.21856097C>A	ENSP00000475939:p.Leu3449Ile	17	0		27	11	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	c	0.004	-2.378914	0.00205	.	.	ENSG00000105877	ENST00000328843	T	0.22743	1.94	5.82	2.24	0.28232	.	0.222391	0.51477	N	0.000081	T	0.07098	0.0180	.	.	.	0.20873	N	0.999838	B	0.06786	0.001	B	0.09377	0.004	T	0.41484	-0.9506	9	0.02654	T	1	.	6.6285	0.22843	0.6613:0.1306:0.2081:0.0	.	3456	Q96DT5	DYH11_HUMAN	I	3456	ENSP00000330671:L3456I	ENSP00000330671:L3456I	L	+	1	2	DNAH11	21822622	0.078000	0.21339	0.358000	0.25811	0.085000	0.17905	0.612000	0.24283	0.153000	0.19213	-1.494000	0.00967	CTA	.		0.433	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
DOCK4	9732	broad.mit.edu;bcgsc.ca	37	7	111368620	111368620	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr7:111368620C>T	ENST00000437633.1	-	52	5867	c.5611G>A	c.(5611-5613)Gaa>Aaa	p.E1871K	DOCK4_ENST00000428084.1_Missense_Mutation_p.E1880K|DOCK4_ENST00000494651.2_Missense_Mutation_p.E754K	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1871					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCCGACTGTTCATTCACCTGA	0.632																																					p.E1871K													.	DOCK4-26	0			c.G5611A						.						45.0	52.0	49.0					7																	111368620		2078	4208	6286	SO:0001583	missense	9732	exon52			ACTGTTCATTCAC		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5611G>A	7.37:g.111368620C>T	ENSP00000404179:p.Glu1871Lys	118	0		124	11	NM_014705	0	0	17	19	2	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.39|17.39	3.377179|3.377179	0.61735|0.61735	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|.	0.36520|.	1.25;1.25;1.25|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.164526|.	0.53938|.	D|.	0.000047|.	T|T	0.69602|0.69602	0.3129|0.3129	L|L	0.46157|0.46157	1.445|1.445	0.53688|0.53688	D|D	0.999979|0.999979	B;B;B;B;B;P|.	0.35272|.	0.034;0.136;0.039;0.319;0.135;0.493|.	B;B;B;B;B;B|.	0.27380|.	0.016;0.033;0.018;0.034;0.037;0.079|.	T|T	0.64757|0.64757	-0.6332|-0.6332	10|5	0.27785|.	T|.	0.31|.	.|.	19.5919|19.5919	0.95518|0.95518	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	740;754;1916;1871;1842;184|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4|.	.;.;.;DOCK4_HUMAN;.;.|.	K|I	1859;1880;754;1871;1830|1293;1903	ENSP00000410746:E1880K;ENSP00000440944:E754K;ENSP00000404179:E1871K|.	ENSP00000345432:E1830K|.	E|M	-|-	1|3	0|0	DOCK4|DOCK4	111155856|111155856	1.000000|1.000000	0.71417|0.71417	0.077000|0.077000	0.20336|0.20336	0.479000|0.479000	0.33129|0.33129	6.966000|6.966000	0.76073|0.76073	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GAA|ATG	.		0.632	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	30694449	30694449	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr8:30694449T>C	ENST00000256246.2	-	3	8276	c.8202A>G	c.(8200-8202)caA>caG	p.Q2734Q		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2734					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTATTTGAGATTGAAAATACC	0.408																																					p.Q2734Q		.											.	TEX15-97	0			c.A8202G						.						97.0	100.0	99.0					8																	30694449		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon3			TTGAGATTGAAAA	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.8202A>G	8.37:g.30694449T>C		67	0		104	43	NM_031271	0	0	0	0	0		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																			.		0.408	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
ZFAT	57623	broad.mit.edu	37	8	135524765	135524765	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr8:135524765T>C	ENST00000377838.3	-	14	3488	c.3314A>G	c.(3313-3315)cAg>cGg	p.Q1105R	ZFAT_ENST00000520356.1_Intron|ZFAT_ENST00000429442.2_Missense_Mutation_p.Q1093R|ZFAT_ENST00000517307.1_5'Flank|ZFAT_ENST00000520214.1_Missense_Mutation_p.Q1093R|ZFAT_ENST00000523399.1_Missense_Mutation_p.Q1043R|ZFAT_ENST00000520727.1_Missense_Mutation_p.Q1093R	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1105					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CACCGCTGCCTGTGTCCCTTG	0.532																																					p.Q1105R													.	ZFAT-90	0			c.A3314G						.						164.0	175.0	171.0					8																	135524765		2020	4178	6198	SO:0001583	missense	57623	exon14			GCTGCCTGTGTCC	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3314A>G	8.37:g.135524765T>C	ENSP00000367069:p.Gln1105Arg	309	0		324	6	NM_020863	0	0	26	26	0	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.397232	0.42512	.	.	ENSG00000066827	ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T	0.10382	2.93;2.88;2.93;2.93;2.95	4.8	4.8	0.61643	.	0.058678	0.64402	D	0.000002	T	0.09730	0.0239	N	0.24115	0.695	0.34214	D	0.674611	P;P;P	0.49090	0.919;0.842;0.842	B;B;B	0.42692	0.395;0.321;0.236	T	0.14980	-1.0453	10	0.62326	D	0.03	-31.9885	13.9728	0.64252	0.0:0.0:0.0:1.0	.	224;1043;1105	B7Z741;E9PER3;Q9P243	.;.;ZFAT_HUMAN	R	1093;1093;1105;1093;992;1043	ENSP00000427831:Q1093R;ENSP00000394501:Q1093R;ENSP00000367069:Q1105R;ENSP00000428483:Q1093R;ENSP00000429091:Q1043R	ENSP00000326997:Q992R	Q	-	2	0	ZFAT	135593947	1.000000	0.71417	0.997000	0.53966	0.181000	0.23173	5.978000	0.70501	2.140000	0.66376	0.460000	0.39030	CAG	.		0.532	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
FAM47B	170062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	34961454	34961454	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chrX:34961454G>A	ENST00000329357.5	+	1	542	c.506G>A	c.(505-507)cGg>cAg	p.R169Q		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	169										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TGTGAGGCCCGGGAGAAGACA	0.592																																					p.R169Q		.											.	FAM47B-196	0			c.G506A						.						36.0	35.0	35.0					X																	34961454		2202	4300	6502	SO:0001583	missense	170062	exon1			AGGCCCGGGAGAA	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.506G>A	X.37:g.34961454G>A	ENSP00000328307:p.Arg169Gln	34	0		36	30	NM_152631	0	0	0	0	0	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	1.355	-0.590410	0.03799	.	.	ENSG00000189132	ENST00000329357	T	0.14266	2.52	0.843	-0.104	0.13605	.	.	.	.	.	T	0.04952	0.0133	N	0.05259	-0.085	0.09310	N	1	B	0.19073	0.033	B	0.08055	0.003	T	0.45175	-0.9279	8	0.13108	T	0.6	.	.	.	.	.	169	Q8NA70	FA47B_HUMAN	Q	169	ENSP00000328307:R169Q	ENSP00000328307:R169Q	R	+	2	0	FAM47B	34871375	0.070000	0.21116	0.001000	0.08648	0.009000	0.06853	-2.406000	0.01044	-0.099000	0.12263	-0.780000	0.03373	CGG	.		0.592	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
IQSEC2	23096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53268433	53268433	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chrX:53268433C>G	ENST00000375368.5	-	10	3229	c.3029G>C	c.(3028-3030)aGt>aCt	p.S1010T	IQSEC2_ENST00000396435.3_Missense_Mutation_p.S1020T|IQSEC2_ENST00000375365.2_Missense_Mutation_p.S815T			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1010	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTGACGGAAACTGTACGTCAC	0.502											OREG0019800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1020T		.											.	IQSEC2-178	0			c.G3059C						.						114.0	103.0	107.0					X																	53268433		2203	4300	6503	SO:0001583	missense	23096	exon11			CGGAAACTGTACG	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3029G>C	X.37:g.53268433C>G	ENSP00000364517:p.Ser1010Thr	58	0	991	42	33	NM_001111125	0	0	0	9	9	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	C	14.06	2.422471	0.43020	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.54071	0.59;0.59;0.59	5.61	5.61	0.85477	.	.	.	.	.	T	0.52240	0.1722	N	0.19112	0.55	0.80722	D	1	B;P	0.39903	0.039;0.694	B;P	0.56434	0.105;0.798	T	0.40001	-0.9586	9	0.02654	T	1	.	17.3443	0.87306	0.0:1.0:0.0:0.0	.	1020;815	Q5JU85-2;Q5JU85-3	.;.	T	1020;1010;815	ENSP00000379712:S1020T;ENSP00000364517:S1010T;ENSP00000364514:S815T	ENSP00000364514:S815T	S	-	2	0	IQSEC2	53285158	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	2.668000	0.46816	2.363000	0.80096	0.511000	0.50034	AGT	.		0.502	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
WDR37	22884	bcgsc.ca	37	10	1170912	1170915	+	Frame_Shift_Del	DEL	TGTT	TGTT	-			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	TGTT	TGTT	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr10:1170912_1170915delTGTT	ENST00000358220.1	+	13	1445_1448	c.1301_1304delTGTT	c.(1300-1305)ctgtttfs	p.LF434fs	WDR37_ENST00000482165.1_3'UTR|WDR37_ENST00000263150.4_Frame_Shift_Del_p.LF434fs			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	434										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CAAGTGAGACTGTTTGATATGTCA	0.539																																					p.434_435del													.	WDR37-90	0			c.1301_1304del						.																																			SO:0001589	frameshift_variant	22884	exon13			TGAGACTGTTTGA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1301_1304delTGTT	10.37:g.1170912_1170915delTGTT	ENSP00000350954:p.Leu434fs	70	0		56	6	NM_014023	0	0	0	0	0	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Frame_Shift_Del	DEL	ENST00000358220.1	37	CCDS7057.1																																																																																			.		0.539	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
C9orf84	158401	hgsc.bcm.edu;broad.mit.edu	37	9	114454268	114454270	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr9:114454268_114454270delCTC	ENST00000318737.4	-	25	3923_3925	c.3795_3797delGAG	c.(3793-3798)aggaga>aga	p.1265_1266RR>R	C9orf84_ENST00000374287.3_In_Frame_Del_p.1265_1266RR>R|C9orf84_ENST00000394779.3_In_Frame_Del_p.1226_1227RR>R|C9orf84_ENST00000394777.4_In_Frame_Del_p.1191_1192RR>R	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	1265										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTCATGTGTTCTCCTTTTCTGAG	0.369																																					p.1265_1266del		.											.	C9orf84-92	0			c.3795_3797del						.																																			SO:0001651	inframe_deletion	158401	exon25			.	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.3795_3797delGAG	9.37:g.114454268_114454270delCTC	ENSP00000322108:p.Arg1266del	45	0		56	10	NM_173521	0	0	0	0	0	A2A2V3|Q2M1H8|Q96M73	In_Frame_Del	DEL	ENST00000318737.4	37	CCDS6781.3																																																																																			.		0.369	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
