#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Invalid:failed_liftOver	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								7920	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		7626	4.72	378		NA	NA	NA	7920	3790	33.92	1965		Missense_Mutation	SNP	PatternScan_COX2,HMMPfam_COX2,superfamily_Cupredoxins,HMMPfam_COX2_TM,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^II-like^^_^^transmembrane^^_^^region	p.D112N		37	c.334		MT																																																																																			-	HMMPfam_COX2,superfamily_Cupredoxins	0	0					MT-CO2			G			7920	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	missense	SNP	NULL	A
FAM47A	158724	genome.wustl.edu	37	X	34150174	34150174	+	Silent	SNP	G	G	A	rs373597275		TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chrX:34150174G>A	ENST00000346193.3	-	1	273	c.222C>T	c.(220-222)gaC>gaT	p.D74D		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	74								p.D74D(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GTAAAAACTCGTCACGGCGAC	0.532																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|kidney(1)	X											91.0	86.0	88.0					X																	34150174		2202	4300	6502	34060095	SO:0001819	synonymous_variant	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.222C>T	X.37:g.34150174G>A		146	10.43	17		NA	NA	NA	34060095	40	46.05	35	A8K8I9|Q8TAA0	Silent	SNP	NULL	p.D74	ENST00000346193.3	37	c.222	CCDS43926.1	X																																																																																			-	NULL		0.532	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	G	NM_203408		34060095	-1	no_errors	NM_203408.2	genbank	human	predicted	54_36p	silent	SNP	0.004	A
KLHL4	56062	genome.wustl.edu	37	X	86773292	86773292	+	Silent	SNP	T	T	C			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chrX:86773292T>C	ENST00000373119.4	+	1	541	c.396T>C	c.(394-396)gaT>gaC	p.D132D	KLHL4_ENST00000373114.4_Silent_p.D132D	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	132						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TGATGGCTGATGACAATATAG	0.358																																						dbGAP											0			X											63.0	64.0	64.0					X																	86773292		2201	4297	6498	86659948	SO:0001819	synonymous_variant	0			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.396T>C	X.37:g.86773292T>C		112	7.44	9		NA	NA	NA	86659948	18	58.14	25	B2RTW2|Q9Y3J5	Silent	SNP	HMMSmart_SM00225,HMMPfam_Kelch_1,HMMSmart_SM00612,superfamily_Galactose oxidase central domain,superfamily_POZ domain,HMMPfam_BACK,HMMPfam_BTB	p.D132	ENST00000373119.4	37	c.396	CCDS14457.1	X																																																																																			-	NULL		0.358	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	protein_coding	OTTHUMT00000057413.1	T			86659948	+1	no_errors	NM_057162.4	genbank	human	reviewed	54_36p	silent	SNP	0.948	C
TAS1R1	80835	genome.wustl.edu	37	1	6636675	6636675	+	Silent	SNP	A	A	G	rs148266626	byFrequency	TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr1:6636675A>G	ENST00000333172.6	+	4	1654	c.1461A>G	c.(1459-1461)ggA>ggG	p.G487G	TAS1R1_ENST00000328191.4_Intron|TAS1R1_ENST00000351136.3_Silent_p.G233G	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	487					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGTGGCACGGAAAGGACAACC	0.532													A|||	2	0.000399361	0.0015	0.0	5008	,	,		22222	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			1						A	,	4,4402	8.1+/-20.4	0,4,2199	68.0	63.0	64.0		1461,699	0.9	0.0	1	dbSNP_134	64	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TAS1R1	NM_138697.3,NM_177540.2	,	0,4,6499	GG,GA,AA		0.0,0.0908,0.0308	,	487/842,233/588	6636675	4,13002	2203	4300	6503	6559262	SO:0001819	synonymous_variant	0				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1461A>G	1.37:g.6636675A>G		175	4.89	9		NA	NA	NA	6559262	31	43.86	25	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	HMMPfam_ANF_receptor,HMMPfam_NCD3G,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_2,PatternScan_G_PROTEIN_RECEP_F3_3,superfamily_Periplasmic binding protein-like I	p.G487	ENST00000333172.6	37	c.1461	CCDS81.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	6.734	0.504213	0.12822	9.08E-4	0.0	ENSG00000173662	ENST00000415267	.	.	.	5.05	0.929	0.19449	.	.	.	.	.	T	0.31702	0.0805	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25082	-1.0142	4	.	.	.	.	7.0406	0.25019	0.6542:0.0:0.3458:0.0	.	.	.	.	G	159	.	.	E	+	2	0	TAS1R1	6559262	0.000000	0.05858	0.013000	0.15412	0.903000	0.53119	0.126000	0.15769	0.131000	0.18576	0.482000	0.46254	GAA	-	superfamily_Periplasmic binding protein-like I		0.532	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R1	protein_coding	OTTHUMT00000004211.1	A			6559262	+1	no_errors	NM_138697.2	genbank	human	reviewed	54_36p	silent	SNP	0.016	G
CHRNB2	1141	genome.wustl.edu	37	1	154543959	154543959	+	Silent	SNP	G	G	A	rs539974140		TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr1:154543959G>A	ENST00000368476.3	+	5	924	c.660G>A	c.(658-660)acG>acA	p.T220T		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	220					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ACGACTCTACGTACGTGGACA	0.587																																						dbGAP											0			1											281.0	214.0	237.0					1																	154543959		2203	4300	6503	152810583	SO:0001819	synonymous_variant	0			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.660G>A	1.37:g.154543959G>A		255	8.57	24		NA	NA	NA	152810583	17	48.57	17	Q9UEH9	Silent	SNP	HMMPfam_Neur_chan_memb,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_LBD,superfamily_Nicotinic receptor ligand binding domain-like,PatternScan_NEUROTR_ION_CHANNEL	p.T220	ENST00000368476.3	37	c.660	CCDS1070.1	1																																																																																			-	HMMPfam_Neur_chan_LBD,superfamily_Nicotinic receptor ligand binding domain-like		0.587	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB2	protein_coding	OTTHUMT00000090697.1	G	NM_000748		152810583	+1	no_errors	NM_000748.2	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
NBAS	51594	genome.wustl.edu	37	2	15415893	15415893	+	Silent	SNP	T	T	C			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr2:15415893T>C	ENST00000281513.5	-	44	5464	c.5439A>G	c.(5437-5439)gcA>gcG	p.A1813A	NBAS_ENST00000441750.1_Silent_p.A1693A	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1813					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CTGGCTCCAATGCTTCAAGAG	0.373																																						dbGAP											0			2											64.0	67.0	66.0					2																	15415893		2203	4300	6503	15333344	SO:0001819	synonymous_variant	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5439A>G	2.37:g.15415893T>C		242	6.56	17		28	37.78	17	15333344	67	39.29	44	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.A1813	ENST00000281513.5	37	c.5439	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	T	8.113	0.779170	0.16120	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.44	-10.9	0.00192	.	.	.	.	.	T	0.45935	0.1367	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56625	-0.7948	4	.	.	.	.	8.5174	0.33255	0.0707:0.2018:0.5285:0.199	.	.	.	.	R	861	.	.	H	-	2	0	NBAS	15333344	0.000000	0.05858	0.011000	0.14972	0.968000	0.65278	-2.190000	0.01247	-1.951000	0.01029	-0.290000	0.09829	CAT	-	NULL		0.373	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	T	NM_015909		15333344	-1	no_errors	NM_015909.2	genbank	human	validated	54_36p	silent	SNP	0.222	C
DNMT3A	1788	genome.wustl.edu	37	2	25457242	25457242	+	Missense_Mutation	SNP	C	C	T	rs147001633	byFrequency	TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr2:25457242C>T	ENST00000264709.3	-	23	2982	c.2645G>A	c.(2644-2646)cGc>cAc	p.R882H	DNMT3A_ENST00000380746.4_Missense_Mutation_p.R693H|DNMT3A_ENST00000402667.1_Missense_Mutation_p.R659H|DNMT3A_ENST00000321117.5_Missense_Mutation_p.R882H|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	882	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.		R -> C (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.|R -> H (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.|R -> P (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.		C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.R882H(209)|p.R882P(5)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCGCCAAGCGGCTCATGTT	0.592			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	214	Substitution - Missense(214)	haematopoietic_and_lymphoid_tissue(214)	2						C	HIS/ARG,HIS/ARG,HIS/ARG	4,4402	6.2+/-15.9	0,4,2199	56.0	51.0	53.0		2645,2078,2645	5.7	1.0	2	dbSNP_134	53	5,8595	3.0+/-9.4	0,5,4295	yes	missense,missense,missense	DNMT3A	NM_022552.3,NM_153759.2,NM_175629.1	29,29,29	0,9,6494	TT,TC,CC		0.0581,0.0908,0.0692	possibly-damaging,possibly-damaging,possibly-damaging	882/913,693/724,882/913	25457242	9,12997	2203	4300	6503	25310746	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2645G>A	2.37:g.25457242C>T	ENSP00000264709:p.Arg882His	233	8.24	21		34	53.33	40	25310746	50	40.00	34	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	HMMPfam_PWWP,HMMSmart_SM00293,HMMPfam_DNA_methylase,superfamily_FYVE/PHD zinc finger,PatternScan_C5_MTASE_1,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,superfamily_Tudor/PWWP/MBT	p.R882H	ENST00000264709.3	37	c.2645	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380427	0.82682	9.08E-4	5.81E-4	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95843	0.8647	M	0.80982	2.52	0.80722	D	1	P;B	0.38922	0.651;0.11	B;B	0.23018	0.043;0.003	D	0.95939	0.8945	10	0.62326	D	0.03	-8.768	18.4404	0.90665	0.0:1.0:0.0:0.0	.	882;693	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	H	693;882;882;659	ENSP00000370122:R693H;ENSP00000324375:R882H;ENSP00000264709:R882H;ENSP00000384237:R659H	ENSP00000264709:R882H	R	-	2	0	DNMT3A	25310746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.698000	0.92095	0.561000	0.74099	CGC	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.592	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	C	NM_022552		25310746	-1	no_errors	NM_022552.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
COL7A1	1294	genome.wustl.edu	37	3	48608698	48608698	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr3:48608698G>A	ENST00000328333.8	-	92	7189	c.7082C>T	c.(7081-7083)gCt>gTt	p.A2361V	COL7A1_ENST00000454817.1_Missense_Mutation_p.A2329V	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2361	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGGTCCTGGAGCCCCTTTCTG	0.527																																						dbGAP											0			3											57.0	59.0	58.0					3																	48608698		2203	4300	6503	48583702	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7082C>T	3.37:g.48608698G>A	ENSP00000332371:p.Ala2361Val	276	6.44	19		NA	NA	NA	48583702	46	37.84	28	Q14054|Q16507	Missense_Mutation	SNP	HMMPfam_VWA,HMMSmart_SM00327,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1,superfamily_BPTI-like,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_vWA-like	p.A2361V	ENST00000328333.8	37	c.7082	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713332	0.48517	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.93712	-3.27;-3.27;-3.27	4.94	4.05	0.47172	.	0.000000	0.45126	D	0.000396	D	0.90611	0.7056	M	0.62209	1.925	0.34587	D	0.715044	P	0.34934	0.476	B	0.36378	0.223	D	0.90536	0.4499	10	0.18276	T	0.48	.	12.1763	0.54188	0.0859:0.0:0.9141:0.0	.	2361	Q02388	CO7A1_HUMAN	V	2361;2329;26	ENSP00000332371:A2361V;ENSP00000412569:A2329V;ENSP00000391608:A26V	ENSP00000332371:A2361V	A	-	2	0	COL7A1	48583702	0.060000	0.20803	1.000000	0.80357	0.992000	0.81027	1.486000	0.35530	2.439000	0.82584	0.655000	0.94253	GCT	-	HMMPfam_Collagen		0.527	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	G	NM_000094		48583702	-1	no_errors	NM_000094.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GATA2	2624	genome.wustl.edu	37	3	128202809	128202809	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr3:128202809G>T	ENST00000341105.2	-	4	1242	c.911C>A	c.(910-912)cCt>cAt	p.P304H	GATA2_ENST00000487848.1_Missense_Mutation_p.P304H|GATA2_ENST00000489987.1_5'Flank|GATA2_ENST00000430265.2_Missense_Mutation_p.P304H	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	304					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P304H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		CCGCCAGAGAGGGGTGGCTGT	0.632			Mis		AML(CML blast transformation)																																	dbGAP		Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	3											53.0	51.0	52.0					3																	128202809		2203	4300	6503	129685499	SO:0001583	missense	0			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.911C>A	3.37:g.128202809G>T	ENSP00000345681:p.Pro304His	82	3.53	3		6	66.67	12	129685499	12	36.84	7	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Missense_Mutation	SNP	HMMPfam_GATA,HMMSmart_ZnF_GATA,PatternScan_GATA_ZN_FINGER_1,superfamily_SSF57716	p.P304H	ENST00000341105.2	37	c.911	CCDS3049.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.176488	0.94846	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848	D;D;D	0.99727	-6.55;-6.55;-6.55	4.83	4.83	0.62350	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	H	0.98577	4.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96269	0.9197	10	0.87932	D	0	-23.8594	17.9063	0.88919	0.0:0.0:1.0:0.0	.	304;304	P23769-2;P23769	.;GATA2_HUMAN	H	304	ENSP00000345681:P304H;ENSP00000400259:P304H;ENSP00000417074:P304H	ENSP00000345681:P304H	P	-	2	0	GATA2	129685499	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.758000	0.98927	2.205000	0.71048	0.491000	0.48974	CCT	-	HMMPfam_GATA,HMMSmart_ZnF_GATA,PatternScan_GATA_ZN_FINGER_1,superfamily_SSF57716		0.632	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	protein_coding	OTTHUMT00000356925.1	G	NM_032638		129685499	-1	no_errors	NM_032638.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RPS3A	6189	genome.wustl.edu	37	4	152024038	152024038	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr4:152024038C>T	ENST00000509736.1	+	2	107	c.13C>T	c.(13-15)Cac>Tac	p.H5Y	RPS3A_ENST00000506126.1_Missense_Mutation_p.H87Y|RPS3A_ENST00000512690.1_Missense_Mutation_p.H124Y|SNORD73_ENST00000364394.1_RNA|SNORD73A_ENST00000386062.1_RNA|RPS3A_ENST00000514682.1_Missense_Mutation_p.H87Y|RPS3A_ENST00000274065.4_Missense_Mutation_p.H124Y|RPS3A_ENST00000322686.6_Missense_Mutation_p.H111Y					ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					GATTGAAGCTCACGTTGATGT	0.373																																						dbGAP											0			4											98.0	102.0	100.0					4																	152024038		2202	4299	6501	152243488	SO:0001583	missense	0			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000509736.1:c.13C>T	4.37:g.152024038C>T	ENSP00000422994:p.His5Tyr	405	7.32	32		173	50.00	174	152243488	83	41.96	60		Missense_Mutation	SNP	HMMPfam_Ribosomal_S3Ae,PatternScan_RIBOSOMAL_S3AE	p.H124Y	ENST00000509736.1	37	c.370		4	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485805	0.63962	.	.	ENSG00000145425	ENST00000274065;ENST00000509736;ENST00000505243;ENST00000514682;ENST00000322686;ENST00000508783;ENST00000507327;ENST00000515792;ENST00000506126;ENST00000510993	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	T	0.71896	0.3394	M	0.74647	2.275	0.80722	D	1	P	0.36909	0.573	P	0.45794	0.493	T	0.74290	-0.3713	8	0.49607	T	0.09	.	18.4551	0.90717	0.0:1.0:0.0:0.0	.	124	P61247	RS3A_HUMAN	Y	124;5;87;87;111;87;87;68;87;104	.	ENSP00000346050:H124Y	H	+	1	0	RPS3A	152243488	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.747000	0.85070	2.432000	0.82394	0.543000	0.68304	CAC	-	HMMPfam_Ribosomal_S3Ae		0.373	RPS3A-006	PUTATIVE	basic|exp_conf	protein_coding	RPS3A	protein_coding	OTTHUMT00000364962.2	C			152243488	+1	no_errors	NM_001006.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PCDHA1	56147	genome.wustl.edu	37	5	140167574	140167574	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr5:140167574G>A	ENST00000504120.2	+	1	1699	c.1699G>A	c.(1699-1701)Gcg>Acg	p.A567T	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Missense_Mutation_p.A567T	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	567					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGCTGCTGGCGCCTCGAGT	0.687																																						dbGAP											0			5											85.0	85.0	85.0					5																	140167574		2203	4299	6502	140147758	SO:0001583	missense	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1699G>A	5.37:g.140167574G>A	ENSP00000420840:p.Ala567Thr	128	9.22	13		NA	NA	NA	140147758	16	37.04	10	O75288|Q9NRT7	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin-like	p.A567T	ENST00000504120.2	37	c.1699	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	g	6.870	0.529827	0.13127	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.60920	0.15;0.15	3.68	1.8	0.24995	Cadherin-like (1);	0.425559	0.16619	U	0.206589	T	0.33498	0.0865	N	0.17564	0.495	0.09310	N	1	B;B	0.19445	0.004;0.036	B;B	0.15870	0.006;0.014	T	0.16305	-1.0407	10	0.16896	T	0.51	.	5.8025	0.18422	0.0:0.5034:0.2501:0.2466	.	567;567	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	T	567	ENSP00000420840:A567T;ENSP00000367373:A567T	ENSP00000367373:A567T	A	+	1	0	PCDHA1	140147758	0.000000	0.05858	0.542000	0.28115	0.387000	0.30353	0.130000	0.15850	0.152000	0.19188	0.484000	0.47621	GCG	-	superfamily_Cadherin-like		0.687	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	protein_coding	OTTHUMT00000389127.1	G	NM_018900		140147758	+1	no_errors	NM_018900.2	genbank	human	reviewed	54_36p	missense	SNP	0.018	A
PCDHB18	54660	genome.wustl.edu	37	5	140615588	140615588	+	RNA	SNP	T	T	C			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr5:140615588T>C	ENST00000526308.1	+	0	1651					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CCAGGTCACCTACTCGCTGCT	0.642																																						dbGAP											0			5																																								140595772			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615588T>C		83	6.74	6		NA	NA	NA	140595772	9	43.75	7	B3KTF8	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin	p.Y435H	ENST00000526308.1	37	c.1303		5																																																																																			-	HMMPfam_Cadherin,HMMSmart_CA,superfamily_Cadherin		0.642	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	pseudogene	OTTHUMT00000394776.1	T			140595772	+1	no_errors	ENST00000274705	ensembl	human	known	54_36p	missense	SNP	0.998	C
PRPF4B	8899	genome.wustl.edu	37	6	4057322	4057322	+	Silent	SNP	C	C	G			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr6:4057322C>G	ENST00000337659.6	+	13	2734	c.2634C>G	c.(2632-2634)acC>acG	p.T878T	PRPF4B_ENST00000538861.1_Silent_p.T864T	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	878	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TAGGTTGCACCTTATACGAAC	0.348																																						dbGAP											0			6											113.0	113.0	113.0					6																	4057322		2203	4300	6503	4002321	SO:0001819	synonymous_variant	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2634C>G	6.37:g.4057322C>G		164	8.38	15		38	53.57	45	4002321	42	45.45	35	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Silent	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase	p.T878	ENST00000337659.6	37	c.2634	CCDS4488.1	6																																																																																			-	HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase		0.348	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	protein_coding	OTTHUMT00000314018.2	C			4002321	+1	no_errors	NM_003913.4	genbank	human	reviewed	54_36p	silent	SNP	0.859	G
KRT6A	3853	genome.wustl.edu	37	12	52885485	52885485	+	Silent	SNP	T	T	C			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr12:52885485T>C	ENST00000330722.6	-	2	644	c.576A>G	c.(574-576)gaA>gaG	p.E192E		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	192	Coil 1A.|Rod.			E -> D (in Ref. 1; AAB60696). {ECO:0000305}.	cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCACTTTGTTTCCAGAACCT	0.532																																						dbGAP											0			12											66.0	67.0	67.0					12																	52885485		2203	4300	6503	51171752	SO:0001819	synonymous_variant	0			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.576A>G	12.37:g.52885485T>C		217	8.05	19		NA	NA	NA	51171752	21	55.32	26	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	NULL	p.F333L	ENST00000330722.6	37	c.997	CCDS41786.1	12																																																																																			-	NULL		0.532	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129218	protein_coding	OTTHUMT00000404978.2	T	NM_005554		51171752	+1	no_errors	XM_001718439.1	genbank	human	model	54_36p	missense	SNP	1.000	C
MYH6	4624	genome.wustl.edu	37	14	23874854	23874854	+	Nonsense_Mutation	SNP	G	G	C	rs147148031	byFrequency	TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr14:23874854G>C	ENST00000356287.3	-	3	356	c.327C>G	c.(325-327)taC>taG	p.Y109*	MYH6_ENST00000405093.3_Nonsense_Mutation_p.Y109*			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	109	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.Y109Y(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCCAGGCCGCGTAGCGCTCCT	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)	14											144.0	107.0	120.0					14																	23874854		2203	4300	6503	22944694	SO:0001587	stop_gained	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.327C>G	14.37:g.23874854G>C	ENSP00000348634:p.Tyr109*	668	7.21	52		NA	NA	NA	22944694	71	48.20	67	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Nonsense_Mutation	SNP	HMMPfam_Myosin_head,HMMSmart_SM00242,HMMPfam_Myosin_tail_1,HMMPfam_Myosin_N,superfamily_Prefoldin,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Y109*	ENST00000356287.3	37	c.327	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	28.8	4.950394	0.92660	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	.	.	.	4.08	-0.649	0.11461	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.31	0.37898	0.6199:0.0:0.3801:0.0	.	.	.	.	X	109	.	ENSP00000348634:Y109X	Y	-	3	2	MYH6	22944694	0.000000	0.05858	0.877000	0.34402	0.964000	0.63967	-5.001000	0.00161	-0.223000	0.09943	0.550000	0.68814	TAC	-	HMMPfam_Myosin_head,HMMSmart_SM00242,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.577	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	protein_coding	OTTHUMT00000071796.3	G			22944694	-1	no_errors	NM_002471.2	genbank	human	validated	54_36p	nonsense	SNP	1.000	C
GOLGA8UP	100507067	genome.wustl.edu	37	15	31093092	31093092	+	RNA	SNP	G	G	T			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr15:31093092G>T	ENST00000408452.1	+	0	0				RN7SL82P_ENST00000463782.2_RNA																							CCCTCAGGTGGCATTTTTCAA	0.597																																						dbGAP											0			15																																								28880384			0																															15.37:g.31093092G>T		368	6.84	27		2	0.00	0	28880384	33	50.00	33		Missense_Mutation	SNP	NULL	p.A264S	ENST00000408452.1	37	c.790		15																																																																																			-	NULL		0.597	AC004460.1-201	NOVEL	basic	miRNA	ENSG00000103832	miRNA		G			28880384	+1	no_stop_codon	ENST00000220188	ensembl	human	known	54_36p	missense	SNP	0.951	T
PLA2G4D	283748	genome.wustl.edu	37	15	42373282	42373282	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr15:42373282G>A	ENST00000290472.3	-	12	1101	c.1007C>T	c.(1006-1008)aCc>aTc	p.T336I		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	336	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GTAGAGTGAGGTCATGGCCCG	0.592																																						dbGAP											0			15											125.0	97.0	107.0					15																	42373282		2203	4299	6502	40160574	SO:0001583	missense	0			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.1007C>T	15.37:g.42373282G>A	ENSP00000290472:p.Thr336Ile	170	3.95	7		NA	NA	NA	40160574	21	44.74	17	Q8N176	Missense_Mutation	SNP	HMMPfam_C2,HMMSmart_SM00239,HMMPfam_PLA2_B,HMMSmart_SM00022,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_FabD/lysophospholipase-like	p.T336I	ENST00000290472.3	37	c.1007	CCDS32203.1	15	.	.	.	.	.	.	.	.	.	.	g	14.67	2.604104	0.46423	.	.	ENSG00000159337	ENST00000290472	T	0.09350	2.99	4.29	3.36	0.38483	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.291277	0.25517	N	0.030127	T	0.09379	0.0231	L	0.31926	0.97	0.27265	N	0.95854	B	0.19200	0.034	B	0.28709	0.093	T	0.28839	-1.0031	10	0.22706	T	0.39	-5.7863	10.8665	0.46858	0.0962:0.0:0.9038:0.0	.	336	Q86XP0	PA24D_HUMAN	I	336	ENSP00000290472:T336I	ENSP00000290472:T336I	T	-	2	0	PLA2G4D	40160574	0.999000	0.42202	0.860000	0.33809	0.378000	0.30076	3.201000	0.51059	0.766000	0.33244	0.550000	0.68814	ACC	-	HMMPfam_PLA2_B,HMMSmart_SM00022,superfamily_FabD/lysophospholipase-like		0.592	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4D	protein_coding	OTTHUMT00000419317.1	G	NM_178034		40160574	-1	no_errors	NM_178034.3	genbank	human	validated	54_36p	missense	SNP	0.864	A
CCL16	6360	genome.wustl.edu	37	17	34308404	34308404	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr17:34308404G>A	ENST00000293275.3	-	1	128	c.53C>T	c.(52-54)aCt>aTt	p.T18I		NM_004590.2	NP_004581.1	O15467	CCL16_HUMAN	chemokine (C-C motif) ligand 16	18					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive chemotaxis (GO:0050918)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGAAGCCGAAGTAATGATAAG	0.567																																						dbGAP											0			17											69.0	53.0	58.0					17																	34308404		2203	4300	6503	31332517	SO:0001583	missense	0			AB007454	CCDS11303.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000161573	ENSG00000275152		"""Chemokine ligands"", ""Endogenous ligands"""	10614	protein-coding gene	gene with protein product		601394	"""small inducible cytokine subfamily A (Cys-Cys), member 16"""	SCYA16		8661057	Standard	NM_004590		Approved	NCC-4, SCYL4, LEC, HCC-4, LMC, LCC-1, CKb12, Mtn-1	uc002hkl.3	O15467	OTTHUMG00000188402	ENST00000293275.3:c.53C>T	17.37:g.34308404G>A	ENSP00000293275:p.Thr18Ile	931	8.72	89		NA	NA	NA	31332517	95	49.48	95	Q4KKU0	Missense_Mutation	SNP	PatternScan_SMALL_CYTOKINES_CC,HMMPfam_IL8,HMMSmart_SCY,superfamily_Chemokine_IL8	p.T18I	ENST00000293275.3	37	c.53	CCDS11303.1	17	.	.	.	.	.	.	.	.	.	.	G	12.01	1.808187	0.31961	.	.	ENSG00000161573	ENST00000293275	T	0.03272	3.99	3.76	2.72	0.32119	.	.	.	.	.	T	0.04588	0.0125	L	0.55481	1.735	0.09310	N	1	B	0.17038	0.02	B	0.12156	0.007	T	0.35201	-0.9798	9	0.33940	T	0.23	.	6.5822	0.22600	0.1463:0.0:0.8537:0.0	.	18	O15467	CCL16_HUMAN	I	18	ENSP00000293275:T18I	ENSP00000293275:T18I	T	-	2	0	CCL16	31332517	0.000000	0.05858	0.001000	0.08648	0.096000	0.18686	0.462000	0.21956	0.877000	0.35895	0.462000	0.41574	ACT	-	NULL		0.567	CCL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL16	protein_coding	OTTHUMT00000256579.1	G	NM_004590		31332517	-1	no_errors	NM_004590.2	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
DNAJC7	7266	genome.wustl.edu	37	17	40133887	40133887	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr17:40133887C>T	ENST00000457167.4	-	12	1606	c.1370G>A	c.(1369-1371)gGc>gAc	p.G457D	DNAJC7_ENST00000316603.7_Missense_Mutation_p.G401D|DNAJC7_ENST00000426588.3_Missense_Mutation_p.G401D	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	457					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				CATATTCATGCCCTCCTCATC	0.473																																					Colon(63;618 1117 8600 10857 19751)	dbGAP											0			17											147.0	138.0	141.0					17																	40133887		1963	4155	6118	37387413	SO:0001583	missense	0			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.1370G>A	17.37:g.40133887C>T	ENSP00000406463:p.Gly457Asp	340	4.48	16		41	35.94	23	37387413	50	36.25	29	Q7Z784	Missense_Mutation	SNP	HMMPfam_TPR_1,HMMPfam_DnaJ,HMMSmart_SM00271,superfamily_Chaperone J-domain,HMMSmart_SM00028,superfamily_TPR-like	p.G447D	ENST00000457167.4	37	c.1340	CCDS45677.1	17	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791610	0.50102	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.73575	-0.76;-0.76;-0.76	5.46	5.46	0.80206	Heat shock protein DnaJ, N-terminal (2);	0.158517	0.56097	D	0.000034	T	0.57858	0.2082	N	0.11560	0.145	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.54111	-0.8342	10	0.13853	T	0.58	-1.8343	19.3043	0.94155	0.0:1.0:0.0:0.0	.	401;457	Q7Z784;Q99615	.;DNJC7_HUMAN	D	457;401;401	ENSP00000406463:G457D;ENSP00000394327:G401D;ENSP00000313311:G401D	ENSP00000313311:G401D	G	-	2	0	DNAJC7	37387413	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.447000	0.66606	2.548000	0.85928	0.655000	0.94253	GGC	-	superfamily_Chaperone J-domain		0.473	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC7	protein_coding	OTTHUMT00000453366.2	C			37387413	-1	no_errors	NM_003315.1	genbank	human	provisional	54_36p	missense	SNP	1.000	T
ZNF254	9534	genome.wustl.edu	37	19	24288856	24288856	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr19:24288856C>G	ENST00000357002.4	+	2	260	c.145C>G	c.(145-147)Ctg>Gtg	p.L49V	ZNF254_ENST00000339642.6_Missense_Mutation_p.L49V|ZNF254_ENST00000342944.6_Intron	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				CTACAGAAACCTGGCCTTCCT	0.373																																						dbGAP											0			19											86.0	95.0	92.0					19																	24288856		2203	4298	6501	24080696	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.145C>G	19.37:g.24288856C>G	ENSP00000349494:p.Leu49Val	108	3.57	4		10	35.29	6	24080696	30	37.50	18	A4QPC0|Q86XL7	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.L49V	ENST00000357002.4	37	c.145	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375126	0.42105	.	.	ENSG00000213096	ENST00000357002;ENST00000392281;ENST00000339642	T;T	0.03358	3.96;3.96	0.225	0.225	0.15325	Krueppel-associated box (4);	.	.	.	.	T	0.14141	0.0342	M	0.80332	2.49	0.51233	D	0.999912	D	0.55172	0.97	D	0.63283	0.913	T	0.02126	-1.1209	8	0.87932	D	0	.	.	.	.	.	49	O75437	ZN254_HUMAN	V	49	ENSP00000349494:L49V;ENSP00000341573:L49V	ENSP00000341573:L49V	L	+	1	2	ZNF254	24080696	0.543000	0.26434	0.822000	0.32727	0.825000	0.46686	0.501000	0.22578	0.300000	0.22699	0.305000	0.20034	CTG	-	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352)		0.373	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	protein_coding	OTTHUMT00000466453.1	C	NM_004876		24080696	+1	no_errors	NM_203282.2	genbank	human	validated	54_36p	missense	SNP	0.994	G
CEBPA	1050	genome.wustl.edu	37	19	33792404	33792405	+	In_Frame_Ins	INS	-	-	GCT			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	-	-	-	GCT	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr19:33792404_33792405insGCT	ENST00000498907.2	-	1	1065_1066	c.916_917insAGC	c.(916-918)cgc>cAGCgc	p.305_306insQ	CTD-2540B15.7_ENST00000587312.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	305	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q305_R306insQ(3)|p.R306fs*48(3)|p.R306P(2)|p.H200_K352>Q(1)|p.R306>RRNVDKQ(1)|p.?(1)|p.V308_E309insDKQRNV(1)|p.R306>RALAPPR(1)|p.Q305_T310del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CTCCACGTTGCGCTGCTTGGCC	0.639			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																													dbGAP		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	14	Insertion - In frame(4)|Complex - deletion inframe(4)|Complex - insertion inframe(2)|Substitution - Missense(2)|Deletion - In frame(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(14)	19																																								38484245	SO:0001652	inframe_insertion	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.914_916dupAGC	19.37:g.33792408_33792410dupGCT	ENSP00000427514:p.Gln305_Gln305dup	31	8.82	3		58	29.27	24	38484244	3	50.00	3	A7LNP2|P78319|Q05CA4	In_Frame_Ins	INS	HMMSmart_BRLZ,PatternScan_BZIP_BASIC,HMMPfam_bZIP_2	p.306in_frame_insQ	ENST00000498907.2	37	c.917_916	CCDS54243.1	19																																																																																			-	HMMSmart_BRLZ,HMMPfam_bZIP_2		0.639	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	protein_coding	OTTHUMT00000365012.1	-	NM_004364		38484245	-1	no_errors	NM_004364.3	genbank	human	reviewed	54_36p	in_frame_ins	INS	1.000:1.000	GCT
CEBPA	1050	genome.wustl.edu	37	19	33793184	33793184	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AB-2955-03A-01W-0733-08	TCGA-AB-2955-11A-01W-0732-08	G	G	G	-	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	4e3241c5-adeb-4a0e-8e27-147ee63f32fd	c11cf123-f8e8-4777-b45f-d3498d8d38fa	g.chr19:33793184delG	ENST00000498907.2	-	1	286	c.137delC	c.(136-138)cctfs	p.P46fs	CTD-2540B15.9_ENST00000593041.1_lincRNA|CTD-2540B15.7_ENST00000587312.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	46					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P46fs*107(2)|p.A47fs*114(1)|p.Y7_G130del(1)|p.A47fs*112(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CGGGGCGGCAGGTGGGGCGGG	0.751			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																													dbGAP		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	5	Deletion - Frameshift(3)|Deletion - In frame(1)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(5)	19											3.0	4.0	3.0					19																	33793184		933	1949	2882	38485024	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.137delC	19.37:g.33793184delG	ENSP00000427514:p.Pro46fs	0	0.00	0		14	37.50	9	38485024	0	0.00	0	A7LNP2|P78319|Q05CA4	Frame_Shift_Del	DEL	HMMSmart_BRLZ,PatternScan_BZIP_BASIC,HMMPfam_bZIP_2	p.P46fs	ENST00000498907.2	37	c.137	CCDS54243.1	19																																																																																			-	NULL		0.751	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	protein_coding	OTTHUMT00000365012.1	G	NM_004364		38485024	-1	no_errors	NM_004364.3	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
