#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRRC8B	23507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90048545	90048545	+	Silent	SNP	A	A	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr1:90048545A>G	ENST00000330947.2	+	5	696	c.336A>G	c.(334-336)aaA>aaG	p.K112K	LRRC8B_ENST00000358200.4_Silent_p.K112K|RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Silent_p.K112K	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	112					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GTTACGAGAAACAGCTCCATT	0.512																																					p.K112K		.											.	LRRC8B-92	0			c.A336G						.						158.0	154.0	155.0					1																	90048545		2203	4300	6503	SO:0001819	synonymous_variant	23507	exon5			CGAGAAACAGCTC	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.336A>G	1.37:g.90048545A>G		152	0		174	61	NM_015350	0	0	0	0	0	D3DT28|Q6UY21|Q8N106|Q92627	Silent	SNP	ENST00000330947.2	37	CCDS724.1																																																																																			.		0.512	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350	
CTNNA3	29119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	67726425	67726425	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr10:67726425C>T	ENST00000433211.2	-	17	2519	c.2345G>A	c.(2344-2346)tGc>tAc	p.C782Y	CTNNA3_ENST00000373744.4_Missense_Mutation_p.C782Y|CTNNA3_ENST00000373735.1_5'UTR	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						AACTTGACTGCAGATTTTCAG	0.438																																					p.C782Y		.											.	CTNNA3-234	0			c.G2345A						.						114.0	109.0	111.0					10																	67726425		2203	4300	6503	SO:0001583	missense	29119	exon17			TGACTGCAGATTT	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2345G>A	10.37:g.67726425C>T	ENSP00000389714:p.Cys782Tyr	124	0		131	53	NM_013266	0	0	0	0	0		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771295	0.69992	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.37915	1.17;1.17;1.17	5.41	3.56	0.40772	.	0.000000	0.64402	D	0.000004	T	0.39911	0.1096	M	0.75447	2.3	0.80722	D	1	P	0.37500	0.597	B	0.38562	0.276	T	0.36383	-0.9750	10	0.72032	D	0.01	-1.9994	10.42	0.44344	0.0:0.8383:0.0:0.1617	.	782	Q9UI47	CTNA3_HUMAN	Y	782;782;121	ENSP00000389714:C782Y;ENSP00000362849:C782Y;ENSP00000362840:C121Y	ENSP00000362840:C121Y	C	-	2	0	CTNNA3	67396431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	0.771000	0.33359	0.650000	0.86243	TGC	.		0.438	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
NUP98	4928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	3744474	3744474	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr11:3744474T>A	ENST00000324932.7	-	16	2479	c.2059A>T	c.(2059-2061)Agc>Tgc	p.S687C	NUP98_ENST00000397007.4_Missense_Mutation_p.S704C|NUP98_ENST00000397004.4_Missense_Mutation_p.S687C|NUP98_ENST00000355260.3_Missense_Mutation_p.S687C|NUP98_ENST00000359171.4_Missense_Mutation_p.S687C	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	704					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TCTTCACTGCTTCCTTCCAGC	0.433			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.S704C		.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98-703	0			c.A2110T						.						181.0	154.0	163.0					11																	3744474		2201	4298	6499	SO:0001583	missense	4928	exon16			CACTGCTTCCTTC	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.2059A>T	11.37:g.3744474T>A	ENSP00000316032:p.Ser687Cys	205	0		251	93	NM_005387	0	0	2	2	0	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985170	0.74474	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.	.	.	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.77046	0.4073	M	0.70275	2.135	0.53005	D	0.999969	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.98;0.951;0.997;0.997	T	0.79546	-0.1759	9	0.62326	D	0.03	.	13.3986	0.60870	0.0:0.0:0.0:1.0	.	704;687;687;687	P52948-3;P52948-4;P52948-2;P52948-5	.;.;.;.	C	687;687;687;687;704	.	ENSP00000316032:S687C	S	-	1	0	NUP98	3701050	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.800000	0.62524	1.773000	0.52216	0.477000	0.44152	AGC	.		0.433	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
MTMR2	8898	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	95568462	95568462	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr11:95568462C>T	ENST00000346299.5	-	15	2264	c.1924G>A	c.(1924-1926)Gtt>Att	p.V642I	MTMR2_ENST00000409459.1_Missense_Mutation_p.V570I|MTMR2_ENST00000352297.7_Missense_Mutation_p.V570I|MTMR2_ENST00000393223.3_Missense_Mutation_p.V570I	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	642					cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTTTATACAACAGTTTGGACA	0.438																																					p.V642I													.	MTMR2-91	0			c.G1924A						.						103.0	91.0	95.0					11																	95568462		2201	4297	6498	SO:0001583	missense	8898	exon15			ATACAACAGTTTG	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.1924G>A	11.37:g.95568462C>T	ENSP00000345752:p.Val642Ile	124	1		158	56	NM_016156	0	0	17	37	20	A6NN98|Q9UPS9	Missense_Mutation	SNP	ENST00000346299.5	37	CCDS8305.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159321	0.57368	.	.	ENSG00000087053	ENST00000346299;ENST00000393223;ENST00000409459;ENST00000352297	D;D;D;D	0.95756	-3.55;-3.8;-3.8;-3.8	6.17	6.17	0.99709	.	0.050299	0.85682	D	0.000000	D	0.89626	0.6769	N	0.08118	0	0.52501	D	0.99995	B	0.27229	0.172	B	0.22386	0.039	D	0.85343	0.1097	10	0.17369	T	0.5	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	642	Q13614	MTMR2_HUMAN	I	642;570;570;570	ENSP00000345752:V642I;ENSP00000376915:V570I;ENSP00000386882:V570I;ENSP00000343737:V570I	ENSP00000345752:V642I	V	-	1	0	MTMR2	95208110	1.000000	0.71417	0.221000	0.23827	0.035000	0.12851	4.526000	0.60566	2.941000	0.99782	0.655000	0.94253	GTT	.		0.438	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
CRACR2A	84766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	3765545	3765545	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr12:3765545G>T	ENST00000252322.1	-	9	1258	c.790C>A	c.(790-792)Caa>Aaa	p.Q264K	EFCAB4B_ENST00000444507.1_Missense_Mutation_p.Q264K|EFCAB4B_ENST00000440314.2_Missense_Mutation_p.Q264K	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		264					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TCCAGCTCTTGACTGCGGGCT	0.517																																					p.Q264K		.											.	EFCAB4B-92	0			c.C790A						.						117.0	98.0	105.0					12																	3765545		2203	4300	6503	SO:0001583	missense	84766	exon9			GCTCTTGACTGCG																												ENST00000252322.1:c.790C>A	12.37:g.3765545G>T	ENSP00000252322:p.Gln264Lys	85	0		109	37	NM_001144958	0	0	0	0	0	B4E1X0|B9EK63	Missense_Mutation	SNP	ENST00000252322.1	37	CCDS8522.1	.	.	.	.	.	.	.	.	.	.	g	8.882	0.951842	0.18431	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.21031	2.03;2.62;2.62	4.87	4.87	0.63330	.	0.650048	0.16394	N	0.216346	T	0.15003	0.0362	L	0.31294	0.92	0.27366	N	0.955823	B;B;B	0.22346	0.068;0.037;0.022	B;B;B	0.15484	0.006;0.013;0.006	T	0.10154	-1.0642	10	0.23302	T	0.38	-9.002	11.0361	0.47802	0.0:0.0:0.8142:0.1858	.	264;264;264	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	K	264	ENSP00000409382:Q264K;ENSP00000412496:Q264K;ENSP00000252322:Q264K	ENSP00000252322:Q264K	Q	-	1	0	EFCAB4B	3635806	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.957000	0.56730	2.385000	0.81259	0.556000	0.70494	CAA	.		0.517	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398673.1		
HECTD1	25831	broad.mit.edu	37	14	31604103	31604103	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr14:31604103C>T	ENST00000399332.1	-	22	4041	c.3553G>A	c.(3553-3555)Gat>Aat	p.D1185N	HECTD1_ENST00000553700.1_Missense_Mutation_p.D1185N	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1185					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTGCAGTCATCAACATGGGTA	0.388																																					p.D1185N													.	HECTD1-570	0			c.G3553A						.						72.0	65.0	67.0					14																	31604103		1855	4088	5943	SO:0001583	missense	25831	exon22			AGTCATCAACATG	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.3553G>A	14.37:g.31604103C>T	ENSP00000382269:p.Asp1185Asn	95	0		119	5	NM_015382	0	0	2	2	0	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697335	0.88830	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.17054	2.3;2.3;2.3	5.91	5.91	0.95273	Galactose-binding domain-like (1);Sad1/UNC-like, C-terminal (1);	0.000000	0.85682	U	0.000000	T	0.30103	0.0754	N	0.17800	0.525	0.80722	D	1	P;D	0.69078	0.743;0.997	P;D	0.79108	0.758;0.992	T	0.02639	-1.1130	10	0.38643	T	0.18	-13.5834	20.2983	0.98569	0.0:1.0:0.0:0.0	.	1185;1185	D3DS86;Q9ULT8	.;HECD1_HUMAN	N	1185;1187;1185;659	ENSP00000450697:D1185N;ENSP00000382269:D1185N;ENSP00000451860:D659N	ENSP00000261312:D1187N	D	-	1	0	HECTD1	30673854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.800000	0.85949	2.802000	0.96397	0.655000	0.94253	GAT	.		0.388	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
IL21R	50615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27445763	27445763	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr16:27445763C>G	ENST00000337929.3	+	3	618	c.145C>G	c.(145-147)Ctt>Gtt	p.L49V	IL21R_ENST00000395754.4_Missense_Mutation_p.L49V|IL21R_ENST00000395755.1_Missense_Mutation_p.L49V|IL21R_ENST00000564089.1_Missense_Mutation_p.L49V	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	49	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CACGCTCACCCTTACCTGGTA	0.612			T	BCL6	NHL																																p.L71V		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R-660	0			c.C211G						.						92.0	67.0	75.0					16																	27445763		2197	4300	6497	SO:0001583	missense	50615	exon4			CTCACCCTTACCT	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.145C>G	16.37:g.27445763C>G	ENSP00000338010:p.Leu49Val	64	0		89	42	NM_181079	0	0	0	0	0	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	c	3.641	-0.073506	0.07184	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.97994	-4.65;-4.65;-4.65	4.39	0.877	0.19145	Fibronectin, type III (1);	55.521400	0.00166	N	0.000000	D	0.96272	0.8784	M	0.67953	2.075	0.80722	D	1	B	0.21225	0.053	B	0.17722	0.019	D	0.85799	0.1372	10	0.34782	T	0.22	-22.7421	6.3283	0.21257	0.3777:0.4383:0.184:0.0	.	49	Q9HBE5	IL21R_HUMAN	V	49	ENSP00000338010:L49V;ENSP00000379104:L49V;ENSP00000379103:L49V	ENSP00000338010:L49V	L	+	1	0	IL21R	27353264	0.011000	0.17503	0.032000	0.17829	0.011000	0.07611	0.263000	0.18478	0.530000	0.28619	0.555000	0.69702	CTT	.		0.612	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
IL21R	50615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27459874	27459874	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr16:27459874T>C	ENST00000337929.3	+	9	1360	c.887T>C	c.(886-888)tTc>tCc	p.F296S	IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Missense_Mutation_p.F296S|IL21R_ENST00000395755.1_Missense_Mutation_p.F296S|IL21R_ENST00000564089.1_Missense_Mutation_p.F296S|IL21R_ENST00000564583.1_3'UTR	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	296					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						GGTGCACCCTTCACTGGCTCC	0.547			T	BCL6	NHL																																p.F318S		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R-660	0			c.T953C						.						16.0	19.0	18.0					16																	27459874		2177	4255	6432	SO:0001583	missense	50615	exon10			CACCCTTCACTGG	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.887T>C	16.37:g.27459874T>C	ENSP00000338010:p.Phe296Ser	148	0		172	62	NM_181079	0	0	1	1	0	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.495777	0.26774	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.37411	1.2;1.2;1.2	5.24	2.9	0.33743	.	0.718376	0.13350	N	0.394470	T	0.26810	0.0656	M	0.64997	1.995	0.09310	N	1	P	0.41265	0.744	B	0.38327	0.271	T	0.17776	-1.0358	10	0.06365	T	0.9	-23.6851	4.7668	0.13135	0.1986:0.0:0.1808:0.6206	.	296	Q9HBE5	IL21R_HUMAN	S	296	ENSP00000338010:F296S;ENSP00000379104:F296S;ENSP00000379103:F296S	ENSP00000338010:F296S	F	+	2	0	IL21R	27367375	0.006000	0.16342	0.739000	0.30968	0.006000	0.05464	1.501000	0.35693	1.980000	0.57719	0.459000	0.35465	TTC	.		0.547	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
TRIM37	4591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57134407	57134407	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr17:57134407T>C	ENST00000262294.7	-	13	1287	c.1028A>G	c.(1027-1029)tAt>tGt	p.Y343C	TRIM37_ENST00000376149.3_Missense_Mutation_p.Y221C|RN7SL716P_ENST00000580539.1_RNA|TRIM37_ENST00000393066.3_Missense_Mutation_p.Y343C|TRIM37_ENST00000393065.2_Missense_Mutation_p.Y309C	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	343	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CTCTACACGATATTCATATCT	0.318									Mulibrey Nanism																												p.Y343C		.											.	TRIM37-660	0			c.A1028G						.						63.0	61.0	62.0					17																	57134407		2203	4300	6503	SO:0001583	missense	4591	exon13	Familial Cancer Database	Perheentupa syndrome	ACACGATATTCAT	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1028A>G	17.37:g.57134407T>C	ENSP00000262294:p.Tyr343Cys	46	0		36	21	NM_015294	0	0	0	0	0	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.164224	0.78339	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.43	5.43	0.79202	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.81635	0.4864	M	0.86420	2.815	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.943	D;D;P	0.87578	0.998;0.998;0.896	D	0.84579	0.0660	10	0.56958	D	0.05	-9.1299	15.4842	0.75551	0.0:0.0:0.0:1.0	.	309;221;343	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	C	343;343;221;309	ENSP00000376785:Y343C;ENSP00000262294:Y343C;ENSP00000365319:Y221C;ENSP00000376784:Y309C	ENSP00000262294:Y343C	Y	-	2	0	TRIM37	54489189	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.036000	0.88901	2.048000	0.60808	0.482000	0.46254	TAT	.		0.318	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		117	0		118	2	NM_031203	0	0	1	1	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	30936011	30936011	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr19:30936011G>C	ENST00000355537.3	+	2	1689	c.1542G>C	c.(1540-1542)gaG>gaC	p.E514D		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	514					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGGCTGCGGAGATGGACCCCG	0.632																																					p.E514D		.											.	ZNF536-144	0			c.G1542C						.						38.0	43.0	42.0					19																	30936011		2202	4299	6501	SO:0001583	missense	9745	exon2			TGCGGAGATGGAC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1542G>C	19.37:g.30936011G>C	ENSP00000347730:p.Glu514Asp	31	0		44	21	NM_014717	0	0	0	0	0	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833785	0.50951	.	.	ENSG00000198597	ENST00000355537	T	0.16743	2.32	5.53	2.25	0.28309	.	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	M	0.64404	1.975	0.41871	D	0.99027	D;D	0.69078	0.997;0.997	D;D	0.72625	0.978;0.978	T	0.02020	-1.1228	10	0.51188	T	0.08	-39.7837	9.9979	0.41911	0.2217:0.0:0.7783:0.0	.	514;514	A7E228;O15090	.;ZN536_HUMAN	D	514	ENSP00000347730:E514D	ENSP00000347730:E514D	E	+	3	2	ZNF536	35627851	1.000000	0.71417	0.993000	0.49108	0.967000	0.64934	1.738000	0.38207	0.276000	0.22118	0.655000	0.94253	GAG	.		0.632	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
CEACAM8	1088	broad.mit.edu	37	19	43098028	43098028	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr19:43098028G>A	ENST00000244336.5	-	2	190	c.89C>T	c.(88-90)cCg>cTg	p.P30L	LIPE-AS1_ENST00000594688.1_RNA|CEACAM8_ENST00000599005.1_Intron|LIPE-AS1_ENST00000594624.2_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	30					immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				AGTGGTGGGCGGGTTCCAGAA	0.507																																					p.P30L													.	CEACAM8-91	0			c.C89T						.						109.0	101.0	104.0					19																	43098028		2203	4300	6503	SO:0001583	missense	1088	exon2			GTGGGCGGGTTCC	D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.89C>T	19.37:g.43098028G>A	ENSP00000244336:p.Pro30Leu	85	0		109	4	NM_001816	0	0	0	0	0	O60399|Q16574	Missense_Mutation	SNP	ENST00000244336.5	37	CCDS12610.1	.	.	.	.	.	.	.	.	.	.	g	4.232	0.042039	0.08196	.	.	ENSG00000124469	ENST00000244336	T	0.16897	2.31	1.63	0.565	0.17309	.	.	.	.	.	T	0.08626	0.0214	N	0.20445	0.575	0.09310	N	1	B	0.21147	0.052	B	0.23852	0.049	T	0.42327	-0.9458	9	0.14252	T	0.57	.	3.9174	0.09228	0.2332:0.0:0.7668:0.0	.	30	P31997	CEAM8_HUMAN	L	30	ENSP00000244336:P30L	ENSP00000244336:P30L	P	-	2	0	CEACAM8	47789868	0.002000	0.14202	0.021000	0.16686	0.463000	0.32649	-0.315000	0.08081	0.242000	0.21303	0.313000	0.20887	CCG	.		0.507	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321430.1		
KCNN4	3783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44278354	44278354	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr19:44278354C>T	ENST00000262888.3	-	3	1068	c.673G>A	c.(673-675)Gtg>Atg	p.V225M		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	225					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CTCTCGGCCACGGACAGCACC	0.677											OREG0025535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V225M		.											.	KCNN4-92	0			c.G673A						.						17.0	19.0	18.0					19																	44278354		2196	4295	6491	SO:0001583	missense	3783	exon3			CGGCCACGGACAG	AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.673G>A	19.37:g.44278354C>T	ENSP00000262888:p.Val225Met	41	0	922	89	48	NM_002250	0	0	0	0	0	Q53XR4	Missense_Mutation	SNP	ENST00000262888.3	37	CCDS12630.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961648	0.74016	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	T	0.24538	1.85	4.31	4.31	0.51392	Ion transport 2 (1);	0.149552	0.43416	D	0.000563	T	0.41834	0.1176	L	0.42245	1.32	0.40618	D	0.981731	D;D	0.76494	0.999;0.999	D;D	0.70487	0.969;0.961	T	0.36529	-0.9744	10	0.56958	D	0.05	-28.677	14.7241	0.69329	0.0:1.0:0.0:0.0	.	119;225	D1MQ10;O15554	.;KCNN4_HUMAN	M	225;93	ENSP00000262888:V225M	ENSP00000262888:V225M	V	-	1	0	KCNN4	48970194	0.982000	0.34865	0.985000	0.45067	0.977000	0.68977	2.272000	0.43373	2.104000	0.64026	0.478000	0.44815	GTG	.		0.677	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	
OTX1	5013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	63282730	63282730	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr2:63282730T>A	ENST00000282549.2	+	5	620	c.344T>A	c.(343-345)gTg>gAg	p.V115E	OTX1_ENST00000366671.3_Missense_Mutation_p.V115E	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	115					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					TCCTCTCCAGTGCGGGAGAGC	0.647																																					p.V115E		.											.	OTX1-70	0			c.T344A						.						37.0	38.0	38.0					2																	63282730		2203	4300	6503	SO:0001583	missense	5013	exon5			CTCCAGTGCGGGA		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.344T>A	2.37:g.63282730T>A	ENSP00000282549:p.Val115Glu	149	0		239	86	NM_014562	0	0	0	0	0	A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	37	CCDS1873.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.497563	0.64186	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.90385	-2.66;-2.66	3.69	2.55	0.30701	.	0.158837	0.42053	D	0.000765	T	0.79411	0.4441	N	0.19112	0.55	0.41015	D	0.985031	P	0.45531	0.86	P	0.45232	0.474	T	0.76572	-0.2910	10	0.06757	T	0.87	.	3.9166	0.09225	0.0:0.3229:0.0:0.6771	.	115	P32242	OTX1_HUMAN	E	115	ENSP00000355631:V115E;ENSP00000282549:V115E	ENSP00000282549:V115E	V	+	2	0	OTX1	63136234	0.998000	0.40836	1.000000	0.80357	0.945000	0.59286	3.890000	0.56220	1.676000	0.50930	0.460000	0.39030	GTG	.		0.647	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
PNO1	56902	bcgsc.ca	37	2	68388842	68388842	+	Missense_Mutation	SNP	G	G	T	rs528399980		TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr2:68388842G>T	ENST00000263657.2	+	3	476	c.385G>T	c.(385-387)Gct>Tct	p.A129S	RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	129						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						GGATGTTAGTGCTCTGACAAA	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		19513	0.0		0.0	False		,,,				2504	0.001				p.A129S	NSCLC(83;642 1410 13044 32832 40058)												.	PNO1-68	0			c.G385T						.						106.0	110.0	108.0					2																	68388842		2203	4300	6503	SO:0001583	missense	56902	exon3			GTTAGTGCTCTGA	AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.385G>T	2.37:g.68388842G>T	ENSP00000263657:p.Ala129Ser	63	0		52	4	NM_020143	0	0	13	13	0	A8K6Q0|Q53G13|Q8WVB8	Missense_Mutation	SNP	ENST00000263657.2	37	CCDS1885.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023360	0.54683	.	.	ENSG00000115946	ENST00000263657	T	0.41400	1.0	6.02	5.12	0.69794	.	0.100235	0.64402	N	0.000002	T	0.34919	0.0914	L	0.35487	1.065	0.58432	D	0.999999	B	0.12630	0.006	B	0.13407	0.009	T	0.06110	-1.0845	10	0.30078	T	0.28	1.5014	16.5765	0.84681	0.0:0.0:0.8687:0.1313	.	129	Q9NRX1	PNO1_HUMAN	S	129	ENSP00000263657:A129S	ENSP00000263657:A129S	A	+	1	0	PNO1	68242346	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.568000	0.60857	1.511000	0.48818	0.650000	0.86243	GCT	.		0.338	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251756.1	NM_020143	
KCNJ3	3760	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	155555531	155555531	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr2:155555531T>C	ENST00000295101.2	+	1	721	c.244T>C	c.(244-246)Tgg>Cgg	p.W82R	KCNJ3_ENST00000544049.1_Missense_Mutation_p.W82R|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	82					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CAAGTGGCGCTGGAACCTCTT	0.592																																					p.W82R		.											.	KCNJ3-92	0			c.T244C						.						147.0	139.0	142.0					2																	155555531		2203	4300	6503	SO:0001583	missense	3760	exon1			TGGCGCTGGAACC	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.244T>C	2.37:g.155555531T>C	ENSP00000295101:p.Trp82Arg	352	0		467	30	NM_001260509	0	0	1	1	0	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.585481	0.66105	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.94184	-3.37;-3.37	5.16	5.16	0.70880	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.063086	0.64402	D	0.000001	D	0.95717	0.8607	M	0.73430	2.235	0.80722	D	1	D;D	0.54207	0.965;0.965	P;P	0.60886	0.88;0.879	D	0.96140	0.9099	10	0.87932	D	0	.	13.8034	0.63216	0.0:0.0:0.0:1.0	.	82;82	B4DEW7;P48549	.;IRK3_HUMAN	R	82	ENSP00000295101:W82R;ENSP00000438410:W82R	ENSP00000295101:W82R	W	+	1	0	KCNJ3	155263777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.981000	0.88123	1.946000	0.56461	0.454000	0.30748	TGG	.		0.592	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179615958	179615958	+	Intron	SNP	C	C	T	rs145004106	byFrequency	TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr2:179615958C>T	ENST00000591111.1	-	45	10585				TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Silent_p.T3723T|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCAGAAGACGTATCTAAAA	0.358													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20087	0.001		0.0	False		,,,				2504	0.0				p.T3723T		.											.	TTN-636	0			c.G11169A						.	C	,,,,	1,4403	2.1+/-5.4	0,1,2201	61.0	60.0	60.0		,,11169,,	-1.5	0.0	2	dbSNP_134	60	1,8593	1.2+/-3.3	0,1,4296	no	intron,intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,,,	0,2,6497	TT,TC,CC		0.0116,0.0227,0.0154	,,,,	,,3723/5605,,	179615958	2,12996	2202	4297	6499	SO:0001627	intron_variant	7273	exon46			AGAAGACGTATCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+1892G>A	2.37:g.179615958C>T		133	0		121	36	NM_133379	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				C|1.000;T|0.000		0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC11A1	6556	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219249037	219249037	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr2:219249037C>A	ENST00000233202.6	+	3	562	c.222C>A	c.(220-222)gaC>gaA	p.D74E	SLC11A1_ENST00000473367.1_Intron|SLC11A1_ENST00000539932.1_5'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	74	Pro/Ser-rich.				activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTTCCTGGACCCAGGAAACA	0.592																																					p.D74E													.	SLC11A1-93	0			c.C222A						.						116.0	112.0	113.0					2																	219249037		2203	4300	6503	SO:0001583	missense	6556	exon3			CCTGGACCCAGGA	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.222C>A	2.37:g.219249037C>A	ENSP00000233202:p.Asp74Glu	123	1		103	32	NM_000578	0	0	2	2	0	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050694	0.75960	.	.	ENSG00000018280	ENST00000233202	T	0.56103	0.48	5.06	0.964	0.19655	.	0.000000	0.85682	D	0.000000	T	0.78710	0.4326	H	0.97214	3.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80641	-0.1292	10	0.87932	D	0	-45.4925	9.4926	0.38969	0.0:0.6108:0.0:0.3892	.	74;74;74	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	E	74	ENSP00000233202:D74E	ENSP00000233202:D74E	D	+	3	2	SLC11A1	218957281	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.564000	0.23563	0.306000	0.22856	0.561000	0.74099	GAC	.		0.592	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
BPIFB3	359710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31660577	31660577	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr20:31660577A>G	ENST00000375494.3	+	14	1379	c.1379A>G	c.(1378-1380)aAt>aGt	p.N460S		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	460					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										AATTTTTCCAATTCAGTTCTG	0.473																																					p.N460S		.											.	.	0			c.A1379G						.						156.0	143.0	148.0					20																	31660577		2203	4300	6503	SO:0001583	missense	359710	exon14			TTTCCAATTCAGT	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1379A>G	20.37:g.31660577A>G	ENSP00000364643:p.Asn460Ser	191	0		163	62	NM_182658	0	0	0	0	0	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	A	1.299	-0.605319	0.03717	.	.	ENSG00000186190	ENST00000375494	T	0.09255	3.0	4.64	-3.29	0.05017	.	0.321650	0.26258	N	0.025402	T	0.07638	0.0192	L	0.53561	1.675	0.24245	N	0.995343	B	0.02656	0.0	B	0.08055	0.003	T	0.41413	-0.9510	10	0.15499	T	0.54	0.023	6.6155	0.22774	0.4895:0.4045:0.106:0.0	.	460	P59826	BPIB3_HUMAN	S	460	ENSP00000364643:N460S	ENSP00000364643:N460S	N	+	2	0	BPIFB3	31124238	0.983000	0.35010	0.689000	0.30133	0.014000	0.08584	-0.057000	0.11768	-0.887000	0.03961	-1.064000	0.02280	AAT	.		0.473	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
FAM83C	128876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33874582	33874582	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr20:33874582G>C	ENST00000374408.3	-	4	2096	c.2000C>G	c.(1999-2001)tCt>tGt	p.S667C	FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|EIF6_ENST00000374443.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	667										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CTCATCCCCAGACCCAGCTCC	0.617																																					p.S667C		.											.	FAM83C-92	0			c.C2000G						.						54.0	48.0	50.0					20																	33874582		2203	4300	6503	SO:0001583	missense	128876	exon4			TCCCCAGACCCAG	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.2000C>G	20.37:g.33874582G>C	ENSP00000363529:p.Ser667Cys	173	0		236	101	NM_178468	0	0	0	0	0	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	9.533	1.111448	0.20714	.	.	ENSG00000125998	ENST00000374408	T	0.11385	2.78	4.93	3.99	0.46301	.	1.069840	0.07374	N	0.886296	T	0.15392	0.0371	L	0.59436	1.845	0.09310	N	1	P	0.50369	0.934	B	0.43916	0.436	T	0.23691	-1.0181	10	0.87932	D	0	-20.9594	6.8394	0.23955	0.0917:0.0:0.7235:0.1848	.	667	Q9BQN1	FA83C_HUMAN	C	667	ENSP00000363529:S667C	ENSP00000363529:S667C	S	-	2	0	FAM83C	33337996	0.485000	0.25972	0.025000	0.17156	0.218000	0.24690	2.726000	0.47302	1.235000	0.43724	0.462000	0.41574	TCT	.		0.617	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
TMPRSS3	64699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43802332	43802332	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr21:43802332G>C	ENST00000291532.3	-	9	1749	c.794C>G	c.(793-795)cCc>cGc	p.P265R	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.P349R|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.P263R|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.P265R|TMPRSS3_ENST00000398397.3_Missense_Mutation_p.P265R	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	265	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						CCATGACTTGGGGAGGTACAA	0.493																																					p.P265R		.											.	TMPRSS3-155	0			c.C794G						.						68.0	51.0	57.0					21																	43802332		2203	4300	6503	SO:0001583	missense	64699	exon9			GACTTGGGGAGGT	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.794C>G	21.37:g.43802332G>C	ENSP00000291532:p.Pro265Arg	67	0		70	27	NM_001256317	0	0	0	0	0	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853752	0.71719	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	4.8	4.8	0.61643	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	D	0.000001	D	0.92984	0.7767	L	0.58428	1.81	0.53688	D	0.999975	D;D;P;D	0.76494	0.998;0.999;0.949;0.999	D;D;P;D	0.74348	0.977;0.983;0.803;0.982	D	0.92525	0.6028	9	.	.	.	.	17.8827	0.88845	0.0:0.0:1.0:0.0	.	265;265;265;263	P57727-3;P57727-5;P57727;B7WPR2	.;.;TMPS3_HUMAN;.	R	265;265;263;349;265	ENSP00000291532:P265R;ENSP00000411013:P265R;ENSP00000381442:P263R;ENSP00000369762:P349R;ENSP00000381434:P265R	.	P	-	2	0	TMPRSS3	42675401	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	7.925000	0.87563	2.213000	0.71641	0.655000	0.94253	CCC	.		0.493	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
MMP11	4320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24125618	24125618	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr22:24125618G>T	ENST00000215743.3	+	8	1406	c.1354G>T	c.(1354-1356)Ggc>Tgc	p.G452C	AP000349.1_ENST00000598975.1_Silent_p.A176A	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	452					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CTTCCTGCGCGGCCGCCTCTA	0.622																																					p.G452C		.											.	MMP11-291	0			c.G1354T						.						102.0	82.0	89.0					22																	24125618		2203	4300	6503	SO:0001583	missense	4320	exon8			CTGCGCGGCCGCC		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.1354G>T	22.37:g.24125618G>T	ENSP00000215743:p.Gly452Cys	116	0		166	21	NM_005940	0	0	44	52	8	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383170	0.82792	.	.	ENSG00000099953	ENST00000215743	T	0.10382	2.88	4.73	4.73	0.59995	Hemopexin/matrixin (2);	0.049339	0.85682	D	0.000000	T	0.45915	0.1366	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61549	-0.7040	10	0.87932	D	0	.	17.3138	0.87217	0.0:0.0:1.0:0.0	.	452	P24347	MMP11_HUMAN	C	452	ENSP00000215743:G452C	ENSP00000215743:G452C	G	+	1	0	MMP11	22455618	1.000000	0.71417	0.971000	0.41717	0.995000	0.86356	7.028000	0.76470	2.649000	0.89929	0.650000	0.86243	GGC	.		0.622	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940	
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	92	0		115	18	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CRBN	51185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	3209472	3209472	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr3:3209472T>G	ENST00000231948.4	-	5	555	c.533A>C	c.(532-534)cAg>cCg	p.Q178P	CRBN_ENST00000432408.2_Missense_Mutation_p.Q177P	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	178	Lon.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	TTTAGCTTGCTGGATTCTAAA	0.333																																					p.Q178P		.											.	CRBN-91	0			c.A533C						.						90.0	89.0	89.0					3																	3209472		2203	4300	6503	SO:0001583	missense	51185	exon5			GCTTGCTGGATTC	BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.533A>C	3.37:g.3209472T>G	ENSP00000231948:p.Gln178Pro	50	0		52	19	NM_016302	0	0	0	0	0	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	ENST00000231948.4	37	CCDS2562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.59|13.59	2.282820|2.282820	0.40394|0.40394	.|.	.|.	ENSG00000113851|ENSG00000113851	ENST00000231948;ENST00000432408;ENST00000546075|ENST00000424814;ENST00000450014	T;T|.	0.40225|.	1.04;1.04|.	5.1|5.1	5.1|5.1	0.69264|0.69264	Peptidase S16, lon N-terminal (2);PUA-like domain (1);|.	0.056186|.	0.64402|.	D|.	0.000001|.	T|T	0.38931|0.38931	0.1059|0.1059	N|N	0.08118|0.08118	0|0	0.54753|0.54753	D|D	0.999981|0.999981	B;B;B|.	0.06786|.	0.001;0.0;0.001|.	B;B;B|.	0.08055|.	0.003;0.002;0.003|.	T|T	0.31779|0.31779	-0.9931|-0.9931	10|5	0.29301|.	T|.	0.29|.	-13.9919|-13.9919	15.19|15.19	0.73035|0.73035	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	115;177;178|.	F5H3U1;Q96SW2-2;Q96SW2|.	.;.;CRBN_HUMAN|.	P|R	178;177;115|174	ENSP00000231948:Q178P;ENSP00000412499:Q177P|.	ENSP00000231948:Q178P|.	Q|S	-|-	2|1	0|0	CRBN|CRBN	3184472|3184472	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.567000|3.567000	0.53813|0.53813	2.045000|2.045000	0.60652|0.60652	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.333	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206579.3	NM_016302	
ACVR2B	93	broad.mit.edu	37	3	38519723	38519723	+	Silent	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr3:38519723G>A	ENST00000352511.4	+	4	934	c.462G>A	c.(460-462)ctG>ctA	p.L154L		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	154					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		TCATCGTCCTGCTGGCCTTTT	0.642																																					p.L154L													.	ACVR2B-942	0			c.G462A						.						70.0	70.0	70.0					3																	38519723		2203	4300	6503	SO:0001819	synonymous_variant	93	exon4			CGTCCTGCTGGCC	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.462G>A	3.37:g.38519723G>A		106	0		142	4	NM_001106	0	0	1	1	0	Q4VAV0	Silent	SNP	ENST00000352511.4	37	CCDS2679.1																																																																																			.		0.642	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
KLHDC8B	200942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49212303	49212303	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr3:49212303G>A	ENST00000332780.2	+	4	879	c.670G>A	c.(670-672)Gtc>Atc	p.V224I	KLHDC8B_ENST00000476495.2_3'UTR|C3orf84_ENST00000443990.1_5'Flank	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	224						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGAAGGCAGCGTCTTTAGCCT	0.592																																					p.V224I		.											.	KLHDC8B-90	0			c.G670A						.						50.0	51.0	51.0					3																	49212303		2203	4300	6503	SO:0001583	missense	200942	exon4			GGCAGCGTCTTTA		CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.670G>A	3.37:g.49212303G>A	ENSP00000327468:p.Val224Ile	63	0		58	31	NM_173546	0	0	9	17	8		Missense_Mutation	SNP	ENST00000332780.2	37	CCDS2791.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459584	0.26248	.	.	ENSG00000185909	ENST00000332780	T	0.71222	-0.55	5.97	2.98	0.34508	Kelch-type beta propeller (1);	0.187468	0.46145	N	0.000320	T	0.44498	0.1296	N	0.12182	0.205	0.32968	D	0.521921	B;B	0.25272	0.103;0.122	B;B	0.16289	0.009;0.015	T	0.44590	-0.9318	10	0.14252	T	0.57	-25.1154	6.9162	0.24361	0.1603:0.0:0.608:0.2317	.	178;224	B4DFM2;Q8IXV7	.;KLD8B_HUMAN	I	224	ENSP00000327468:V224I	ENSP00000327468:V224I	V	+	1	0	KLHDC8B	49187307	0.897000	0.30589	0.786000	0.31890	0.987000	0.75469	1.471000	0.35365	0.874000	0.35823	0.655000	0.94253	GTC	.		0.592	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345974.1	NM_173546	
CHRD	8646	bcgsc.ca	37	3	184106751	184106751	+	Missense_Mutation	SNP	G	G	A	rs200027250		TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr3:184106751G>A	ENST00000204604.1	+	22	3026	c.2780G>A	c.(2779-2781)cGa>cAa	p.R927Q	CHRD_ENST00000545352.1_Missense_Mutation_p.R469Q|CHRD_ENST00000450923.1_Missense_Mutation_p.R927Q|CHRD_ENST00000348986.3_Missense_Mutation_p.R887Q|EIF2B5_ENST00000444495.1_Intron	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	927	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAGGAGAGTCGATGCTGTTCC	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16920	0.0		0.0	False		,,,				2504	0.0				p.R927Q													.	CHRD-93	0			c.G2780A						.						93.0	78.0	83.0					3																	184106751		2203	4300	6503	SO:0001583	missense	8646	exon22			AGAGTCGATGCTG	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.2780G>A	3.37:g.184106751G>A	ENSP00000204604:p.Arg927Gln	80	0		86	4	NM_003741	0	0	25	25	0	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	16.82	3.229186	0.58777	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	4.93	3.09	0.35607	von Willebrand factor, type C (1);	0.295775	0.28109	N	0.016569	T	0.45518	0.1346	N	0.11064	0.09	0.18873	N	0.999989	P;D;P;D	0.67145	0.944;0.996;0.954;0.993	B;P;B;P	0.51385	0.201;0.668;0.262;0.57	T	0.30534	-0.9975	10	0.21540	T	0.41	-3.6881	6.6856	0.23144	0.098:0.18:0.722:0.0	.	469;887;927;927	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	Q	927;927;887;469	ENSP00000204604:R927Q;ENSP00000408972:R927Q;ENSP00000334036:R887Q;ENSP00000442948:R469Q	ENSP00000204604:R927Q	R	+	2	0	CHRD	185589445	0.823000	0.29233	0.936000	0.37596	0.526000	0.34562	2.487000	0.45268	0.456000	0.26937	0.655000	0.94253	CGA	G|0.999;A|0.000		0.622	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
MAML3	55534	hgsc.bcm.edu	37	4	140811102	140811102	+	Silent	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr4:140811102C>T	ENST00000509479.2	-	2	2344	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	MAML3_ENST00000327122.5_Silent_p.Q340Q|MAML3_ENST00000398940.1_Silent_p.Q35Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.542																																					p.Q496Q		.											.	MAML3-455	0			c.G1488A						.						13.0	19.0	17.0					4																	140811102		2124	4242	6366	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1488G>A	4.37:g.140811102C>T		77	0		92	12	NM_018717	0	4	3216	3314	94		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MAML3	55534	hgsc.bcm.edu	37	4	140811104	140811104	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr4:140811104G>T	ENST00000509479.2	-	2	2342	c.1486C>A	c.(1486-1488)Cag>Aag	p.Q496K	MAML3_ENST00000327122.5_Missense_Mutation_p.Q340K|MAML3_ENST00000398940.1_Missense_Mutation_p.Q35K	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					tgctgctgctgctgctgctgc	0.542																																					p.Q496K		.											.	MAML3-455	0			c.C1486A						.						13.0	18.0	17.0					4																	140811104		2145	4254	6399	SO:0001583	missense	55534	exon2			GCTGCTGCTGCTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1486C>A	4.37:g.140811104G>T	ENSP00000421180:p.Gln496Lys	79	0		93	10	NM_018717	10	2	2727	2741	2		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	g	6.502	0.460780	0.12342	.	.	ENSG00000196782	ENST00000509479;ENST00000327122;ENST00000398940	T;T	0.64260	0.89;-0.09	4.53	4.53	0.55603	.	0.116387	0.37577	N	0.002035	T	0.39937	0.1097	N	0.08118	0	0.32507	N	0.538137	B	0.22276	0.067	B	0.19391	0.025	T	0.35025	-0.9805	10	0.06494	T	0.89	.	17.2683	0.87093	0.0:0.0:1.0:0.0	.	496	Q96JK9	MAML3_HUMAN	K	496;340;35	ENSP00000421180:Q496K;ENSP00000313316:Q340K	ENSP00000313316:Q340K	Q	-	1	0	MAML3	141030554	0.998000	0.40836	0.988000	0.46212	0.665000	0.39181	0.180000	0.16860	2.038000	0.60285	0.455000	0.32223	CAG	.		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
SLC6A19	340024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1219218	1219218	+	Silent	SNP	C	C	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr5:1219218C>T	ENST00000304460.10	+	9	1430	c.1374C>T	c.(1372-1374)ctC>ctT	p.L458L		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	458					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			AGGAGGTGCTCACAGGTACGT	0.642																																					p.L458L		.											.	SLC6A19-90	0			c.C1374T						.						117.0	100.0	106.0					5																	1219218		2201	4298	6499	SO:0001819	synonymous_variant	340024	exon9			GGTGCTCACAGGT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1374C>T	5.37:g.1219218C>T		79	0		106	41	NM_001003841	0	0	0	0	0	A8K446	Silent	SNP	ENST00000304460.10	37	CCDS34130.1																																																																																			.		0.642	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
LYRM4	57128	hgsc.bcm.edu	37	6	5260906	5260906	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr6:5260906T>A	ENST00000330636.4	-	1	266	c.61A>T	c.(61-63)Aag>Tag	p.K21*	FARS2_ENST00000324331.6_5'Flank|LYRM4_ENST00000480566.1_Nonsense_Mutation_p.K21*|LYRM4_ENST00000500576.2_Nonsense_Mutation_p.K21*|FARS2_ENST00000274680.4_5'Flank|LYRM4_ENST00000468929.1_Nonsense_Mutation_p.K21*|LYRM4_ENST00000464010.1_Nonsense_Mutation_p.K21*	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4	21					small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				CTGAAACGCTTGCTCTCTCTC	0.627																																					p.K21X	NSCLC(130;1006 2426 17608 36797)	.											.	LYRM4-90	0			c.A61T						.						25.0	24.0	24.0					6																	5260906		2161	4232	6393	SO:0001587	stop_gained	57128	exon1			AACGCTTGCTCTC	AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.61A>T	6.37:g.5260906T>A	ENSP00000418787:p.Lys21*	6	0		13	9	NM_020408	0	0	12	27	15	A8K543|Q5XKP1	Nonsense_Mutation	SNP	ENST00000330636.4	37	CCDS4493.1	.	.	.	.	.	.	.	.	.	.	T	40	8.023762	0.98616	.	.	ENSG00000214113	ENST00000468929;ENST00000330636;ENST00000464010;ENST00000480566;ENST00000500576	.	.	.	5.04	1.08	0.20341	.	0.185374	0.32753	U	0.005684	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-6.0522	1.2294	0.01940	0.1825:0.1031:0.1903:0.5241	.	.	.	.	X	21	.	ENSP00000418787:K21X	K	-	1	0	LYRM4	5205905	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.725000	0.25970	1.898000	0.54952	0.533000	0.62120	AAG	.		0.627	LYRM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353461.3	NM_020408	
ABCF1	23	broad.mit.edu	37	6	30550906	30550906	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr6:30550906G>A	ENST00000326195.8	+	10	968	c.856G>A	c.(856-858)Gtg>Atg	p.V286M	MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000376545.3_Missense_Mutation_p.V248M|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	286					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TGACTTCTCCGTGTCCCAGGC	0.498																																					p.V286M													.	ABCF1-92	0			c.G856A						.						89.0	93.0	92.0					6																	30550906		1509	2708	4217	SO:0001583	missense	23	exon10			TTCTCCGTGTCCC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.856G>A	6.37:g.30550906G>A	ENSP00000313603:p.Val286Met	140	0		125	3	NM_001025091	0	0	22	22	0	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.738855	0.69304	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000455943;ENST00000441867	T;T;T	0.55930	0.52;0.83;0.49	5.41	5.41	0.78517	.	0.280189	0.34002	N	0.004351	T	0.43942	0.1270	L	0.41573	1.285	0.80722	D	1	P;P;P	0.52692	0.905;0.955;0.955	P;P;P	0.51079	0.557;0.658;0.658	T	0.16453	-1.0402	10	0.22109	T	0.4	-26.4394	17.9672	0.89102	0.0:0.0:1.0:0.0	.	248;286;286	Q2L6I2;Q8NE71;A2BF75	.;ABCF1_HUMAN;.	M	286;248;287;287	ENSP00000313603:V286M;ENSP00000365728:V248M;ENSP00000405512:V287M	ENSP00000313603:V286M	V	+	1	0	ABCF1	30658885	1.000000	0.71417	0.997000	0.53966	0.953000	0.61014	5.478000	0.66806	2.553000	0.86117	0.313000	0.20887	GTG	.		0.498	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
TNRC18	84629	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	5396874	5396874	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr7:5396874G>A	ENST00000430969.1	-	16	5215	c.4867C>T	c.(4867-4869)Cag>Tag	p.Q1623*	TNRC18_ENST00000399537.4_Nonsense_Mutation_p.Q1623*	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1623							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		AACTGCTCCTGGTCGCTGGCC	0.507																																					p.Q1623X													.	TNRC18-46	0			c.C4867T						.						46.0	47.0	46.0					7																	5396874		2005	4189	6194	SO:0001587	stop_gained	84629	exon16			GCTCCTGGTCGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4867C>T	7.37:g.5396874G>A	ENSP00000395538:p.Gln1623*	89	1		112	48	NM_001080495	0	0	9	15	6	A8MX41|Q96JH1|Q96K91	Nonsense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	g	35	5.528361	0.96446	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	.	.	.	5.25	5.25	0.73442	.	0.000000	0.37348	N	0.002123	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.8572	0.92257	0.0:0.0:1.0:0.0	.	.	.	.	X	1623;1623;678;113	.	ENSP00000382452:Q1623X	Q	-	1	0	TNRC18	5363400	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.932000	0.87634	2.456000	0.83038	0.561000	0.74099	CAG	.		0.507	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
C7orf31	136895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	25182389	25182389	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr7:25182389T>G	ENST00000409280.1	-	8	1037	c.729A>C	c.(727-729)aaA>aaC	p.K243N	C7orf31_ENST00000283905.3_Missense_Mutation_p.K243N			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	243										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						TTTTAGGAGGTTTTGGGTAGA	0.378																																					p.K243N		.											.	C7orf31-90	0			c.A729C						.						91.0	98.0	95.0					7																	25182389		2203	4300	6503	SO:0001583	missense	136895	exon8			AGGAGGTTTTGGG	AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.729A>C	7.37:g.25182389T>G	ENSP00000386604:p.Lys243Asn	81	0		89	38	NM_138811	0	0	0	1	1	A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Missense_Mutation	SNP	ENST00000409280.1	37	CCDS5394.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.131855	0.56828	.	.	ENSG00000153790	ENST00000409280;ENST00000283905	T;T	0.08720	3.06;3.06	5.51	3.06	0.35304	.	0.133847	0.47093	D	0.000247	T	0.21267	0.0512	M	0.65975	2.015	0.30063	N	0.810728	D	0.76494	0.999	D	0.74674	0.984	T	0.03597	-1.1021	10	0.40728	T	0.16	-1.5455	7.6462	0.28321	0.0:0.3231:0.0:0.6769	.	243	Q8N865	CG031_HUMAN	N	243	ENSP00000386604:K243N;ENSP00000283905:K243N	ENSP00000283905:K243N	K	-	3	2	C7orf31	25148914	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	0.178000	0.16820	0.357000	0.24183	0.397000	0.26171	AAA	.		0.378	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326929.1	NM_138811	
NOM1	64434	hgsc.bcm.edu	37	7	156742605	156742605	+	Silent	SNP	A	A	G	rs149616380	byFrequency	TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr7:156742605A>G	ENST00000275820.3	+	1	189	c.174A>G	c.(172-174)gaA>gaG	p.E58E		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	58	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CGACTTCGGAAGGCGAGGCTC	0.706													.|||	55	0.0109824	0.0401	0.0029	5008	,	,		10993	0.0		0.0	False		,,,				2504	0.0				p.E58E		.											.	NOM1-90	0			c.A174G						.	G		110,3692		1,108,1792	8.0	10.0	9.0		174	2.3	0.0	7	dbSNP_134	9	0,7382		0,0,3691	no	coding-synonymous	NOM1	NM_138400.1		1,108,5483	GG,GA,AA		0.0,2.8932,0.9835		58/861	156742605	110,11074	1901	3691	5592	SO:0001819	synonymous_variant	64434	exon1			TTCGGAAGGCGAG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.174A>G	7.37:g.156742605A>G		0	0		4	4	NM_138400	0	0	2	2	0	Q96I08	Silent	SNP	ENST00000275820.3	37	CCDS34787.1																																																																																			A|0.993;G|0.007		0.706	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
FAM214B	80256	ucsc.edu;bcgsc.ca	37	9	35106598	35106598	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr9:35106598G>T	ENST00000378561.1	-	4	4051	c.996C>A	c.(994-996)agC>agA	p.S332R	FAM214B_ENST00000605244.1_Missense_Mutation_p.S332R|FAM214B_ENST00000378566.1_Missense_Mutation_p.S27R|FAM214B_ENST00000603301.1_Missense_Mutation_p.S332R|FAM214B_ENST00000378554.2_Missense_Mutation_p.S332R|FAM214B_ENST00000322813.5_Missense_Mutation_p.S332R|FAM214B_ENST00000378557.1_Missense_Mutation_p.S332R|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000488109.2_Missense_Mutation_p.S332R			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	332						nucleus (GO:0005634)											CACTGGGGGGGCTCAGCAGGC	0.622																																					p.S332R													.	.	0			c.C996A						.						11.0	13.0	13.0					9																	35106598		2179	4273	6452	SO:0001583	missense	80256	exon5			GGGGGGGCTCAGC	AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.996C>A	9.37:g.35106598G>T	ENSP00000367823:p.Ser332Arg	45	0		37	4	NM_025182	0	0	9	9	0	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	ENST00000378561.1	37	CCDS6578.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442584	0.43326	.	.	ENSG00000005238	ENST00000378566;ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	5.38	4.47	0.54385	.	0.226724	0.42821	D	0.000655	T	0.38612	0.1047	N	0.14661	0.345	0.45129	D	0.998147	B	0.25169	0.119	B	0.29440	0.102	T	0.16660	-1.0395	9	0.11485	T	0.65	-21.9657	13.3283	0.60473	0.0781:0.0:0.9219:0.0	.	332	Q7L5A3	K1539_HUMAN	R	27;332;332;332;332	.	ENSP00000319897:S332R	S	-	3	2	KIAA1539	35096598	0.008000	0.16893	0.996000	0.52242	0.978000	0.69477	0.174000	0.16743	2.813000	0.96785	0.655000	0.94253	AGC	.		0.622	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182	
C9orf153	389766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88844472	88844472	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr9:88844472G>A	ENST00000376001.3	-	2	127	c.47C>T	c.(46-48)gCc>gTc	p.A16V	C9orf153_ENST00000339137.3_Missense_Mutation_p.A16V|C9orf153_ENST00000469914.1_5'UTR	NM_001276366.1	NP_001263295.1	Q5TBE3	CI153_HUMAN	chromosome 9 open reading frame 153	16										breast(1)|lung(1)	2						AGGAAGGGTGGCTTCTCTATT	0.393																																					p.A16V		.											.	C9orf153-90	0			c.C47T						.						173.0	130.0	144.0					9																	88844472		2203	4300	6503	SO:0001583	missense	389766	exon3			AGGGTGGCTTCTC		CCDS35055.1, CCDS35055.2	9q22.1	2012-04-03			ENSG00000187753	ENSG00000187753			31456	protein-coding gene	gene with protein product							Standard	NM_001276366		Approved	bA507D14.1	uc031teh.1	Q5TBE3	OTTHUMG00000020134	ENST00000376001.3:c.47C>T	9.37:g.88844472G>A	ENSP00000365169:p.Ala16Val	105	0		103	37	NM_001276368	0	0	0	0	0	Q5TBE4	Missense_Mutation	SNP	ENST00000376001.3	37	CCDS35055.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166595	0.38217	.	.	ENSG00000187753	ENST00000339137;ENST00000376001	T;T	0.43294	0.95;0.95	3.33	-2.4	0.06583	.	1.675050	0.04061	N	0.306344	T	0.22704	0.0548	N	0.24115	0.695	0.09310	N	1	P;P	0.42584	0.784;0.642	B;B	0.33690	0.168;0.089	T	0.15093	-1.0449	10	0.52906	T	0.07	.	2.4955	0.04621	0.1061:0.1403:0.2414:0.5123	.	16;16	Q5TBE3;Q5TBE3-2	CI153_HUMAN;.	V	16	ENSP00000344865:A16V;ENSP00000365169:A16V	ENSP00000344865:A16V	A	-	2	0	C9orf153	88034292	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.853000	0.04303	-0.543000	0.06240	0.655000	0.94253	GCC	.		0.393	C9orf153-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052913.1	NM_001010907	
VCX	26609	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	7811790	7811790	+	Silent	SNP	C	C	T	rs200229312		TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chrX:7811790C>T	ENST00000381059.3	+	3	573	c.354C>T	c.(352-354)agC>agT	p.S118S	VCX_ENST00000341408.4_Silent_p.S118S	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	118	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.S118S(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GTCAGGAGAGCGAGGTGGAAG	0.637																																					p.S118S		.											.	VCX-22	1	Substitution - coding silent(1)	endometrium(1)	c.C354T						.						54.0	67.0	62.0					X																	7811790		2129	4090	6219	SO:0001819	synonymous_variant	26609	exon3			GGAGAGCGAGGTG	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.354C>T	X.37:g.7811790C>T		269	0		308	103	NM_013452	0	0	3	3	0	A0JNS5|Q4V774|Q9P0H3	Silent	SNP	ENST00000381059.3	37	CCDS14128.1																																																																																			.		0.637	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452	
GAB3	139716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153908429	153908429	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chrX:153908429A>G	ENST00000369575.3	-	9	1655	c.1624T>C	c.(1624-1626)Tca>Cca	p.S542P	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.S543P	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	542					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGGGCTGGTGATGCTGAATTG	0.488																																					p.S543P		.											.	GAB3-227	0			c.T1627C						.						205.0	201.0	202.0					X																	153908429		2203	4300	6503	SO:0001583	missense	139716	exon9			CTGGTGATGCTGA	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1624T>C	X.37:g.153908429A>G	ENSP00000358588:p.Ser542Pro	145	0		149	57	NM_001081573	0	0	0	0	0	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.60|17.60	3.430652|3.430652	0.62844|0.62844	.|.	.|.	ENSG00000160219|ENSG00000160219	ENST00000454973|ENST00000369575;ENST00000424127	.|T;T	.|0.28895	.|1.59;1.91	5.36|5.36	4.2|4.2	0.49525|0.49525	.|.	.|0.063412	.|0.64402	.|D	.|0.000004	T|T	0.54775|0.54775	0.1879|0.1879	M|M	0.84219|0.84219	2.685|2.685	0.52099|0.52099	D|D	0.999946|0.999946	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.83275	.|0.996;0.996	T|T	0.55829|0.55829	-0.8079|-0.8079	5|10	.|0.72032	.|D	.|0.01	-5.3879|-5.3879	8.3095|8.3095	0.32062|0.32062	0.9048:0.0:0.0952:0.0|0.9048:0.0:0.0952:0.0	.|.	.|543;542	.|E9PB44;Q8WWW8	.|.;GAB3_HUMAN	T|P	23|542;543	.|ENSP00000358588:S542P;ENSP00000399588:S543P	.|ENSP00000358588:S542P	I|S	-|-	2|1	0|0	GAB3|GAB3	153561623|153561623	0.998000|0.998000	0.40836|0.40836	0.338000|0.338000	0.25549|0.25549	0.747000|0.747000	0.42532|0.42532	3.865000|3.865000	0.56033|0.56033	0.695000|0.695000	0.31675|0.31675	0.412000|0.412000	0.27726|0.27726	ATC|TCA	.		0.488	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
MYPOP	339344	broad.mit.edu	37	19	46393972	46393972	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr19:46393972delG	ENST00000322217.5	-	3	1195	c.1109delC	c.(1108-1110)ccafs	p.P370fs		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	370	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.A371fs*>30(1)		large_intestine(2)|lung(1)|skin(1)	4						GAGCGGGGCTGGGGGGGGCCG	0.662																																					p.P370fs													.	MYPOP-90	1	Insertion - Frameshift(1)	large_intestine(1)	c.1109delC						.			45,80,3733		3,0,39,7,66,1814	6.0	8.0	7.0			-0.2	0.3	19		8	74,145,7487		6,0,62,4,137,3644	no	codingComplex	MYPOP	NM_001012643.2		9,0,101,11,203,5458	A1A1,A1A2,A1R,A2A2,A2R,RR		2.8419,3.24,2.9747			46393972	119,225,11220	2061	4148	6209	SO:0001589	frameshift_variant	339344	exon3			GGGGCTGGGGGGG	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1109delC	19.37:g.46393972delG	ENSP00000325402:p.Pro370fs	8	0		7	2	NM_001012643	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000322217.5	37	CCDS33055.1																																																																																			.		0.662	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	141	0		147	57	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EPHA6	285220	broad.mit.edu	37	3	96533514	96533514	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr3:96533514delA	ENST00000389672.5	+	1	85	c.47delA	c.(46-48)cagfs	p.Q16fs	EPHA6_ENST00000470610.2_Frame_Shift_Del_p.Q16fs|EPHA6_ENST00000542517.1_5'Flank	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CCGGCGCCGCAGGCAGCGTCC	0.711																																					p.Q16fs													.	EPHA6-1561	0			c.47delA						.						17.0	21.0	20.0					3																	96533514		2057	4183	6240	SO:0001589	frameshift_variant	285220	exon1			CGCCGCAGGCAGC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.47delA	3.37:g.96533514delA	ENSP00000374323:p.Gln16fs	8	0		6	3	NM_001080448	0	0	0	0	0	D6RAL5	Frame_Shift_Del	DEL	ENST00000389672.5	37	CCDS46876.1																																																																																			.		0.711	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
GPR133	283383	hgsc.bcm.edu	37	12	131476916	131476917	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chr12:131476916_131476917insAC	ENST00000261654.5	+	8	1504_1505	c.945_946insAC	c.(946-948)acafs	p.T316fs	RP11-76C10.5_ENST00000542980.1_lincRNA|GPR133_ENST00000535015.1_Frame_Shift_Ins_p.T348fs	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	316					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCTCGGAGCAGACAGCCTTGAA	0.5																																					p.Q315fs		.											.	GPR133-191	0			c.945_946insAC						.																																			SO:0001589	frameshift_variant	283383	exon8			.	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.946_947dupAC	12.37:g.131476917_131476918dupAC	ENSP00000261654:p.Thr316fs	70	0		91	28	NM_198827	0	0	0	0	0	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Frame_Shift_Ins	INS	ENST00000261654.5	37	CCDS9272.1																																																																																			.		0.500	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382384	24382385	+	IGR	DNP	GC	GC	AT			TCGA-IA-A40X-01A-11D-A25F-10	TCGA-IA-A40X-10A-01D-A25F-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e1217ebe-1826-41a9-b6c4-702100a66f5e	611a2445-8df1-4abd-bb6b-4954ee1dc47d	g.chrX:24382384_24382385GC>AT								AC004552.1 (15361 upstream) : PDK3 (100952 downstream)																							tgctgctgctgctgctgctgct	0.579																																					.		.											.	.	0			c.C1508T						.																																			SO:0001628	intergenic_variant	100130302	exon1			CTGCTGCTGCTGC																													X.37:g.24382384_24382385delinsAT		244.0	0.0		324.0	25.0	NM_001136234	0	0	0	0	0		Missense_Mutation	DNP		37																																																																																				.	0	0.579								
