#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SMC1A	8243	genome.wustl.edu	37	X	53409232	53409232	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chrX:53409232T>C	ENST00000322213.4	-	22	3485	c.3358A>G	c.(3358-3360)Aaa>Gaa	p.K1120E	SMC1A_ENST00000469129.1_5'UTR	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1120					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CGGAAGCGTTTCCCAGGAGCC	0.582																																						dbGAP											0			X											77.0	57.0	64.0					X																	53409232		2203	4300	6503	53425957	SO:0001583	missense	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3358A>G	X.37:g.53409232T>C	ENSP00000323421:p.Lys1120Glu	117	3.31	4		34	64.58	62	53425957	87	32.56	42	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N,HMMPfam_SMC_hinge,superfamily_SMC_hinge,superfamily_SSF52540	p.K1120E	ENST00000322213.4	37	c.3358	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	T	24.0	4.476658	0.84640	.	.	ENSG00000072501	ENST00000322213	D	0.91351	-2.83	5.04	5.04	0.67666	RecF/RecN/SMC (1);	0.062114	0.64402	D	0.000007	D	0.96417	0.8831	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97280	0.9917	10	0.87932	D	0	.	13.1063	0.59249	0.0:0.0:0.0:1.0	.	1120	Q14683	SMC1A_HUMAN	E	1120	ENSP00000323421:K1120E	ENSP00000323421:K1120E	K	-	1	0	SMC1A	53425957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.798000	0.85924	1.804000	0.52760	0.486000	0.48141	AAA	-	HMMPfam_SMC_N,superfamily_SSF52540		0.582	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	T	NM_006306		53425957	-1	no_errors	NM_006306.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GBP4	115361	genome.wustl.edu	37	1	89652701	89652701	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr1:89652701C>T	ENST00000355754.6	-	9	1592	c.1495G>A	c.(1495-1497)Gga>Aga	p.G499R	GBP4_ENST00000471938.1_5'Flank	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	499						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		GCCTTCTCTCCAGCAGTGAGG	0.517																																						dbGAP											0			1											127.0	107.0	114.0					1																	89652701		2203	4300	6503	89425289	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1495G>A	1.37:g.89652701C>T	ENSP00000359490:p.Gly499Arg	194	3.96	8		19	52.50	21	89425289	161	32.64	78	B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	HMMPfam_GBP_C,HMMPfam_GBP,superfamily_GBP,superfamily_SSF52540	p.G499R	ENST00000355754.6	37	c.1495	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	9.599	1.128273	0.21041	.	.	ENSG00000162654	ENST00000355754	T	0.01981	4.52	4.3	-4.43	0.03568	Guanylate-binding protein, C-terminal (3);	0.874412	0.10184	N	0.705459	T	0.00637	0.0021	L	0.43598	1.365	0.09310	N	1	B	0.20459	0.045	B	0.29598	0.104	T	0.45556	-0.9253	10	0.13853	T	0.58	.	6.074	0.19905	0.0:0.2469:0.2525:0.5006	.	499	Q96PP9	GBP4_HUMAN	R	499	ENSP00000359490:G499R	ENSP00000359490:G499R	G	-	1	0	GBP4	89425289	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-3.556000	0.00432	-0.648000	0.05437	-1.077000	0.02231	GGA	-	HMMPfam_GBP_C,superfamily_GBP		0.517	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	protein_coding	OTTHUMT00000029409.1	C	NM_052941		89425289	-1	no_errors	NM_052941.4	genbank	human	validated	54_36p	missense	SNP	0.001	T
CORIN	10699	genome.wustl.edu	37	4	47667068	47667068	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr4:47667068C>T	ENST00000273857.4	-	11	1569	c.1570G>A	c.(1570-1572)Gag>Aag	p.E524K	CORIN_ENST00000504584.1_Missense_Mutation_p.E487K|CORIN_ENST00000508498.1_Missense_Mutation_p.E385K|CORIN_ENST00000502252.1_Missense_Mutation_p.E457K|CORIN_ENST00000505909.1_Missense_Mutation_p.E487K	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	524	FZ 2. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GGGATATGCTCGCCTGTATTC	0.423																																						dbGAP											0			4											79.0	80.0	79.0					4																	47667068		2203	4300	6503	47361825	SO:0001583	missense	0			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1570G>A	4.37:g.47667068C>T	ENSP00000273857:p.Glu524Lys	148	3.25	5		NA	NA	NA	47361825	72	33.94	37	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	superfamily_Frizzled cysteine-rich domain,PatternScan_SRCR_1,HMMPfam_Trypsin,HMMSmart_SM00020,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,superfamily_LDL receptor-like module,superfamily_Trypsin-like serine proteases,HMMSmart_SM00202,superfamily_SRCR-like,PatternScan_TRYPSIN_SER,HMMPfam_Fz,HMMSmart_SM00063	p.E524K	ENST00000273857.4	37	c.1570	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373989	0.42105	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	5.25	4.41	0.53225	Frizzled domain (5);	0.313155	0.31323	N	0.007846	T	0.48466	0.1501	N	0.04705	-0.18	0.09310	N	0.999997	B;B;P;B	0.38551	0.216;0.139;0.636;0.027	B;B;B;B	0.31495	0.025;0.028;0.131;0.032	T	0.44574	-0.9319	10	0.06757	T	0.87	.	16.0173	0.80450	0.0:0.254:0.746:0.0	.	487;487;457;524	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	K	524;385;457;487;487	ENSP00000273857:E524K;ENSP00000425597:E385K;ENSP00000424212:E457K;ENSP00000425401:E487K;ENSP00000423216:E487K	ENSP00000273857:E524K	E	-	1	0	CORIN	47361825	1.000000	0.71417	0.054000	0.19295	0.006000	0.05464	5.577000	0.67444	0.804000	0.34136	-0.780000	0.03373	GAG	-	superfamily_Frizzled cysteine-rich domain,HMMPfam_Fz,HMMSmart_SM00063		0.423	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	C			47361825	-1	no_errors	NM_006587.2	genbank	human	reviewed	54_36p	missense	SNP	0.119	T
RAPGEF2	9693	genome.wustl.edu	37	4	160243597	160243597	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr4:160243597G>T	ENST00000264431.4	+	4	888	c.469G>T	c.(469-471)Gaa>Taa	p.E157*		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	157					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CGCAGTGGTGGAAAGAGCAGG	0.413																																						dbGAP											0			4											108.0	106.0	107.0					4																	160243597		2008	4192	6200	160463047	SO:0001587	stop_gained	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.469G>T	4.37:g.160243597G>T	ENSP00000264431:p.Glu157*	163	3.49	6		4	55.56	5	160463047	164	29.61	69	D3DP27	Nonsense_Mutation	SNP	HMMPfam_RA,HMMSmart_RA,HMMPfam_cNMP_binding,HMMSmart_cNMP,HMMPfam_RasGEF_N,HMMSmart_RasGEFN,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ,HMMPfam_RasGEF,HMMSmart_RasGEF,superfamily_Ras_GEF,superfamily_cNMP_binding	p.E157*	ENST00000264431.4	37	c.469	CCDS43277.1	4	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928461	0.73327	.	.	ENSG00000109756	ENST00000511336;ENST00000510510;ENST00000264431;ENST00000514565	.	.	.	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3811	0.87405	0.0:0.0:1.0:0.0	.	.	.	.	X	85;155;157;138	.	.	E	+	1	0	RAPGEF2	160463047	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.809000	0.99208	2.162000	0.67917	0.591000	0.81541	GAA	-	HMMPfam_cNMP_binding,HMMSmart_cNMP,superfamily_cNMP_binding		0.413	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	protein_coding	OTTHUMT00000364980.2	G	NM_014247		160463047	+1	no_errors	NM_014247.2	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
PCDHB10	56126	genome.wustl.edu	37	5	140569138	140569138	+	5'Flank	SNP	C	C	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr5:140569138C>T	ENST00000239446.4	+	0	0					NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCAGAGCTACCAGTACGAGG	0.632																																						dbGAP											0			5											103.0	120.0	114.0					5																	140569138		2203	4300	6503	140549322	SO:0001631	upstream_gene_variant	0			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626		5.37:g.140569138C>T	Exception_encountered	79	4.82	4		NA	NA	NA	140549322	74	28.16	29	Q96T99	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin-like	p.T749I	ENST00000239446.4	37	c.2246	CCDS4252.1	5																																																																																			-	NULL		0.632	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB9	protein_coding	OTTHUMT00000251821.1	C	NM_018930		140549322	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_019119.3	genbank	human	reviewed	54_36p	missense	SNP	0.141	T
ZSCAN21	7589	genome.wustl.edu	37	7	99654638	99654638	+	Silent	SNP	C	C	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr7:99654638C>T	ENST00000292450.4	+	2	173	c.9C>T	c.(7-9)acC>acT	p.T3T	ZSCAN21_ENST00000477297.1_3'UTR|ZSCAN21_ENST00000543588.1_Silent_p.T3T|ZSCAN21_ENST00000456748.2_Silent_p.T3T	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	3					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ACATGATGACCAAGGTACTAG	0.517																																						dbGAP											0			7											159.0	174.0	169.0					7																	99654638		2203	4300	6503	99492574	SO:0001819	synonymous_variant	0			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.9C>T	7.37:g.99654638C>T		50	3.70	2		4	60.00	6	99492574	80	21.36	22	A4D2A6|D6W5T9|Q9H0B5	Silent	SNP	HMMPfam_SCAN,HMMSmart_SM00431,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.T3	ENST00000292450.4	37	c.9	CCDS5681.1	7																																																																																			-	NULL		0.517	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN21	protein_coding	OTTHUMT00000336166.1	C	NM_145914		99492574	+1	no_errors	NM_145914.2	genbank	human	validated	54_36p	silent	SNP	0.942	T
DNAI1	27019	genome.wustl.edu	37	9	34514416	34514416	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr9:34514416T>C	ENST00000242317.4	+	17	1765	c.1594T>C	c.(1594-1596)Ttc>Ctc	p.F532L		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	532					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CTCCAGCCAATTCCTCGACAC	0.567									Kartagener syndrome																													dbGAP											0			9											169.0	153.0	158.0					9																	34514416		2203	4300	6503	34504416	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1594T>C	9.37:g.34514416T>C	ENSP00000242317:p.Phe532Leu	65	2.99	2		NA	NA	NA	34504416	84	34.38	44	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	HMMSmart_WD40,superfamily_WD40_like,PatternScan_WD_REPEATS_1,HMMPfam_WD40	p.F532L	ENST00000242317.4	37	c.1594	CCDS6557.1	9	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579522	0.65878	.	.	ENSG00000122735	ENST00000379040;ENST00000242317	T	0.68331	-0.32	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.168180	0.53938	D	0.000060	T	0.47875	0.1469	N	0.10760	0.04	0.80722	D	1	B	0.09022	0.002	B	0.21151	0.033	T	0.48186	-0.9057	10	0.66056	D	0.02	.	11.9408	0.52899	0.0:0.0:0.0:1.0	.	532	Q9UI46	DNAI1_HUMAN	L	88;532	ENSP00000242317:F532L	ENSP00000242317:F532L	F	+	1	0	DNAI1	34504416	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.077000	0.64419	2.072000	0.62099	0.459000	0.35465	TTC	-	HMMSmart_WD40,superfamily_WD40_like,HMMPfam_WD40		0.567	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	protein_coding	OTTHUMT00000052192.1	T			34504416	+1	no_errors	NM_012144.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PRF1	5551	genome.wustl.edu	37	10	72360182	72360182	+	Silent	SNP	G	G	A	rs139175805		TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr10:72360182G>A	ENST00000441259.1	-	2	637	c.477C>T	c.(475-477)gcC>gcT	p.A159A	PRF1_ENST00000373209.2_Silent_p.A159A	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	159	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)	p.Q160K(1)|p.A159A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GGGTCTTCTGGGCTGCAAAGT	0.612			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													dbGAP	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	10											82.0	71.0	75.0					10																	72360182		2203	4300	6503	72030188	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.477C>T	10.37:g.72360182G>A		106	4.46	5		16	0.00	0	72030188	189	34.15	98	B2R6X4|Q59F57|Q86WX7	Silent	SNP	HMMPfam_C2,HMMSmart_SM00239,HMMPfam_MACPF,HMMSmart_SM00457,PatternScan_MAC_PERFORIN,superfamily_C2 domain (Calcium/lipid-binding domain CaLB)	p.A159	ENST00000441259.1	37	c.477	CCDS7305.1	10																																																																																			-	HMMPfam_MACPF		0.612	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRF1	protein_coding	OTTHUMT00000048517.2	G	NM_005041		72030188	-1	no_errors	NM_001083116.1	genbank	human	reviewed	54_36p	silent	SNP	0.008	A
WAPAL	23063	genome.wustl.edu	37	10	88277746	88277746	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr10:88277746T>G	ENST00000298767.5	-	2	553	c.81A>C	c.(79-81)aaA>aaC	p.K27N		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	27	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						GGGTAGTCCGTTTGTTGGAAA	0.398																																						dbGAP											0			10											87.0	83.0	84.0					10																	88277746		2203	4300	6503	88267726	SO:0001583	missense	0			AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.81A>C	10.37:g.88277746T>G	ENSP00000298767:p.Lys27Asn	118	3.23	4		47	40.51	32	88267726	116	35.56	64	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	HMMPfam_WAPL,superfamily_ARM repeat	p.K27N	ENST00000298767.5	37	c.81	CCDS7375.1	10	.	.	.	.	.	.	.	.	.	.	T	25.2	4.616699	0.87359	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.39056	1.1	5.41	5.41	0.78517	.	0.064020	0.64402	D	0.000011	T	0.61299	0.2336	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.997;0.999	D;P;P;D	0.76575	0.988;0.888;0.888;0.964	T	0.64757	-0.6332	10	0.87932	D	0	.	15.4453	0.75225	0.0:0.0:0.0:1.0	.	112;27;27;70	Q7Z5K2-3;B2RTX8;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	N	112;27;112	ENSP00000298767:K27N	ENSP00000298767:K27N	K	-	3	2	WAPAL	88267726	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.067000	0.41461	2.062000	0.61559	0.528000	0.53228	AAA	-	NULL		0.398	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WAPAL	protein_coding	OTTHUMT00000049151.2	T	NM_015045		88267726	-1	no_errors	NM_015045.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
DCDC1	341019	genome.wustl.edu	37	11	30938514	30938514	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr11:30938514A>T	ENST00000597505.1	-	24	3354	c.3355T>A	c.(3355-3357)Tgg>Agg	p.W1119R	DCDC1_ENST00000339794.5_Missense_Mutation_p.W198R|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTTTCCTGCCAGGCATACCTG	0.418																																						dbGAP											0			11											164.0	159.0	160.0					11																	30938514		2202	4299	6501	30895090	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3355T>A	11.37:g.30938514A>T	ENSP00000472625:p.Trp1119Arg	119	7.69	10		NA	NA	NA	30895090	104	26.24	37	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	HMMPfam_DCX,superfamily_RicinB_like,superfamily_SSF89837	p.W229R	ENST00000597505.1	37	c.685		11	.	.	.	.	.	.	.	.	.	.	A	15.10	2.732055	0.48939	.	.	ENSG00000170959	ENST00000339794	.	.	.	5.24	4.11	0.48088	.	0.274192	0.26571	N	0.023627	T	0.63486	0.2515	M	0.75447	2.3	0.26451	N	0.975608	D	0.64830	0.994	D	0.66084	0.941	T	0.57568	-0.7789	9	0.87932	D	0	-1.6062	8.7026	0.34334	0.9114:0.0:0.0886:0.0	.	198	Q6ZRR9	DCDC5_HUMAN	R	198	.	ENSP00000341700:W198R	W	-	1	0	DCDC5	30895090	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	2.596000	0.46205	0.823000	0.34589	0.459000	0.35465	TGG	-	NULL		0.418	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC5	protein_coding	OTTHUMT00000463167.1	A	NM_181807		30895090	-1	no_errors	ENST00000406071	ensembl	human	known	54_36p	missense	SNP	1.000	T
GRIK4	2900	genome.wustl.edu	37	11	120833249	120833249	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr11:120833249G>A	ENST00000527524.2	+	18	2412	c.2125G>A	c.(2125-2127)Gga>Aga	p.G709R	GRIK4_ENST00000438375.2_Missense_Mutation_p.G709R	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	709					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CACAGAGGAGGGAATCGCCAG	0.512																																						dbGAP											0			11											85.0	76.0	79.0					11																	120833249		2203	4299	6502	120338459	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2125G>A	11.37:g.120833249G>A	ENSP00000435648:p.Gly709Arg	56	0.00	0		1	0.00	0	120338459	44	29.03	18	A8K9L1	Missense_Mutation	SNP	HMMPfam_Lig_chan,HMMSmart_PBPe,HMMPfam_ANF_receptor,HMMPfam_Lig_chan-Glu_bd,superfamily_SSF53822,superfamily_SSF53850	p.G709R	ENST00000527524.2	37	c.2125	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.395251	0.96009	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.13089	2.62;2.62	5.69	5.69	0.88448	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65487	-0.6156	10	0.87932	D	0	.	19.3996	0.94623	0.0:0.0:1.0:0.0	.	709;709	A6H8K8;Q16099	.;GRIK4_HUMAN	R	709	ENSP00000435648:G709R;ENSP00000404063:G709R	ENSP00000404063:G709R	G	+	1	0	GRIK4	120338459	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.869000	0.99810	2.676000	0.91093	0.655000	0.94253	GGA	-	HMMPfam_Lig_chan,HMMSmart_PBPe,superfamily_SSF53850		0.512	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	protein_coding	OTTHUMT00000109760.4	G	NM_014619		120338459	+1	no_errors	NM_014619.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CFAP54	144535	genome.wustl.edu	37	12	97150340	97150340	+	Splice_Site	SNP	G	G	A			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr12:97150340G>A	ENST00000524981.4	+	57	7968	c.7945G>A	c.(7945-7947)Gga>Aga	p.G2649R				Q96N23	CL055_HUMAN		0								p.G1074*(1)									TCAAAACTCAGGGTAAAAAGA	0.388																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)	12											86.0	96.0	93.0					12																	97150340		2201	4299	6500	95674471	SO:0001630	splice_region_variant	0																														ENST00000524981.4:c.7946+1G>A	12.37:g.97150340G>A		227	5.31	13		NA	NA	NA	95674471	181	26.72	66		Missense_Mutation	SNP	NULL	p.G1074R	ENST00000524981.4	37	c.3220		12	.	.	.	.	.	.	.	.	.	.	G	16.05	3.011683	0.54468	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.4	4.51	0.55191	.	0.307999	0.27976	N	0.017088	T	0.56834	0.2012	M	0.62723	1.935	0.33493	D	0.588895	B	0.27498	0.18	B	0.31442	0.13	T	0.69060	-0.5245	9	0.72032	D	0.01	-6.553	12.5518	0.56231	0.0772:0.0:0.9228:0.0	.	1074	Q6ZTY8	CL063_HUMAN	R	2649;1074	.	ENSP00000345466:G1074R	G	+	1	0	C12orf63	95674471	1.000000	0.71417	0.911000	0.35937	0.351000	0.29236	3.212000	0.51145	1.427000	0.47276	0.650000	0.86243	GGA	-	NULL		0.388	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf63	protein_coding	OTTHUMT00000395046.4	G		Missense_Mutation	95674471	+1	no_errors	NM_198520.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
IGHG3	3502	genome.wustl.edu	37	14	106234188	106234188	+	RNA	SNP	A	A	G			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr14:106234188A>G	ENST00000390551.2	-	0	1268							P01860	IGHG3_HUMAN	immunoglobulin heavy constant gamma 3 (G3m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										CACACGCTTAACAGGAAGAGT	0.592																																						dbGAP											0			14											23.0	16.0	18.0					14																	106234188		2026	4106	6132	105305233			0			M12958		14q32.33	2012-10-02			ENSG00000211897	ENSG00000211897		"""Immunoglobulins / IGH locus"""	5527	other	immunoglobulin gene		147120				6808505	Standard	NG_001019		Approved			P01860	OTTHUMG00000152539		14.37:g.106234188A>G		41	0.00	0		0	100.00	1	105305233	54	14.29	9	A2NU35	Silent	SNP	PatternScan_IG_MHC,HMMPfam_C1-set,HMMSmart_SM00407,superfamily_Immunoglobulin	p.C406	ENST00000390551.2	37	c.1218		14																																																																																			-	NULL		0.592	IGHG3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG3	IG_C_gene	OTTHUMT00000326654.1	A	NG_001019		105305233	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390550	ensembl	human	known	54_36p	silent	SNP	1.000	G
SLTM	79811	genome.wustl.edu	37	15	59179602	59179602	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr15:59179602A>G	ENST00000380516.2	-	18	2600	c.2513T>C	c.(2512-2514)cTt>cCt	p.L838P	SLTM_ENST00000536328.1_Missense_Mutation_p.L407P|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	838	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TGATTCTCTAAGTTCATTTCT	0.473																																						dbGAP											0			15											257.0	224.0	235.0					15																	59179602		2192	4292	6484	56966894	SO:0001583	missense	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2513T>C	15.37:g.59179602A>G	ENSP00000369887:p.Leu838Pro	250	3.08	8		125	39.61	82	56966894	234	32.76	114	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_RRM,HMMPfam_SAP,HMMSmart_SAP,superfamily_SSF54928,superfamily_SSF68906	p.L838P	ENST00000380516.2	37	c.2513	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117018	0.77323	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.13420	2.59	5.68	5.68	0.88126	.	0.000000	0.49916	D	0.000125	T	0.20700	0.0498	L	0.50333	1.59	0.80722	D	1	P;B	0.44044	0.825;0.2	P;B	0.46479	0.518;0.128	T	0.00717	-1.1596	10	0.35671	T	0.21	.	15.9384	0.79734	1.0:0.0:0.0:0.0	.	838;407	Q9NWH9;A8K5V8	SLTM_HUMAN;.	P	838;404;407	ENSP00000369887:L838P	ENSP00000369887:L838P	L	-	2	0	SLTM	56966894	1.000000	0.71417	0.997000	0.53966	0.919000	0.55068	6.375000	0.73137	2.159000	0.67721	0.460000	0.39030	CTT	-	NULL		0.473	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	protein_coding	OTTHUMT00000157124.1	A	NM_024755		56966894	-1	no_errors	NM_024755.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
CACNG4	27092	genome.wustl.edu	37	17	65026862	65026862	+	Silent	SNP	C	C	T			TCGA-AB-2858-03D-01W-0755-09	TCGA-AB-2858-12A-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	b9dcb0aa-0098-49a9-a0c8-790a06dadea8	d964bbe3-75e8-47d6-a495-505ff49b9f2b	g.chr17:65026862C>T	ENST00000262138.3	+	4	728	c.726C>T	c.(724-726)cgC>cgT	p.R242R	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	242					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GGCGACGGCGCTCGAGGTCCA	0.587																																						dbGAP											0			17											64.0	67.0	66.0					17																	65026862		2203	4300	6503	62457324	SO:0001819	synonymous_variant	0			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.726C>T	17.37:g.65026862C>T		244	2.76	7		NA	NA	NA	62457324	206	29.93	88	B2RCK0	Silent	SNP	HMMPfam_PMP22_Claudin,PatternScan_CLAUDIN	p.R242	ENST00000262138.3	37	c.726	CCDS11667.1	17																																																																																			-	NULL		0.587	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	protein_coding	OTTHUMT00000447036.1	C	NM_014405		62457324	+1	no_errors	NM_014405.2	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
