#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	A	A	A	G	A	A	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								1311	SO:0001628	intergenic_variant	0																															Unknown.37:g.0A>G		1448	0.82	12		NA	NA	NA	1311	2481	52.22	2728		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000211459			A			1311	+1	no_errors	ENST00000389680	ensembl	human	novel	54_36p	rna	SNP	NULL	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	T	T	T	C	T	T	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								3434	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		888	0.78	7		NA	NA	NA	3434	3097	35.73	1726		Missense_Mutation	SNP	HMMPfam_NADHdh,PatternScan_COMPLEX1_ND1_1,PatternScan_COMPLEX1_ND1_2	p.Y43H		37	c.127		MT																																																																																			-	HMMPfam_NADHdh	0	0					MT-ND1			T			3434	+1	no_errors	ENST00000361390	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	T	T	T	C	T	T	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								10493	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		1004	0.59	6		NA	NA	NA	10493	2833	41.85	2041		Missense_Mutation	SNP	HMMPfam_Oxidored_q2	p.I8T		37	c.23		MT																																																																																			-	HMMPfam_Oxidored_q2	0	0					MT-ND4			T			10493	+1	no_errors	ENST00000361335	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	T	T	T	C	T	T	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								13116	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		691	0.14	1		NA	NA	NA	13116	1999	36.59	1156		Missense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.L260P		37	c.779		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND5			T			13116	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	missense	SNP	NULL	C
BRINP3	339479	genome.wustl.edu	37	1	190067861	190067861	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr1:190067861G>A	ENST00000367462.3	-	8	1819	c.1588C>T	c.(1588-1590)Cgt>Tgt	p.R530C	BRINP3_ENST00000534846.1_Missense_Mutation_p.R428C	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	530					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.R530C(1)									ATCCGCTTACGCCAGGAGGGA	0.428																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)	1											119.0	116.0	117.0					1																	190067861		2203	4300	6503	188334484	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1588C>T	1.37:g.190067861G>A	ENSP00000356432:p.Arg530Cys	29	0.00	0		NA	NA	NA	188334484	90	40.79	62	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF,HMMSmart_SM00457	p.R530C	ENST00000367462.3	37	c.1588	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825390	0.50739	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.25749	2.03;1.78	5.64	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.973	T	0.54957	-0.8215	10	0.87932	D	0	.	13.2819	0.60219	0.0:0.0:0.835:0.165	.	428;530	B7Z260;Q76B58	.;FAM5C_HUMAN	C	530;428	ENSP00000356432:R530C;ENSP00000438022:R428C	ENSP00000356432:R530C	R	-	1	0	FAM5C	188334484	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	2.155000	0.42301	1.317000	0.45149	0.591000	0.81541	CGT	-	NULL		0.428	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	G	NM_199051		188334484	-1	no_errors	NM_199051.1	genbank	human	provisional	54_36p	missense	SNP	1.000	A
TRNT1	51095	genome.wustl.edu	37	3	3189779	3189779	+	Missense_Mutation	SNP	A	A	G	rs199931785		TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr3:3189779A>G	ENST00000251607.6	+	8	1348	c.1246A>G	c.(1246-1248)Aaa>Gaa	p.K416E	TRNT1_ENST00000280591.6_Missense_Mutation_p.K396E	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	416					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		AGAACAGTGGAAAAAAAGTGG	0.388																																						dbGAP											0			3											61.0	63.0	63.0					3																	3189779		2203	4300	6503	3164779	SO:0001583	missense	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.1246A>G	3.37:g.3189779A>G	ENSP00000251607:p.Lys416Glu	27	0.00	0		16	40.74	11	3164779	75	45.26	62	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	HMMPfam_PolyA_pol,superfamily_Nucleotidyltransferase,superfamily_Poly A polymerase C-terminal region-like	p.K416E	ENST00000251607.6	37	c.1246	CCDS2561.2	3	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643256	0.67244	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.44881	0.93;0.91	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	L	0.61036	1.89	0.80722	D	1	P;B	0.41978	0.767;0.23	P;B	0.47915	0.561;0.119	T	0.51364	-0.8715	10	0.45353	T	0.12	-19.6505	14.8158	0.70034	1.0:0.0:0.0:0.0	.	396;416	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	E	416;396	ENSP00000251607:K416E;ENSP00000280591:K396E	ENSP00000251607:K416E	K	+	1	0	TRNT1	3164779	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	8.662000	0.91130	1.968000	0.57251	0.533000	0.62120	AAA	-	superfamily_Poly A polymerase C-terminal region-like		0.388	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	protein_coding	OTTHUMT00000337616.1	A			3164779	+1	no_errors	NM_182916.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF502	91392	genome.wustl.edu	37	3	44763608	44763608	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr3:44763608A>T	ENST00000296091.4	+	4	1555	c.1299A>T	c.(1297-1299)aaA>aaT	p.K433N	ZNF502_ENST00000436624.2_Missense_Mutation_p.K433N|ZNF502_ENST00000449836.1_Missense_Mutation_p.K433N	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CTGGAGAAAAACCCTATAAAT	0.423																																						dbGAP											0			3											75.0	80.0	78.0					3																	44763608		2203	4300	6503	44738612	SO:0001583	missense	0			AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.1299A>T	3.37:g.44763608A>T	ENSP00000296091:p.Lys433Asn	153	0.64	1		NA	NA	NA	44738612	63	42.73	47		Missense_Mutation	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.K433N	ENST00000296091.4	37	c.1299	CCDS2719.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.54|17.54	3.413904|3.413904	0.62511|0.62511	.|.	.|.	ENSG00000196653|ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624|ENST00000427783	T;T;T|.	0.26067|.	1.76;1.76;1.76|.	4.19|4.19	3.02|3.02	0.34903|0.34903	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.48114|0.48114	0.1482|0.1482	L|L	0.46947|0.46947	1.48|1.48	0.31234|0.31234	N|N	0.695932|0.695932	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.55528|0.55528	-0.8127|-0.8127	9|6	0.66056|0.87932	D|D	0.02|0	-15.6506|-15.6506	8.8594|8.8594	0.35247|0.35247	0.9075:0.0:0.0925:0.0|0.9075:0.0:0.0925:0.0	.|.	433|.	Q8TBZ5|.	ZN502_HUMAN|.	N|I	433|433	ENSP00000397390:K433N;ENSP00000296091:K433N;ENSP00000406469:K433N|.	ENSP00000296091:K433N|ENSP00000397812:N433I	K|N	+|+	3|2	2|0	ZNF502|ZNF502	44738612|44738612	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.504000|0.504000	0.22626|0.22626	0.768000|0.768000	0.33290|0.33290	0.533000|0.533000	0.62120|0.62120	AAA|AAC	-	superfamily_SSF57667		0.423	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF502	protein_coding	OTTHUMT00000256744.4	A	NM_033210		44738612	+1	no_errors	NM_033210.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
GALNT7	51809	genome.wustl.edu	37	4	174219440	174219440	+	Silent	SNP	A	A	G			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr4:174219440A>G	ENST00000265000.4	+	6	1223	c.1140A>G	c.(1138-1140)gaA>gaG	p.E380E	GALNT7_ENST00000512285.1_3'UTR	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	380					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		CAAAAACTGAACCGTATCGGT	0.423																																						dbGAP											0			4											64.0	64.0	64.0					4																	174219440		2203	4300	6503	174456015	SO:0001819	synonymous_variant	0			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1140A>G	4.37:g.174219440A>G		42	0.00	0		25	41.86	18	174456015	67	47.24	60	B3KQU3|Q7Z5W7|Q9UJ28	Silent	SNP	HMMPfam_Ricin_B_lectin,HMMSmart_SM00458,HMMPfam_Glycos_transf_2,superfamily_Ricin B-like lectins,superfamily_Nucleotide-diphospho-sugar transferases	p.E380	ENST00000265000.4	37	c.1140	CCDS3815.1	4																																																																																			-	HMMPfam_Glycos_transf_2,superfamily_Nucleotide-diphospho-sugar transferases		0.423	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT7	protein_coding	OTTHUMT00000362456.2	A	NM_017423		174456015	+1	no_errors	NM_017423.2	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
CMYA5	202333	genome.wustl.edu	37	5	79034411	79034411	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr5:79034411C>T	ENST00000446378.2	+	2	9854	c.9823C>T	c.(9823-9825)Ccg>Tcg	p.P3275S		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3275					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTCATACCAACCGATAGCTGC	0.438																																						dbGAP											0			5											99.0	94.0	95.0					5																	79034411		1867	4112	5979	79070167	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9823C>T	5.37:g.79034411C>T	ENSP00000394770:p.Pro3275Ser	73	0.00	0		NA	NA	NA	79070167	149	46.40	129	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	HMMPfam_SPRY,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like	p.P3275S	ENST00000446378.2	37	c.9823	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	8.167	0.790913	0.16258	.	.	ENSG00000164309	ENST00000446378	T	0.20598	2.06	5.89	4.13	0.48395	.	0.802608	0.10844	N	0.627939	T	0.18551	0.0445	L	0.36672	1.1	0.23341	N	0.997877	B	0.21381	0.055	B	0.12837	0.008	T	0.18461	-1.0336	10	0.52906	T	0.07	.	10.3491	0.43924	0.0:0.8462:0.0:0.1538	.	3275	Q8N3K9	CMYA5_HUMAN	S	3275	ENSP00000394770:P3275S	ENSP00000394770:P3275S	P	+	1	0	CMYA5	79070167	0.000000	0.05858	0.482000	0.27366	0.868000	0.49771	-0.055000	0.11807	0.840000	0.34995	0.655000	0.94253	CCG	-	NULL		0.438	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	C	NM_153610		79070167	+1	no_errors	NM_153610.3	genbank	human	validated	54_36p	missense	SNP	0.515	T
GPR6	2830	genome.wustl.edu	37	6	110300868	110300868	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr6:110300868G>A	ENST00000275169.3	+	1	571	c.553G>A	c.(553-555)Gtg>Atg	p.V185M	GPR6_ENST00000414000.2_Missense_Mutation_p.V200M	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	185					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		CCTGTTGGGCGTGCACCTCCT	0.672																																						dbGAP											0			6											33.0	34.0	34.0					6																	110300868		2203	4300	6503	110407561	SO:0001583	missense	0				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.553G>A	6.37:g.110300868G>A	ENSP00000275169:p.Val185Met	35	0.00	0		NA	NA	NA	110407561	44	49.43	43	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.V185M	ENST00000275169.3	37	c.553	CCDS5079.1	6	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947751	0.53186	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.39056	1.1;1.1	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.072592	0.56097	D	0.000037	T	0.29491	0.0735	N	0.20807	0.61	0.42923	D	0.994298	D;D	0.71674	0.998;0.994	P;P	0.62014	0.897;0.895	T	0.22941	-1.0202	10	0.54805	T	0.06	.	5.763	0.18211	0.2339:0.0:0.7661:0.0	.	200;185	B4DHS9;P46095	.;GPR6_HUMAN	M	185;200;185	ENSP00000406986:V200M;ENSP00000275169:V185M	ENSP00000275169:V185M	V	+	1	0	GPR6	110407561	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.025000	0.64097	2.504000	0.84457	0.563000	0.77884	GTG	-	HMMPfam_7tm_1,superfamily_SSF81321		0.672	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR6	protein_coding	OTTHUMT00000041774.1	G			110407561	+1	no_errors	NM_005284.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
FAM115A	9747	genome.wustl.edu	37	7	143573124	143573124	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr7:143573124A>G	ENST00000479870.1	-	2	786	c.578T>C	c.(577-579)tTt>tCt	p.F193S	FAM115A_ENST00000355951.2_Missense_Mutation_p.F193S|FAM115A_ENST00000392900.3_Intron	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	193										NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					GGAGACTTTAAAGAAACTCGT	0.507																																						dbGAP											0			7											58.0	50.0	53.0					7																	143573124		2203	4300	6503	143204057	SO:0001583	missense	0			AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.578T>C	7.37:g.143573124A>G	ENSP00000419235:p.Phe193Ser	62	0.00	0		2	66.67	4	143204057	13	87.13	88	A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Missense_Mutation	SNP	NULL	p.F193S	ENST00000479870.1	37	c.578	CCDS5886.1	7	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626382	0.66901	.	.	ENSG00000198420	ENST00000479870;ENST00000355951	T;T	0.42131	0.98;0.98	4.14	2.97	0.34412	.	0.265926	0.37483	N	0.002075	T	0.55000	0.1893	M	0.86420	2.815	0.38674	D	0.952387	P	0.37176	0.586	P	0.48770	0.589	T	0.60021	-0.7344	10	0.87932	D	0	-7.6257	5.0636	0.14570	0.6268:0.1902:0.0:0.183	.	193	Q9Y4C2	F115A_HUMAN	S	193	ENSP00000419235:F193S;ENSP00000348220:F193S	ENSP00000348220:F193S	F	-	2	0	FAM115A	143204057	0.993000	0.37304	0.968000	0.41197	0.992000	0.81027	2.978000	0.49305	0.894000	0.36317	0.528000	0.53228	TTT	-	NULL		0.507	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM115A	protein_coding	OTTHUMT00000349583.1	A	NM_014719		143204057	-1	no_errors	NM_014719.1	genbank	human	predicted	54_36p	missense	SNP	0.934	G
CYP26A1	1592	genome.wustl.edu	37	10	94835682	94835682	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr10:94835682G>A	ENST00000224356.4	+	5	1009	c.964G>A	c.(964-966)Gtt>Att	p.V322I	CYP26A1_ENST00000371531.1_Missense_Mutation_p.V253I|CYP26A1_ENST00000394139.1_Missense_Mutation_p.V253I	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	322					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CTACCCACATGTTCTCCAGAA	0.517																																						dbGAP											0			10											71.0	67.0	68.0					10																	94835682		2203	4300	6503	94825672	SO:0001583	missense	0			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.964G>A	10.37:g.94835682G>A	ENSP00000224356:p.Val322Ile	64	1.54	1		NA	NA	NA	94825672	33	37.74	20	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450	p.V322I	ENST00000224356.4	37	c.964	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.387987	0.95988	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.70749	-0.51;-0.51;-0.51	5.11	5.11	0.69529	.	0.124932	0.53938	D	0.000053	T	0.68329	0.2989	L	0.32530	0.975	0.58432	D	0.999998	B;P	0.42556	0.04;0.783	B;P	0.46917	0.259;0.531	T	0.64512	-0.6390	10	0.26408	T	0.33	-8.3032	18.7344	0.91749	0.0:0.0:1.0:0.0	.	253;322	B3KNI4;O43174	.;CP26A_HUMAN	I	253;322;253	ENSP00000360586:V253I;ENSP00000224356:V322I;ENSP00000377695:V253I	ENSP00000224356:V322I	V	+	1	0	CYP26A1	94825672	1.000000	0.71417	0.847000	0.33407	0.970000	0.65996	7.187000	0.77730	2.662000	0.90505	0.655000	0.94253	GTT	-	HMMPfam_p450,superfamily_Cytochrome_P450		0.517	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	protein_coding	OTTHUMT00000049408.3	G			94825672	+1	no_errors	NM_000783.3	genbank	human	reviewed	54_36p	missense	SNP	0.887	A
AP3S2	10239	genome.wustl.edu	37	15	90414717	90414717	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr15:90414717T>C	ENST00000336418.4	-	4	727	c.335A>G	c.(334-336)cAt>cGt	p.H112R	AP3S2_ENST00000558011.1_Missense_Mutation_p.H124R|C15orf38-AP3S2_ENST00000560224.1_5'UTR|C15orf38-AP3S2_ENST00000398333.3_Missense_Mutation_p.H313R|AP3S2_ENST00000560940.1_Missense_Mutation_p.H112R	NM_005829.4	NP_005820.1	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2 subunit	112					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)	protein transporter activity (GO:0008565)			NS(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(1)	6	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			CTTATCCATATGGAAGATCAA	0.373																																						dbGAP											0			15											92.0	89.0	90.0					15																	90414717		2200	4299	6499	88215721	SO:0001583	missense	0			X99459	CCDS10357.1	15q26.1	2010-08-13			ENSG00000157823	ENSG00000157823			571	protein-coding gene	gene with protein product		602416				9118953	Standard	NM_005829		Approved	sigma3b		P59780	OTTHUMG00000149811	ENST00000336418.4:c.335A>G	15.37:g.90414717T>C	ENSP00000338777:p.His112Arg	57	0.00	0		18	41.94	13	88215721	24	36.84	14	B2R677|B4DGQ3|O09077|O09149|Q53H83|Q99589	Missense_Mutation	SNP	HMMPfam_Clat_adaptor_s,PatternScan_CLAT_ADAPTOR_S,superfamily_SNARE-like	p.H112R	ENST00000336418.4	37	c.335	CCDS10357.1	15	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013408	0.75161	.	.	ENSG00000157823;ENSG00000250021	ENST00000336418;ENST00000398333	T;T	0.44881	0.91;0.91	5.85	5.85	0.93711	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.64402	D	0.000001	T	0.59609	0.2206	M	0.92880	3.355	0.32937	D	0.517921	P;P	0.42409	0.594;0.779	P;B	0.45167	0.472;0.362	T	0.78193	-0.2299	10	0.87932	D	0	-10.6034	12.6294	0.56649	0.0:0.0:0.0:1.0	.	313;112	E2QRD5;P59780	.;AP3S2_HUMAN	R	112;313	ENSP00000338777:H112R;ENSP00000381377:H313R	ENSP00000338777:H112R	H	-	2	0	C15orf38-AP3S2;AP3S2	88215721	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.954000	0.70298	2.222000	0.72286	0.533000	0.62120	CAT	-	HMMPfam_Clat_adaptor_s,superfamily_SNARE-like		0.373	AP3S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3S2	protein_coding	OTTHUMT00000313422.1	T			88215721	-1	no_errors	NM_005829.4	genbank	human	validated	54_36p	missense	SNP	1.000	C
SSTR4	6754	genome.wustl.edu	37	20	23016628	23016628	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr20:23016628G>A	ENST00000255008.3	+	1	572	c.508G>A	c.(508-510)Gtg>Atg	p.V170M	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	170					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CAACCTGGGCGTGTGGCTGGC	0.697																																					Esophageal Squamous(15;850 1104 16640)	dbGAP											0			20											48.0	54.0	52.0					20																	23016628		2197	4293	6490	22964628	SO:0001583	missense	0				CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.508G>A	20.37:g.23016628G>A	ENSP00000255008:p.Val170Met	28	0.00	0		NA	NA	NA	22964628	16	30.43	7	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.V170M	ENST00000255008.3	37	c.508	CCDS42856.1	20	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341249	0.60963	.	.	ENSG00000132671	ENST00000255008	T	0.75154	-0.91	3.72	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	U	0.000039	D	0.85716	0.5761	M	0.84846	2.72	0.51012	D	0.999907	D	0.65815	0.995	D	0.65684	0.937	D	0.87858	0.2662	10	0.54805	T	0.06	.	14.194	0.65656	0.0:0.0:1.0:0.0	.	170	P31391	SSR4_HUMAN	M	170	ENSP00000255008:V170M	ENSP00000255008:V170M	V	+	1	0	SSTR4	22964628	1.000000	0.71417	0.853000	0.33588	0.366000	0.29705	5.707000	0.68370	1.882000	0.54519	0.655000	0.94253	GTG	-	HMMPfam_7tm_1,superfamily_SSF81321		0.697	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR4	protein_coding	OTTHUMT00000078308.1	G			22964628	+1	no_errors	NM_001052.2	genbank	human	validated	54_36p	missense	SNP	0.990	A
EZH2	2146	genome.wustl.edu	37	7	148504762	148504763	+	Frame_Shift_Ins	INS	-	-	ATGCA	rs373975096		TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	-	-	-	ATGCA	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr7:148504762_148504763insATGCA	ENST00000460911.1	-	20	2304_2305	c.2216_2217insTGCAT	c.(2215-2217)atcfs	p.-739fs	EZH2_ENST00000483967.1_Frame_Shift_Ins_p.-730fs|EZH2_ENST00000476773.1_Frame_Shift_Ins_p.-688fs|EZH2_ENST00000320356.2_Frame_Shift_Ins_p.-744fs|EZH2_ENST00000541220.1_Frame_Shift_Ins_p.-688fs|EZH2_ENST00000350995.2_Frame_Shift_Ins_p.-700fs|EZH2_ENST00000478654.1_Frame_Shift_Ins_p.-688fs			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit						cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TTTCTCTTTCGATGCCGACATA	0.51			Mis		DLBCL																																	dbGAP		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0			7																																								148135696	SO:0001589	frameshift_variant	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.2216_2217insTGCAT	7.37:g.148504762_148504763insATGCA	ENSP00000419711:p.Ile739fs	NA	NA	NA		NA	NA	NA	148135695	NA	NA	NA	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Frame_Shift_Ins	INS	HMMSmart_SANT,HMMPfam_SET,HMMSmart_SET,superfamily_SSF82199	p.E745fs	ENST00000460911.1	37	c.2232_2231	CCDS56516.1	7																																																																																			-	NULL		0.510	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	protein_coding	OTTHUMT00000352744.1	-	NM_004456		148135696	-1	no_errors	NM_004456.3	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.985:1.000	ATGCA
EZH2	2146	genome.wustl.edu	37	7	148504763	148504764	+	Frame_Shift_Ins	INS	-	-	ATGCA			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	-	-	-	ATGCA	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr7:148504763_148504764insATGCA	ENST00000460911.1	-	20	2303_2304	c.2215_2216insTGCAT	c.(2215-2217)atcfs	p.I739fs	EZH2_ENST00000483967.1_Frame_Shift_Ins_p.I730fs|EZH2_ENST00000476773.1_Frame_Shift_Ins_p.I688fs|EZH2_ENST00000320356.2_Frame_Shift_Ins_p.I744fs|EZH2_ENST00000541220.1_Frame_Shift_Ins_p.I688fs|EZH2_ENST00000350995.2_Frame_Shift_Ins_p.I700fs|EZH2_ENST00000478654.1_Frame_Shift_Ins_p.I688fs			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	739					cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TTCTCTTTCGATGCCGACATAC	0.51			Mis		DLBCL																																	dbGAP		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0			7																																								148135697	SO:0001589	frameshift_variant	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.2215_2216insTGCAT	7.37:g.148504763_148504764insATGCA	ENSP00000419711:p.Ile739fs	NA	NA	NA		NA	NA	NA	148135696	NA	NA	NA	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Frame_Shift_Ins	INS	HMMSmart_SANT,HMMPfam_SET,HMMSmart_SET,superfamily_SSF82199	p.I744fs	ENST00000460911.1	37	c.2231_2230	CCDS56516.1	7																																																																																			-	NULL		0.510	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	protein_coding	OTTHUMT00000352744.1	-	NM_004456		148135697	-1	no_errors	NM_004456.3	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	ATGCA
CBFB	865	genome.wustl.edu	37	16	67116171	67116172	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AB-2817-03B-01W-0728-08	TCGA-AB-2817-11B-01W-0728-08	-	-	-	A	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	1c97470b-4715-470b-b0c7-9e4807b5fae4	800efb0e-942d-4afc-bdb3-454dc18c6c38	g.chr16:67116171_67116172insA	ENST00000290858.6	+	5	716_717	c.455_456insA	c.(454-459)gaatttfs	p.F153fs	CBFB_ENST00000412916.2_Frame_Shift_Ins_p.F153fs|CBFB_ENST00000561924.2_Frame_Shift_Ins_p.F53fs	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	153					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		AGGACACGCGAATTTGAAGATA	0.441			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0			16																																								65673673	SO:0001589	frameshift_variant	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.456dupA	16.37:g.67116172_67116172dupA	ENSP00000290858:p.Phe153fs	288	0.00	0		12	0.00	0	65673672	197	0.00	0	A8K347|Q13124|Q9HCT2	Frame_Shift_Ins	INS	HMMPfam_CBF_beta,superfamily_CBF_beta	p.F153fs	ENST00000290858.6	37	c.455_456	CCDS10827.1	16																																																																																			-	HMMPfam_CBF_beta		0.441	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	protein_coding	OTTHUMT00000268843.2	-	NM_001755		65673673	+1	no_errors	NM_022845.2	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	A
