#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
Unknown	0	broad.mit.edu;bcgsc.ca	37	1	13183399	13183399	+	IGR	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:13183399A>G								RP13-221M14.3 (18931 upstream) : PRAMEF26 (32956 downstream)																							AATTGAAGCCACTTTTGCCCC	0.512																																					p.S158S													.	.	0			c.T474C						.						56.0	45.0	48.0					1																	13183399		692	1591	2283	SO:0001628	intergenic_variant	0	exon2			GAAGCCACTTTTG																													1.37:g.13183399A>G		1035	1		873	80	NM_001136561	0	0	1169	1171	2		Silent	SNP		37																																																																																				.	0	0.512								
C1orf64	149563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16332451	16332451	+	Silent	SNP	G	G	C	rs531928100		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:16332451G>C	ENST00000329454.2	+	2	188	c.120G>C	c.(118-120)acG>acC	p.T40T	RP11-5P18.5_ENST00000437156.1_RNA	NM_178840.2	NP_849162.1	Q8NEQ6	CA064_HUMAN	chromosome 1 open reading frame 64	40										breast(2)|endometrium(1)|lung(3)	6		Colorectal(325;0.000435)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;2.08e-05)|BRCA - Breast invasive adenocarcinoma(304;9.19e-05)|Kidney(64;0.000165)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTCCCCACGGCTCACCTGA	0.562																																					p.T40T		.											.	C1orf64-153	0			c.G120C						.						220.0	231.0	228.0					1																	16332451		2203	4300	6503	SO:0001819	synonymous_variant	149563	exon2			CCCCACGGCTCAC	AK127425	CCDS166.1	1p36.13	2013-10-11			ENSG00000183888	ENSG00000183888			28339	protein-coding gene	gene with protein product	"""ER-related factor"""					22341523	Standard	NM_178840		Approved	MGC24047, ERRF	uc001axn.3	Q8NEQ6	OTTHUMG00000009523	ENST00000329454.2:c.120G>C	1.37:g.16332451G>C		555	2		454	126	NM_178840	0	0	0	0	0	B3KXI9	Silent	SNP	ENST00000329454.2	37	CCDS166.1																																																																																			.		0.562	C1orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026317.1	NM_178840	
JAK1	3716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	65330541	65330541	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:65330541A>T	ENST00000342505.4	-	8	1353	c.1105T>A	c.(1105-1107)Ttc>Atc	p.F369I		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	369	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ATTTCAGGGAAGTAAGAAAAA	0.368			Mis		ALL																																p.F369I		.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1-3900	0			c.T1105A						.						156.0	150.0	152.0					1																	65330541		1885	4123	6008	SO:0001583	missense	3716	exon8			CAGGGAAGTAAGA	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1105T>A	1.37:g.65330541A>T	ENSP00000343204:p.Phe369Ile	74	0		68	22	NM_002227	0	0	53	90	37	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	37	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861730	0.91433	.	.	ENSG00000162434	ENST00000342505	T	0.21191	2.02	5.55	5.55	0.83447	FERM domain (1);	.	.	.	.	T	0.25382	0.0617	M	0.85462	2.755	0.52099	D	0.999945	D	0.53619	0.961	P	0.47206	0.541	T	0.10042	-1.0647	9	0.28530	T	0.3	-5.6269	16.0013	0.80294	1.0:0.0:0.0:0.0	.	369	P23458	JAK1_HUMAN	I	369	ENSP00000343204:F369I	ENSP00000343204:F369I	F	-	1	0	JAK1	65103129	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.607000	0.90891	2.247000	0.74100	0.528000	0.53228	TTC	.		0.368	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
SLC6A17	388662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110738291	110738291	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:110738291T>A	ENST00000331565.4	+	10	2061	c.1576T>A	c.(1576-1578)Tac>Aac	p.Y526N		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	526					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GTTCGATGACTACTCGGCCAC	0.537																																					p.Y526N		.											.	SLC6A17-92	0			c.T1576A						.						107.0	88.0	94.0					1																	110738291		2203	4300	6503	SO:0001583	missense	388662	exon10			GATGACTACTCGG		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1576T>A	1.37:g.110738291T>A	ENSP00000330199:p.Tyr526Asn	73	0		75	32	NM_001010898	0	0	0	0	0	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	T	32	5.131369	0.94473	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	D	0.81996	-1.56	5.65	5.65	0.86999	.	0.056027	0.64402	D	0.000001	D	0.92492	0.7616	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94407	0.7628	10	0.87932	D	0	.	15.8499	0.78921	0.0:0.0:0.0:1.0	.	526	Q9H1V8	S6A17_HUMAN	N	526	ENSP00000330199:Y526N	ENSP00000330199:Y526N	Y	+	1	0	SLC6A17	110539814	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.934000	0.87649	2.146000	0.66826	0.533000	0.62120	TAC	.		0.537	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
SIKE1	80143	hgsc.bcm.edu;bcgsc.ca	37	1	115323170	115323170	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:115323170C>A	ENST00000060969.5	-	1	128	c.59G>T	c.(58-60)cGg>cTg	p.R20L	SIKE1_ENST00000369528.5_Missense_Mutation_p.R20L|SIKE1_ENST00000506320.1_5'UTR			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1	20					innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						ATCGTGCTCCCGTAGCCTCTC	0.687																																					p.R20L		.											.	SIKE1-227	0			c.G59T						.						22.0	24.0	23.0					1																	115323170		2200	4298	6498	SO:0001583	missense	80143	exon1			TGCTCCCGTAGCC	AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.59G>T	1.37:g.115323170C>A	ENSP00000060969:p.Arg20Leu	53	0		57	5	NM_001102396	0	0	8	8	0	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	Missense_Mutation	SNP	ENST00000060969.5	37	CCDS878.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946346	0.92593	.	.	ENSG00000052723	ENST00000369528;ENST00000060969	.	.	.	5.39	5.39	0.77823	.	0.052522	0.64402	D	0.000001	T	0.24586	0.0596	L	0.39898	1.24	0.38578	D	0.950123	P;P	0.47191	0.891;0.8	B;B	0.41764	0.331;0.366	T	0.16247	-1.0409	9	0.48119	T	0.1	-15.9215	6.8936	0.24243	0.0:0.7981:0.0:0.2019	.	20;20	Q9BRV8-2;Q9BRV8	.;SIKE1_HUMAN	L	20	.	ENSP00000060969:R20L	R	-	2	0	SIKE1	115124693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.668000	0.46816	2.791000	0.96007	0.655000	0.94253	CGG	.		0.687	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033401.1	NM_025073	
FCGR1A	2209	hgsc.bcm.edu	37	1	149755582	149755582	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:149755582T>G	ENST00000369168.4	+	3	130	c.76T>G	c.(76-78)Ttg>Gtg	p.L26V	RP11-196G18.3_ENST00000428289.1_RNA|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_Intron	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	26	Ig-like C2-type 1.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGTGATCACTTTGCAGCCTCC	0.498																																					p.L26V		.											.	FCGR1A-23	0			c.T76G						.						1.0	1.0	1.0					1																	149755582		647	1295	1942	SO:0001583	missense	2209	exon3			ATCACTTTGCAGC	BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.76T>G	1.37:g.149755582T>G	ENSP00000358165:p.Leu26Val	230	0		249	40	NM_000566	0	0	6	6	0	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	ENST00000369168.4	37	CCDS933.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.255432	0.22965	.	.	ENSG00000150337	ENST00000369168	T	0.12465	2.68	3.13	-0.514	0.11958	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40469	N	0.001099	T	0.12263	0.0298	M	0.68728	2.09	0.80722	D	1	P	0.41978	0.767	P	0.54431	0.752	T	0.06092	-1.0846	10	0.51188	T	0.08	.	5.5384	0.17023	0.0:0.4493:0.0:0.5506	.	26	P12314	FCGR1_HUMAN	V	26	ENSP00000358165:L26V	ENSP00000358165:L26V	L	+	1	2	FCGR1A	148022206	0.999000	0.42202	0.990000	0.47175	0.526000	0.34562	0.495000	0.22483	0.003000	0.14656	0.338000	0.21704	TTG	.		0.498	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
TRIM46	80128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155148034	155148034	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:155148034C>G	ENST00000334634.4	+	2	236	c.236C>G	c.(235-237)tCt>tGt	p.S79C	TRIM46_ENST00000543729.1_Missense_Mutation_p.S86C|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000368385.4_Missense_Mutation_p.S79C|TRIM46_ENST00000368383.3_Missense_Mutation_p.S79C|TRIM46_ENST00000392451.2_Missense_Mutation_p.S79C|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_Intron|TRIM46_ENST00000368382.1_Missense_Mutation_p.S56C|TRIM46_ENST00000468878.1_3'UTR|KRTCAP2_ENST00000490672.1_5'Flank	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	79						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGCCCACCTCTCCTGCCTCC	0.677																																					p.S79C		.											.	TRIM46-228	0			c.C236G						.						56.0	55.0	55.0					1																	155148034		2203	4300	6503	SO:0001583	missense	80128	exon2			CCACCTCTCCTGC		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.236C>G	1.37:g.155148034C>G	ENSP00000334657:p.Ser79Cys	118	0		97	19	NM_025058	0	0	0	0	0	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448430	0.84101	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T	0.60672	0.75;0.5;0.69;0.42;0.17;0.23	4.53	4.53	0.55603	Zinc finger, RING-type (1);	0.348037	0.29205	N	0.012829	T	0.60856	0.2301	L	0.51422	1.61	0.47547	D	0.999457	D;B;D;D;B;D	0.89917	0.998;0.014;1.0;0.999;0.014;0.999	P;B;D;P;B;D	0.68765	0.889;0.033;0.96;0.867;0.033;0.924	T	0.58567	-0.7614	10	0.33141	T	0.24	.	15.1434	0.72630	0.0:1.0:0.0:0.0	.	66;79;66;56;79;79	F5H5Z2;Q5VT61;B7Z3S2;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;.;TRI46_HUMAN;.	C	86;66;79;79;79;56;79	ENSP00000442719:S86C;ENSP00000357369:S79C;ENSP00000376245:S79C;ENSP00000357367:S79C;ENSP00000357366:S56C;ENSP00000334657:S79C	ENSP00000334657:S79C	S	+	2	0	TRIM46	153414658	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.676000	0.74498	2.222000	0.72286	0.650000	0.86243	TCT	.		0.677	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	64968980	64968980	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr10:64968980A>T	ENST00000399262.2	-	9	2928	c.2710T>A	c.(2710-2712)Tgg>Agg	p.W904R	JMJD1C_ENST00000402544.1_Missense_Mutation_p.W685R|JMJD1C_ENST00000542921.1_Missense_Mutation_p.W722R|JMJD1C_ENST00000399251.1_Missense_Mutation_p.W685R	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	904					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGATGTAGCCAAGGACTGGGA	0.433																																					p.W904R		.											.	JMJD1C-275	0			c.T2710A						.						65.0	59.0	61.0					10																	64968980		1882	4108	5990	SO:0001583	missense	221037	exon9			GTAGCCAAGGACT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.2710T>A	10.37:g.64968980A>T	ENSP00000382204:p.Trp904Arg	57	0		46	19	NM_032776	0	0	5	10	5	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480118	0.84747	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.77624	0.4158	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79105	-0.1940	10	0.66056	D	0.02	-4.4645	16.5655	0.84588	1.0:0.0:0.0:0.0	.	904;722	Q15652;A0T124	JHD2C_HUMAN;.	R	904;685;685;722	ENSP00000382204:W904R;ENSP00000384990:W685R;ENSP00000382195:W685R;ENSP00000444682:W722R	ENSP00000382195:W685R	W	-	1	0	JMJD1C	64638986	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.372000	0.90127	2.302000	0.77476	0.533000	0.62120	TGG	.		0.433	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
LRRC4C	57689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	40136275	40136275	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:40136275A>C	ENST00000278198.2	-	2	3531	c.1568T>G	c.(1567-1569)aTg>aGg	p.M523R	LRRC4C_ENST00000530763.1_Missense_Mutation_p.M523R|LRRC4C_ENST00000528697.1_Missense_Mutation_p.M523R|LRRC4C_ENST00000527150.1_Missense_Mutation_p.M523R			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	523					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGTAGTCTTCATGACCTCATC	0.478																																					p.M523R		.											.	LRRC4C-521	0			c.T1568G						.						174.0	145.0	155.0					11																	40136275		2203	4300	6503	SO:0001583	missense	57689	exon7			GTCTTCATGACCT	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1568T>G	11.37:g.40136275A>C	ENSP00000278198:p.Met523Arg	129	0		109	29	NM_001258419	0	0	0	0	0	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813848	0.50527	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.65940	-0.6046	10	0.72032	D	0.01	.	15.6754	0.77316	1.0:0.0:0.0:0.0	.	523	Q9HCJ2	LRC4C_HUMAN	R	523	ENSP00000278198:M523R;ENSP00000436976:M523R;ENSP00000437132:M523R;ENSP00000434761:M523R	ENSP00000278198:M523R	M	-	2	0	LRRC4C	40092851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	ATG	.		0.478	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
ACCS	84680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	44105011	44105011	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:44105011T>C	ENST00000263776.8	+	14	1726	c.1292T>C	c.(1291-1293)cTc>cCc	p.L431P		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	431					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GAAATGCTGCTCTGGCGCCGC	0.567																																					p.L431P	Esophageal Squamous(158;148 1889 8077 23160 41213)	.											.	ACCS-155	0			c.T1292C						.						71.0	65.0	67.0					11																	44105011		2203	4300	6503	SO:0001583	missense	84680	exon14			TGCTGCTCTGGCG	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1292T>C	11.37:g.44105011T>C	ENSP00000263776:p.Leu431Pro	62	0		68	13	NM_032592	0	0	17	33	16	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.025435	0.54683	.	.	ENSG00000110455	ENST00000263776	D	0.93488	-3.23	5.91	5.91	0.95273	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.073130	0.56097	D	0.000026	D	0.97942	0.9323	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99297	1.0900	10	0.87932	D	0	-19.4821	16.0098	0.80391	0.0:0.0:0.0:1.0	.	431	Q96QU6	1A1L1_HUMAN	P	431	ENSP00000263776:L431P	ENSP00000263776:L431P	L	+	2	0	ACCS	44061587	0.997000	0.39634	0.041000	0.18516	0.142000	0.21351	7.315000	0.78998	2.254000	0.74563	0.533000	0.62120	CTC	.		0.567	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
AHNAK	79026	broad.mit.edu	37	11	62288080	62288080	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:62288080T>G	ENST00000378024.4	-	5	14083	c.13809A>C	c.(13807-13809)aaA>aaC	p.K4603N	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4603					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTTTGGACCTTTCAGATTCA	0.507																																					p.K4603N													.	AHNAK-109	0			c.A13809C						.						103.0	102.0	103.0					11																	62288080		2202	4299	6501	SO:0001583	missense	79026	exon5			TGGACCTTTCAGA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13809A>C	11.37:g.62288080T>G	ENSP00000367263:p.Lys4603Asn	183	1		185	5	NM_001620	0	0	172	172	0	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.945631	0.34377	.	.	ENSG00000124942	ENST00000378024	T	0.01665	4.7	5.43	-4.89	0.03103	.	0.190348	0.43579	D	0.000541	T	0.11281	0.0275	H	0.95187	3.635	0.30066	N	0.8105	D	0.69078	0.997	D	0.79784	0.993	T	0.03728	-1.1009	10	0.20046	T	0.44	.	15.082	0.72122	0.0:0.3027:0.0:0.6973	.	4603	Q09666	AHNK_HUMAN	N	4603	ENSP00000367263:K4603N	ENSP00000367263:K4603N	K	-	3	2	AHNAK	62044656	0.003000	0.15002	0.838000	0.33150	0.111000	0.19643	-1.791000	0.01758	-0.699000	0.05077	-0.276000	0.10085	AAA	.		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49434235	49434235	+	Missense_Mutation	SNP	C	C	T	rs375114492		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:49434235C>T	ENST00000301067.7	-	31	7317	c.7318G>A	c.(7318-7320)Gtt>Att	p.V2440I		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2440	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CGAGGGGTAACGGGTGATGGG	0.622																																					p.V2440I		.											.	MLL2-612	0			c.G7318A						.	C	ILE/VAL	1,4177		0,1,2088	40.0	46.0	44.0		7318	5.2	0.8	12		44	0,8456		0,0,4228	no	missense	MLL2	NM_003482.3	29	0,1,6316	TT,TC,CC		0.0,0.0239,0.0079	probably-damaging	2440/5538	49434235	1,12633	2089	4228	6317	SO:0001583	missense	8085	exon31			GGGTAACGGGTGA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7318G>A	12.37:g.49434235C>T	ENSP00000301067:p.Val2440Ile	96	0		101	35	NM_003482	0	0	3	3	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924285	0.34002	2.39E-4	0.0	ENSG00000167548	ENST00000301067	T	0.80033	-1.33	5.21	5.21	0.72293	.	0.000000	0.34002	N	0.004349	T	0.77136	0.4086	L	0.36672	1.1	0.26063	N	0.981323	D	0.57899	0.981	P	0.44772	0.46	T	0.74553	-0.3627	10	0.87932	D	0	.	17.9117	0.88936	0.0:1.0:0.0:0.0	.	2440	O14686	MLL2_HUMAN	I	2440	ENSP00000301067:V2440I	ENSP00000301067:V2440I	V	-	1	0	MLL2	47720502	0.544000	0.26441	0.785000	0.31869	0.974000	0.67602	3.934000	0.56553	2.596000	0.87737	0.591000	0.81541	GTT	.		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
RDH5	5959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56115126	56115126	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:56115126T>C	ENST00000257895.5	+	2	310	c.158T>C	c.(157-159)tTc>tCc	p.F53S	RDH5_ENST00000548082.1_Missense_Mutation_p.F53S|RDH5_ENST00000547072.1_5'UTR|RP11-644F5.10_ENST00000550412.1_Intron|RP11-644F5.10_ENST00000549424.1_Intron|RDH5_ENST00000553160.1_Intron	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	53					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	CAGAGAGGCTTCCGAGTCCTG	0.662											OREG0021907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F53S		.											.	RDH5-91	0			c.T158C						.						37.0	40.0	39.0					12																	56115126		2202	4299	6501	SO:0001583	missense	5959	exon2			GAGGCTTCCGAGT	U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.158T>C	12.37:g.56115126T>C	ENSP00000257895:p.Phe53Ser	120	1	1013	102	29	NM_001199771	0	0	25	45	20	O00179|Q8TAI2	Missense_Mutation	SNP	ENST00000257895.5	37	CCDS31829.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.091465	0.55968	.	.	ENSG00000135437	ENST00000257895;ENST00000548082	D;D	0.93019	-3.15;-3.15	5.11	3.88	0.44766	NAD(P)-binding domain (1);	0.095258	0.64402	D	0.000001	D	0.95636	0.8581	M	0.74881	2.28	0.58432	D	0.999993	D	0.76494	0.999	D	0.76575	0.988	D	0.95464	0.8545	10	0.87932	D	0	.	10.0549	0.42239	0.0:0.0:0.1688:0.8312	.	53	Q92781	RDH1_HUMAN	S	53	ENSP00000257895:F53S;ENSP00000447128:F53S	ENSP00000257895:F53S	F	+	2	0	RDH5	54401393	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	4.981000	0.63819	2.062000	0.61559	0.533000	0.62120	TTC	.		0.662	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407493.1	NM_002905	
AGAP2-AS1	100130776	broad.mit.edu;bcgsc.ca	37	12	58120789	58120789	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:58120789C>T	ENST00000542466.2	+	2	150	c.14C>T	c.(13-15)gCg>gTg	p.A5V	AGAP2_ENST00000547588.1_Missense_Mutation_p.A1102T|AGAP2_ENST00000257897.3_Missense_Mutation_p.A746T|RP11-571M6.8_ENST00000548410.2_RNA					AGAP2 antisense RNA 1																		ACGACGTGGGCGAGCTCGGCC	0.647											OREG0021951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1102T													.	AGAP2-716	0			c.G3304A						.						18.0	20.0	19.0					12																	58120789		2202	4300	6502	SO:0001583	missense	116986	exon18			CGTGGGCGAGCTC	BC039697, BC069024		12q14.1	2013-05-30			ENSG00000255737	ENSG00000255737		"""Long non-coding RNAs"""	48633	non-coding RNA	RNA, long non-coding							Standard	NR_027032		Approved				OTTHUMG00000170286	ENST00000542466.2:c.14C>T	12.37:g.58120789C>T	ENSP00000437523:p.Ala5Val	25	0	1028	21	6	NM_001122772	0	0	1	4	3		Missense_Mutation	SNP	ENST00000542466.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.61|17.61|17.61	3.432070|3.432070|3.432070	0.62844|0.62844|0.62844	.|.|.	.|.|.	ENSG00000135439|ENSG00000255737|ENSG00000135439	ENST00000257897;ENST00000547588|ENST00000542466|ENST00000328568	T;T|.|.	0.64260|.|.	-0.09;-0.09|.|.	4.62|4.62|4.62	3.72|3.72|3.72	0.42706|0.42706|0.42706	Ankyrin repeat-containing domain (3);|.|.	0.192175|0.192175|.	0.43110|0.43110|.	D|D|.	0.000610|0.000610|.	T|T|T	0.42675|0.42675|0.42675	0.1213|0.1213|0.1213	L|L|L	0.33668|0.33668|0.33668	1.02|1.02|1.02	0.31617|0.31617|0.31617	N|N|N	0.650763|0.650763|0.650763	D;D;D|D|.	0.63880|0.65815|.	0.989;0.98;0.993|0.995|.	P;P;P|P|.	0.51055|0.49637|.	0.651;0.525;0.657|0.617|.	T|T|T	0.48352|0.48352|0.48352	-0.9043|-0.9043|-0.9043	10|9|5	0.87932|0.87932|.	D|D|.	0|0|.	.|.|.	11.8047|11.8047|11.8047	0.52147|0.52147|0.52147	0.317:0.683:0.0:0.0|0.317:0.683:0.0:0.0|0.317:0.683:0.0:0.0	.|.|.	746;1102;1102|5|.	Q99490-2;F8VVT9;Q99490|B7Z718|.	.;.;AGAP2_HUMAN|.|.	T|V|H	746;1102|5|945	ENSP00000257897:A746T;ENSP00000449241:A1102T|.|.	ENSP00000257897:A746T|ENSP00000437523:A5V|.	A|A|R	-|+|-	1|2|2	0|0|0	AGAP2|RP11-571M6.6|AGAP2	56407056|56407056|56407056	0.926000|0.926000|0.926000	0.31397|0.31397|0.31397	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.948000|0.948000|0.948000	0.59901|0.59901|0.59901	1.941000|1.941000|1.941000	0.40233|0.40233|0.40233	1.047000|1.047000|1.047000	0.40274|0.40274|0.40274	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	GCC|GCG|CGC	.		0.647	AGAP2-AS1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000408368.1		
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121437343	121437343	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:121437343C>T	ENST00000257555.6	+	9	1907	c.1681C>T	c.(1681-1683)Cag>Tag	p.Q561*	RP11-216P16.2_ENST00000606238.1_RNA|HNF1A_ENST00000544413.1_Nonsense_Mutation_p.Q568*|HNF1A_ENST00000541395.1_Nonsense_Mutation_p.Q592*			P20823	HNF1A_HUMAN	HNF1 homeobox A	561					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCGGCATCTCAGGCCACCAC	0.701									Hepatic Adenoma, Familial Clustering of																												p.Q561X		.											.	HNF1A-1745	0			c.C1681T	GRCh37	CM056410	HNF1A	M		.						28.0	28.0	28.0					12																	121437343		2201	4300	6501	SO:0001587	stop_gained	6927	exon9	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	GCATCTCAGGCCA	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1681C>T	12.37:g.121437343C>T	ENSP00000257555:p.Gln561*	42	0		37	10	NM_000545	0	0	46	57	11	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Nonsense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	37	6.366855	0.97511	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000537424;ENST00000543027;ENST00000541395;ENST00000544413	.	.	.	5.8	5.8	0.92144	.	0.246461	0.28754	N	0.014249	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-4.9172	17.2189	0.86952	0.0:1.0:0.0:0.0	.	.	.	.	X	561;453;561;382;592;568	.	ENSP00000257555:Q561X	Q	+	1	0	HNF1A	119921726	0.929000	0.31497	0.953000	0.39169	0.944000	0.59088	3.336000	0.52113	2.741000	0.93983	0.650000	0.86243	CAG	.		0.701	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HMGB1	3146	broad.mit.edu	37	13	31035512	31035512	+	Missense_Mutation	SNP	T	T	A	rs200836895	byFrequency	TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:31035512T>A	ENST00000405805.1	-	5	1570	c.630A>T	c.(628-630)gaA>gaT	p.E210D	HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000339872.4_Missense_Mutation_p.E210D|HMGB1_ENST00000399494.1_Missense_Mutation_p.E210D|HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000341423.5_Missense_Mutation_p.E210D			P09429	HMGB1_HUMAN	high mobility group box 1	210	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CATCAtcatcttcttcttcat	0.378													T|||	6	0.00119808	0.003	0.0	5008	,	,		18295	0.0		0.0	False		,,,				2504	0.002				p.E210D													.	HMGB1-227	0			c.A630T						.						20.0	25.0	23.0					13																	31035512		1894	4135	6029	SO:0001583	missense	3146	exon5			ATCATCTTCTTCT	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.630A>T	13.37:g.31035512T>A	ENSP00000384678:p.Glu210Asp	58	1		63	4	NM_002128	1	0	549	550	0	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	37	CCDS9335.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336740	0.41398	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.68	-1.58	0.08479	Armadillo-like helical (1);	0.305542	0.22770	N	0.055856	T	0.33440	0.0863	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.02901	-1.1096	10	0.87932	D	0	.	4.5078	0.11896	0.474:0.2443:0.0:0.2817	.	171;210	B3KQ05;P09429	.;HMGB1_HUMAN	D	210	ENSP00000384678:E210D;ENSP00000343040:E210D;ENSP00000345347:E210D;ENSP00000382417:E210D	ENSP00000343040:E210D	E	-	3	2	HMGB1	29933512	0.999000	0.42202	0.997000	0.53966	0.995000	0.86356	0.152000	0.16302	-0.149000	0.11215	-0.276000	0.10085	GAA	T|0.500;A|0.500		0.378	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
CCDC70	83446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	52439743	52439743	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:52439743C>T	ENST00000242819.4	+	2	525	c.229C>T	c.(229-231)Cat>Tat	p.H77Y		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	77						extracellular region (GO:0005576)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		AGGCAAGATCCATGCTTTCCG	0.463																																					p.H77Y		.											.	CCDC70-90	0			c.C229T						.						58.0	65.0	62.0					13																	52439743		2203	4300	6503	SO:0001583	missense	83446	exon2			AAGATCCATGCTT		CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.229C>T	13.37:g.52439743C>T	ENSP00000242819:p.His77Tyr	95	0		127	59	NM_031290	0	0	0	0	0	Q8N7A8|Q9H097	Missense_Mutation	SNP	ENST00000242819.4	37	CCDS9431.1	.	.	.	.	.	.	.	.	.	.	C	4.558	0.103562	0.08731	.	.	ENSG00000123171	ENST00000242819	T	0.20463	2.07	5.19	-0.626	0.11544	.	0.950993	0.08647	N	0.914676	T	0.13670	0.0331	N	0.22421	0.69	0.09310	N	1	B	0.18013	0.025	B	0.21708	0.036	T	0.35674	-0.9779	10	0.62326	D	0.03	-14.9052	6.1269	0.20184	0.4441:0.3965:0.0:0.1594	.	77	Q6NSX1	CCD70_HUMAN	Y	77	ENSP00000242819:H77Y	ENSP00000242819:H77Y	H	+	1	0	CCDC70	51337744	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.815000	0.04481	-0.051000	0.13334	-0.311000	0.09066	CAT	.		0.463	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	NM_031290	
PCDH8	5100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	53418949	53418949	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:53418949A>T	ENST00000377942.3	-	3	3162	c.2959T>A	c.(2959-2961)Ttc>Atc	p.F987I	PCDH8_ENST00000338862.4_Missense_Mutation_p.F890I	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	987					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CTCTTACAGAAGGTTGACATC	0.602																																					p.F987I	GBM(36;25 841 9273 49207)	.											.	PCDH8-153	0			c.T2959A						.						163.0	95.0	118.0					13																	53418949		2203	4300	6503	SO:0001583	missense	5100	exon3			TACAGAAGGTTGA	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2959T>A	13.37:g.53418949A>T	ENSP00000367177:p.Phe987Ile	122	0		112	48	NM_002590	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.419256	0.62622	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.56444	0.46;0.47	5.95	5.95	0.96441	.	0.000000	0.46442	D	0.000291	T	0.62816	0.2459	L	0.34521	1.04	0.52501	D	0.999954	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	T	0.59731	-0.7399	10	0.31617	T	0.26	.	16.4069	0.83677	1.0:0.0:0.0:0.0	.	890;987	O95206-2;O95206	.;PCDH8_HUMAN	I	987;890;513;830	ENSP00000367177:F987I;ENSP00000341350:F890I	ENSP00000341350:F890I	F	-	1	0	PCDH8	52316950	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.730000	0.91510	2.272000	0.75746	0.460000	0.39030	TTC	.		0.602	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
KTN1	3895	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	56107681	56107681	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr14:56107681C>T	ENST00000395314.3	+	16	2082	c.2014C>T	c.(2014-2016)Caa>Taa	p.Q672*	KTN1_ENST00000395309.3_Nonsense_Mutation_p.Q672*|KTN1_ENST00000438792.2_Nonsense_Mutation_p.Q672*|KTN1_ENST00000395308.1_Nonsense_Mutation_p.Q672*|KTN1_ENST00000413890.2_Nonsense_Mutation_p.Q672*|KTN1_ENST00000395311.1_Nonsense_Mutation_p.Q672*|KTN1_ENST00000416613.1_Nonsense_Mutation_p.Q672*	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	672					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GGAGAAGATGCAACAAAGGTG	0.338			T	RET	papillary thryoid																																p.Q672X				Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1-1147	0			c.C2014T						.						72.0	65.0	68.0					14																	56107681		2203	4298	6501	SO:0001587	stop_gained	3895	exon16			AAGATGCAACAAA		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2014C>T	14.37:g.56107681C>T	ENSP00000378725:p.Gln672*	46	0		55	17	NM_004986	0	0	0	0	0	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Nonsense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	C	39	7.766813	0.98477	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	.	.	.	4.87	4.87	0.63330	.	0.125962	0.35495	N	0.003163	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.3869	12.113	0.53850	0.0:0.9168:0.0:0.0832	.	.	.	.	X	672	.	ENSP00000378719:Q672X	Q	+	1	0	KTN1	55177434	1.000000	0.71417	0.932000	0.37286	0.677000	0.39632	2.235000	0.43044	2.400000	0.81607	0.591000	0.81541	CAA	.		0.338	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
ITGA11	22801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	68631978	68631978	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr15:68631978C>G	ENST00000315757.7	-	11	1222	c.1136G>C	c.(1135-1137)gGg>gCg	p.G379A	ITGA11_ENST00000423218.2_Missense_Mutation_p.G379A	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	379					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.G379V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CAGCAGAACCCCATCCTGGCA	0.597																																					p.G379A		.											.	ITGA11-538	1	Substitution - Missense(1)	kidney(1)	c.G1136C						.						61.0	65.0	63.0					15																	68631978		2028	4187	6215	SO:0001583	missense	22801	exon11			AGAACCCCATCCT	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1136G>C	15.37:g.68631978C>G	ENSP00000327290:p.Gly379Ala	100	0		84	19	NM_001004439	0	0	0	0	0	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	37	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049868	0.75846	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	T;T	0.77750	-1.12;-1.12	5.09	5.09	0.68999	.	0.141219	0.64402	D	0.000005	D	0.86690	0.5993	M	0.84511	2.7	0.54753	D	0.999988	D;D	0.59357	0.985;0.984	P;P	0.55871	0.786;0.736	D	0.87055	0.2149	10	0.38643	T	0.18	.	17.5593	0.87901	0.0:1.0:0.0:0.0	.	379;379	A8K8T0;Q9UKX5	.;ITA11_HUMAN	A	379;379;14;379	ENSP00000327290:G379A;ENSP00000403392:G379A	ENSP00000327290:G379A	G	-	2	0	ITGA11	66419032	1.000000	0.71417	0.983000	0.44433	0.842000	0.47809	7.818000	0.86416	2.391000	0.81399	0.555000	0.69702	GGG	.		0.597	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	76673781	76673781	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr15:76673781C>T	ENST00000563290.1	-	28	3738	c.3643G>A	c.(3643-3645)Gtg>Atg	p.V1215M	SCAPER_ENST00000538941.2_Missense_Mutation_p.V969M|SCAPER_ENST00000324767.7_Missense_Mutation_p.V1215M			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1215						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TGAATGGCCACTTGGATGGTA	0.443																																					p.V1215M		.											.	SCAPER-137	0			c.G3643A						.						92.0	88.0	89.0					15																	76673781		1939	4133	6072	SO:0001583	missense	49855	exon27			TGGCCACTTGGAT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3643G>A	15.37:g.76673781C>T	ENSP00000454973:p.Val1215Met	59	0		50	11	NM_020843	0	0	10	15	5	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481299	0.63849	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.32023	1.5;1.47	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	M	0.67953	2.075	0.51767	D	0.999932	D;D	0.65815	0.975;0.995	P;D	0.67231	0.793;0.95	T	0.53599	-0.8416	10	0.87932	D	0	.	15.5231	0.75881	0.0:0.8625:0.1375:0.0	.	1214;969	Q9BY12;F5H7X8	SCAPE_HUMAN;.	M	1215;969;1237	ENSP00000326924:V1215M;ENSP00000442190:V969M	ENSP00000303560:V1237M	V	-	1	0	SCAPER	74460836	1.000000	0.71417	0.920000	0.36463	0.589000	0.36550	5.651000	0.67951	2.740000	0.93945	0.650000	0.86243	GTG	.		0.443	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
XYLT1	64131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	17252766	17252766	+	Splice_Site	SNP	C	C	G	rs369970325		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr16:17252766C>G	ENST00000261381.6	-	6	1374	c.1290G>C	c.(1288-1290)agG>agC	p.R430S		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	430					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGTCATTTGTCCTGTGGAAAC	0.498																																					p.R430S		.											.	XYLT1-94	0			c.G1290C						.						82.0	76.0	78.0					16																	17252766		2197	4300	6497	SO:0001630	splice_region_variant	64131	exon6			ATTTGTCCTGTGG	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1290-1G>C	16.37:g.17252766C>G		85	1		121	65	NM_022166	0	0	0	0	0	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902489	0.72754	.	.	ENSG00000103489	ENST00000261381	T	0.11495	2.77	4.9	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.32793	0.0841	M	0.82056	2.57	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.07404	-1.0774	10	0.72032	D	0.01	.	11.9464	0.52930	0.0:0.8562:0.0:0.1438	.	430	Q86Y38	XYLT1_HUMAN	S	430	ENSP00000261381:R430S	ENSP00000261381:R430S	R	-	3	2	XYLT1	17160267	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.638000	0.46562	2.398000	0.81561	0.563000	0.77884	AGG	.		0.498	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	Missense_Mutation
DCUN1D3	123879	broad.mit.edu	37	16	20871518	20871518	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr16:20871518C>A	ENST00000324344.4	-	3	890	c.605G>T	c.(604-606)cGg>cTg	p.R202L	ERI2_ENST00000564349.1_Intron|DCUN1D3_ENST00000563934.1_Missense_Mutation_p.R202L	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	202	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		GGCTATTTCCCGATGCAGTGA	0.478																																					p.R202L													.	DCUN1D3-92	0			c.G605T						.						166.0	169.0	168.0					16																	20871518		2201	4300	6501	SO:0001583	missense	123879	exon3			ATTTCCCGATGCA	BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.605G>T	16.37:g.20871518C>A	ENSP00000319482:p.Arg202Leu	252	0		371	7	NM_173475	0	0	11	11	0	B3KVY4	Missense_Mutation	SNP	ENST00000324344.4	37	CCDS10592.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.310323	0.23821	.	.	ENSG00000188215	ENST00000324344	.	.	.	6.08	6.08	0.98989	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	T	0.20333	0.0489	N	0.00329	-1.635	0.80722	D	1	B	0.27791	0.189	B	0.26969	0.075	T	0.48647	-0.9017	9	0.02654	T	1	-21.6441	20.6634	0.99662	0.0:1.0:0.0:0.0	.	202	Q8IWE4	DCNL3_HUMAN	L	202	.	ENSP00000319482:R202L	R	-	2	0	DCUN1D3	20779019	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.760000	0.85248	2.894000	0.99253	0.655000	0.94253	CGG	.		0.478	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475	
MYH13	8735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10227379	10227379	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:10227379A>T	ENST00000418404.3	-	22	3057	c.2894T>A	c.(2893-2895)tTg>tAg	p.L965*	MYH13_ENST00000252172.4_Nonsense_Mutation_p.L965*|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	965					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						AACTTTCGTCAAGGTCAGCTC	0.463																																					p.L965X		.											.	MYH13-6	0			c.T2894A						.						106.0	105.0	106.0					17																	10227379		2195	4300	6495	SO:0001587	stop_gained	8735	exon23			TTCGTCAAGGTCA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2894T>A	17.37:g.10227379A>T	ENSP00000404570:p.Leu965*	70	0		105	68	NM_003802	0	0	0	0	0	O95252|Q9P0U8	Nonsense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	A	42	9.641822	0.99227	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0394	0.64665	1.0:0.0:0.0:0.0	.	.	.	.	X	965;591	.	ENSP00000252172:L965X	L	-	2	0	MYH13	10168104	1.000000	0.71417	0.965000	0.40720	0.705000	0.40729	8.981000	0.93465	1.950000	0.56595	0.533000	0.62120	TTG	.		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MYH8	4626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10309460	10309460	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:10309460T>C	ENST00000403437.2	-	21	2424	c.2330A>G	c.(2329-2331)gAa>gGa	p.E777G	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	777	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCTCATTTCTTCCAGAAGACC	0.413									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.E777G		.											.	MYH8-101	0			c.A2330G						.						113.0	108.0	110.0					17																	10309460		2203	4300	6503	SO:0001583	missense	4626	exon21	Familial Cancer Database	Carney Complex Variant	ATTTCTTCCAGAA		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2330A>G	17.37:g.10309460T>C	ENSP00000384330:p.Glu777Gly	90	0		101	54	NM_002472	0	0	0	0	0	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512766	0.85389	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.75260	-0.92	5.22	5.22	0.72569	Myosin head, motor domain (1);	0.000000	0.42420	U	0.000719	D	0.92182	0.7521	H	0.99415	4.555	0.58432	D	0.999999	D	0.71674	0.998	D	0.74674	0.984	D	0.95289	0.8393	10	0.66056	D	0.02	.	15.2675	0.73672	0.0:0.0:0.0:1.0	.	777	P13535	MYH8_HUMAN	G	777	ENSP00000384330:E777G	ENSP00000252173:E777G	E	-	2	0	MYH8	10250185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.825000	0.86693	2.205000	0.71048	0.528000	0.53228	GAA	.		0.413	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	346	54		573	78	NM_145301	0	0	15	109	94	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
STAC2	342667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37368584	37368584	+	Silent	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:37368584C>T	ENST00000333461.5	-	11	1566	c.1197G>A	c.(1195-1197)aaG>aaA	p.K399K		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	399					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						CCAGGCCCCGCTTCTTGCCAC	0.622																																					p.K399K		.											.	STAC2-91	0			c.G1197A						.						58.0	52.0	54.0					17																	37368584		2203	4300	6503	SO:0001819	synonymous_variant	342667	exon11			GCCCCGCTTCTTG	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.1197G>A	17.37:g.37368584C>T		35	0		60	14	NM_198993	0	0	1	1	0	Q32MA3	Silent	SNP	ENST00000333461.5	37	CCDS11335.1																																																																																			.		0.622	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444533.2	NM_198993	
KRTAP4-11	653240	broad.mit.edu	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	G	C	rs141357429		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:39274087G>C	ENST00000391413.2	-	1	519	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.L161V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.657																																					p.L161V													.	.	1	Substitution - Missense(1)	prostate(1)	c.C481G						.						17.0	21.0	20.0					17																	39274087		692	1589	2281	SO:0001583	missense	653240	exon1			GACGCAGGCAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.481C>G	17.37:g.39274087G>C	ENSP00000375232:p.Leu161Val	26	0		48	8	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	249	0.11401098901098901	67	0.13617886178861788	40	0.11049723756906077	104	0.18181818181818182	38	0.05013192612137203	.	1.347	-0.592411	0.03799	.	.	ENSG00000212721	ENST00000391413	T	0.00614	6.21	4.35	0.986	0.19784	.	.	.	.	.	T	0.00012	0.0000	L	0.31752	0.955	0.80722	P	0.0	B	0.30068	0.267	B	0.18871	0.023	T	0.19063	-1.0317	8	0.11794	T	0.64	.	5.8913	0.18915	0.1751:0.0:0.6569:0.168	.	161	Q9BYQ6	KR411_HUMAN	V	161	ENSP00000375232:L161V	ENSP00000375232:L161V	L	-	1	2	KRTAP4-11	36527613	0.671000	0.27521	0.912000	0.35992	0.970000	0.65996	0.971000	0.29396	0.348000	0.23949	0.609000	0.83330	CTG	G|0.500;C|0.500		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
ITGB4	3691	hgsc.bcm.edu	37	17	73750000	73750000	+	Silent	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:73750000C>G	ENST00000200181.3	+	33	4450	c.4263C>G	c.(4261-4263)ggC>ggG	p.G1421G	ITGB4_ENST00000450894.3_Intron|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000579662.1_Intron|ITGB4_ENST00000449880.2_Intron|ITGB4_ENST00000339591.3_Intron	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1421				HGPPDDGGAGGKGGSL -> TAPRTTAARAGRAAAV (in Ref. 3; CAA37656). {ECO:0000305}.	amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACGACGGCGGCGCGGGCGGGA	0.811																																					p.G1421G		.											.	ITGB4-227	0			c.C4263G						.						1.0	1.0	1.0					17																	73750000		306	673	979	SO:0001819	synonymous_variant	3691	exon33			CGGCGGCGCGGGC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4263C>G	17.37:g.73750000C>G		0	0		4	2	NM_000213	0	0	0	0	0	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	ENST00000200181.3	37	CCDS11727.1																																																																																			.		0.811	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
MISP	126353	broad.mit.edu	37	19	757398	757398	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:757398C>A	ENST00000215582.6	+	2	555	c.452C>A	c.(451-453)gCa>gAa	p.A151E		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	151					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CAGGGCCAGGCAGTCAGGAAG	0.687																																					p.A151E													.	C19orf21-91	0			c.C452A						.						33.0	33.0	33.0					19																	757398		2195	4295	6490	SO:0001583	missense	126353	exon2			GCCAGGCAGTCAG	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.452C>A	19.37:g.757398C>A	ENSP00000215582:p.Ala151Glu	21	0		18	7	NM_173481	0	0	28	42	14		Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914658	0.52546	.	.	ENSG00000099812	ENST00000215582	T	0.72167	-0.63	4.5	-0.245	0.13027	.	0.782626	0.11427	N	0.565152	T	0.75027	0.3794	M	0.62723	1.935	0.09310	N	0.999994	D	0.69078	0.997	D	0.63793	0.918	T	0.61564	-0.7037	10	0.62326	D	0.03	-21.0524	3.6537	0.08213	0.0:0.4294:0.1998:0.3708	.	151	Q8IVT2	CS021_HUMAN	E	151	ENSP00000215582:A151E	ENSP00000215582:A151E	A	+	2	0	C19orf21	708398	0.000000	0.05858	0.315000	0.25238	0.640000	0.38277	-0.256000	0.08757	0.308000	0.22923	0.313000	0.20887	GCA	.		0.687	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
RANBP3	8498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5914495	5914495	+	IGR	SNP	G	G	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:5914495G>T	ENST00000340578.6	-	0	3233				CAPS_ENST00000588776.1_Silent_p.L112L|CAPS_ENST00000222125.5_Silent_p.L26L|AC104532.4_ENST00000591109.1_RNA|AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000452990.2_Silent_p.L26L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						TCCAGGGCCTGGCCAGGTGAG	0.667																																					p.L26L		.											.	CAPS-90	0			c.G78T						.						38.0	42.0	41.0					19																	5914495		2203	4300	6503	SO:0001628	intergenic_variant	828	exon2			GGGCCTGGCCAGG	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914495G>T		72	0		57	22	NM_080590	0	0	0	0	0	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	ENST00000340578.6	37	CCDS42478.1																																																																																			.		0.667	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6709834	6709834	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:6709834T>G	ENST00000245907.6	-	14	1798	c.1706A>C	c.(1705-1707)cAg>cCg	p.Q569P		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	569					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GTCTTCTGACTGGCCGCTTTT	0.637																																					p.Q569P		.											.	C3-95	0			c.A1706C						.						51.0	52.0	52.0					19																	6709834		2203	4300	6503	SO:0001583	missense	718	exon14			TCTGACTGGCCGC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1706A>C	19.37:g.6709834T>G	ENSP00000245907:p.Gln569Pro	101	1		72	18	NM_000064	0	0	6	176	170	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	7.093	0.572475	0.13623	.	.	ENSG00000125730	ENST00000245907	T	0.60548	0.18	5.15	-4.43	0.03568	Alpha-2-macroglobulin, N-terminal 2 (1);	1.754940	0.02473	N	0.087708	T	0.26991	0.0661	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09143	-1.0688	10	0.15066	T	0.55	.	2.5674	0.04786	0.1135:0.1705:0.2356:0.4803	.	569	P01024	CO3_HUMAN	P	569	ENSP00000245907:Q569P	ENSP00000245907:Q569P	Q	-	2	0	C3	6660834	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.671000	0.01954	-0.737000	0.04824	-0.382000	0.06688	CAG	.		0.637	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
FCER2	2208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7755293	7755293	+	Splice_Site	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:7755293T>A	ENST00000346664.5	-	9	832	c.620A>T	c.(619-621)cAg>cTg	p.Q207L	FCER2_ENST00000597921.1_Splice_Site_p.Q207L|FCER2_ENST00000360067.4_Splice_Site_p.Q206L	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	207	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						CCAGCCCACCTGCTCCTCCGG	0.667																																					p.Q207L		.											.	FCER2-130	0			c.A620T						.						43.0	46.0	45.0					19																	7755293		2203	4300	6503	SO:0001630	splice_region_variant	2208	exon9			CCCACCTGCTCCT	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.621+1A>T	19.37:g.7755293T>A		105	0		92	27	NM_002002	0	0	0	0	0		Missense_Mutation	SNP	ENST00000346664.5	37	CCDS12184.1	.	.	.	.	.	.	.	.	.	.	t	14.83	2.652954	0.47362	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.16457	2.34;2.34	4.61	4.61	0.57282	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.33477	U	0.004865	T	0.37652	0.1011	M	0.66378	2.025	0.36695	D	0.879773	D	0.76494	0.999	D	0.87578	0.998	T	0.46843	-0.9162	10	0.87932	D	0	.	10.4446	0.44486	0.0:0.0:0.0:1.0	.	207	P06734	FCER2_HUMAN	L	207;206	ENSP00000264072:Q207L;ENSP00000353178:Q206L	ENSP00000264072:Q207L	Q	-	2	0	FCER2	7661293	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	3.912000	0.56386	1.733000	0.51620	0.382000	0.24955	CAG	.		0.667	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	Missense_Mutation
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11113781	11113781	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:11113781G>C	ENST00000429416.3	+	13	2170	c.1889G>C	c.(1888-1890)gGc>gCc	p.G630A	SMARCA4_ENST00000344626.4_Missense_Mutation_p.G630A|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G630A|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G630A|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G630A|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G630A|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G630A|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G630A|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G630A	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	630					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATCCTCACAGGCACAGATGCC	0.597			"""F, N, Mis"""		NSCLC																																p.G630A		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.G1889C						.						77.0	79.0	78.0					19																	11113781		2203	4300	6503	SO:0001583	missense	6597	exon12			TCACAGGCACAGA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1889G>C	19.37:g.11113781G>C	ENSP00000395654:p.Gly630Ala	148	0		111	28	NM_003072	0	0	19	45	26	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862182	0.91511	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	4.57	4.57	0.56435	BRK domain (2);	0.000000	0.85682	D	0.000000	T	0.79805	0.4509	L	0.58510	1.815	0.80722	D	1	P;P;P;P;D;P;P	0.54772	0.857;0.932;0.932;0.853;0.968;0.868;0.868	P;P;P;P;P;P;P	0.53760	0.597;0.708;0.708;0.734;0.699;0.708;0.708	T	0.82386	-0.0483	10	0.66056	D	0.02	-36.4878	16.6596	0.85238	0.0:0.0:1.0:0.0	.	630;630;630;630;630;630;630	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	A	630;630;694;630;630;630;630;630	ENSP00000395654:G630A;ENSP00000350720:G630A;ENSP00000343896:G630A;ENSP00000445036:G630A;ENSP00000392837:G630A;ENSP00000397783:G630A;ENSP00000414727:G630A	ENSP00000343896:G630A	G	+	2	0	SMARCA4	10974781	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.601000	0.98297	2.526000	0.85167	0.563000	0.77884	GGC	.		0.597	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
MAU2	23383	broad.mit.edu;bcgsc.ca	37	19	19431865	19431865	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:19431865G>T	ENST00000392313.6	+	1	376	c.197G>T	c.(196-198)cGt>cTt	p.R66L	MAU2_ENST00000262815.8_Missense_Mutation_p.R66L|SUGP1_ENST00000334782.5_5'Flank|SUGP1_ENST00000247001.5_5'Flank|SUGP1_ENST00000585763.1_5'Flank	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	66	Sufficient for interaction with NIPBL.				maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						ATCGAGGCCCGTACACACCTG	0.682																																					p.R66L													.	MAU2-91	0			c.G197T						.						26.0	30.0	29.0					19																	19431865		2080	4228	6308	SO:0001583	missense	23383	exon1			AGGCCCGTACACA	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.197G>T	19.37:g.19431865G>T	ENSP00000376127:p.Arg66Leu	35	0		33	10	NM_015329	0	0	5	13	8	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Missense_Mutation	SNP	ENST00000392313.6	37	CCDS32969.2	.	.	.	.	.	.	.	.	.	.	G	33	5.199804	0.94997	.	.	ENSG00000129933	ENST00000392313;ENST00000262815	T;T	0.76060	-0.99;-0.99	5.31	5.31	0.75309	.	0.000000	0.85682	U	0.000000	T	0.73575	0.3604	L	0.47716	1.5	0.80722	D	1	P	0.42908	0.793	P	0.46275	0.51	T	0.69453	-0.5141	10	0.20519	T	0.43	.	17.548	0.87867	0.0:0.0:1.0:0.0	.	66	Q9Y6X3	SCC4_HUMAN	L	66	ENSP00000376127:R66L;ENSP00000262815:R66L	ENSP00000262815:R66L	R	+	2	0	MAU2	19292865	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	8.702000	0.91338	2.511000	0.84671	0.561000	0.74099	CGT	.		0.682	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38990577	38990577	+	Missense_Mutation	SNP	G	G	A	rs201584482		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:38990577G>A	ENST00000359596.3	+	45	7244	c.7244G>A	c.(7243-7245)cGg>cAg	p.R2415Q	RYR1_ENST00000360985.3_Missense_Mutation_p.R2415Q|RYR1_ENST00000355481.4_Missense_Mutation_p.R2415Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2415	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAAGAAAACCGGGTGCACCTG	0.632																																					p.R2415Q		.											.	RYR1-100	0			c.G7244A						.						120.0	97.0	104.0					19																	38990577		2203	4300	6503	SO:0001583	missense	6261	exon45			AAAACCGGGTGCA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7244G>A	19.37:g.38990577G>A	ENSP00000352608:p.Arg2415Gln	109	0		105	35	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704736	0.48412	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97529	-4.42;-4.42;-4.42	3.99	3.99	0.46301	.	0.000000	0.64402	U	0.000007	D	0.95726	0.8610	L	0.48362	1.52	0.38108	D	0.937463	D;D	0.63046	0.992;0.985	P;B	0.48901	0.594;0.44	D	0.95492	0.8570	10	0.33141	T	0.24	.	15.0045	0.71501	0.0:0.0:1.0:0.0	.	2415;2415	P21817-2;P21817	.;RYR1_HUMAN	Q	2415	ENSP00000352608:R2415Q;ENSP00000347667:R2415Q;ENSP00000354254:R2415Q	ENSP00000347667:R2415Q	R	+	2	0	RYR1	43682417	0.992000	0.36948	1.000000	0.80357	0.705000	0.40729	2.287000	0.43505	2.045000	0.60652	0.297000	0.19635	CGG	.		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
MYH14	79784	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50764757	50764757	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:50764757A>G	ENST00000596571.1	+	18	2327	c.2327A>G	c.(2326-2328)aAc>aGc	p.N776S	MYH14_ENST00000440075.2_Missense_Mutation_p.N817S|MYH14_ENST00000262269.8_Missense_Mutation_p.N817S|MYH14_ENST00000425460.1_Missense_Mutation_p.N784S|MYH14_ENST00000376970.2_Missense_Mutation_p.N809S|MYH14_ENST00000601313.1_Missense_Mutation_p.N817S|MYH14_ENST00000598205.1_Missense_Mutation_p.N784S			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	776	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CTGGACCCCAACCTCTACCGC	0.632																																					p.N817S		.											.	MYH14-23	0			c.A2450G						.						40.0	44.0	42.0					19																	50764757		2011	4174	6185	SO:0001583	missense	79784	exon21			ACCCCAACCTCTA	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2327A>G	19.37:g.50764757A>G	ENSP00000472819:p.Asn776Ser	85	0		74	20	NM_001145809	0	0	22	53	31	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.111012	0.56398	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	4.48	4.48	0.54585	Myosin head, motor domain (2);	.	.	.	.	D	0.82770	0.5109	L	0.47016	1.485	0.80722	D	1	B;B;B	0.29909	0.144;0.261;0.22	B;B;B	0.29176	0.03;0.099;0.06	T	0.82348	-0.0502	9	0.54805	T	0.06	.	12.0425	0.53460	1.0:0.0:0.0:0.0	.	817;776;784	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	S	776;817;809;784;776;817	ENSP00000406273:N817S;ENSP00000366169:N809S;ENSP00000407879:N784S;ENSP00000262269:N817S	ENSP00000262269:N817S	N	+	2	0	MYH14	55456569	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.830000	0.92063	2.028000	0.59812	0.454000	0.30748	AAC	.		0.632	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
NLRP8	126205	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56459545	56459545	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:56459545C>A	ENST00000291971.3	+	1	348	c.277C>A	c.(277-279)Cct>Act	p.P93T	NLRP8_ENST00000590542.1_Missense_Mutation_p.P93T	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	93	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGAGCGTTTCCCTGGACGACG	0.507																																					p.P93T													.	NLRP8-361	0			c.C277A						.						115.0	106.0	109.0					19																	56459545		2203	4300	6503	SO:0001583	missense	126205	exon1			CGTTTCCCTGGAC	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.277C>A	19.37:g.56459545C>A	ENSP00000291971:p.Pro93Thr	49	0		37	9	NM_176811	0	0	0	0	0	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024871	0.35701	.	.	ENSG00000179709	ENST00000291971	T	0.51574	0.7	2.05	2.05	0.26809	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.63177	0.2489	M	0.76170	2.325	0.09310	N	1	D;D	0.76494	0.993;0.999	D;D	0.79784	0.916;0.993	T	0.46555	-0.9183	9	0.44086	T	0.13	.	7.6404	0.28290	0.0:1.0:0.0:0.0	.	93;93	Q86W28-2;Q86W28	.;NALP8_HUMAN	T	93	ENSP00000291971:P93T	ENSP00000291971:P93T	P	+	1	0	NLRP8	61151357	0.001000	0.12720	0.262000	0.24481	0.056000	0.15407	0.287000	0.18920	1.462000	0.47948	0.514000	0.50259	CCT	.		0.507	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ZBTB45	84878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	59027831	59027831	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:59027831C>G	ENST00000594051.1	-	2	1690	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q	ZBTB45_ENST00000354590.3_Missense_Mutation_p.E404Q|ZBTB45_ENST00000600990.1_Missense_Mutation_p.E404Q			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		TGGCTGCACTCATACGTAGGT	0.642																																					p.E404Q	NSCLC(164;1383 2017 5233 27540 46677)	.											.	ZBTB45-90	0			c.G1210C						.						63.0	61.0	62.0					19																	59027831		2203	4300	6503	SO:0001583	missense	84878	exon2			TGCACTCATACGT	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.1210G>C	19.37:g.59027831C>G	ENSP00000469089:p.Glu404Gln	43	1		52	14	NM_032792	0	0	15	19	4		Missense_Mutation	SNP	ENST00000594051.1	37	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	c	13.94	2.388310	0.42308	.	.	ENSG00000119574	ENST00000354590	T	0.35236	1.32	3.41	3.41	0.39046	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.411951	0.20599	N	0.089190	T	0.41328	0.1154	N	0.20328	0.56	0.28981	N	0.888614	D	0.71674	0.998	D	0.65874	0.939	T	0.27020	-1.0086	10	0.56958	D	0.05	.	13.1018	0.59224	0.0:1.0:0.0:0.0	.	404	Q96K62	ZBT45_HUMAN	Q	404	ENSP00000346603:E404Q	ENSP00000346603:E404Q	E	-	1	0	ZBTB45	63719643	0.226000	0.23696	0.996000	0.52242	0.534000	0.34807	1.041000	0.30291	2.221000	0.72209	0.467000	0.42956	GAG	.		0.642	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792	
GRHL1	29841	broad.mit.edu;bcgsc.ca	37	2	10130855	10130855	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:10130855G>A	ENST00000324907.9	+	10	1437	c.1301G>A	c.(1300-1302)cGa>cAa	p.R434Q	GRHL1_ENST00000324883.5_Missense_Mutation_p.R245Q|GRHL1_ENST00000405379.2_Missense_Mutation_p.R434Q	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	434					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GATGAAGAACGAAAGCAAAGC	0.418																																					p.R434Q													.	GRHL1-92	0			c.G1301A						.						114.0	99.0	104.0					2																	10130855		2203	4300	6503	SO:0001583	missense	29841	exon10			AAGAACGAAAGCA	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1301G>A	2.37:g.10130855G>A	ENSP00000324693:p.Arg434Gln	34	0		29	9	NM_198182	0	0	7	8	1	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	37	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817681	0.90790	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907	T;T;T	0.18016	2.24;2.24;2.24	5.76	5.76	0.90799	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	M	0.73598	2.24	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.74674	0.961;0.984	T	0.35822	-0.9773	10	0.72032	D	0.01	-7.5436	19.9574	0.97228	0.0:0.0:1.0:0.0	.	245;434	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	Q	434;245;434	ENSP00000384209:R434Q;ENSP00000324494:R245Q;ENSP00000324693:R434Q	ENSP00000324494:R245Q	R	+	2	0	GRHL1	10048306	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	7.066000	0.76734	2.715000	0.92844	0.561000	0.74099	CGA	.		0.418	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
GREB1	9687	hgsc.bcm.edu;broad.mit.edu	37	2	11758729	11758729	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:11758729A>G	ENST00000381486.2	+	22	4028	c.3728A>G	c.(3727-3729)cAg>cGg	p.Q1243R	GREB1_ENST00000234142.5_Missense_Mutation_p.Q1243R|GREB1_ENST00000396123.1_Missense_Mutation_p.Q241R	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1243						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGGGTCCTGCAGGCCTCCCAG	0.652																																					p.Q1243R	Ovarian(39;850 945 2785 23371 33093)	.											.	GREB1-91	0			c.A3728G						.						24.0	27.0	26.0					2																	11758729		2170	4247	6417	SO:0001583	missense	9687	exon22			TCCTGCAGGCCTC		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3728A>G	2.37:g.11758729A>G	ENSP00000370896:p.Gln1243Arg	42	0		54	3	NM_014668	0	0	11	11	0	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.322801	0.41096	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.25579	3.12;3.12;1.79	4.79	4.79	0.61399	.	0.429519	0.25958	N	0.027219	T	0.27454	0.0674	L	0.56769	1.78	0.36790	D	0.884798	B	0.30709	0.291	B	0.27715	0.082	T	0.30534	-0.9975	10	0.56958	D	0.05	-42.3953	14.313	0.66429	1.0:0.0:0.0:0.0	.	1243	Q4ZG55	GREB1_HUMAN	R	1243;1243;241	ENSP00000370896:Q1243R;ENSP00000234142:Q1243R;ENSP00000379429:Q241R	ENSP00000234142:Q1243R	Q	+	2	0	GREB1	11676180	1.000000	0.71417	0.906000	0.35671	0.930000	0.56654	3.610000	0.54125	1.802000	0.52723	0.445000	0.29226	CAG	.		0.652	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	15691634	15691634	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:15691634A>G	ENST00000281513.5	-	6	387	c.362T>C	c.(361-363)aTt>aCt	p.I121T	NBAS_ENST00000441750.1_Missense_Mutation_p.I121T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	121					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TTTCCCAATAATGGATGTAAA	0.299																																					p.I121T		.											.	NBAS-94	0			c.T362C						.						41.0	40.0	41.0					2																	15691634		2201	4297	6498	SO:0001583	missense	51594	exon6			CCAATAATGGATG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.362T>C	2.37:g.15691634A>G	ENSP00000281513:p.Ile121Thr	16	0		20	6	NM_015909	0	0	9	9	0	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	A	9.005	0.980968	0.18812	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.52526	0.66;0.66	5.66	5.66	0.87406	Quinoprotein amine dehydrogenase, beta chain-like (1);	0.283763	0.33854	N	0.004482	T	0.36026	0.0952	N	0.21448	0.665	0.23657	N	0.997182	B	0.06786	0.001	B	0.06405	0.002	T	0.36065	-0.9763	10	0.87932	D	0	.	13.4276	0.61035	1.0:0.0:0.0:0.0	.	121	A2RRP1	NBAS_HUMAN	T	121	ENSP00000413201:I121T;ENSP00000281513:I121T	ENSP00000281513:I121T	I	-	2	0	NBAS	15609085	1.000000	0.71417	0.995000	0.50966	0.472000	0.32918	4.934000	0.63491	2.144000	0.66660	0.477000	0.44152	ATT	.		0.299	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
LTBP1	4052	hgsc.bcm.edu	37	2	33172879	33172879	+	Missense_Mutation	SNP	T	T	C	rs62135680	byFrequency	TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:33172879T>C	ENST00000404816.2	+	1	841	c.488T>C	c.(487-489)cTg>cCg	p.L163P	Y_RNA_ENST00000384224.1_RNA|LTBP1_ENST00000354476.3_Missense_Mutation_p.L163P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	163					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGCAGCAGCTGCAGGGGTAA	0.716													T|||	22	0.00439297	0.0	0.0	5008	,	,		8051	0.0		0.0189	False		,,,				2504	0.0031				p.L163P		.											.	LTBP1-230	0			c.T488C						.	T	PRO/LEU	5,3041		0,5,1518	6.0	6.0	6.0		488	3.5	1.0	2	dbSNP_129	6	61,5721		0,61,2830	yes	missense	LTBP1	NM_206943.2	98	0,66,4348	CC,CT,TT		1.055,0.1641,0.7476	possibly-damaging	163/1722	33172879	66,8762	1523	2891	4414	SO:0001583	missense	4052	exon1			AGCAGCTGCAGGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.488T>C	2.37:g.33172879T>C	ENSP00000386043:p.Leu163Pro	11	1		21	10	NM_206943	0	0	0	0	0	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	17	0.007783882783882784	0	0.0	0	0.0	0	0.0	17	0.022427440633245383	T	20.4	3.981933	0.74474	0.001641	0.01055	ENSG00000049323	ENST00000404816;ENST00000354476	D;D	0.83992	-1.79;-1.78	4.67	3.52	0.40303	.	.	.	.	.	T	0.56124	0.1964	N	0.24115	0.695	0.80722	D	1	B	0.15930	0.015	B	0.14578	0.011	T	0.60905	-0.7170	9	0.87932	D	0	.	7.8282	0.29328	0.0:0.0979:0.0:0.9021	rs62135680	163	Q14766-4	.	P	163	ENSP00000386043:L163P;ENSP00000346467:L163P	ENSP00000346467:L163P	L	+	2	0	LTBP1	33026383	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.717000	0.54911	0.649000	0.30751	0.459000	0.35465	CTG	T|0.992;C|0.008		0.716	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SMEK2	57223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55812212	55812212	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:55812212A>G	ENST00000345102.5	-	7	1509	c.1208T>C	c.(1207-1209)aTg>aCg	p.M403T	SMEK2_ENST00000272313.5_Missense_Mutation_p.M403T|SMEK2_ENST00000407823.3_Missense_Mutation_p.M403T	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	403					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGCTTCTTGCATTACAAACTC	0.368																																					p.M403T		.											.	SMEK2-228	0			c.T1208C						.						114.0	111.0	112.0					2																	55812212		2203	4300	6503	SO:0001583	missense	57223	exon7			TCTTGCATTACAA	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1208T>C	2.37:g.55812212A>G	ENSP00000339769:p.Met403Thr	77	0		134	29	NM_001122964	0	0	33	59	26	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	37	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.325891	0.60743	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.40225	1.04;1.04;1.04	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	M	0.66939	2.045	0.80722	D	1	B;B;B;B	0.25850	0.018;0.136;0.002;0.136	B;B;B;B	0.30782	0.071;0.082;0.005;0.12	T	0.40979	-0.9534	10	0.44086	T	0.13	-11.8434	16.134	0.81465	1.0:0.0:0.0:0.0	.	403;403;403;403	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	T	403	ENSP00000272313:M403T;ENSP00000385912:M403T;ENSP00000339769:M403T	ENSP00000272313:M403T	M	-	2	0	SMEK2	55665716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.216000	0.71823	0.528000	0.53228	ATG	.		0.368	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	171687570	171687570	+	Silent	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:171687570C>T	ENST00000358196.3	+	5	965	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000375272.1_Silent_p.L139L|GAD1_ENST00000344257.5_Silent_p.L139L	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	139					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CACCAAGGTGCTGGACTTTCA	0.547																																					p.L139L		.											.	GAD1-91	0			c.C415T						.						114.0	99.0	104.0					2																	171687570		2203	4300	6503	SO:0001819	synonymous_variant	2571	exon5			AAGGTGCTGGACT		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.415C>T	2.37:g.171687570C>T		137	0		128	63	NM_000817	0	0	0	0	0	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Silent	SNP	ENST00000358196.3	37	CCDS2239.1																																																																																			.		0.547	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179419674	179419674	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:179419674A>G	ENST00000591111.1	-	281	83813	c.83589T>C	c.(83587-83589)gaT>gaC	p.D27863D	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Silent_p.D20439D|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Silent_p.D26936D|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Silent_p.D20631D|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_Silent_p.D29504D|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Silent_p.D20564D			Q8WZ42	TITIN_HUMAN	titin	27863	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTAAGGCGATCGGCATCTT	0.423																																					p.D29504D		.											.	TTN-636	0			c.T88512C						.						90.0	86.0	87.0					2																	179419674		1936	4131	6067	SO:0001819	synonymous_variant	7273	exon331			AAGGCGATCGGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83589T>C	2.37:g.179419674A>G		50	0		64	37	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179650834	179650834	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:179650834G>C	ENST00000591111.1	-	14	2335	c.2111C>G	c.(2110-2112)aCa>aGa	p.T704R	TTN_ENST00000460472.2_Missense_Mutation_p.T658R|TTN_ENST00000342992.6_Missense_Mutation_p.T704R|TTN_ENST00000342175.6_Missense_Mutation_p.T658R|TTN_ENST00000589042.1_Missense_Mutation_p.T704R|TTN_ENST00000360870.5_Missense_Mutation_p.T704R|TTN_ENST00000359218.5_Missense_Mutation_p.T658R			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAACAACTGTTGCTACAGC	0.493																																					p.T704R		.											.	TTN-636	0			c.C2111G						.						53.0	55.0	54.0					2																	179650834		2203	4300	6503	SO:0001583	missense	7273	exon14			ACAACTGTTGCTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2111C>G	2.37:g.179650834G>C	ENSP00000465570:p.Thr704Arg	66	0		110	56	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	16.74	3.207756	0.58343	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.70399	-0.48;-0.26;-0.26;-0.27;0.29;0.24	5.99	5.99	0.97316	Ribonuclease H-like (1);	.	.	.	.	T	0.80303	0.4598	L	0.36672	1.1	0.43574	D	0.995901	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.999	T	0.80732	-0.1251	9	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	658;658;658;704;704	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	R	704;658;658;658;658;704;208	ENSP00000343764:T704R;ENSP00000434586:T658R;ENSP00000340554:T658R;ENSP00000352154:T658R;ENSP00000354117:T704R;ENSP00000405517:T208R	ENSP00000340554:T658R	T	-	2	0	TTN	179359079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.402000	0.79972	2.840000	0.97914	0.655000	0.94253	ACA	.		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	185801068	185801068	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:185801068A>G	ENST00000302277.6	+	4	1539	c.945A>G	c.(943-945)caA>caG	p.Q315Q		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	315							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCAAGTTTCAACTTCAGTTAT	0.333																																					p.Q315Q		.											.	ZNF804A-163	0			c.A945G						.						33.0	32.0	33.0					2																	185801068		2203	4296	6499	SO:0001819	synonymous_variant	91752	exon4			GTTTCAACTTCAG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.945A>G	2.37:g.185801068A>G		47	0		67	41	NM_194250	0	0	0	0	0	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																			.		0.333	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
RUFY4	285180	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218938568	218938568	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:218938568A>T	ENST00000344321.7	+	8	1078	c.560A>T	c.(559-561)cAg>cTg	p.Q187L	RUFY4_ENST00000463872.1_Intron|RUFY4_ENST00000441828.2_Silent_p.P151P|RUFY4_ENST00000374155.3_Missense_Mutation_p.Q187L	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	187							metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		ACCCAAACCCAGGGAAGGAGA	0.562											OREG0015195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q187L													.	RUFY4-46	0			c.A560T						.						77.0	86.0	83.0					2																	218938568		1983	4166	6149	SO:0001583	missense	285180	exon8			AAACCCAGGGAAG	AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.560A>T	2.37:g.218938568A>T	ENSP00000345900:p.Gln187Leu	58	0	2255	66	11	NM_198483	0	0	0	0	0	Q6ZR96	Missense_Mutation	SNP	ENST00000344321.7	37		.	.	.	.	.	.	.	.	.	.	A	8.780	0.927938	0.18056	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.48836	1.44;0.8	3.8	-1.56	0.08532	.	1.202910	0.06250	N	0.691990	T	0.25382	0.0617	L	0.27053	0.805	0.09310	N	0.999999	B	0.33694	0.421	B	0.29267	0.1	T	0.10543	-1.0625	10	0.07644	T	0.81	-1.2143	3.9675	0.09437	0.4544:0.1956:0.35:0.0	.	187	Q6ZNE9	RUFY4_HUMAN	L	187	ENSP00000345900:Q187L;ENSP00000363270:Q187L	ENSP00000345900:Q187L	Q	+	2	0	RUFY4	218646813	0.084000	0.21492	0.030000	0.17652	0.036000	0.12997	0.189000	0.17037	-0.380000	0.07894	0.482000	0.46254	CAG	.		0.562	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198483	
COL6A3	1293	broad.mit.edu	37	2	238277277	238277277	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:238277277A>G	ENST00000295550.4	-	10	5281	c.4829T>C	c.(4828-4830)aTg>aCg	p.M1610T	COL6A3_ENST00000353578.4_Missense_Mutation_p.M1404T|COL6A3_ENST00000409809.1_Missense_Mutation_p.M1404T|COL6A3_ENST00000347401.3_Missense_Mutation_p.M1409T|COL6A3_ENST00000346358.4_Missense_Mutation_p.M1410T|COL6A3_ENST00000472056.1_Missense_Mutation_p.M1003T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1610	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAACGAGTTCATGATTCTTTC	0.547																																					p.M1610T													.	COL6A3-526	0			c.T4829C						.						118.0	112.0	114.0					2																	238277277		2203	4300	6503	SO:0001583	missense	1293	exon10			GAGTTCATGATTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4829T>C	2.37:g.238277277A>G	ENSP00000295550:p.Met1610Thr	161	1		190	6	NM_004369	0	0	5	5	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	A	6.501	0.460572	0.12342	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.69	4.52	0.55395	.	0.789008	0.11541	N	0.553748	T	0.63212	0.2492	N	0.16368	0.405	0.09310	N	1	P;B;B	0.34757	0.467;0.409;0.005	B;B;B	0.37422	0.17;0.249;0.006	T	0.51663	-0.8677	10	0.26408	T	0.33	.	7.117	0.25423	0.6357:0.1219:0.0:0.2424	.	1003;1404;1610	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	T	1610;1409;1404;1003;1404;1410	ENSP00000295550:M1610T;ENSP00000315609:M1409T;ENSP00000315873:M1404T;ENSP00000418285:M1003T;ENSP00000386844:M1404T;ENSP00000295546:M1410T	ENSP00000295550:M1610T	M	-	2	0	COL6A3	237942016	0.528000	0.26314	0.001000	0.08648	0.004000	0.04260	4.745000	0.62125	0.963000	0.38082	0.533000	0.62120	ATG	.		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CEP250	11190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34092361	34092361	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:34092361A>G	ENST00000397527.1	+	30	6884	c.6164A>G	c.(6163-6165)cAg>cGg	p.Q2055R	CEP250_ENST00000342580.4_Missense_Mutation_p.Q1999R	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2055	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGACATCAGCAGGAACGGGAG	0.557																																					p.Q2055R		.											.	CEP250-27	0			c.A6164G						.						29.0	31.0	30.0					20																	34092361		2203	4300	6503	SO:0001583	missense	11190	exon30			ATCAGCAGGAACG	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6164A>G	20.37:g.34092361A>G	ENSP00000380661:p.Gln2055Arg	29	0		52	17	NM_007186	0	0	6	7	1	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	7.149	0.583366	0.13749	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.43688	2.96;2.95;0.94	4.83	1.33	0.21861	.	0.879228	0.09850	N	0.747749	T	0.14743	0.0356	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29792	-1.0000	10	0.19147	T	0.46	.	8.6927	0.34275	0.6701:0.0:0.3299:0.0	.	2055	Q9BV73	CP250_HUMAN	R	2055;1999;543	ENSP00000380661:Q2055R;ENSP00000341541:Q1999R;ENSP00000395992:Q543R	ENSP00000341541:Q1999R	Q	+	2	0	CEP250	33555775	0.990000	0.36364	0.012000	0.15200	0.910000	0.53928	0.903000	0.28475	0.045000	0.15804	0.533000	0.62120	CAG	.		0.557	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
EPB41L1	2036	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34778270	34778270	+	Silent	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:34778270C>A	ENST00000338074.2	+	10	1259	c.1098C>A	c.(1096-1098)gtC>gtA	p.V366V	EPB41L1_ENST00000441639.1_Silent_p.V304V|EPB41L1_ENST00000202028.5_Silent_p.V304V|EPB41L1_ENST00000373946.3_Silent_p.V335V|EPB41L1_ENST00000373950.2_Silent_p.V269V|EPB41L1_ENST00000373941.1_Silent_p.V366V	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	366	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.V366V(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TGTGGAAGGTCTGCATCGAGC	0.537																																					p.V366V													.	EPB41L1-93	1	Substitution - coding silent(1)	kidney(1)	c.C1098A						.						84.0	71.0	75.0					20																	34778270		2203	4300	6503	SO:0001819	synonymous_variant	2036	exon11			GAAGGTCTGCATC	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1098C>A	20.37:g.34778270C>A		46	0		47	10	NM_001258329	0	0	22	37	15	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1																																																																																			.		0.537	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
UBE2V1	7335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	48713266	48713266	+	Silent	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:48713266T>C	ENST00000371674.3	-	2	158	c.114A>G	c.(112-114)gaA>gaG	p.E38E	UBE2V1_ENST00000396059.3_Intron|UBE2V1_ENST00000420027.2_Intron|UBE2V1_ENST00000415862.2_Intron|UBE2V1_ENST00000371677.3_Silent_p.E61E|TMEM189_ENST00000557021.1_Silent_p.E261E|UBE2V1_ENST00000371657.5_Silent_p.E38E|TMEM189-UBE2V1_ENST00000341698.2_Silent_p.E261E|UBE2V1_ENST00000340309.3_Silent_p.E61E	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1	38					cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			CTTCGTCATCTTCTAGACCCC	0.443																																					p.E261E		.											.	TMEM189-UBE2V1-454	0			c.A783G						.						140.0	132.0	134.0					20																	48713266		2203	4298	6501	SO:0001819	synonymous_variant	387522	exon6			GTCATCTTCTAGA	U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.114A>G	20.37:g.48713266T>C		210	2		196	58	NM_199203	0	0	39	60	21	E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	Silent	SNP	ENST00000371674.3	37	CCDS33483.1																																																																																			.		0.443	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080530.1	NM_021988	
ADNP	23394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49510230	49510230	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:49510230A>T	ENST00000396029.3	-	5	1588	c.1021T>A	c.(1021-1023)Tac>Aac	p.Y341N	ADNP_ENST00000396032.3_Missense_Mutation_p.Y341N|ADNP_ENST00000349014.3_Missense_Mutation_p.Y341N|ADNP_ENST00000371602.4_Missense_Mutation_p.Y341N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	341					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CCAACACTGTAACCCTGGCCT	0.443																																					p.Y341N		.											.	ADNP-92	0			c.T1021A						.						137.0	123.0	128.0					20																	49510230		2203	4300	6503	SO:0001583	missense	23394	exon5			CACTGTAACCCTG	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1021T>A	20.37:g.49510230A>T	ENSP00000379346:p.Tyr341Asn	114	0		98	31	NM_015339	0	0	13	22	9	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072885	0.36566	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.91	5.91	0.95273	.	0.295208	0.38663	N	0.001605	T	0.74665	0.3746	L	0.55990	1.75	0.42457	D	0.992773	D	0.76494	0.999	D	0.81914	0.995	T	0.72121	-0.4386	9	0.30078	T	0.28	-7.2492	16.3436	0.83110	1.0:0.0:0.0:0.0	.	341	Q9H2P0	ADNP_HUMAN	N	341	.	ENSP00000342905:Y341N	Y	-	1	0	ADNP	48943637	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.948000	0.93006	2.269000	0.75478	0.533000	0.62120	TAC	.		0.443	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
ADARB1	104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46596347	46596347	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr21:46596347G>A	ENST00000360697.3	+	2	746	c.731G>A	c.(730-732)cGc>cAc	p.R244H	ADARB1_ENST00000539173.1_Missense_Mutation_p.R244H|ADARB1_ENST00000389863.4_Missense_Mutation_p.R244H|ADARB1_ENST00000437626.1_Intron|ADARB1_ENST00000348831.4_Missense_Mutation_p.R244H			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	244	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		AACGAACTGCGCCCAGGACTC	0.587																																					p.R244H		.											.	ADARB1-91	0			c.G731A						.						108.0	97.0	101.0					21																	46596347		2203	4300	6503	SO:0001583	missense	104	exon4			AACTGCGCCCAGG	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.731G>A	21.37:g.46596347G>A	ENSP00000353920:p.Arg244His	117	0		122	44	NM_001160230	0	0	5	5	0	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564135	0.86335	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.28	5.28	0.74379	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	U	0.000000	D	0.86818	0.6024	M	0.75447	2.3	0.80722	D	1	P;D;D;B;P	0.61697	0.928;0.99;0.97;0.046;0.861	P;D;P;B;P	0.66716	0.521;0.946;0.877;0.04;0.521	D	0.85797	0.1371	10	0.38643	T	0.18	-42.4461	16.7859	0.85574	0.0:0.0:1.0:0.0	.	271;244;244;272;244	P78563-4;P78563;Q4AE77;G5E9B4;P78563-3	.;RED1_HUMAN;.;.;.	H	244	ENSP00000441897:R244H;ENSP00000374513:R244H;ENSP00000015877:R244H;ENSP00000353920:R244H	ENSP00000015877:R244H	R	+	2	0	ADARB1	45420775	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	9.347000	0.97059	2.633000	0.89246	0.655000	0.94253	CGC	.		0.587	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
CRKL	1399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21272259	21272259	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr22:21272259G>C	ENST00000354336.3	+	1	546	c.37G>C	c.(37-39)Gcc>Ccc	p.A13P		NM_005207.3	NP_005198.1	P46109	CRKL_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog-like	13					activation of MAPKK activity (GO:0000186)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|heart development (GO:0007507)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|parathyroid gland development (GO:0060017)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|thymus development (GO:0048538)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	poly(A) RNA binding (GO:0044822)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)	14	all_cancers(11;1.16e-25)|all_epithelial(7;3.37e-24)|Lung NSC(8;7.25e-16)|all_lung(8;1.37e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.176)			GGACCGCTCCGCCTGGTATAT	0.697																																					p.A13P	Pancreas(85;3 1441 23889 42519 42763)	.											.	CRKL-439	0			c.G37C						.						29.0	30.0	29.0					22																	21272259		2202	4299	6501	SO:0001583	missense	1399	exon1			CGCTCCGCCTGGT		CCDS13785.1	22q11.21	2013-07-09	2013-07-09		ENSG00000099942	ENSG00000099942		"""SH2 domain containing"""	2363	protein-coding gene	gene with protein product		602007				8361759, 8798523	Standard	NM_005207		Approved		uc002ztf.2	P46109	OTTHUMG00000150807	ENST00000354336.3:c.37G>C	22.37:g.21272259G>C	ENSP00000346300:p.Ala13Pro	60	1		60	13	NM_005207	0	0	8	19	11	A8KA44|D3DX35	Missense_Mutation	SNP	ENST00000354336.3	37	CCDS13785.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683747	0.68157	.	.	ENSG00000099942	ENST00000354336	T	0.21932	1.98	5.27	0.287	0.15714	SH2 motif (2);	0.368313	0.30611	N	0.009241	T	0.07098	0.0180	N	0.02412	-0.56	0.42745	D	0.993759	B	0.33000	0.393	B	0.29353	0.101	T	0.31888	-0.9927	10	0.14252	T	0.57	.	13.4072	0.60919	0.0:0.0:0.4263:0.5737	.	13	P46109	CRKL_HUMAN	P	13	ENSP00000346300:A13P	ENSP00000346300:A13P	A	+	1	0	CRKL	19602259	0.824000	0.29247	0.757000	0.31301	0.988000	0.76386	1.158000	0.31737	-0.041000	0.13558	0.650000	0.86243	GCC	.		0.697	CRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320158.1	NM_005207	
APOL4	80832	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36595420	36595420	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr22:36595420A>G	ENST00000405511.1	-	4	460	c.38T>C	c.(37-39)gTg>gCg	p.V13A	APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000397275.2_Missense_Mutation_p.C31R|APOL4_ENST00000404685.3_Missense_Mutation_p.V16A|APOL4_ENST00000332987.1_Missense_Mutation_p.V13A|APOL4_ENST00000328429.4_Splice_Site_p.C31R|APOL4_ENST00000429038.2_Missense_Mutation_p.V13A|APOL4_ENST00000352371.1_Missense_Mutation_p.V16A	NM_030643.3	NP_085146.2	Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	16					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						GTTTTGCTGCACCCTTGAGGA	0.557																																					.													.	APOL4-90	0			.						.						122.0	129.0	127.0					22																	36595420		2186	4294	6480	SO:0001583	missense	80832	.			TGCTGCACCCTTG	AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000405511.1:c.38T>C	22.37:g.36595420A>G	ENSP00000384011:p.Val13Ala	162	0		152	44	.	0	0	0	0	0	Q9BQ37|Q9BXQ8	Missense_Mutation	SNP	ENST00000405511.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	5.282|5.282	0.237449|0.237449	0.10023|0.10023	.|.	.|.	ENSG00000100336|ENSG00000100336	ENST00000397275;ENST00000328429|ENST00000404685;ENST00000405511;ENST00000429038;ENST00000352371;ENST00000332987;ENST00000457630;ENST00000419360;ENST00000449084;ENST00000436763	.|T;T;T;T;T;T;T;T;T	.|0.61742	.|1.51;1.37;1.37;3.81;3.92;0.81;0.77;0.39;0.08	1.44|1.44	0.359|0.359	0.16088|0.16088	.|.	.|9.394490	.|0.00944	.|U	.|0.002875	T|T	0.40448|0.40448	0.1117|0.1117	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17465	.|0.013;0.022	.|B;B	.|0.11329	.|0.003;0.006	T|T	0.11251|0.11251	-1.0595|-1.0595	5|9	0.87932|0.26408	D|T	0|0.33	.|.	3.4282|3.4282	0.07418|0.07418	0.767:0.0:0.233:0.0|0.767:0.0:0.233:0.0	.|.	.|16;13	.|Q9BPW4;Q9BPW4-3	.|APOL4_HUMAN;.	R|A	31|16;13;13;16;13;13;13;13;13	.|ENSP00000385119:V16A;ENSP00000384011:V13A;ENSP00000404366:V13A;ENSP00000338260:V16A;ENSP00000333229:V13A;ENSP00000409085:V13A;ENSP00000395548:V13A;ENSP00000388936:V13A;ENSP00000393096:V13A	ENSP00000331089:C31R|ENSP00000333229:V13A	C|V	-|-	1|2	0|0	APOL4|APOL4	34925366|34925366	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	0.524000|0.524000	0.22940|0.22940	0.051000|0.051000	0.15978|0.15978	-0.946000|-0.946000	0.02672|0.02672	TGC|GTG	.		0.557	APOL4-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000319256.2	NM_145660	
PODXL2	50512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127379599	127379599	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr3:127379599T>A	ENST00000342480.6	+	3	767	c.728T>A	c.(727-729)tTg>tAg	p.L243*		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	243					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						GGGCCCAGCTTGCTGCTGCCT	0.647																																					p.L243X		.											.	PODXL2-91	0			c.T728A						.						51.0	57.0	55.0					3																	127379599		2203	4300	6503	SO:0001587	stop_gained	50512	exon3			CCAGCTTGCTGCT	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.728T>A	3.37:g.127379599T>A	ENSP00000345359:p.Leu243*	95	0		88	18	NM_015720	0	0	1	1	0	Q6UVY4|Q8WUV6	Nonsense_Mutation	SNP	ENST00000342480.6	37	CCDS3044.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.198338	0.38806	.	.	ENSG00000114631	ENST00000342480;ENST00000302192	.	.	.	4.67	-0.49	0.12049	.	0.719396	0.11780	N	0.530317	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0789	7.8382	0.29382	0.0:0.3596:0.0:0.6404	.	.	.	.	X	243	.	ENSP00000304498:L243X	L	+	2	0	PODXL2	128862289	0.001000	0.12720	0.001000	0.08648	0.181000	0.23173	0.600000	0.24104	-0.256000	0.09473	0.402000	0.26972	TTG	.		0.647	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
XRN1	54464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142123863	142123863	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr3:142123863C>G	ENST00000264951.4	-	16	1886	c.1769G>C	c.(1768-1770)aGg>aCg	p.R590T	XRN1_ENST00000392981.2_Missense_Mutation_p.R590T|RNU6-1294P_ENST00000515995.1_RNA	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	590					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						GTTTCTTTTCCTCTCTTCCTT	0.408																																					p.R590T		.											.	XRN1-93	0			c.G1769C						.						162.0	148.0	152.0					3																	142123863		2203	4300	6503	SO:0001583	missense	54464	exon16			CTTTTCCTCTCTT	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1769G>C	3.37:g.142123863C>G	ENSP00000264951:p.Arg590Thr	76	0		82	35	NM_001042604	0	0	3	9	6	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363718	0.41902	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.26373	1.74;1.74	5.53	2.35	0.29111	.	0.408805	0.27109	N	0.020895	T	0.15825	0.0381	L	0.31664	0.95	0.80722	D	1	B;P;B	0.34800	0.067;0.469;0.417	B;B;B	0.33121	0.024;0.158;0.142	T	0.05599	-1.0875	10	0.40728	T	0.16	-9.364	7.0395	0.25013	0.0:0.5382:0.0:0.4618	.	451;590;590	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	T	590	ENSP00000264951:R590T;ENSP00000376707:R590T	ENSP00000264951:R590T	R	-	2	0	XRN1	143606553	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	1.245000	0.32790	0.691000	0.31592	-0.145000	0.13849	AGG	.		0.408	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
CHRD	8646	hgsc.bcm.edu	37	3	184098193	184098193	+	Silent	SNP	A	A	C	rs1920128		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr3:184098193A>C	ENST00000204604.1	+	1	333	c.87A>C	c.(85-87)ccA>ccC	p.P29P	THPO_ENST00000204615.7_5'Flank|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Silent_p.P29P|CHRD_ENST00000348986.3_Silent_p.P29P|CHRD_ENST00000545352.1_5'Flank|THPO_ENST00000445696.2_5'Flank|CHRD_ENST00000310236.3_Silent_p.P29P	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	29					BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			gcgccggcccAGAGCCCCCCG	0.796																																					p.P29P		.											.	CHRD-93	0			c.A87C						.						1.0	1.0	1.0					3																	184098193		283	643	926	SO:0001819	synonymous_variant	8646	exon1			CGGCCCAGAGCCC	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.87A>C	3.37:g.184098193A>C		0	0		4	4	NM_003741	0	0	0	6	6	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Silent	SNP	ENST00000204604.1	37	CCDS3266.1																																																																																			T|0.680;G|0.319		0.796	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48578148	48578148	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:48578148C>T	ENST00000503238.1	-	21	2619	c.2620G>A	c.(2620-2622)Gca>Aca	p.A874T	FRYL_ENST00000358350.4_Missense_Mutation_p.A874T|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.A874T|FRYL_ENST00000507711.1_Missense_Mutation_p.A874T|RNU5E-3P_ENST00000515913.1_RNA			O94915	FRYL_HUMAN	FRY-like	874					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GATGTTGCTGCACTGCAGCAA	0.468																																					p.A874T		.											.	FRYL-69	0			c.G2620A						.						122.0	124.0	124.0					4																	48578148		1943	4148	6091	SO:0001583	missense	285527	exon24			TTGCTGCACTGCA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2620G>A	4.37:g.48578148C>T	ENSP00000426064:p.Ala874Thr	148	0		97	27	NM_015030	0	0	9	9	0	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875024	0.51695	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.34859	2.35;2.35;2.35;1.34	5.14	5.14	0.70334	.	0.163703	0.41001	U	0.000974	T	0.19685	0.0473	N	0.08118	0	0.80722	D	1	B;B	0.25441	0.043;0.126	B;B	0.24701	0.011;0.055	T	0.09707	-1.0662	10	0.02654	T	1	.	18.6027	0.91255	0.0:1.0:0.0:0.0	.	874;874	F2Z2S2;O94915	.;FRYL_HUMAN	T	874	ENSP00000426064:A874T;ENSP00000351113:A874T;ENSP00000441114:A874T;ENSP00000421584:A874T	ENSP00000351113:A874T	A	-	1	0	FRYL	48272905	1.000000	0.71417	0.894000	0.35097	0.417000	0.31264	4.730000	0.62015	2.370000	0.80446	0.467000	0.42956	GCA	.		0.468	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
SHROOM3	57619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	77675996	77675996	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:77675996C>A	ENST00000296043.6	+	7	5313	c.4360C>A	c.(4360-4362)Ctg>Atg	p.L1454M	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1454					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TTTTGCAAACCTGAAGCACTA	0.567																																					p.L1454M		.											.	SHROOM3-93	0			c.C4360A						.						52.0	54.0	54.0					4																	77675996		2203	4300	6503	SO:0001583	missense	57619	exon7			GCAAACCTGAAGC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4360C>A	4.37:g.77675996C>A	ENSP00000296043:p.Leu1454Met	73	0		57	21	NM_020859	0	0	13	29	16	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358823	0.24598	.	.	ENSG00000138771	ENST00000296043	T	0.22743	1.94	5.23	5.23	0.72850	.	1.171820	0.06113	N	0.667490	T	0.22820	0.0551	N	0.24115	0.695	0.09310	N	1	D	0.56521	0.976	P	0.47744	0.556	T	0.17837	-1.0356	10	0.33141	T	0.24	-1.3606	12.5341	0.56133	0.0:0.9214:0.0:0.0786	.	1454	Q8TF72	SHRM3_HUMAN	M	1454	ENSP00000296043:L1454M	ENSP00000296043:L1454M	L	+	1	2	SHROOM3	77895020	0.251000	0.23961	0.544000	0.28141	0.006000	0.05464	2.227000	0.42972	2.716000	0.92895	0.655000	0.94253	CTG	.		0.567	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SLC39A8	64116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	103225511	103225511	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:103225511T>C	ENST00000394833.2	-	5	1279	c.803A>G	c.(802-804)cAt>cGt	p.H268R	SLC39A8_ENST00000510255.1_5'Flank|SLC39A8_ENST00000356736.4_Missense_Mutation_p.H268R|SLC39A8_ENST00000424970.2_Missense_Mutation_p.H268R	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	268					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AAAATGGATATGTCCATTAGC	0.363																																					p.H268R		.											.	SLC39A8-90	0			c.A803G						.						158.0	138.0	145.0					4																	103225511		2203	4300	6503	SO:0001583	missense	64116	exon5			TGGATATGTCCAT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.803A>G	4.37:g.103225511T>C	ENSP00000378310:p.His268Arg	68	0		68	23	NM_022154	0	0	71	149	78	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	37	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	T	9.588	1.125353	0.20959	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.44881	0.91;0.91;0.91	4.81	4.81	0.61882	.	0.460729	0.18153	U	0.150001	T	0.25938	0.0632	L	0.27053	0.805	0.33924	D	0.641179	B;B;B	0.32350	0.366;0.002;0.016	B;B;B	0.28385	0.089;0.003;0.048	T	0.32640	-0.9899	10	0.16896	T	0.51	-3.0995	9.2864	0.37760	0.1605:0.0:0.0:0.8395	.	268;268;201	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	R	268	ENSP00000394548:H268R;ENSP00000349174:H268R;ENSP00000378310:H268R	ENSP00000349174:H268R	H	-	2	0	SLC39A8	103444534	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.339000	0.43965	1.930000	0.55929	0.528000	0.53228	CAT	.		0.363	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
ACSL1	2180	broad.mit.edu	37	4	185686012	185686012	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:185686012G>A	ENST00000515030.1	-	15	1752	c.1427C>T	c.(1426-1428)aCc>aTc	p.T476I	ACSL1_ENST00000281455.2_Missense_Mutation_p.T476I|ACSL1_ENST00000513317.1_Missense_Mutation_p.T476I|ACSL1_ENST00000437665.3_Missense_Mutation_p.T305I|ACSL1_ENST00000454703.2_Missense_Mutation_p.T305I|ACSL1_ENST00000507295.1_Missense_Mutation_p.T442I|ACSL1_ENST00000504342.1_Missense_Mutation_p.T476I			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	476					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CATACCTGCGGTCCAGTCTCC	0.468																																					p.T476I													.	ACSL1-92	0			c.C1427T						.						60.0	56.0	57.0					4																	185686012		2203	4300	6503	SO:0001583	missense	2180	exon15			CCTGCGGTCCAGT	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1427C>T	4.37:g.185686012G>A	ENSP00000422607:p.Thr476Ile	25	0		33	9	NM_001995	0	0	0	0	0	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252413	0.59212	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.58	5.58	0.84498	AMP-dependent synthetase/ligase (1);	0.130276	0.64402	D	0.000001	T	0.56396	0.1982	M	0.84082	2.675	0.54753	D	0.999987	B;B;B;B	0.21905	0.062;0.023;0.023;0.019	B;B;B;B	0.33042	0.157;0.082;0.05;0.03	T	0.57230	-0.7847	10	0.56958	D	0.05	-15.4726	19.9889	0.97359	0.0:0.0:1.0:0.0	.	442;476;476;476	E7EPM6;B7Z452;P33121;P33121-2	.;.;ACSL1_HUMAN;.	I	305;476;82;476;442;305;476;476	ENSP00000407165:T305I;ENSP00000422607:T476I;ENSP00000425098:T82I;ENSP00000281455:T476I;ENSP00000426244:T442I;ENSP00000405687:T305I;ENSP00000425006:T476I;ENSP00000426150:T476I	ENSP00000281455:T476I	T	-	2	0	ACSL1	185923006	1.000000	0.71417	0.992000	0.48379	0.901000	0.52897	6.556000	0.73932	2.804000	0.96469	0.650000	0.86243	ACC	.		0.468	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	
IPO11	51194	ucsc.edu	37	5	61897615	61897615	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr5:61897615G>T	ENST00000325324.6	+	29	2872	c.2703G>T	c.(2701-2703)gaG>gaT	p.E901D	IPO11_ENST00000512177.1_3'UTR|IPO11_ENST00000409534.1_Missense_Mutation_p.E20D|IPO11_ENST00000409296.3_Missense_Mutation_p.E941D	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	901					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		CTCATCTTGAGGAACCAAAAG	0.269																																					p.E941D													.	IPO11-227	0			c.G2823T						.						62.0	60.0	61.0					5																	61897615		2203	4298	6501	SO:0001583	missense	51194	exon29			TCTTGAGGAACCA	AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.2703G>T	5.37:g.61897615G>T	ENSP00000316651:p.Glu901Asp	49	0		32	5	NM_001134779	0	0	12	12	0	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Missense_Mutation	SNP	ENST00000325324.6	37	CCDS34167.1	.	.	.	.	.	.	.	.	.	.	G	9.497	1.102268	0.20632	.	.	ENSG00000086200	ENST00000325324;ENST00000409296;ENST00000540553;ENST00000409534	T;T;T	0.73469	-0.75;-0.75;0.18	4.92	0.572	0.17357	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	L	0.36672	1.1	0.48901	D	0.999726	P;P	0.48089	0.905;0.846	P;B	0.45276	0.475;0.283	T	0.55289	-0.8164	10	0.13853	T	0.58	.	9.1233	0.36799	0.807:0.0:0.193:0.0	.	941;901	Q9UI26-2;Q9UI26	.;IPO11_HUMAN	D	901;941;471;20	ENSP00000316651:E901D;ENSP00000386992:E941D;ENSP00000387039:E20D	ENSP00000316651:E901D	E	+	3	2	IPO11	61933371	0.986000	0.35501	1.000000	0.80357	0.992000	0.81027	0.142000	0.16096	0.217000	0.20800	-0.136000	0.14681	GAG	.		0.269	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335062.1	NM_016338	
CTNNA1	1495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138266342	138266342	+	Splice_Site	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr5:138266342C>T	ENST00000302763.7	+	15	2281	c.2191C>T	c.(2191-2193)Cga>Tga	p.R731*	CTNNA1_ENST00000355078.5_Splice_Site_p.R628*|CTNNA1_ENST00000540387.1_Splice_Site_p.R361*|CTNNA1_ENST00000518825.1_Splice_Site_p.R731*	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	731					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.R731R(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGACTTTACCCGGTGAGCAGC	0.582																																					p.R731X		.											.	CTNNA1-671	1	Substitution - coding silent(1)	lung(1)	c.C2191T						.						134.0	129.0	130.0					5																	138266342		2203	4300	6503	SO:0001630	splice_region_variant	1495	exon15			TTTACCCGGTGAG	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2192+1C>T	5.37:g.138266342C>T		191	0		195	75	NM_001903	0	0	0	0	0	Q12795|Q8N1C0	Nonsense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	C	36	5.632988	0.96682	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387;ENST00000520520	.	.	.	5.77	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7916	13.7731	0.63038	0.4172:0.5828:0.0:0.0	.	.	.	.	X	628;731;731;716;731;361;6	.	ENSP00000304669:R731X	R	+	1	2	CTNNA1	138294241	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	4.424000	0.59868	1.565000	0.49641	0.655000	0.94253	CGA	.		0.582	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	Nonsense_Mutation
FAM71B	153745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156590094	156590094	+	Silent	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr5:156590094T>A	ENST00000302938.4	-	2	1277	c.1182A>T	c.(1180-1182)gcA>gcT	p.A394A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	394						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGGTCCCACTGCTGGTCCTT	0.552																																					p.A394A		.											.	FAM71B-96	0			c.A1182T						.						62.0	65.0	64.0					5																	156590094		2203	4300	6503	SO:0001819	synonymous_variant	153745	exon2			TCCCACTGCTGGT		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1182A>T	5.37:g.156590094T>A		103	0		92	36	NM_130899	0	0	0	0	0	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	CCDS4335.1																																																																																			.		0.552	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
HIST1H3A	8350	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26021008	26021008	+	Silent	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:26021008C>T	ENST00000357647.3	+	1	291	c.291C>T	c.(289-291)tgC>tgT	p.C97C	HIST1H1A_ENST00000244573.3_5'Flank|HIST1H4A_ENST00000359907.3_5'Flank	NM_003529.2	NP_003520.1	P68431	H31_HUMAN	histone cluster 1, H3a	97					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|lung(3)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						AGGAGGCGTGCGAGGCCTACT	0.587																																					p.C97C													.	HIST1H3A-92	0			c.C291T						.						46.0	47.0	47.0					6																	26021008		2203	4300	6503	SO:0001819	synonymous_variant	8350	exon1			GGCGTGCGAGGCC	Z46261	CCDS4570.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000198366	ENSG00000275714		"""Histones / Replication-dependent"""	4766	protein-coding gene	gene with protein product		602810	"""H3 histone family, member A"", ""histone 1, H3a"""	H3FA		9119399, 12408966	Standard	NM_003529		Approved	H3/A	uc003nfp.1	P68431	OTTHUMG00000014418	ENST00000357647.3:c.291C>T	6.37:g.26021008C>T		47	0		57	14	NM_003529	0	0	0	0	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000357647.3	37	CCDS4570.1																																																																																			.		0.587	HIST1H3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040080.1	NM_003529	
CMTR1	23070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	37442389	37442389	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:37442389A>G	ENST00000373451.4	+	18	2075	c.1911A>G	c.(1909-1911)ctA>ctG	p.L637L		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	637					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										ACACTCTGCTATCTGTGGAAA	0.572																																					p.L637L		.											.	FTSJD2-94	0			c.A1911G						.						105.0	100.0	102.0					6																	37442389		2203	4300	6503	SO:0001819	synonymous_variant	23070	exon18			TCTGCTATCTGTG	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.1911A>G	6.37:g.37442389A>G		109	0		101	31	NM_015050	0	0	18	37	19	A8K949|Q14670|Q96FJ9	Silent	SNP	ENST00000373451.4	37	CCDS4835.1																																																																																			.		0.572	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
ADCY1	107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	45747951	45747951	+	Silent	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr7:45747951T>C	ENST00000297323.7	+	18	2842	c.2820T>C	c.(2818-2820)gcT>gcC	p.A940A		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	940			A -> T (in dbSNP:rs45444695).		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACACCTAGGCTAAGAAGTCCA	0.522																																					p.A940A		.											.	ADCY1-95	0			c.T2820C						.						179.0	135.0	150.0					7																	45747951		2203	4300	6503	SO:0001819	synonymous_variant	107	exon18			CTAGGCTAAGAAG	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2820T>C	7.37:g.45747951T>C		83	0		104	56	NM_021116	0	0	0	0	0	A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	37	CCDS34631.1																																																																																			.		0.522	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	104717426	104717426	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr7:104717426T>G	ENST00000311117.3	+	10	1330	c.785T>G	c.(784-786)aTt>aGt	p.I262S	KMT2E_ENST00000334877.4_Missense_Mutation_p.I262S|KMT2E_ENST00000334914.7_De_novo_Start_InFrame|KMT2E_ENST00000476671.1_Missense_Mutation_p.I262S|KMT2E_ENST00000257745.4_Missense_Mutation_p.I262S	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	262					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GCTCCAGAGATTGATCCTTCA	0.418																																					p.I262S		.											.	MLL5-93	0			c.T785G						.						89.0	88.0	88.0					7																	104717426		2203	4300	6503	SO:0001583	missense	55904	exon9			CAGAGATTGATCC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.785T>G	7.37:g.104717426T>G	ENSP00000312379:p.Ile262Ser	41	0		59	25	NM_018682	0	0	5	13	8	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.456010	0.26161	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	D;D;D;D;D	0.95482	-2.85;-2.47;-2.85;-3.72;-3.22	6.07	4.92	0.64577	.	0.471220	0.25735	N	0.028644	D	0.92639	0.7661	L	0.44542	1.39	0.80722	D	1	D;B	0.54207	0.965;0.372	P;B	0.46758	0.526;0.083	D	0.89734	0.3928	10	0.08837	T	0.75	.	12.0897	0.53719	0.0:0.0668:0.0:0.9332	.	262;262	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	S	262;262;262;262;262;120;262;196	ENSP00000312379:I262S;ENSP00000335599:I262S;ENSP00000257745:I262S;ENSP00000419883:I120S;ENSP00000417888:I262S	ENSP00000257745:I262S	I	+	2	0	MLL5	104504662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.809000	0.38922	1.114000	0.41781	0.533000	0.62120	ATT	.		0.418	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
COL14A1	7373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	121237425	121237425	+	Silent	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr8:121237425A>T	ENST00000297848.3	+	15	2106	c.1836A>T	c.(1834-1836)tcA>tcT	p.S612S	COL14A1_ENST00000247781.3_Silent_p.S517S|COL14A1_ENST00000309791.4_Silent_p.S612S|COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AAGGACAGTCAGAGCCTCTGA	0.418																																					p.S612S		.											.	COL14A1-543	0			c.A1836T						.						76.0	75.0	76.0					8																	121237425		2203	4300	6503	SO:0001819	synonymous_variant	7373	exon15			ACAGTCAGAGCCT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1836A>T	8.37:g.121237425A>T		99	0		78	20	NM_021110	0	0	0	0	0		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																			.		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
WDYHV1	55093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124448833	124448833	+	Missense_Mutation	SNP	G	G	T	rs201436036		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr8:124448833G>T	ENST00000287387.2	+	4	500	c.375G>T	c.(373-375)caG>caT	p.Q125H	WDYHV1_ENST00000523984.1_Missense_Mutation_p.Q65H|WDYHV1_ENST00000523356.1_Missense_Mutation_p.Q125H|WDYHV1_ENST00000518125.1_Intron|WDYHV1_ENST00000517609.1_3'UTR	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	125					cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						TTCACCCACAGTTTAGGAGGT	0.358																																					p.Q125H		.											.	WDYHV1-92	0			c.G375T						.						179.0	152.0	161.0					8																	124448833		2203	4300	6503	SO:0001583	missense	55093	exon4			CCCACAGTTTAGG	AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.375G>T	8.37:g.124448833G>T	ENSP00000287387:p.Gln125His	93	1		78	24	NM_018024	0	0	0	0	0	B4DE68|Q9NW95	Missense_Mutation	SNP	ENST00000287387.2	37	CCDS6344.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242859	0.58995	.	.	ENSG00000156795	ENST00000287387;ENST00000523984;ENST00000523356	T;T;T	0.17854	2.25;2.25;2.25	5.78	4.72	0.59763	Protein N-terminal glutamine amidohydrolase, alpha beta roll (1);Protein N-terminal glutamine amidohydrolase (1);	0.467670	0.22279	N	0.062144	T	0.17323	0.0416	L	0.39245	1.2	0.80722	D	1	P	0.46952	0.887	P	0.47118	0.538	T	0.00484	-1.1712	10	0.62326	D	0.03	-11.18	6.1363	0.20235	0.1332:0.0:0.6856:0.1812	.	125	Q96HA8	NTAQ1_HUMAN	H	125;65;125	ENSP00000287387:Q125H;ENSP00000430427:Q65H;ENSP00000428615:Q125H	ENSP00000287387:Q125H	Q	+	3	2	WDYHV1	124518014	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	1.216000	0.32443	2.724000	0.93272	0.655000	0.94253	CAG	G|0.999;A|0.000		0.358	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381772.1	NM_018024	
Unknown	0	hgsc.bcm.edu	37	9	17011	17011	+	IGR	SNP	T	T	C	rs201297177	byFrequency	TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:17011T>C								None (None upstream) : MIR1302-2 (10645 downstream)																							TGGGCAGTTCTGGAATGGTGC	0.642																																					p.P279P		.											.	.	0			c.A837G						.						5.0	8.0	7.0					9																	17011		767	1848	2615	SO:0001628	intergenic_variant	100287171	exon7			CAGTTCTGGAATG																													9.37:g.17011T>C		33	2		24	5	NM_182905	0	0	41	98	57		Silent	SNP		37																																																																																				.	0	0.642								
CNTLN	54875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	17332674	17332674	+	Silent	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:17332674G>A	ENST00000380647.3	+	10	1674	c.1590G>A	c.(1588-1590)aaG>aaA	p.K530K	CNTLN_ENST00000425824.1_Silent_p.K530K|CNTLN_ENST00000262360.5_Silent_p.K530K			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	530					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AGCTACAGAAGCTGAGAAAAG	0.378																																					p.K530K		.											.	CNTLN-91	0			c.G1590A						.						74.0	70.0	71.0					9																	17332674		1836	4082	5918	SO:0001819	synonymous_variant	54875	exon10			ACAGAAGCTGAGA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1590G>A	9.37:g.17332674G>A		69	0		71	17	NM_017738	0	0	3	3	0	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	37	CCDS43789.1																																																																																			.		0.378	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
ACO1	48	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	32448942	32448942	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:32448942A>T	ENST00000309951.6	+	20	2557	c.2419A>T	c.(2419-2421)Aac>Tac	p.N807Y	ACO1_ENST00000379923.1_Missense_Mutation_p.N807Y|ACO1_ENST00000541043.1_Missense_Mutation_p.N708Y	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	807					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TCACCGCAGTAACCTGGTTGG	0.478																																					p.N807Y		.											.	ACO1-226	0			c.A2419T						.						131.0	111.0	117.0					9																	32448942		2203	4300	6503	SO:0001583	missense	48	exon20			CGCAGTAACCTGG	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.2419A>T	9.37:g.32448942A>T	ENSP00000309477:p.Asn807Tyr	93	0		74	29	NM_002197	0	0	52	89	37	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.351925	0.82132	.	.	ENSG00000122729	ENST00000309951;ENST00000379923;ENST00000541043	T;T;T	0.61392	0.11;0.11;1.13	5.83	5.83	0.93111	Aconitase/3-isopropylmalate dehydratase, swivel (2);Aconitase A/isopropylmalate dehydratase small subunit, swivel (1);	0.000000	0.85682	D	0.000000	D	0.86711	0.5998	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92343	0.5883	10	0.87932	D	0	-31.6045	15.1831	0.72975	1.0:0.0:0.0:0.0	.	807	P21399	ACOC_HUMAN	Y	807;807;708	ENSP00000309477:N807Y;ENSP00000369255:N807Y;ENSP00000438733:N708Y	ENSP00000309477:N807Y	N	+	1	0	ACO1	32438942	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.996000	0.63914	2.227000	0.72691	0.528000	0.53228	AAC	.		0.478	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
HNRNPK	3190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86585225	86585225	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:86585225T>A	ENST00000376264.2	-	16	1471	c.1213A>T	c.(1213-1215)Aaa>Taa	p.K405*	HNRNPK_ENST00000376281.4_Nonsense_Mutation_p.K405*|RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000360384.5_Nonsense_Mutation_p.K405*|MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000376263.3_Nonsense_Mutation_p.K405*|HNRNPK_ENST00000351839.3_Nonsense_Mutation_p.K405*	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	405	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						TGACCACCTTTGCCAATAATA	0.368																																					p.K405X		.											.	HNRNPK-227	0			c.A1213T						.						60.0	58.0	59.0					9																	86585225		2203	4300	6503	SO:0001587	stop_gained	3190	exon16			CACCTTTGCCAAT		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.1213A>T	9.37:g.86585225T>A	ENSP00000365440:p.Lys405*	60	0		71	24	NM_031262	0	0	423	431	8	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Nonsense_Mutation	SNP	ENST00000376264.2	37	CCDS6667.1	.	.	.	.	.	.	.	.	.	.	T	38	7.091735	0.98059	.	.	ENSG00000165119	ENST00000376281;ENST00000376264;ENST00000376263;ENST00000376268;ENST00000351839;ENST00000435158;ENST00000360384;ENST00000376258	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1915	15.5864	0.76485	0.0:0.0:0.0:1.0	.	.	.	.	X	405;405;405;405;405;370;405;400	.	ENSP00000317788:K405X	K	-	1	0	HNRNPK	85775045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.510000	0.81708	2.142000	0.66516	0.482000	0.46254	AAA	.		0.368	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
SPTLC1	10558	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	94877626	94877626	+	Silent	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:94877626A>T	ENST00000262554.2	-	1	32	c.27T>A	c.(25-27)gtT>gtA	p.V9V	SPTLC1_ENST00000337841.4_Silent_p.V9V|SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	9					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	TCTCCACCAGAACCCACTGCT	0.652																																					p.V9V													.	SPTLC1-154	0			c.T27A						.						33.0	36.0	35.0					9																	94877626		2197	4292	6489	SO:0001819	synonymous_variant	10558	exon1			CACCAGAACCCAC	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.27T>A	9.37:g.94877626A>T		93	0		78	13	NM_006415	0	0	24	49	25	A8K681|Q5VWB4|Q96IX6	Silent	SNP	ENST00000262554.2	37	CCDS6692.1																																																																																			.		0.652	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	
ADAMTS13	11093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136305491	136305491	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:136305491G>C	ENST00000371929.3	+	16	2257	c.1813G>C	c.(1813-1815)Gtg>Ctg	p.V605L	ADAMTS13_ENST00000355699.2_Missense_Mutation_p.V605L|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.V277L|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.V574L|ADAMTS13_ENST00000371916.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	605	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCGCTATGTCGTGGCTGGGAA	0.627																																					p.V605L		.											.	ADAMTS13-229	0			c.G1813C						.						139.0	98.0	112.0					9																	136305491		2203	4300	6503	SO:0001583	missense	11093	exon16			TATGTCGTGGCTG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1813G>C	9.37:g.136305491G>C	ENSP00000360997:p.Val605Leu	70	0		77	27	NM_139027	0	0	3	5	2	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663418	0.47572	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.62788	0.04;0.0;0.06;0.49	5.21	4.31	0.51392	.	.	.	.	.	T	0.61912	0.2385	N	0.25825	0.765	0.41780	D	0.989816	D;D;D;D	0.89917	1.0;1.0;1.0;0.992	D;D;D;P	0.91635	0.997;0.999;0.99;0.742	T	0.59241	-0.7491	9	0.02654	T	1	.	12.261	0.54651	0.0833:0.0:0.9167:0.0	.	605;574;605;277	Q76LX8;Q76LX8-3;Q76LX8-2;Q9UGQ1	ATS13_HUMAN;.;.;.	L	605;605;574;277	ENSP00000360997:V605L;ENSP00000347927:V605L;ENSP00000348997:V574L;ENSP00000444504:V277L	ENSP00000347927:V605L	V	+	1	0	ADAMTS13	135295312	1.000000	0.71417	0.300000	0.25030	0.035000	0.12851	5.003000	0.63959	1.191000	0.43056	0.561000	0.74099	GTG	.		0.627	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
OFD1	8481	broad.mit.edu	37	X	13754640	13754640	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chrX:13754640T>C	ENST00000340096.6	+	3	482	c.155T>C	c.(154-156)gTa>gCa	p.V52A	TRAPPC2_ENST00000453655.2_5'Flank|TRAPPC2_ENST00000519885.1_5'Flank|OFD1_ENST00000380550.3_Missense_Mutation_p.V52A|TRAPPC2_ENST00000358231.5_5'Flank|OFD1_ENST00000490265.1_3'UTR|TRAPPC2_ENST00000458511.2_5'Flank|TRAPPC2_ENST00000359680.5_5'Flank|TRAPPC2_ENST00000380579.1_5'Flank|OFD1_ENST00000380567.1_5'UTR|OFD1_ENST00000398395.3_Missense_Mutation_p.V52A	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	52					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						ATGCACCCTGTATTGAGTGGA	0.398																																					p.V52A													.	OFD1-108	0			c.T155C						.						152.0	148.0	149.0					X																	13754640		2203	4300	6503	SO:0001583	missense	8481	exon3			ACCCTGTATTGAG	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.155T>C	X.37:g.13754640T>C	ENSP00000344314:p.Val52Ala	154	0		156	4	NM_003611	0	0	11	11	0	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	37	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.550708	0.45383	.	.	ENSG00000046651	ENST00000380550;ENST00000398395;ENST00000340096	D;D;D	0.95412	-3.68;-3.44;-3.7	5.55	4.38	0.52667	.	0.499719	0.22428	N	0.060189	D	0.93880	0.8042	M	0.76002	2.32	0.09310	N	1	P;P;P	0.47106	0.89;0.82;0.89	B;B;B	0.42738	0.396;0.285;0.396	D	0.87609	0.2502	10	0.42905	T	0.14	-9.6943	7.333	0.26594	0.0:0.2422:0.0:0.7578	.	52;52;52	A8K2T9;O75665-3;O75665	.;.;OFD1_HUMAN	A	52	ENSP00000369923:V52A;ENSP00000381432:V52A;ENSP00000344314:V52A	ENSP00000344314:V52A	V	+	2	0	OFD1	13664561	0.946000	0.32159	0.608000	0.28969	0.837000	0.47467	1.572000	0.36461	0.740000	0.32651	-0.314000	0.08810	GTA	.		0.398	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611	
PNCK	139728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	152937464	152937464	+	Silent	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chrX:152937464A>T	ENST00000370150.1	-	5	463	c.285T>A	c.(283-285)ggT>ggA	p.G95G	PNCK_ENST00000393831.2_Silent_p.G95G|PNCK_ENST00000447676.2_Silent_p.G178G|PNCK_ENST00000370142.1_Silent_p.G95G|PNCK_ENST00000340888.3_Silent_p.G95G|PNCK_ENST00000475172.1_5'UTR|PNCK_ENST00000370145.4_Silent_p.G112G			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	95	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACAGCTCGCCACCCGTCACCC	0.657																																					p.G178G		.											.	PNCK-207	0			c.T534A						.						39.0	35.0	36.0					X																	152937464		2203	4299	6502	SO:0001819	synonymous_variant	139728	exon5			CTCGCCACCCGTC	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.285T>A	X.37:g.152937464A>T		30	0		21	10	NM_001039582	0	0	0	0	0	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Silent	SNP	ENST00000370150.1	37																																																																																				.		0.657	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	
RC3H1	149041	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	173916659	173916660	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:173916659_173916660delGT	ENST00000367696.2	-	15	2935_2936	c.2584_2585delAC	c.(2584-2586)accfs	p.T862fs	RC3H1_ENST00000258349.4_Frame_Shift_Del_p.T862fs|RC3H1_ENST00000367694.2_Frame_Shift_Del_p.T862fs			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	862					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						ATCATCACTGGTTTCTGCTGCT	0.45																																					p.862_862del		.											.	RC3H1-92	0			c.2584_2585del						.																																			SO:0001589	frameshift_variant	149041	exon14			.	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2584_2585delAC	1.37:g.173916659_173916660delGT	ENSP00000356669:p.Thr862fs	153	0		130	29	NM_172071	0	0	0	0	0	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Frame_Shift_Del	DEL	ENST00000367696.2	37	CCDS30940.1																																																																																			.		0.450	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
DBX1	120237	bcgsc.ca	37	11	20177947	20177947	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:20177947delG	ENST00000524983.2	-	4	1133	c.845delC	c.(844-846)ccgfs	p.P282fs	DBX1_ENST00000227256.3_Frame_Shift_Del_p.P321fs			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	282					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						GGGGCTGCCCGGGCCCTCCTC	0.751																																					p.P282fs													.	DBX1-91	0			c.845delC						.						8.0	11.0	10.0					11																	20177947		2164	4209	6373	SO:0001589	frameshift_variant	120237	exon4			CTGCCCGGGCCCT			11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.845delC	11.37:g.20177947delG	ENSP00000436881:p.Pro282fs	31	0		16	6	NM_001029865	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000524983.2	37																																																																																				.		0.751	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387585.2	NM_001029865	
NLK	51701	broad.mit.edu;bcgsc.ca	37	17	26459690	26459690	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:26459690delT	ENST00000407008.3	+	3	1351	c.633delT	c.(631-633)tatfs	p.Y211fs		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		ACATTGACTATTTTGAAGAAA	0.353																																					p.Y211fs													.	NLK-1403	0			c.633delT						.						54.0	49.0	51.0					17																	26459690		2203	4300	6503	SO:0001589	frameshift_variant	51701	exon3			TGACTATTTTGAA	AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.633delT	17.37:g.26459690delT	ENSP00000384625:p.Tyr211fs	33	0		37	9	NM_016231	0	0	0	0	0	B2RCX1|Q2PNI9|Q6P2A3	Frame_Shift_Del	DEL	ENST00000407008.3	37	CCDS11224.2																																																																																			.		0.353	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	NM_016231	
GREB1	9687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	11706688	11706688	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:11706688delG	ENST00000381486.2	+	4	660	c.360delG	c.(358-360)gtgfs	p.V120fs	GREB1_ENST00000234142.5_Frame_Shift_Del_p.V120fs|GREB1_ENST00000381483.2_Frame_Shift_Del_p.V120fs|GREB1_ENST00000263834.5_Frame_Shift_Del_p.V120fs|GREB1_ENST00000389825.3_Frame_Shift_Del_p.V10fs	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	120						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TTCTCCTCGTGGGGGTCAAGT	0.597																																					p.V120fs	Ovarian(39;850 945 2785 23371 33093)	.											.	GREB1-91	0			c.360delG						.						98.0	91.0	93.0					2																	11706688		2203	4300	6503	SO:0001589	frameshift_variant	9687	exon4			.		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.360delG	2.37:g.11706688delG	ENSP00000370896:p.Val120fs	101	0		135	41	NM_148903	0	0	0	0	0	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Frame_Shift_Del	DEL	ENST00000381486.2	37	CCDS42655.1																																																																																			.		0.597	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
BPHL	670	broad.mit.edu;bcgsc.ca	37	6	3123907	3123927	+	In_Frame_Del	DEL	GCCAAAGTGGCTGTGAATGGC	GCCAAAGTGGCTGTGAATGGC	-	rs148622332|rs375917764	byFrequency	TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	GCCAAAGTGGCTGTGAATGGC	GCCAAAGTGGCTGTGAATGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:3123907_3123927delGCCAAAGTGGCTGTGAATGGC	ENST00000380379.5	+	2	173_193	c.124_144delGCCAAAGTGGCTGTGAATGGC	c.(124-144)gccaaagtggctgtgaatggcdel	p.AKVAVNG42del	BPHL_ENST00000380375.3_In_Frame_Del_p.AKVAVNG25del|BPHL_ENST00000380368.2_In_Frame_Del_p.AKVAVNG25del|BPHL_ENST00000434640.1_In_Frame_Del_p.AKVAVNG25del	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)	42					cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				GGTAACCTCTGCCAAAGTGGCTGTGAATGGCGTTCAGCTGC	0.475																																					p.42_48del													.	BPHL-90	0			c.124_144del						.																																			SO:0001651	inframe_deletion	670	exon2			ACCTCTGCCAAAG	X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.124_144delGCCAAAGTGGCTGTGAATGGC	6.37:g.3123907_3123927delGCCAAAGTGGCTGTGAATGGC	ENSP00000369739:p.Ala42_Gly48del	131	0		112	8	NM_004332	0	0	0	0	0	Q00306|Q13855|Q3KP51	In_Frame_Del	DEL	ENST00000380379.5	37	CCDS4483.2																																																																																			.		0.475	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039670.5		
F5	2153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169510915	169510916	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:169510915_169510916insTT	ENST00000367797.3	-	13	3613_3614	c.3412_3413insAA	c.(3412-3414)atgfs	p.M1138fs	F5_ENST00000367796.3_Frame_Shift_Ins_p.M1143fs	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1138	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGTAGAGTGCATTTGATCAGGG	0.48																																					p.M1138fs		.											.	F5-157	0			c.3413_3414insAA						.																																			SO:0001589	frameshift_variant	2153	exon13			.	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3411_3412dupAA	1.37:g.169510916_169510917dupTT	ENSP00000356771:p.Met1138fs	289	0		276	80	NM_000130	0	0	0	0	0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Frame_Shift_Ins	INS	ENST00000367797.3	37	CCDS1281.1																																																																																			.		0.480	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
RPL10A	4736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	35437266	35437267	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:35437266_35437267insA	ENST00000322203.6	+	4	297_298	c.270_271insA	c.(271-273)aaafs	p.K91fs	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	91					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						TCGAGGCGCTGAAAAAACTCAA	0.55																																					p.L90fs		.											.	RPL10A-91	0			c.270_271insA						.																																			SO:0001589	frameshift_variant	4736	exon4			.	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.276dupA	6.37:g.35437272_35437272dupA	ENSP00000363018:p.Lys91fs	52	0		44	12	NM_007104	0	0	0	0	0	B2R801|P52859|P53025|Q5TZT6|Q8J013	Frame_Shift_Ins	INS	ENST00000322203.6	37	CCDS4806.1																																																																																			.		0.550	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
EPSTI1	94240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	43463356	43463357	+	Intron	DNP	CT	CT	TA			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:43463356_43463357CT>TA	ENST00000398762.3	-	12	948				EPSTI1_ENST00000313640.7_Nonsense_Mutation_p.R324*|EPSTI1_ENST00000313624.7_Intron			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)											endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CCTTAGGTGCCTCGAAAAAACT	0.292																																					p.R324*		.											.	EPSTI1	0			c.A970T						.																																			SO:0001627	intron_variant	94240	exon12			GGTGCCTCGAAAA	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.949_949delinsTA	13.37:g.43463356_43463357delinsTA		47.0	0.0		27.0	16.0		0	0	0	0	0	Q8IVC7|Q8NDQ7	Nonsense_Mutation	DNP	ENST00000398762.3	37	CCDS9387.1																																																																																			.		0.292	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48578146	48578147	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:48578146_48578147TG>CT	ENST00000503238.1	-	21	2620_2621	c.2621_2622CA>AG	c.(2620-2622)gCA>gAG	p.A874E	FRYL_ENST00000358350.4_Missense_Mutation_p.A874E|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.A874E|FRYL_ENST00000507711.1_Missense_Mutation_p.A874E|RNU5E-3P_ENST00000515913.1_RNA			O94915	FRYL_HUMAN	FRY-like	874					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACGATGTTGCTGCACTGCAGCA	0.47																																					p.A874E		.											.	FRYL	0			c.C2621A						.																																			SO:0001583	missense	285527	exon24			GTTGCTGCACTGC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2621_2622delinsCT	4.37:g.48578146_48578147delinsCT	ENSP00000426064:p.Ala874Glu	149.0	1.0		99.0	29.0		0	0	0	0	0	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	DNP	ENST00000503238.1	37	CCDS43227.1																																																																																			.		0.470	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
