#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	A	G	G	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								7207	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		1385	0.07	1		NA	NA	NA	7207	3582	21.12	968		Nonsense_Mutation	SNP	HMMPfam_COX1,PatternScan_COX1_CUB,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^I-like	p.G435*		37	c.1303		MT																																																																																			-	HMMPfam_COX1,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^I-like	0	0					MT-CO1			G			7207	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	nonsense	SNP	NULL	A
CACNA1S	779	genome.wustl.edu	37	1	201054627	201054627	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr1:201054627G>A	ENST00000362061.3	-	8	1313	c.1087C>T	c.(1087-1089)Ctt>Ttt	p.L363F	CACNA1S_ENST00000367338.3_Missense_Mutation_p.L363F	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	363	Binding to the beta subunit. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TAGCCCCGAAGGTCCTCATCT	0.572											OREG0014068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0			1											156.0	139.0	145.0					1																	201054627		2203	4300	6503	199321250	SO:0001583	missense	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1087C>T	1.37:g.201054627G>A	ENSP00000355192:p.Leu363Phe	90	0.00	0	2118	NA	NA	NA	199321250	107	36.09	61	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ,superfamily_SSF81324	p.L363F	ENST00000362061.3	37	c.1087	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536881	0.45176	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97791	-4.54;-4.54	4.55	3.61	0.41365	.	0.164243	0.41605	D	0.000855	D	0.98036	0.9353	M	0.82923	2.615	0.39415	D	0.966812	D	0.58620	0.983	P	0.59595	0.86	D	0.98119	1.0424	10	0.62326	D	0.03	.	9.2941	0.37804	0.0809:0.0:0.7121:0.2069	.	363	Q13698	CAC1S_HUMAN	F	363	ENSP00000355192:L363F;ENSP00000356307:L363F	ENSP00000355192:L363F	L	-	1	0	CACNA1S	199321250	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.236000	0.51336	2.232000	0.73038	0.579000	0.79373	CTT	-	NULL		0.572	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	G	NM_000069		199321250	-1	no_errors	NM_000069.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LMOD1	25802	genome.wustl.edu	37	1	201915305	201915305	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr1:201915305G>A	ENST00000367288.4	-	1	410	c.164C>T	c.(163-165)aCg>aTg	p.T55M		NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	55					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CTGTTTCTCCGTCTGGTTTCT	0.577																																						dbGAP											0			1											91.0	98.0	96.0					1																	201915305		2003	4173	6176	200181928	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.164C>T	1.37:g.201915305G>A	ENSP00000356257:p.Thr55Met	94	0.00	0		NA	NA	NA	200181928	99	43.58	78	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	HMMPfam_WH2,HMMPfam_Tropomodulin,superfamily_SSF52047	p.T55M	ENST00000367288.4	37	c.164	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678551	0.88542	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	T	0.39229	1.09	5.93	5.02	0.67125	.	0.173327	0.27604	N	0.018632	T	0.69124	0.3076	M	0.90019	3.08	0.50813	D	0.999898	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.978	T	0.76046	-0.3102	10	0.87932	D	0	-39.4263	12.6599	0.56808	0.0792:0.0:0.9208:0.0	.	55;55	B4E3S9;P29536	.;LMOD1_HUMAN	M	55	ENSP00000356257:T55M	ENSP00000356257:T55M	T	-	2	0	LMOD1	200181928	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.329000	0.52060	1.522000	0.49001	0.561000	0.74099	ACG	-	HMMPfam_Tropomodulin		0.577	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	protein_coding	OTTHUMT00000087085.2	G			200181928	-1	no_errors	ENST00000367288	ensembl	human	known	54_36p	missense	SNP	1.000	A
RPL32	6161	genome.wustl.edu	37	3	12880994	12880994	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr3:12880994C>A	ENST00000429711.2	-	3	231	c.132G>T	c.(130-132)agG>agT	p.R44S	RPL32_ENST00000396953.2_Missense_Mutation_p.R44S|RPL32_ENST00000435983.1_Missense_Mutation_p.R44S|RPL32_ENST00000396957.1_Missense_Mutation_p.R44S|RPL32_ENST00000273223.6_Missense_Mutation_p.R62S|SNORA7A_ENST00000384765.1_RNA	NM_000994.3	NP_000985.1	P62910	RL32_HUMAN	ribosomal protein L32	44					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						TTCTACGAACCCTGTTGTCAA	0.493																																						dbGAP											0			3											215.0	218.0	217.0					3																	12880994		2203	4300	6503	12855994	SO:0001583	missense	0			CA436299, CF124158, CR608027	CCDS2614.1	3q13.3-q21	2011-04-06			ENSG00000144713	ENSG00000144713		"""L ribosomal proteins"""	10336	protein-coding gene	gene with protein product						9284913	Standard	NM_001007073		Approved	L32	uc003bxl.3	P62910	OTTHUMG00000129804	ENST00000429711.2:c.132G>T	3.37:g.12880994C>A	ENSP00000416429:p.Arg44Ser	84	0.00	0		1244	52.68	1394	12855994	64	46.28	56	B2R4Q3|P02433	Missense_Mutation	SNP	HMMPfam_Ribosomal_L32e,superfamily_Ribosomal protein L32e,PatternScan_RIBOSOMAL_L32E	p.R44S	ENST00000429711.2	37	c.132	CCDS2614.1	3	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691853	0.48097	.	.	ENSG00000144713	ENST00000429711;ENST00000396957;ENST00000273223;ENST00000435983;ENST00000396953;ENST00000457131;ENST00000434963	.	.	.	3.95	0.933	0.19471	.	0.000000	0.85682	D	0.000000	T	0.62282	0.2415	M	0.88105	2.93	0.80722	D	1	B	0.27264	0.173	B	0.30401	0.115	T	0.60244	-0.7301	9	0.87932	D	0	-1.9732	3.8505	0.08953	0.0:0.4983:0.1857:0.316	.	44	P62910	RL32_HUMAN	S	44;44;62;44;44;44;44	.	ENSP00000339064:R62S	R	-	3	2	RPL32	12855994	1.000000	0.71417	0.995000	0.50966	0.910000	0.53928	1.002000	0.29796	0.284000	0.22305	0.467000	0.42956	AGG	-	HMMPfam_Ribosomal_L32e,superfamily_Ribosomal protein L32e		0.493	RPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL32	protein_coding	OTTHUMT00000252032.2	C	NM_000994		12855994	-1	no_errors	NM_000994.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CC2D2A	57545	genome.wustl.edu	37	4	15569352	15569352	+	Missense_Mutation	SNP	C	C	T	rs386833752		TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr4:15569352C>T	ENST00000503292.1	+	27	3521	c.3341C>T	c.(3340-3342)aCg>aTg	p.T1114M	CC2D2A_ENST00000413206.1_Missense_Mutation_p.T1114M|CC2D2A_ENST00000424120.1_Missense_Mutation_p.T1114M|CC2D2A_ENST00000389652.5_Missense_Mutation_p.T1065M	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1114	C2.		T -> M (in MKS6 and JBTS9). {ECO:0000269|PubMed:19466712, ECO:0000269|PubMed:19777577}.		cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GTTTGCCATACGACTACGGCT	0.368																																						dbGAP											0			4											81.0	78.0	79.0					4																	15569352		1857	4103	5960	15178450	SO:0001583	missense	0			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.3341C>T	4.37:g.15569352C>T	ENSP00000421809:p.Thr1114Met	123	0.00	0		NA	NA	NA	15178450	102	39.53	68	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	HMMSmart_C2	p.T1114M	ENST00000503292.1	37	c.3341	CCDS47026.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127726	0.77549	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	6.08	5.24	0.73138	C2 calcium-dependent membrane targeting (1);	0.000000	0.85682	D	0.000000	D	0.93671	0.7978	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94505	0.7713	10	0.87932	D	0	.	15.1507	0.72696	0.0:0.9329:0.0:0.0671	.	1114;1065	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	M	1114;1114;1065;1065;1114;1065	ENSP00000403465:T1114M;ENSP00000398391:T1114M;ENSP00000421809:T1114M;ENSP00000374303:T1065M	ENSP00000374303:T1065M	T	+	2	0	CC2D2A	15178450	1.000000	0.71417	0.868000	0.34077	0.694000	0.40290	7.538000	0.82048	1.590000	0.49995	0.655000	0.94253	ACG	-	HMMSmart_C2		0.368	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CC2D2A	protein_coding	OTTHUMT00000359906.2	C	NM_001080522		15178450	+1	no_errors	NM_001080522.2	genbank	human	validated	54_36p	missense	SNP	0.971	T
LNX1	84708	genome.wustl.edu	37	4	54374249	54374249	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr4:54374249C>T	ENST00000263925.7	-	3	840	c.526G>A	c.(526-528)Gag>Aag	p.E176K	LNX1-AS1_ENST00000510785.1_RNA|LNX1_ENST00000306888.2_Missense_Mutation_p.E80K|LNX1-AS1_ENST00000511989.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000514364.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	176					protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGGCCAGGCTCGTCTGTCATT	0.627																																						dbGAP											0			4											32.0	32.0	32.0					4																	54374249		2203	4300	6503	54069006	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.526G>A	4.37:g.54374249C>T	ENSP00000263925:p.Glu176Lys	89	2.17	2		NA	NA	NA	54069006	97	49.22	95	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ	p.E80K	ENST00000263925.7	37	c.238	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.338532	0.95783	.	.	ENSG00000072201	ENST00000306888;ENST00000263925	T;T	0.11277	2.79;3.88	5.31	4.46	0.54185	.	0.095720	0.64402	D	0.000001	T	0.13670	0.0331	L	0.34521	1.04	0.58432	D	0.999998	P;P	0.42735	0.788;0.778	B;P	0.46629	0.254;0.522	T	0.05533	-1.0879	10	0.29301	T	0.29	.	16.0484	0.80735	0.0:0.8656:0.1344:0.0	.	176;80	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	K	80;176	ENSP00000302879:E80K;ENSP00000263925:E176K	ENSP00000263925:E176K	E	-	1	0	LNX1	54069006	1.000000	0.71417	0.834000	0.33040	0.959000	0.62525	4.451000	0.60047	1.222000	0.43521	0.555000	0.69702	GAG	-	NULL		0.627	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	protein_coding	OTTHUMT00000219934.2	C			54069006	-1	no_errors	NM_032622.1	genbank	human	reviewed	54_36p	missense	SNP	0.988	T
FNIP2	57600	genome.wustl.edu	37	4	159754760	159754760	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr4:159754760G>A	ENST00000264433.6	+	6	710	c.635G>A	c.(634-636)tGt>tAt	p.C212Y	FNIP2_ENST00000379346.3_Missense_Mutation_p.C235Y	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	212					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TTGGGTCCTTGTCGTACTGGA	0.383																																						dbGAP											0			4											97.0	91.0	93.0					4																	159754760		1833	4092	5925	159974210	SO:0001583	missense	0			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.635G>A	4.37:g.159754760G>A	ENSP00000264433:p.Cys212Tyr	186	0.00	0		2	33.33	1	159974210	145	36.86	87	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	NULL	p.C212Y	ENST00000264433.6	37	c.635	CCDS47155.1	4	.	.	.	.	.	.	.	.	.	.	G	1.135	-0.651337	0.03506	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346;ENST00000504715	T;T;T;T	0.29655	1.97;1.95;1.96;1.56	5.32	4.47	0.54385	.	.	.	.	.	T	0.25494	0.0620	L	0.36672	1.1	0.31829	N	0.624937	B;B	0.30021	0.248;0.265	B;B	0.30105	0.111;0.098	T	0.20075	-1.0286	8	.	.	.	.	13.3068	0.60357	0.0:0.0:0.7138:0.2862	.	212;235	Q9P278;D6RFH5	FNIP2_HUMAN;.	Y	212;235;235;47	ENSP00000264433:C212Y;ENSP00000421488:C235Y;ENSP00000368651:C235Y;ENSP00000420841:C47Y	.	C	+	2	0	FNIP2	159974210	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.962000	0.49176	1.210000	0.43336	0.655000	0.94253	TGT	-	NULL		0.383	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP2	protein_coding	OTTHUMT00000366602.1	G	NM_020840		159974210	+1	no_errors	NM_020840.1	genbank	human	validated	54_36p	missense	SNP	0.998	A
POU5F1	5460	genome.wustl.edu	37	6	31133004	31133004	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr6:31133004G>T	ENST00000259915.8	-	4	789	c.717C>A	c.(715-717)aaC>aaA	p.N239K	POU5F1_ENST00000513407.1_Missense_Mutation_p.N43K|POU5F1_ENST00000512818.1_Missense_Mutation_p.N43K|POU5F1_ENST00000606567.1_Missense_Mutation_p.N69K|POU5F1_ENST00000441888.3_Missense_Mutation_p.N43K|POU5F1_ENST00000471529.2_Missense_Mutation_p.N43K	NM_002701.4	NP_002692.2	Q01860	PO5F1_HUMAN	POU class 5 homeobox 1	239					anatomical structure morphogenesis (GO:0009653)|blastocyst development (GO:0001824)|BMP signaling pathway involved in heart induction (GO:0003130)|cardiac cell fate determination (GO:0060913)|cell fate commitment involved in formation of primary germ layer (GO:0060795)|endodermal cell fate specification (GO:0001714)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of gene silencing by miRNA (GO:0060965)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of asymmetric cell division (GO:0009786)|regulation of gene expression (GO:0010468)|regulation of heart induction by regulation of canonical Wnt signaling pathway (GO:0090081)|regulation of methylation-dependent chromatin silencing (GO:0090308)|regulation of transcription, DNA-templated (GO:0006355)|response to wounding (GO:0009611)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)		EWSR1/POU5F1(10)	breast(1)|large_intestine(2)|lung(3)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	13					Dopamine(DB00988)|Norepinephrine(DB00368)	CTCTCACTCGGTTCTCGATAC	0.562			T	EWSR1	sarcoma																																	dbGAP		Dom	yes		6	6p21.31	5460	"""POU domain, class 5, transcription factor 1"""		M	0			6											53.0	34.0	41.0					6																	31133004		1511	2708	4219	31240983	SO:0001583	missense	0			Z11898	CCDS34391.1, CCDS47398.1, CCDS47398.2, CCDS75420.1	6p21.33	2011-06-20	2007-07-13		ENSG00000204531	ENSG00000204531		"""Homeoboxes / POU class"""	9221	protein-coding gene	gene with protein product		164177	"""POU domain class 5, transcription factor 1"""	OTF3		1408763	Standard	NM_002701		Approved	OCT3, Oct4, MGC22487	uc003nsv.3	Q01860	OTTHUMG00000031206	ENST00000259915.8:c.717C>A	6.37:g.31133004G>T	ENSP00000259915:p.Asn239Lys	191	0.00	0		1	75.00	3	31240983	136	43.44	106	A6NCS1|A6NLL8|D2IYK4|P31359|Q15167|Q15168|Q16422|Q5STF3|Q5STF4	Missense_Mutation	SNP	HMMPfam_Pou,HMMSmart_SM00352,PatternScan_POU_1,PatternScan_POU_2,HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like,superfamily_lambda repressor-like DNA-binding domains,PatternScan_HOMEOBOX_1	p.N239K	ENST00000259915.8	37	c.717	CCDS34391.1	6	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309254	0.60414	.	.	ENSG00000204531	ENST00000541552;ENST00000512818;ENST00000259915;ENST00000441888;ENST00000471529	D;D;D;D	0.95756	-3.8;-3.8;-3.8;-3.8	6.05	4.27	0.50696	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.090924	0.48286	D	0.000199	D	0.87605	0.6219	L	0.33624	1.015	0.32235	N	0.57349	P;P	0.48089	0.73;0.905	B;B	0.42245	0.251;0.381	D	0.86783	0.1980	10	0.66056	D	0.02	.	8.9791	0.35955	0.2296:0.0:0.7704:0.0	.	239;144	Q01860;D2IYK4	PO5F1_HUMAN;.	K	144;43;239;43;43	ENSP00000425479:N43K;ENSP00000259915:N239K;ENSP00000389359:N43K;ENSP00000425083:N43K	ENSP00000259915:N239K	N	-	3	2	POU5F1	31240983	0.006000	0.16342	1.000000	0.80357	0.984000	0.73092	0.384000	0.20668	1.577000	0.49804	-0.156000	0.13503	AAC	-	HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like		0.562	POU5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1	protein_coding	OTTHUMT00000076413.4	G	NM_002701		31240983	-1	no_errors	NM_002701.4	genbank	human	validated	54_36p	missense	SNP	0.995	T
POM121C	100101267	genome.wustl.edu	37	7	75051473	75051473	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr7:75051473C>G	ENST00000257665.5	-	11	2787	c.2788G>C	c.(2788-2790)Ggc>Cgc	p.G930R	POM121C_ENST00000453279.2_Missense_Mutation_p.G688R|POM121C_ENST00000473168.1_5'Flank			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	930	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GCGCTTGAGCCAAAGGGAATG	0.672																																						dbGAP											0			7																																								74889409	SO:0001583	missense	0				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.2788G>C	7.37:g.75051473C>G	ENSP00000257665:p.Gly930Arg	7	0.00	0		13	0.00	0	74889409	9	10.00	1	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.G688R	ENST00000257665.5	37	c.2062		7	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067750	0.36470	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.25250	3.27;1.81	2.84	0.862	0.19056	.	0.556655	0.15025	N	0.284770	T	0.38825	0.1055	M	0.75777	2.31	0.28114	N	0.930895	D	0.61080	0.989	P	0.58873	0.847	T	0.21415	-1.0246	10	0.87932	D	0	.	4.0874	0.09953	0.0:0.477:0.0:0.523	.	930	A8CG34	P121C_HUMAN	R	930;688	ENSP00000257665:G930R;ENSP00000414208:G688R	ENSP00000257665:G930R	G	-	1	0	POM121C	74889409	0.334000	0.24739	0.241000	0.24154	0.368000	0.29767	0.316000	0.19469	0.479000	0.27511	0.187000	0.17357	GGC	-	NULL		0.672	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	POM121C	protein_coding	OTTHUMT00000343919.2	C	NM_001099415		74889409	-1	no_errors	NM_001099415.1	genbank	human	validated	54_36p	missense	SNP	0.135	G
TAS2R38	5726	genome.wustl.edu	37	7	141672554	141672554	+	Silent	SNP	C	C	G			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr7:141672554C>G	ENST00000547270.1	-	1	1019	c.936G>C	c.(934-936)ctG>ctC	p.L312L		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	312					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GAGCCCAGAGCAGAATGGTCA	0.517																																						dbGAP											0			7											69.0	60.0	63.0					7																	141672554		2203	4300	6503	141319023	SO:0001819	synonymous_variant	0			AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.936G>C	7.37:g.141672554C>G		74	0.00	0		NA	NA	NA	141319023	81	42.07	61	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Silent	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.L312	ENST00000547270.1	37	c.936	CCDS34765.1	7																																																																																			-	HMMPfam_TAS2R,superfamily_SSF81321		0.517	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R38	protein_coding	OTTHUMT00000350810.2	C	NM_176817		141319023	-1	no_errors	NM_176817.3	genbank	human	validated	54_36p	silent	SNP	0.001	G
ZBED6CL	113763	genome.wustl.edu	37	7	150028046	150028046	+	Silent	SNP	C	C	T			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr7:150028046C>T	ENST00000343855.4	+	1	1109	c.553C>T	c.(553-555)Ctg>Ttg	p.L185L	LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	185																	CGGGGGCTCGCTGTCCACCAA	0.617																																						dbGAP											0			7											27.0	29.0	28.0					7																	150028046		2203	4300	6503	149658979	SO:0001819	synonymous_variant	0			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.553C>T	7.37:g.150028046C>T		23	0.00	0		1	0.00	0	149658979	44	29.03	18		Silent	SNP	NULL	p.L185	ENST00000343855.4	37	c.553	CCDS5900.1	7																																																																																			-	NULL		0.617	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf29	protein_coding	OTTHUMT00000350702.1	C	NM_138434		149658979	+1	no_errors	NM_138434.2	genbank	human	validated	54_36p	silent	SNP	0.015	T
XKR4	114786	genome.wustl.edu	37	8	56366649	56366649	+	Intron	SNP	A	A	G			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr8:56366649A>G	ENST00000327381.6	+	3	1106					NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGCATATTCAAGGAGGAGGGG	0.587																																						dbGAP											0			8																																								56529203	SO:0001627	intron_variant	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1007-69191A>G	8.37:g.56366649A>G		25	0.00	0		NA	NA	NA	56529203	28	30.00	12	Q96PZ8	RNA	SNP	-	NULL	ENST00000327381.6	37	NULL	CCDS34893.1	8																																																																																			-	-		0.587	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133234	protein_coding	OTTHUMT00000378129.2	A	NM_052898		56529203	-1	pseudogene	XR_038021.1	genbank	human	model	54_36p	rna	SNP	0.803	G
TRIM48	79097	genome.wustl.edu	37	11	55033149	55033149	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr11:55033149C>A	ENST00000417545.2	+	3	619	c.533C>A	c.(532-534)aCc>aAc	p.T178N		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	162						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						AATGTGGAAACCACCAGAATC	0.403																																						dbGAP											0			11											46.0	52.0	50.0					11																	55033149		2187	4252	6439	54789725	SO:0001583	missense	0			AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.533C>A	11.37:g.55033149C>A	ENSP00000402414:p.Thr178Asn	24	0.00	0		NA	NA	NA	54789725	44	37.14	26	Q9BUW4	Missense_Mutation	SNP	HMMPfam_zf-B_box,HMMSmart_BBOX,HMMSmart_RING,PatternScan_ZF_RING_1,HMMPfam_zf-C3HC4,superfamily_SSF57850	p.T162N	ENST00000417545.2	37	c.485	CCDS7947.2	11	.	.	.	.	.	.	.	.	.	.	c	5.706	0.314868	0.10789	.	.	ENSG00000150244	ENST00000417545	T	0.72942	-0.7	0.596	-1.19	0.09585	.	.	.	.	.	T	0.71341	0.3328	M	0.84511	2.7	0.09310	N	1	P	0.45011	0.848	P	0.48368	0.575	T	0.59579	-0.7428	8	0.21014	T	0.42	.	.	.	.	.	162	Q8IWZ4	TRI48_HUMAN	N	178	ENSP00000402414:T178N	ENSP00000402414:T178N	T	+	2	0	TRIM48	54789725	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	-0.232000	0.09055	-1.193000	0.02688	-0.506000	0.04501	ACC	-	NULL		0.403	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM48	protein_coding	OTTHUMT00000347088.1	C			54789725	+1	no_errors	NM_024114.3	genbank	human	validated	54_36p	missense	SNP	0.000	A
TUBA1A	7846	genome.wustl.edu	37	12	49578980	49578980	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr12:49578980C>T	ENST00000295766.5	-	4	1648	c.1169G>A	c.(1168-1170)cGc>cAc	p.R390H	TUBA1A_ENST00000301071.7_Missense_Mutation_p.R390H|TUBA1A_ENST00000550767.1_Missense_Mutation_p.R355H	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	390					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	GTGGTCCAGGCGAGCCCAGGC	0.577																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	dbGAP											0			12											100.0	87.0	91.0					12																	49578980		2203	4298	6501	47865247	SO:0001583	missense	0			AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.1169G>A	12.37:g.49578980C>T	ENSP00000439020:p.Arg390His	98	0.00	0		167	16.92	34	47865247	148	22.40	43	A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	HMMPfam_Tubulin,superfamily_Tubulin C-terminal domain-like,PatternScan_TUBULIN,HMMPfam_Tubulin_C,superfamily_Tubulin nucleotide-binding domain-like	p.R390H	ENST00000295766.5	37	c.1169	CCDS58227.1	12	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557390	0.45590	.	.	ENSG00000167552	ENST00000301071;ENST00000552597;ENST00000548405;ENST00000295766;ENST00000550767	D;D;D	0.83673	-1.75;-1.75;-1.75	5.51	5.51	0.81932	Tubulin/FtsZ, 2-layer sandwich domain (2);Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87438	0.6177	M	0.87682	2.9	0.80722	D	1	B	0.22146	0.065	B	0.30646	0.118	D	0.86107	0.1560	10	0.87932	D	0	.	18.2109	0.89869	0.0:1.0:0.0:0.0	.	390	Q71U36	TBA1A_HUMAN	H	390;121;237;390;355	ENSP00000301071:R390H;ENSP00000439020:R390H;ENSP00000446637:R355H	ENSP00000439020:R390H	R	-	2	0	TUBA1A	47865247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.334000	0.79224	2.581000	0.87130	0.655000	0.94253	CGC	-	superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C		0.577	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	TUBA1A	protein_coding	OTTHUMT00000404547.2	C	NM_006009		47865247	-1	no_errors	NM_006009.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34048515	34048515	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr15:34048515G>A	ENST00000389232.4	+	59	8594	c.8524G>A	c.(8524-8526)Gtc>Atc	p.V2842I	RYR3_ENST00000415757.3_Missense_Mutation_p.V2842I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2842					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGAAGCCATTGTCAGCAGTGG	0.413																																						dbGAP											0			15											69.0	66.0	67.0					15																	34048515		1856	4109	5965	31835807	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8524G>A	15.37:g.34048515G>A	ENSP00000373884:p.Val2842Ile	122	0.00	0		NA	NA	NA	31835807	107	39.55	70	O15175|Q15412	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR,HMMPfam_RyR,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_SPRY,HMMPfam_Ion_trans,HMMPfam_RR_TM4-6,HMMPfam_RIH_assoc,HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_efhand,HMMSmart_SM00449,superfamily_EF-hand	p.V2842I	ENST00000389232.4	37	c.8524	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898795	0.52227	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96554	-4.05;-4.05	5.2	4.28	0.50868	.	0.136962	0.49305	N	0.000155	D	0.91341	0.7269	N	0.17082	0.46	0.35894	D	0.829888	B;B	0.16396	0.008;0.017	B;B	0.13407	0.003;0.009	D	0.90007	0.4118	10	0.33940	T	0.23	.	13.998	0.64414	0.0737:0.0:0.9263:0.0	.	2842;2842	Q15413-2;Q15413	.;RYR3_HUMAN	I	2842	ENSP00000373884:V2842I;ENSP00000399610:V2842I	ENSP00000354735:V2842I	V	+	1	0	RYR3	31835807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.684000	0.61686	1.558000	0.49541	0.655000	0.94253	GTC	-	NULL		0.413	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	G			31835807	+1	no_errors	NM_001036.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
FSD2	123722	genome.wustl.edu	37	15	83455740	83455740	+	Missense_Mutation	SNP	C	C	T	rs376156057		TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr15:83455740C>T	ENST00000334574.8	-	2	584	c.403G>A	c.(403-405)Gga>Aga	p.G135R	FSD2_ENST00000541889.1_Missense_Mutation_p.G135R			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	135										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						CCCCACCCTCCGAAGCCCAGG	0.587																																						dbGAP											0			15						C	ARG/GLY	0,4160		0,0,2080	53.0	59.0	57.0		403	-0.7	0.0	15		57	1,8383		0,1,4191	no	missense	FSD2	NM_001007122.2	125	0,1,6271	TT,TC,CC		0.0119,0.0,0.0080	possibly-damaging	135/750	83455740	1,12543	2080	4192	6272	81252794	SO:0001583	missense	0			AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.403G>A	15.37:g.83455740C>T	ENSP00000335651:p.Gly135Arg	75	0.00	0		NA	NA	NA	81252794	68	50.72	70	B3KVG1|B7ZM02	Missense_Mutation	SNP	HMMPfam_SPRY,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like	p.G135R	ENST00000334574.8	37	c.403	CCDS45332.1	15	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099704	0.37048	0.0	1.19E-4	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.41758	0.99;0.99	5.15	-0.719	0.11201	.	1.993840	0.02296	N	0.070770	T	0.29524	0.0736	L	0.47716	1.5	0.09310	N	1	B;B	0.33494	0.414;0.414	B;B	0.27887	0.042;0.084	T	0.05484	-1.0882	10	0.19590	T	0.45	-0.2918	1.3727	0.02214	0.2936:0.3707:0.1049:0.2308	.	135;135	B7ZM02;A1L4K1	.;FSD2_HUMAN	R	135	ENSP00000335651:G135R;ENSP00000444078:G135R	ENSP00000335651:G135R	G	-	1	0	FSD2	81252794	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.675000	0.05227	-0.029000	0.13827	-0.140000	0.14226	GGA	-	NULL		0.587	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD2	protein_coding	OTTHUMT00000418385.1	C	NM_001007122		81252794	-1	no_errors	NM_001007122.2	genbank	human	provisional	54_36p	missense	SNP	0.000	T
PEX13	5194	genome.wustl.edu	37	2	61258937	61258937	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	G	G	G	-	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr2:61258937delG	ENST00000295030.5	+	2	514	c.476delG	c.(475-477)aggfs	p.R159fs	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	159	Targeting to peroxisomes.				cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AACAGTTTCAGGGCTGTATTG	0.393																																						dbGAP											0			2											176.0	170.0	172.0					2																	61258937		2203	4300	6503	61112441	SO:0001589	frameshift_variant	0			U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.476delG	2.37:g.61258937delG	ENSP00000295030:p.Arg159fs	158	0.00	0		3	0.00	0	61112441	113	43.46	93	B2RCS1	Frame_Shift_Del	DEL	HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH3-domain,HMMPfam_Peroxin-13_N	p.A160fs	ENST00000295030.5	37	c.476	CCDS1866.1	2																																																																																			-	HMMPfam_Peroxin-13_N		0.393	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX13	protein_coding	OTTHUMT00000251581.3	G	NM_002618		61112441	+1	no_errors	NM_002618.3	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
FANCC	2176	genome.wustl.edu	37	9	98055569	98055570	+	Intron	DEL	TG	TG	-			TCGA-AB-2803-03B-01W-0728-08	TCGA-AB-2803-11B-01W-0728-08	TG	TG	TG	-	TG	TG	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b32f55af-f22a-4a37-a9f6-753d1b1eb72d	7cf1ee32-4453-4377-af5e-7d9ac9f8d43b	g.chr9:98055569_98055570delTG	ENST00000289081.3	-	1	177				FANCC_ENST00000375305.1_Intron	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				TGCCTGTCTTTGTGCCTACAGC	0.51			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0			9																																								97095391	SO:0001627	intron_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.77+24237CA>-	9.37:g.98055571_98055572delTG		0	0.00	0		0	0.00	0	97095390	0	14.29	15	B1ALR8	RNA	DEL	-	NULL	ENST00000289081.3	37	NULL	CCDS35071.1	9																																																																																			-	-		0.510	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643342	protein_coding	OTTHUMT00000053219.1	TG	NM_000136		97095391	+1	pseudogene	XR_016301.2	genbank	human	model	54_36p	rna	DEL	0.996:0.998	-
