#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	T	T	T	C	T	T	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								7655	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		4863	0.87	43		NA	NA	NA	7655	1793	29.13	746		Silent	SNP	PatternScan_COX2,HMMPfam_COX2,superfamily_Cupredoxins,HMMPfam_COX2_TM,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^II-like^^_^^transmembrane^^_^^region	p.F23		37	c.69		MT																																																																																			-	HMMPfam_COX2_TM,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^II-like^^_^^transmembrane^^_^^region	0	0					MT-CO2			T			7655	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	silent	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	T	T	T	C	T	T	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								9968	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		7147	1.97	145		NA	NA	NA	9968	1641	61.67	2713		Missense_Mutation	SNP	HMMPfam_COX3,superfamily_CytC_oxdse_III	p.V254A		37	c.761		MT																																																																																			-	HMMPfam_COX3,superfamily_CytC_oxdse_III	0	0					MT-CO3			T			9968	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000362079	ensembl	human	known	54_36p	missense	SNP	NULL	C
FAM47A	158724	genome.wustl.edu	37	X	34150073	34150073	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chrX:34150073G>A	ENST00000346193.3	-	1	374	c.323C>T	c.(322-324)tCt>tTt	p.S108F		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	108										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTGGGCTGGAGAGAGCTTGGA	0.527																																						dbGAP											0			X											89.0	87.0	87.0					X																	34150073		2202	4300	6502	34059994	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.323C>T	X.37:g.34150073G>A	ENSP00000345029:p.Ser108Phe	41	0.00	0		NA	NA	NA	34059994	10	91.47	118	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.S108F	ENST00000346193.3	37	c.323	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594423	0.28445	.	.	ENSG00000185448	ENST00000346193	T	0.20200	2.09	1.1	1.1	0.20463	.	.	.	.	.	T	0.40522	0.1120	M	0.77820	2.39	0.09310	N	1	D	0.71674	0.998	D	0.69824	0.966	T	0.10706	-1.0618	9	0.87932	D	0	.	5.2341	0.15437	0.0:0.0:1.0:0.0	.	108	Q5JRC9	FA47A_HUMAN	F	108	ENSP00000345029:S108F	ENSP00000345029:S108F	S	-	2	0	FAM47A	34059994	0.244000	0.23889	0.015000	0.15790	0.013000	0.08279	1.298000	0.33412	0.842000	0.35045	0.499000	0.49734	TCT	-	NULL		0.527	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	G	NM_203408		34059994	-1	no_errors	NM_203408.2	genbank	human	predicted	54_36p	missense	SNP	0.038	A
GLOD5	392465	genome.wustl.edu	37	X	48634388	48634388	+	IGR	SNP	C	C	G			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chrX:48634388C>G	ENST00000303227.6	+	0	735				RNU6-29P_ENST00000384637.1_RNA	NM_001080489.2	NP_001073958.2	A6NK44	GLOD5_HUMAN	glyoxalase domain containing 5											endometrium(1)|lung(2)	3						GAGTGGGTCACAGTGAGCTCA	0.502																																						dbGAP											0			X																																								48519332	SO:0001628	intergenic_variant	0				CCDS55410.1	Xp11.23	2008-02-05			ENSG00000171433	ENSG00000171433			33358	protein-coding gene	gene with protein product							Standard	NM_001080489		Approved		uc011mmh.2	A6NK44	OTTHUMG00000024125		X.37:g.48634388C>G		98	5.71	6		5	50.00	5	48519332	5	95.98	191		RNA	SNP	-	NULL	ENST00000303227.6	37	NULL	CCDS55410.1	X																																																																																			-	-		0.502	GLOD5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC648603	protein_coding		C	NM_001080489		48519332	-1	pseudogene	XR_038238.1	genbank	human	model	54_36p	rna	SNP	0.000	G
CIART	148523	genome.wustl.edu	37	1	150255858	150255858	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr1:150255858C>A	ENST00000290363.5	+	1	630	c.181C>A	c.(181-183)Cct>Act	p.P61T	C1orf51_ENST00000469255.1_3'UTR|C1orf51_ENST00000369094.1_Intron|C1orf51_ENST00000369095.1_Missense_Mutation_p.P61T	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		61					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGCCCGGGTCCTATCCGCTG	0.617																																						dbGAP											0			1											123.0	124.0	123.0					1																	150255858		2203	4300	6503	148522482	SO:0001583	missense	0																														ENST00000290363.5:c.181C>A	1.37:g.150255858C>A	ENSP00000290363:p.Pro61Thr	283	1.05	3		NA	NA	NA	148522482	334	44.37	268	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	NULL	p.P61T	ENST00000290363.5	37	c.181	CCDS949.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036421	0.75617	.	.	ENSG00000159208	ENST00000369095;ENST00000290363	.	.	.	4.7	4.7	0.59300	.	0.363163	0.22962	N	0.053529	T	0.64382	0.2593	L	0.60455	1.87	0.38203	D	0.94025	D	0.89917	1.0	D	0.87578	0.998	T	0.65216	-0.6222	9	0.46703	T	0.11	-4.2309	13.0265	0.58819	0.0:1.0:0.0:0.0	.	61	Q8N365	CA051_HUMAN	T	61	.	ENSP00000290363:P61T	P	+	1	0	C1orf51	148522482	0.999000	0.42202	0.995000	0.50966	0.995000	0.86356	3.235000	0.51328	2.437000	0.82529	0.655000	0.94253	CCT	-	NULL		0.617	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1orf51	protein_coding	OTTHUMT00000035058.1	C			148522482	+1	no_errors	NM_144697.2	genbank	human	predicted	54_36p	missense	SNP	0.959	A
MAEL	84944	genome.wustl.edu	37	1	166962013	166962013	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr1:166962013T>C	ENST00000367872.4	+	4	660	c.416T>C	c.(415-417)aTt>aCt	p.I139T	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Missense_Mutation_p.I108T	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	139					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						CCTTGTGAAATTGGCTGTGTT	0.383																																						dbGAP											0			1											115.0	114.0	115.0					1																	166962013		2203	4300	6503	165228637	SO:0001583	missense	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.416T>C	1.37:g.166962013T>C	ENSP00000356846:p.Ile139Thr	94	3.09	3		0	100.00	3	165228637	111	51.45	124	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	superfamily_HMG-box,HMMPfam_DUF1898	p.I139T	ENST00000367872.4	37	c.416	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.594329	0.66219	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.56611	0.53;0.45;0.53	5.65	4.51	0.55191	Domain of unknown function DUF1898 (1);	0.000000	0.64402	D	0.000002	T	0.50086	0.1595	L	0.29908	0.895	0.47547	D	0.999455	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.57423	-0.7814	10	0.87932	D	0	.	11.0707	0.48002	0.0:0.0756:0.0:0.9244	.	108;139	E9JVC3;Q96JY0	.;MAEL_HUMAN	T	139;108;108	ENSP00000356846:I139T;ENSP00000356844:I108T;ENSP00000402143:I108T	ENSP00000356844:I108T	I	+	2	0	MAEL	165228637	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.770000	0.55310	2.150000	0.67090	0.383000	0.25322	ATT	-	HMMPfam_DUF1898		0.383	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	protein_coding	OTTHUMT00000083239.1	T	NM_032858		165228637	+1	no_errors	NM_032858.1	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC16A14	151473	genome.wustl.edu	37	2	230910902	230910902	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr2:230910902G>A	ENST00000295190.4	-	4	1398	c.940C>T	c.(940-942)Cga>Tga	p.R314*		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.R314*(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		ACAAACATTCGATTTGTAAAT	0.453																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)	2											51.0	51.0	51.0					2																	230910902		2203	4300	6503	230619146	SO:0001587	stop_gained	0			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.940C>T	2.37:g.230910902G>A	ENSP00000295190:p.Arg314*	135	2.16	3		11	38.89	7	230619146	116	36.41	67	A8KA08|Q53R92|Q96NI7	Nonsense_Mutation	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.R314*	ENST00000295190.4	37	c.940	CCDS2473.1	2	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919851	0.73098	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	.	.	.	4.77	2.85	0.33270	.	0.108145	0.40144	N	0.001161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4538	0.55691	0.0:0.0:0.4596:0.5404	.	.	.	.	X	314	.	ENSP00000295190:R314X	R	-	1	2	SLC16A14	230619146	0.658000	0.27402	0.012000	0.15200	0.399000	0.30720	1.944000	0.40263	1.198000	0.43158	0.511000	0.50034	CGA	-	HMMPfam_MFS_1,superfamily_MFS general substrate transporter		0.453	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A14	protein_coding	OTTHUMT00000256918.2	G	NM_152527		230619146	-1	no_errors	NM_152527.3	genbank	human	provisional	54_36p	nonsense	SNP	0.701	A
SLC6A20	54716	genome.wustl.edu	37	3	45823629	45823629	+	Missense_Mutation	SNP	G	G	A	rs141312000		TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr3:45823629G>A	ENST00000358525.4	-	2	323	c.208C>T	c.(208-210)Cgg>Tgg	p.R70W	SLC6A20_ENST00000353278.4_Missense_Mutation_p.R70W|SLC6A20_ENST00000456124.2_Missense_Mutation_p.R70W	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	70					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		CTGCCCTGCCGCATGCGCTGC	0.632																																						dbGAP											0			3							TRP/ARG,TRP/ARG	0,4406		0,0,2203	76.0	56.0	63.0		208,208	5.4	1.0	3	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC6A20	NM_020208.3,NM_022405.3	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	70/593,70/556	45823629	1,13005	2203	4300	6503	45798633	SO:0001583	missense	0			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.208C>T	3.37:g.45823629G>A	ENSP00000346298:p.Arg70Trp	92	2.11	2		NA	NA	NA	45798633	90	43.03	71	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Missense_Mutation	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2	p.R70W	ENST00000358525.4	37	c.208	CCDS43077.1	3	.	.	.	.	.	.	.	.	.	.	g	24.0	4.485032	0.84854	0.0	1.16E-4	ENSG00000163817	ENST00000353278;ENST00000358525;ENST00000456124	T;T;T	0.78126	-1.15;-1.15;-1.15	5.39	5.39	0.77823	.	0.069273	0.56097	D	0.000024	D	0.91818	0.7411	H	0.94503	3.545	0.43994	D	0.99669	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93815	0.7113	10	0.87932	D	0	.	19.1813	0.93625	0.0:0.0:1.0:0.0	.	70;70	Q9NP91-2;Q9NP91	.;S6A20_HUMAN	W	70	ENSP00000296133:R70W;ENSP00000346298:R70W;ENSP00000404310:R70W	ENSP00000296133:R70W	R	-	1	2	SLC6A20	45798633	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.518000	0.53451	2.545000	0.85829	0.550000	0.68814	CGG	-	HMMPfam_SNF		0.632	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A20	protein_coding	OTTHUMT00000257318.3	G	NM_020208		45798633	-1	no_errors	NM_020208.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164733754	164733754	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr3:164733754A>G	ENST00000264382.3	-	32	3936	c.3874T>C	c.(3874-3876)Tac>Cac	p.Y1292H		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1292	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATAATAATGTATCTCATTCCT	0.393										HNSCC(35;0.089)																												dbGAP											0			3											163.0	171.0	168.0					3																	164733754		2203	4300	6503	166216448	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3874T>C	3.37:g.164733754A>G	ENSP00000264382:p.Tyr1292His	80	1.23	1		NA	NA	NA	166216448	100	43.58	78	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_31,PatternScan_GLYCOSYL_HYDROL_F31_1,PatternScan_GLYCOSYL_HYDROL_F31_2,HMMPfam_Trefoil,HMMSmart_SM00018,superfamily_Trefoil,superfamily_(Trans)glycosidases,PatternScan_P_TREFOIL	p.Y1292H	ENST00000264382.3	37	c.3874	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	17.34	3.365356	0.61513	.	.	ENSG00000090402	ENST00000264382	D	0.92965	-3.14	5.06	2.44	0.29823	Glycoside hydrolase, superfamily (1);	0.124148	0.53938	D	0.000055	D	0.96128	0.8738	H	0.95328	3.655	0.27325	N	0.956934	D	0.60575	0.988	D	0.66196	0.942	D	0.90007	0.4118	10	0.87932	D	0	.	6.5309	0.22326	0.5895:0.1405:0.0:0.27	.	1292	P14410	SUIS_HUMAN	H	1292	ENSP00000264382:Y1292H	ENSP00000264382:Y1292H	Y	-	1	0	SI	166216448	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.347000	0.65998	0.892000	0.36259	0.482000	0.46254	TAC	-	HMMPfam_Glyco_hydro_31,superfamily_(Trans)glycosidases		0.393	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	protein_coding	OTTHUMT00000350116.1	A	NM_001041		166216448	-1	no_errors	NM_001041.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
LNX1	84708	genome.wustl.edu	37	4	54364820	54364820	+	Silent	SNP	G	G	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr4:54364820G>A	ENST00000263925.7	-	5	1280	c.966C>T	c.(964-966)gaC>gaT	p.D322D	FIP1L1_ENST00000507166.1_Intron|LNX1_ENST00000306888.2_Silent_p.D226D|LNX1-AS1_ENST00000502373.1_RNA|LNX1-AS1_ENST00000510785.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	322	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TTAGAATGATGTCTCCTGGCA	0.493																																						dbGAP											0			4											57.0	54.0	55.0					4																	54364820		2203	4300	6503	54059577	SO:0001819	synonymous_variant	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.966C>T	4.37:g.54364820G>A		200	2.44	5		NA	NA	NA	54059577	187	42.86	144	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ	p.D226	ENST00000263925.7	37	c.678	CCDS47057.1	4																																																																																			-	HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ		0.493	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	protein_coding	OTTHUMT00000219934.2	G			54059577	-1	no_errors	NM_032622.1	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
KIT	3815	genome.wustl.edu	37	4	55599321	55599321	+	Missense_Mutation	SNP	A	A	T	rs121913507		TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr4:55599321A>T	ENST00000288135.5	+	17	2544	c.2447A>T	c.(2446-2448)gAc>gTc	p.D816V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816V(758)|p.D816F(6)|p.D816I(2)|p.D816G(2)|p.D816>VVA(1)|p.D816A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTAGCCAGAGACATCAAGAAT	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													dbGAP	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	770	Substitution - Missense(769)|Complex - insertion inframe(1)	haematopoietic_and_lymphoid_tissue(745)|testis(16)|ovary(5)|skin(2)|soft_tissue(1)|genital_tract(1)	4	GRCh37	CM952169	KIT	M	rs121913507						145.0	146.0	145.0					4																	55599321		2203	4300	6503	55294078	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2447A>T	4.37:g.55599321A>T	ENSP00000288135:p.Asp816Val	65	0.00	0		731	50.54	747	55294078	57	55.12	70	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,HMMSmart_IGc2,HMMSmart_IG,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.D816V	ENST00000288135.5	37	c.2447	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831107	0.91036	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83591	-1.74;-1.74	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.85093	0.5618	N	0.21097	0.63	0.80722	A	1	D;D	0.71674	0.998;0.991	D;D	0.68943	0.961;0.933	D	0.88419	0.3027	9	0.87932	D	0	.	15.8126	0.78576	1.0:0.0:0.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	V	816;812	ENSP00000288135:D816V;ENSP00000390987:D812V	ENSP00000288135:D816V	D	+	2	0	KIT	55294078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.181000	0.94874	2.148000	0.66965	0.477000	0.44152	GAC	-	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,superfamily_Kinase_like		0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	A			55294078	+1	no_errors	NM_000222.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PRSS35	167681	genome.wustl.edu	37	6	84234378	84234378	+	Silent	SNP	C	C	T	rs370535612		TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr6:84234378C>T	ENST00000369700.3	+	2	1395	c.1218C>T	c.(1216-1218)aaC>aaT	p.N406N	PRSS35_ENST00000536636.1_Silent_p.N406N	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	406	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TTCACGGGAACGATGCCAATT	0.498																																						dbGAP											0			6						C	,	0,4406		0,0,2203	57.0	40.0	46.0		1218,1218	0.3	0.0	6		46	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PRSS35	NM_001170423.1,NM_153362.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	406/414,406/414	84234378	1,13005	2203	4300	6503	84291097	SO:0001819	synonymous_variant	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.1218C>T	6.37:g.84234378C>T		90	1.10	1		NA	NA	NA	84291097	154	45.07	128	A8K7B3|Q9BQP6	Silent	SNP	HMMPfam_Trypsin,HMMSmart_Tryp_SPc,superfamily_Pept_Ser_Cys,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.N406	ENST00000369700.3	37	c.1218	CCDS4999.1	6																																																																																			-	NULL		0.498	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	protein_coding	OTTHUMT00000041352.1	C	NM_153362		84291097	+1	no_errors	NM_153362.1	genbank	human	provisional	54_36p	silent	SNP	1.000	T
SCIN	85477	genome.wustl.edu	37	7	12644246	12644246	+	Silent	SNP	A	A	C			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr7:12644246A>C	ENST00000297029.5	+	4	725	c.624A>C	c.(622-624)ctA>ctC	p.L208L	SCIN_ENST00000519209.1_5'UTR|SCIN_ENST00000445618.2_5'UTR	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	208	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GGTCTGAACTAATTGTCGTGG	0.438																																						dbGAP											0			7											290.0	248.0	260.0					7																	12644246		692	1591	2283	12610771	SO:0001819	synonymous_variant	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.624A>C	7.37:g.12644246A>C		94	0.00	0		0	100.00	1	12610771	158	43.75	126	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Silent	SNP	HMMSmart_SM00262,HMMPfam_Gelsolin,superfamily_Actin depolymerizing proteins,superfamily_C-terminal gelsolin-like domain of Sec23/24	p.L208	ENST00000297029.5	37	c.624	CCDS47545.1	7																																																																																			-	HMMSmart_SM00262,HMMPfam_Gelsolin,superfamily_Actin depolymerizing proteins		0.438	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	protein_coding	OTTHUMT00000326041.1	A	NM_033128		12610771	+1	no_errors	ENST00000297029	ensembl	human	known	54_36p	silent	SNP	0.066	C
GALNT18	374378	genome.wustl.edu	37	11	11398886	11398886	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr11:11398886G>A	ENST00000227756.4	-	5	1231	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	274					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GAGATGATCCGCTTCCGGTTC	0.527																																						dbGAP											0			11											75.0	67.0	69.0					11																	11398886		2201	4294	6495	11355462	SO:0001583	missense	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.820C>T	11.37:g.11398886G>A	ENSP00000227756:p.Arg274Trp	96	1.03	1		NA	NA	NA	11355462	178	45.81	153	O95903|Q8NDY9	Missense_Mutation	SNP	HMMPfam_Ricin_B_lectin,HMMSmart_SM00458,HMMPfam_Glycos_transf_2,superfamily_Ricin B-like lectins,superfamily_Nucleotide-diphospho-sugar transferases	p.R274W	ENST00000227756.4	37	c.820	CCDS7807.1	11	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787550	0.70337	.	.	ENSG00000110328	ENST00000227756	T	0.59224	0.28	5.52	3.45	0.39498	Glycosyl transferase, family 2 (1);	0.162750	0.39615	N	0.001315	T	0.79353	0.4431	M	0.91612	3.225	0.45161	D	0.998176	D	0.89917	1.0	D	0.78314	0.991	D	0.84052	0.0370	10	0.72032	D	0.01	.	14.1028	0.65068	0.0:0.0:0.7858:0.2142	.	274	Q6P9A2	GLTL4_HUMAN	W	274	ENSP00000227756:R274W	ENSP00000227756:R274W	R	-	1	2	GALNTL4	11355462	1.000000	0.71417	0.984000	0.44739	0.991000	0.79684	3.369000	0.52365	2.589000	0.87451	0.655000	0.94253	CGG	-	HMMPfam_Glycos_transf_2,superfamily_Nucleotide-diphospho-sugar transferases		0.527	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL4	protein_coding	OTTHUMT00000385848.1	G	NM_198516		11355462	-1	no_errors	NM_198516.2	genbank	human	validated	54_36p	missense	SNP	0.981	A
KIAA1549L	25758	genome.wustl.edu	37	11	33572721	33572721	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr11:33572721C>A	ENST00000321505.4	+	4	2926	c.2746C>A	c.(2746-2748)Caa>Aaa	p.Q916K	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.Q922K|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.Q922K			Q6ZVL6	K154L_HUMAN	KIAA1549-like	916						integral component of membrane (GO:0016021)											AGACCTGAAGCAACACACCCC	0.512																																						dbGAP											0			11											147.0	148.0	148.0					11																	33572721		2172	4268	6440	33529297	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2746C>A	11.37:g.33572721C>A	ENSP00000315295:p.Gln916Lys	178	4.23	8		NA	NA	NA	33529297	92	49.46	91	B0QYU0	Missense_Mutation	SNP	NULL	p.Q922K	ENST00000321505.4	37	c.2764	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.99|16.99	3.274890|3.274890	0.59649|0.59649	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.113706|.	0.64402|.	D|.	0.000007|.	T|T	0.57902|0.57902	0.2085|0.2085	L|L	0.29908|0.29908	0.895|0.895	0.35603|0.35603	D|D	0.808008|0.808008	P;D|.	0.56968|.	0.524;0.978|.	B;P|.	0.52881|.	0.138;0.712|.	T|T	0.59685|0.59685	-0.7408|-0.7408	9|5	0.59425|.	D|.	0.04|.	-12.3169|-12.3169	18.3939|18.3939	0.90492|0.90492	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	922;922|.	E9PAT2;Q6ZVL6-2|.	.;.|.	K|R	916;922;922;755|313	.|.	ENSP00000265654:Q922K|.	Q|S	+|+	1|3	0|2	C11orf41|C11orf41	33529297|33529297	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.705000|0.705000	0.40729|0.40729	4.196000|4.196000	0.58407|0.58407	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CAA|AGC	-	NULL		0.512	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf41	protein_coding	OTTHUMT00000317998.1	C	NM_012194		33529297	+1	no_errors	NM_012194.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
LMNTD1	160492	genome.wustl.edu	37	12	25756271	25756271	+	Intron	SNP	G	G	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr12:25756271G>A	ENST00000445693.1	-	1	61					NM_001145727.2	NP_001139199.1	Q8N9Z9	LMTD1_HUMAN							cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					tgcccaggccggagcacagtc	0.368																																						dbGAP											0			12																																								25647538	SO:0001627	intron_variant	0																														ENST00000445693.1:c.58+45156C>T	12.37:g.25756271G>A		156	4.27	7		NA	NA	NA	25647538	134	43.72	108	B4DL27|B4DY70|Q8IY38	RNA	SNP	-	NULL	ENST00000445693.1	37	NULL	CCDS44847.1	12																																																																																			-	-		0.368	IFLTD1-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ENSG00000209624	protein_coding	OTTHUMT00000402280.1	G			25647538	-1	pseudogene	ENST00000386889	ensembl	human	novel	54_36p	rna	SNP	0.013	A
KMT2D	8085	genome.wustl.edu	37	12	49425367	49425367	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr12:49425367A>T	ENST00000301067.7	-	39	13120	c.13121T>A	c.(13120-13122)cTg>cAg	p.L4374Q		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4374					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCAAGGTCCCAGACCCTTGCT	0.612																																						dbGAP											0			12											16.0	16.0	16.0					12																	49425367		1909	4129	6038	47711634	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.13121T>A	12.37:g.49425367A>T	ENSP00000301067:p.Leu4374Gln	25	3.85	1		66	53.19	75	47711634	49	48.96	47	O14687	Missense_Mutation	SNP	HMMPfam_HMG_box,HMMSmart_SM00398,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00184,HMMSmart_SM00249,HMMSmart_SM00508,HMMPfam_FYRN,HMMPfam_FYRC,PatternScan_RECOMBINASES_2,superfamily_HMG-box,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00542,HMMSmart_SM00541,PatternScan_ZF_PHD_1,HMMPfam_PHD,superfamily_SET domain	p.L4374Q	ENST00000301067.7	37	c.13121	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	A	7.995	0.754229	0.15778	.	.	ENSG00000167548	ENST00000301067	T	0.79454	-1.27	5.17	5.17	0.71159	.	0.317981	0.17590	N	0.168797	T	0.61286	0.2335	N	0.14661	0.345	0.22531	N	0.999013	P	0.36733	0.567	B	0.34180	0.177	T	0.60010	-0.7346	10	0.87932	D	0	.	10.0113	0.41988	0.8488:0.0:0.0:0.1512	.	4374	O14686	MLL2_HUMAN	Q	4374	ENSP00000301067:L4374Q	ENSP00000301067:L4374Q	L	-	2	0	MLL2	47711634	0.125000	0.22332	0.888000	0.34837	0.943000	0.58893	1.095000	0.30964	2.254000	0.74563	0.533000	0.62120	CTG	-	NULL		0.612	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	protein_coding	OTTHUMT00000390183.2	A			47711634	-1	no_errors	NM_003482.3	genbank	human	validated	54_36p	missense	SNP	0.599	T
KRT77	374454	genome.wustl.edu	37	12	53097123	53097123	+	Silent	SNP	C	C	T			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr12:53097123C>T	ENST00000341809.3	-	1	124	c.96G>A	c.(94-96)ccG>ccA	p.P32P	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	32	Head.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AACCCACTGCCGGACTCCCAC	0.537																																						dbGAP											0			12											82.0	88.0	86.0					12																	53097123		2203	4300	6503	51383390	SO:0001819	synonymous_variant	0			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.96G>A	12.37:g.53097123C>T		179	2.17	4		NA	NA	NA	51383390	105	41.34	74	Q7RTS8	Silent	SNP	HMMPfam_Filament,PatternScan_IF	p.P32	ENST00000341809.3	37	c.96	CCDS8837.1	12																																																																																			-	NULL		0.537	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	protein_coding	OTTHUMT00000404111.1	C	NM_175078		51383390	-1	no_errors	NM_175078.2	genbank	human	validated	54_36p	silent	SNP	0.000	T
HELZ	9931	genome.wustl.edu	37	17	65074476	65074476	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr17:65074476C>A	ENST00000358691.5	-	33	5887	c.5721G>T	c.(5719-5721)agG>agT	p.R1907S	HELZ_ENST00000580168.1_Missense_Mutation_p.R1908S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1907						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CAGGAGGGGGCCTGGGCTTTG	0.612																																						dbGAP											0			17											45.0	49.0	48.0					17																	65074476		1873	4092	5965	62504938	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5721G>T	17.37:g.65074476C>A	ENSP00000351524:p.Arg1907Ser	23	4.00	1		15	62.79	27	62504938	36	54.32	44	I6L9H4	Missense_Mutation	SNP	HMMPfam_zf-CCCH,HMMSmart_ZnF_C3H1,HMMPfam_PAM2,superfamily_SSF52540,superfamily_SSF90229	p.R1907S	ENST00000358691.5	37	c.5721	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	C	8.944	0.966576	0.18659	.	.	ENSG00000198265	ENST00000358691	D	0.87179	-2.22	5.46	3.03	0.35002	.	0.092329	0.64402	D	0.000001	T	0.74458	0.3719	N	0.19112	0.55	0.37003	D	0.895365	B;B	0.32573	0.376;0.376	B;B	0.26770	0.073;0.073	T	0.76639	-0.2885	10	0.87932	D	0	-15.2159	8.1526	0.31150	0.0:0.6755:0.0:0.3245	.	1908;1907	B7ZLW2;P42694	.;HELZ_HUMAN	S	1907	ENSP00000351524:R1907S	ENSP00000351524:R1907S	R	-	3	2	HELZ	62504938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.930000	0.28858	1.200000	0.43188	0.655000	0.94253	AGG	-	NULL		0.612	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	protein_coding	OTTHUMT00000447068.1	C	NM_014877		62504938	-1	no_errors	NM_014877.3	genbank	human	validated	54_36p	missense	SNP	0.998	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	TG	TG	-			TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	TG	TG	TG	-	TG	TG	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chrUnknown:0delTG								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			13																																								27543085	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delTG		0	0.00	0		0	0.00	0	27543084	0	0.00	0		Frame_Shift_Del	DEL	NULL	p.T347fs		37	c.1040_1039		13																																																																																			-	NULL	0	0					LOC100133684			TG			27543085	-1	no_start_codon:pseudogene:no_stop_codon	XM_001716774.1	genbank	human	model	54_36p	frame_shift_del	DEL	0.000:0.000	-
IL32	9235	genome.wustl.edu	37	16	3119297	3119298	+	Frame_Shift_Ins	INS	-	-	G	rs71818662|rs531600758	byFrequency	TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	-	-	-	G	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr16:3119297_3119298insG	ENST00000534507.1	+	6	857_858	c.646_647insG	c.(646-648)cggfs	p.R216fs	IL32_ENST00000008180.9_Frame_Shift_Ins_p.R150fs|IL32_ENST00000551122.1_Frame_Shift_Ins_p.R113fs|IL32_ENST00000529699.1_Frame_Shift_Ins_p.R150fs|IL32_ENST00000530538.2_Frame_Shift_Ins_p.R170fs|IL32_ENST00000552936.1_Frame_Shift_Ins_p.R194fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000548246.1_Frame_Shift_Ins_p.R130fs|IL32_ENST00000526464.2_Frame_Shift_Ins_p.R170fs|IL32_ENST00000528163.2_Frame_Shift_Ins_p.R170fs|IL32_ENST00000529550.1_Frame_Shift_Ins_p.R170fs|IL32_ENST00000551513.1_Frame_Shift_Ins_p.R207fs|IL32_ENST00000396890.2_Frame_Shift_Ins_p.R216fs|IL32_ENST00000533097.2_Frame_Shift_Ins_p.R170fs|IL32_ENST00000552356.1_Frame_Shift_Ins_p.R150fs|IL32_ENST00000548476.1_Frame_Shift_Ins_p.R216fs|IL32_ENST00000525643.2_Frame_Shift_Ins_p.R170fs|IL32_ENST00000325568.5_Frame_Shift_Ins_p.R170fs|IL32_ENST00000440815.3_Frame_Shift_Ins_p.R170fs|IL32_ENST00000444393.3_Frame_Shift_Ins_p.R170fs|IL32_ENST00000530890.1_Frame_Shift_Ins_p.R150fs|IL32_ENST00000548652.1_Frame_Shift_Ins_p.R161fs|IL32_ENST00000552664.1_Frame_Shift_Ins_p.R170fs|IL32_ENST00000396887.3_Frame_Shift_Ins_p.R113fs|IL32_ENST00000531965.1_Frame_Shift_Ins_p.R160fs|IL32_ENST00000549213.1_Frame_Shift_Ins_p.R113fs|IL32_ENST00000382213.3_Frame_Shift_Ins_p.R161fs			P24001	IL32_HUMAN	interleukin 32	216					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)		p.D172fs*12(3)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CGGAGCCCCACGGGGGGACAAG	0.579																																						dbGAP											3	Insertion - Frameshift(3)	urinary_tract(1)|breast(1)|pancreas(1)	16																																								3059299	SO:0001589	frameshift_variant	0			M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.652dupG	16.37:g.3119303_3119303dupG	ENSP00000431775:p.Arg216fs	9	0.00	0		25	0.00	0	3059298	15	40.00	10	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Ins	INS	NULL	p.D172fs	ENST00000534507.1	37	c.508_509		16																																																																																			-	NULL		0.579	IL32-002	KNOWN	basic	protein_coding	IL32	protein_coding	OTTHUMT00000394812.2	-	NM_004221		3059299	+1	no_errors	NM_001012631.1	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.001:0.001	G
ZNF175	7728	genome.wustl.edu	37	19	52094258	52094259	+	IGR	INS	-	-	CACCTG	rs113581628	byFrequency	TCGA-AB-2939-03A-01W-0745-08	TCGA-AB-2939-11A-01W-0745-08	-	-	-	CACCTG	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4cc29033-1f07-450a-8fd9-119918d41d31	ac036ed9-2075-47b8-b2bf-b7b235fdbf13	g.chr19:52094258_52094259insCACCTG	ENST00000262259.2	+	0	3742					NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175						defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		TTCCTAAGCATCACCTGGGGGG	0.564														1414	0.282348	0.0953	0.1614	5008	,	,		19275	0.5942		0.2217	False		,,,				2504	0.362					dbGAP											0			19																																								56786071	SO:0001628	intergenic_variant	0			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771		19.37:g.52094259_52094264dupCACCTG		NA	NA	NA		NA	NA	NA	56786070	NA	NA	NA	A8K9H2	In_Frame_Ins	INS	NULL	p.17in_frame_insHL	ENST00000262259.2	37	c.45_46	CCDS12837.1	19																																																																																			-	NULL		0.564	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132800	protein_coding	OTTHUMT00000396205.1	-	NM_007147		56786071	+1	no_errors	XM_001724852.1	genbank	human	model	54_36p	in_frame_ins	INS	0.099:0.155	CACCTG
