#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CPXM1	56265	genome.wustl.edu	37	20	2778850	2778850	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr20:2778850G>A	ENST00000380605.2	-	4	602	c.538C>T	c.(538-540)Cac>Tac	p.H180Y		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	180	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.H180Y(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CGGGTGGGGTGCCCAGCGTCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											73.0	74.0	74.0					20																	2778850		2203	4300	6503	2726850	SO:0001583	missense	56265			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.538C>T	20.37:g.2778850G>A	ENSP00000369979:p.His180Tyr		2726850	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	7.211	0.595421	0.13875	.	.	ENSG00000088882	ENST00000380605	D	0.98207	-4.79	4.41	3.41	0.39046	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.838212	0.10560	N	0.660433	D	0.96445	0.8840	N	0.25380	0.74	0.09310	N	1	P;P	0.48589	0.912;0.662	P;B	0.49887	0.625;0.212	D	0.91519	0.5233	10	0.72032	D	0.01	-0.0108	9.0866	0.36586	0.0:0.0:0.436:0.564	.	180;180	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	Y	180	ENSP00000369979:H180Y	ENSP00000369979:H180Y	H	-	1	0	CPXM1	2726850	0.003000	0.15002	0.035000	0.18076	0.023000	0.10783	1.389000	0.34453	0.934000	0.37316	0.563000	0.77884	CAC		0.602	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		Missense_Mutation
NOP2	4839	genome.wustl.edu	37	12	6675291	6675291	+	Silent	SNP	A	A	C			TCGA-04-1336-01	TCGA-04-1336-11	A	A	C	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr12:6675291A>C	ENST00000322166.5	-	5	571	c.450T>G	c.(448-450)tcT>tcG	p.S150S	NOP2_ENST00000542015.1_Intron|NOP2_ENST00000541778.1_Silent_p.S146S|NOP2_ENST00000537442.1_Silent_p.S150S|NOP2_ENST00000545200.1_Silent_p.S146S|NOP2_ENST00000399466.2_Silent_p.S146S|NOP2_ENST00000382421.3_Silent_p.S150S	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	150					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.S146S(1)		breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						CCTCATCCTCAGAGTTGGAGT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	12											73.0	75.0	74.0					12																	6675291		2130	4225	6355	6545552	SO:0001819	synonymous_variant	4839				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.450T>G	12.37:g.6675291A>C			6545552	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Silent	SNP	ENST00000322166.5	37	CCDS58203.1	SNP	7	WashU																																																																																				0.478	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170		Silent
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-04-1336-01	TCGA-04-1336-11	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		7518264	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ALOX15B	247	genome.wustl.edu	37	17	7948892	7948892	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr17:7948892C>T	ENST00000380183.4	+	8	1227	c.1088C>T	c.(1087-1089)gCc>gTc	p.A363V	ALOX15B_ENST00000380173.2_Missense_Mutation_p.A363V|ALOX15B_ENST00000572022.1_Missense_Mutation_p.A363V|ALOX15B_ENST00000573359.1_Missense_Mutation_p.A363V	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	363	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)	p.A363V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						GTGCGCAATGCCGAGTTCTCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											112.0	82.0	92.0					17																	7948892		2203	4300	6503	7889617	SO:0001583	missense	247			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1088C>T	17.37:g.7948892C>T	ENSP00000369530:p.Ala363Val		7889617	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	CCDS11128.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243393	0.58995	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.76839	-1.05;-1.05	4.53	4.53	0.55603	Lipoxygenase, C-terminal (4);	0.315824	0.33916	N	0.004424	D	0.89469	0.6724	M	0.90814	3.15	0.09310	N	1	D;D;D;D	0.67145	0.976;0.995;0.995;0.996	P;P;P;D	0.67900	0.904;0.897;0.897;0.954	D	0.83820	0.0246	10	0.87932	D	0	-9.1279	16.3899	0.83531	0.0:1.0:0.0:0.0	.	363;363;363;363	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	V	363	ENSP00000369520:A363V;ENSP00000369530:A363V	ENSP00000344337:A363V	A	+	2	0	ALOX15B	7889617	0.480000	0.25933	0.033000	0.17914	0.633000	0.38033	4.631000	0.61304	2.225000	0.72522	0.563000	0.77884	GCC		0.637	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2			Missense_Mutation
P2RY11	5032	genome.wustl.edu	37	19	10224364	10224364	+	Silent	SNP	G	G	C			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr19:10224364G>C	ENST00000321826.4	+	2	259	c.75G>C	c.(73-75)ggG>ggC	p.G25G	PPAN_ENST00000556468.1_Silent_p.G445G|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.G466A|PPAN-P2RY11_ENST00000393796.4_Silent_p.G445G|P2RY11_ENST00000471843.1_3'UTR	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	25					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)	p.G445G(1)|p.G25G(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			AACTCAGTGGGTTCCAGGGGG	0.612											OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - coding silent(2)	ovary(2)	19											58.0	60.0	59.0					19																	10224364		2203	4300	6503	10085364	SO:0001819	synonymous_variant	5032			AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.75G>C	19.37:g.10224364G>C		663	10085364	B2R8X9|O43190|Q9BYU4|Q9H170	Silent	SNP	ENST00000321826.4	37	CCDS12226.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	6.698	0.497444	0.12762	.	.	ENSG00000243207	ENST00000428358	T	0.34667	1.35	4.28	-8.56	0.00904	.	0.761136	0.11432	U	0.564702	T	0.19685	0.0473	.	.	.	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.17837	-1.0356	9	0.62326	D	0.03	.	3.3083	0.07007	0.1579:0.1129:0.4379:0.2913	.	466	C9J3F9	.	A	466	ENSP00000411918:G466A	ENSP00000411918:G466A	G	+	2	0	PPAN-P2RY11	10085364	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-3.468000	0.00461	-4.159000	0.00069	-0.263000	0.10527	GGT		0.612	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566		Silent
PRAMEF12	390999	genome.wustl.edu	37	1	12837281	12837281	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:12837281C>A	ENST00000357726.4	+	3	1018	c.991C>A	c.(991-993)Ctg>Atg	p.L331M		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	331					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L331M(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCATCACACTGACCCATTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	96.0	95.0					1																	12837281		2203	4300	6503	12759868	SO:0001583	missense	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.991C>A	1.37:g.12837281C>A	ENSP00000350358:p.Leu331Met		12759868		Missense_Mutation	SNP	ENST00000357726.4	37	CCDS41254.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	.	11.09	1.535583	0.27475	.	.	ENSG00000116726	ENST00000357726	T	0.01388	4.95	2.83	0.782	0.18567	.	0.215920	0.31031	N	0.008387	T	0.04003	0.0112	L	0.60845	1.875	0.18873	N	0.999986	D	0.89917	1.0	D	0.91635	0.999	T	0.36261	-0.9755	10	0.39692	T	0.17	.	3.6171	0.08082	0.4459:0.4257:0.0:0.1284	.	331	O95522	PRA12_HUMAN	M	331	ENSP00000350358:L331M	ENSP00000350358:L331M	L	+	1	2	PRAMEF12	12759868	0.003000	0.15002	0.200000	0.23457	0.178000	0.23041	-0.355000	0.07671	0.203000	0.20529	0.205000	0.17691	CTG		0.567	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		Missense_Mutation
CELA2A	63036	genome.wustl.edu	37	1	15792585	15792585	+	Silent	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:15792585C>T	ENST00000359621.4	+	6	610	c.585C>T	c.(583-585)agC>agT	p.S195S	CELA2B_ENST00000494280.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	195	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)	p.S195S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						GGGGCAGCAGCGTGAAAACCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											152.0	143.0	146.0					1																	15792585		2203	4300	6503	15665172	SO:0001819	synonymous_variant	63036				CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.585C>T	1.37:g.15792585C>T			15665172	B2R5I4|Q14243	Silent	SNP	ENST00000359621.4	37	CCDS157.1	SNP	27	WashU																																																																																				0.582	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440		Silent
CUBN	8029	genome.wustl.edu	37	10	16980963	16980963	+	Splice_Site	SNP	C	C	G			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr10:16980963C>G	ENST00000377833.4	-	38	5797	c.5732G>C	c.(5731-5733)aGg>aCg	p.R1911T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1911	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R1911T(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAACTCACCCTTAATTTGTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											97.0	90.0	93.0					10																	16980963		2203	4300	6503	17020969	SO:0001630	splice_region_variant	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5733+1G>C	10.37:g.16980963C>G			17020969	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	9.337	1.061948	0.19987	.	.	ENSG00000107611	ENST00000377833	T	0.17528	2.27	5.36	-4.61	0.03380	CUB (5);	0.554792	0.16415	N	0.215403	T	0.05181	0.0138	N	0.05467	-0.045	0.80722	D	1	B	0.17268	0.021	B	0.19148	0.024	T	0.35992	-0.9766	10	0.16420	T	0.52	.	3.4076	0.07347	0.2099:0.1211:0.1044:0.5646	.	1911	O60494	CUBN_HUMAN	T	1911	ENSP00000367064:R1911T	ENSP00000367064:R1911T	R	-	2	0	CUBN	17020969	1.000000	0.71417	0.854000	0.33618	0.606000	0.37113	0.760000	0.26475	-0.411000	0.07530	0.585000	0.79938	AGG		0.343	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	Missense_Mutation	Missense_Mutation
ADAMTSL1	92949	genome.wustl.edu	37	9	18622344	18622344	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1336-01	TCGA-04-1336-11	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr9:18622344A>C	ENST00000380548.4	+	5	917	c.578A>C	c.(577-579)aAa>aCa	p.K193T	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.K193T|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.K193T|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.K193T|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.K193T	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	193						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K193T(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GGGCAGTATAAATCCCAGCTC	0.552																																																2	Substitution - Missense(2)	ovary(2)	9											75.0	74.0	74.0					9																	18622344		2203	4300	6503	18612344	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.578A>C	9.37:g.18622344A>C	ENSP00000369921:p.Lys193Thr		18612344	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	19.83	3.900129	0.72754	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T	0.65732	0.1;0.76;-0.17;0.76;0.76	5.46	5.46	0.80206	.	.	.	.	.	T	0.62889	0.2465	N	0.16016	0.355	0.80722	D	1	D;B	0.76494	0.999;0.054	D;B	0.63488	0.915;0.036	T	0.64753	-0.6333	9	0.35671	T	0.21	.	15.8337	0.78782	1.0:0.0:0.0:0.0	.	193;193	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	T	193	ENSP00000369921:K193T;ENSP00000327887:K193T;ENSP00000369944:K193T;ENSP00000369940:K193T;ENSP00000276935:K193T	ENSP00000276935:K193T	K	+	2	0	ADAMTSL1	18612344	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.098000	0.64548	2.206000	0.71126	0.533000	0.62120	AAA		0.552	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			Missense_Mutation
GOLGA8CP	729786	genome.wustl.edu	37	15	20777920	20777920	+	RNA	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr15:20777920G>A	ENST00000408427.1	+	0	83				RN7SL759P_ENST00000485130.2_RNA														p.V383V(1)									TGGAGCCTGTGCAAGGAGAGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	15																																								19037934			0																															15.37:g.20777920G>A			19037934		Silent	SNP	ENST00000408427.1	37		SNP	46	WashU																																																																																				0.622	AC131280.1-201	NOVEL	basic	miRNA	miRNA				Silent
TNRC6A	27327	genome.wustl.edu	37	16	24803028	24803029	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-04-1336-01	TCGA-04-1336-11	GG	GG	GG	TT	GG	GG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr16:24803028_24803029GG>TT	ENST00000395799.3	+	6	3194_3195	c.3065_3066GG>TT	c.(3064-3066)tGG>tTT	p.W1022F	TNRC6A_ENST00000315183.7_Missense_Mutation_p.W1022F	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1022	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GTGAACATGTGGAACAAAAACG	0.46																																																0			16																																								24710530	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	Exception_encountered	16.37:g.24803028_24803029delinsTT	ENSP00000379144:p.Trp1022Phe		24710529	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense	DNP	ENST00000395799.3	37	CCDS10624.2	DNP	47	WashU																																																																																				0.460	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		Missense
HIST1H3B	8358	genome.wustl.edu	37	6	26032138	26032138	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr6:26032138C>G	ENST00000244661.2	-	1	150	c.151G>C	c.(151-153)Gag>Cag	p.E51Q		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	51					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.E51Q(1)		breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CGGCGGATCTCGCGCAGAGCC	0.627																																																1	Substitution - Missense(1)	ovary(1)	6											56.0	67.0	63.0					6																	26032138		2203	4300	6503	26140117	SO:0001583	missense	8358			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.151G>C	6.37:g.26032138C>G	ENSP00000244661:p.Glu51Gln		26140117	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	c	20.3	3.959673	0.74016	.	.	ENSG00000124693	ENST00000244661	T	0.56941	0.43	5.19	5.19	0.71726	.	.	.	.	.	T	0.65502	0.2697	.	.	.	0.45330	D	0.998322	.	.	.	.	.	.	T	0.69610	-0.5099	6	0.87932	D	0	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	Q	51	ENSP00000244661:E51Q	ENSP00000244661:E51Q	E	-	1	0	HIST1H3B	26140117	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	7.588000	0.82629	2.577000	0.86979	0.561000	0.74099	GAG		0.627	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537		Missense_Mutation
DSC2	1824	genome.wustl.edu	37	18	28666673	28666673	+	Nonsense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr18:28666673T>A	ENST00000280904.6	-	7	1251	c.808A>T	c.(808-810)Aaa>Taa	p.K270*	DSC2_ENST00000251081.6_Nonsense_Mutation_p.K270*	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	270	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K270*(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GGCTCATCTTTGTCAGTAGCA	0.453																																																1	Substitution - Nonsense(1)	ovary(1)	18											231.0	185.0	200.0					18																	28666673		2203	4300	6503	26920671	SO:0001587	stop_gained	1824			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.808A>T	18.37:g.28666673T>A	ENSP00000280904:p.Lys270*		26920671		Nonsense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887783	0.72410	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	.	.	.	5.61	1.79	0.24919	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.549	0.22423	0.0:0.0989:0.2884:0.6127	.	.	.	.	X	270;270;36;283	.	ENSP00000251081:K270X	K	-	1	0	DSC2	26920671	0.857000	0.29778	0.871000	0.34182	0.275000	0.26752	1.198000	0.32223	0.370000	0.24538	0.533000	0.62120	AAA		0.453	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		Nonsense_Mutation
LNX2	222484	genome.wustl.edu	37	13	28155767	28155767	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr13:28155767T>A	ENST00000316334.3	-	2	203	c.74A>T	c.(73-75)gAa>gTa	p.E25V		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	25					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)	p.E25V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TTGGCCACATTCAAAACACAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	13											146.0	128.0	134.0					13																	28155767		2203	4300	6503	27053767	SO:0001583	missense	222484			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.74A>T	13.37:g.28155767T>A	ENSP00000325929:p.Glu25Val		27053767	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026318	0.35701	.	.	ENSG00000139517	ENST00000316334	T	0.05996	3.36	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.05731	0.0150	L	0.41632	1.29	0.80722	D	1	B	0.33212	0.402	B	0.26864	0.074	T	0.10753	-1.0616	10	0.02654	T	1	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	25	Q8N448	LNX2_HUMAN	V	25	ENSP00000325929:E25V	ENSP00000325929:E25V	E	-	2	0	LNX2	27053767	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.671000	0.83941	2.324000	0.78689	0.533000	0.62120	GAA		0.438	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2			Missense_Mutation
KRTAP13-3	337960	genome.wustl.edu	37	21	31797972	31797972	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr21:31797972T>G	ENST00000390690.2	-	1	314	c.259A>C	c.(259-261)Atg>Ctg	p.M87L		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	87	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)		p.M87L(1)		endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						TTGCAGAGCATGTGAGTCCTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	21											64.0	72.0	69.0					21																	31797972		2200	4300	6500	30719843	SO:0001583	missense	337960			AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.259A>C	21.37:g.31797972T>G	ENSP00000375109:p.Met87Leu		30719843	Q3LI78	Missense_Mutation	SNP	ENST00000390690.2	37	CCDS13591.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	-	6.480	0.456702	0.12283	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.02737	4.18	4.69	-9.38	0.00623	.	1.618190	0.04401	U	0.364156	T	0.01489	0.0048	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46359	-0.9197	10	0.14656	T	0.56	16.7605	2.1373	0.03765	0.2211:0.3831:0.2248:0.171	.	87	Q3SY46	KR133_HUMAN	L	87;77	ENSP00000375109:M87L	ENSP00000375109:M87L	M	-	1	0	KRTAP13-3	30719843	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.113000	0.03296	-1.798000	0.01250	-2.339000	0.00246	ATG		0.567	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128228.2			Missense_Mutation
IQCC	55721	genome.wustl.edu	37	1	32671824	32671824	+	Missense_Mutation	SNP	C	C	G	rs560946593		TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:32671824C>G	ENST00000291358.6	+	2	133	c.112C>G	c.(112-114)Cga>Gga	p.R38G	RP4-622L5.7_ENST00000373604.4_RNA|IQCC_ENST00000537469.1_Missense_Mutation_p.R118G|RP4-622L5.7_ENST00000421616.1_RNA|DCDC2B_ENST00000409358.1_5'Flank	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	38								p.R38G(1)		endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGCGATTGTACGAGAGGTCGA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18498	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											84.0	86.0	85.0					1																	32671824		2203	4300	6503	32444411	SO:0001583	missense	55721			AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.112C>G	1.37:g.32671824C>G	ENSP00000291358:p.Arg38Gly		32444411	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Missense_Mutation	SNP	ENST00000291358.6	37	CCDS355.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	12.41	1.929302	0.34096	.	.	ENSG00000160051	ENST00000537469;ENST00000291358	T;T	0.11930	2.73;2.73	5.13	4.21	0.49690	.	0.733693	0.11618	N	0.546049	T	0.14313	0.0346	L	0.47716	1.5	0.29097	N	0.881706	B;B	0.12630	0.006;0.003	B;B	0.15052	0.012;0.012	T	0.06588	-1.0818	10	0.48119	T	0.1	-4.0E-4	10.0257	0.42070	0.1814:0.6783:0.1403:0.0	.	118;38	F5H7T8;Q4KMZ1	.;IQCC_HUMAN	G	118;38	ENSP00000442291:R118G;ENSP00000291358:R38G	ENSP00000291358:R38G	R	+	1	2	IQCC	32444411	0.060000	0.20803	0.734000	0.30879	0.550000	0.35303	0.616000	0.24344	1.509000	0.48786	0.655000	0.94253	CGA		0.617	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134		Missense_Mutation
SYNGAP1	8831	genome.wustl.edu	37	6	33410706	33410706	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1336-01	TCGA-04-1336-11	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr6:33410706A>T	ENST00000418600.2	+	15	2478	c.2377A>T	c.(2377-2379)Aag>Tag	p.K793*	SYNGAP1_ENST00000428982.2_Nonsense_Mutation_p.K734*|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Nonsense_Mutation_p.K793*	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	793					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.K793*(1)|p.K778*(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						AACCAAGGAAAAGCCACCCCC	0.587																																																2	Substitution - Nonsense(2)	ovary(2)	6											65.0	67.0	66.0					6																	33410706		2203	4299	6502	33518684	SO:0001587	stop_gained	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2377A>T	6.37:g.33410706A>T	ENSP00000403636:p.Lys793*		33518684	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Nonsense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	39	7.708481	0.98447	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	.	.	.	4.52	4.52	0.55395	.	0.579771	0.17397	N	0.175684	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	11.8301	0.52290	1.0:0.0:0.0:0.0	.	.	.	.	X	793;793;779;734	.	ENSP00000293748:K793X	K	+	1	0	SYNGAP1	33518684	0.982000	0.34865	0.904000	0.35570	0.984000	0.73092	3.048000	0.49862	1.899000	0.54978	0.482000	0.46254	AAG		0.587	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		Nonsense_Mutation
ATP5O	539	genome.wustl.edu	37	21	35284601	35284601	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr21:35284601T>C	ENST00000290299.2	-	3	406	c.190A>G	c.(190-192)Aga>Gga	p.R64G	ATP5O_ENST00000496044.1_5'Flank|AP000304.12_ENST00000429238.1_Missense_Mutation_p.E12G	NM_001697.2	NP_001688.1	P48047	ATPO_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	64					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.R64G(1)		large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	5						ACTGCTACTCTCAACAACTCC	0.388																																																1	Substitution - Missense(1)	ovary(1)	21											112.0	100.0	104.0					21																	35284601		2203	4300	6503	34206471	SO:0001583	missense	539			AF088071	CCDS13634.1	21q22	2012-10-12	2008-07-31		ENSG00000241837	ENSG00000241837	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	850	protein-coding gene	gene with protein product	"""oligomycin sensitivity conferring protein"""	600828				7490082	Standard	NM_001697		Approved	OSCP, ATPO		P48047	OTTHUMG00000065186	ENST00000290299.2:c.190A>G	21.37:g.35284601T>C	ENSP00000290299:p.Arg64Gly		34206471	B2R4E2|Q5U042|Q6IBI2	Missense_Mutation	SNP	ENST00000290299.2	37	CCDS13634.1	SNP	54	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.7|22.7	4.330313|4.330313	0.81690|0.81690	.|.	.|.	ENSG00000249209|ENSG00000241837	ENST00000429238|ENST00000290299	.|T	.|0.42513	.|0.97	5.62|5.62	-2.08|-2.08	0.07254|0.07254	.|.	.|0.093348	.|0.64402	.|D	.|0.000004	T|T	0.51652|0.51652	0.1687|0.1687	L|L	0.49513|0.49513	1.565|1.565	0.30081|0.30081	N|N	0.809142|0.809142	.|D	.|0.54964	.|0.969	.|P	.|0.57283	.|0.817	T|T	0.60047|0.60047	-0.7339|-0.7339	5|9	.|.	.|.	.|.	-6.7294|-6.7294	20.578|20.578	0.99371|0.99371	0.0:0.0:0.7488:0.2512|0.0:0.0:0.7488:0.2512	.|.	.|64	.|P48047	.|ATPO_HUMAN	G|G	12|64	.|ENSP00000290299:R64G	.|.	E|R	-|-	2|1	0|2	AP000304.12|ATP5O	34206471|34206471	0.332000|0.332000	0.24722|0.24722	0.001000|0.001000	0.08648|0.08648	0.899000|0.899000	0.52679|0.52679	0.573000|0.573000	0.23699|0.23699	-0.497000|-0.497000	0.06641|0.06641	0.455000|0.455000	0.32223|0.32223	GAG|AGA		0.388	ATP5O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139907.1	NM_001697		Missense_Mutation
C6orf106	64771	genome.wustl.edu	37	6	34574605	34574605	+	Silent	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr6:34574605C>A	ENST00000374023.3	-	4	831	c.588G>T	c.(586-588)acG>acT	p.T196T	C6orf106_ENST00000374026.3_Silent_p.T130T|C6orf106_ENST00000374021.1_Silent_p.T122T	NM_024294.2	NP_077270.1	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106	196								p.T196T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10						TGTTGAACTCCGTTTCAAAAG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	6											85.0	76.0	79.0					6																	34574605		2203	4300	6503	34682583	SO:0001819	synonymous_variant	64771			AF052106	CCDS4795.1, CCDS4796.1	6p21.31	2012-01-27			ENSG00000196821	ENSG00000196821			21215	protein-coding gene	gene with protein product		612217					Standard	XM_005249298		Approved	FLJ22195, dJ391O22.4	uc003ojr.2	Q9H6K1	OTTHUMG00000014553	ENST00000374023.3:c.588G>T	6.37:g.34574605C>A			34682583	B2R8K7|Q5VV77|Q96MG5|Q9BUR9	Silent	SNP	ENST00000374023.3	37	CCDS4796.1	SNP	23	WashU																																																																																				0.438	C6orf106-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040251.1	NM_022758		Silent
UHRF1BP1	54887	genome.wustl.edu	37	6	34826094	34826094	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr6:34826094T>A	ENST00000192788.5	+	14	2132	c.1961T>A	c.(1960-1962)gTt>gAt	p.V654D	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.V654D	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	654							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.V654D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TTTCCTAAGGTTCCAGGTGGC	0.488																																																1	Substitution - Missense(1)	ovary(1)	6											183.0	167.0	172.0					6																	34826094		1928	4144	6072	34934072	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1961T>A	6.37:g.34826094T>A	ENSP00000192788:p.Val654Asp		34934072	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314101	0.23908	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.07327	3.21;3.2	5.65	3.28	0.37604	.	0.201485	0.41712	D	0.000837	T	0.01558	0.0050	N	0.14661	0.345	0.26695	N	0.971273	B	0.02656	0.0	B	0.01281	0.0	T	0.44726	-0.9309	10	0.44086	T	0.13	-9.6803	7.799	0.29164	0.0:0.2505:0.0:0.7495	.	654	Q6BDS2	URFB1_HUMAN	D	654	ENSP00000192788:V654D;ENSP00000400628:V654D	ENSP00000192788:V654D	V	+	2	0	UHRF1BP1	34934072	0.094000	0.21725	0.937000	0.37676	0.979000	0.70002	0.485000	0.22324	0.948000	0.37687	0.533000	0.62120	GTT		0.488	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		Missense_Mutation
ERG	2078	genome.wustl.edu	37	21	39755800	39755800	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr21:39755800G>A	ENST00000417133.2	-	12	1171	c.986C>T	c.(985-987)tCg>tTg	p.S329L	ERG_ENST00000398919.2_Missense_Mutation_p.S329L|ERG_ENST00000398910.1_Missense_Mutation_p.S306L|ERG_ENST00000288319.7_Missense_Mutation_p.S322L|ERG_ENST00000398905.1_Missense_Mutation_p.S298L|ERG_ENST00000453032.2_Missense_Mutation_p.S230L|ERG_ENST00000442448.1_Missense_Mutation_p.S305L|ERG_ENST00000398907.1_Missense_Mutation_p.S299L|ERG_ENST00000398897.1_Missense_Mutation_p.S206L|ERG_ENST00000398911.1_Missense_Mutation_p.S305L	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.S305L(1)	EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGAGCTGTCCGACAGGAGCTC	0.602			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	1	Substitution - Missense(1)	ovary(1)	21											53.0	53.0	53.0					21																	39755800		2203	4300	6503	38677670	SO:0001583	missense	2078				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.986C>T	21.37:g.39755800G>A	ENSP00000414150:p.Ser329Leu		38677670	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707771	0.89018	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.2	5.2	0.72013	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.36936	0.0985	N	0.13098	0.295	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.987	D;D;D;P	0.97110	0.992;1.0;0.992;0.81	T	0.44574	-0.9319	10	0.87932	D	0	.	18.7596	0.91845	0.0:0.0:1.0:0.0	.	329;298;305;322	P11308;B5MDW0;P11308-1;P11308-4	ERG_HUMAN;.;.;.	L	298;299;322;206;305;329;306;305;230;329	ENSP00000381877:S298L;ENSP00000381879:S299L;ENSP00000288319:S322L;ENSP00000381871:S206L;ENSP00000381882:S305L;ENSP00000414150:S329L;ENSP00000381881:S306L;ENSP00000394694:S305L;ENSP00000396268:S230L;ENSP00000381891:S329L	ENSP00000288319:S322L	S	-	2	0	ERG	38677670	1.000000	0.71417	0.940000	0.37924	0.939000	0.58152	9.869000	0.99810	2.404000	0.81709	0.655000	0.94253	TCG		0.602	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918		Missense_Mutation
ELL3	80237	genome.wustl.edu	37	15	44066460	44066460	+	Missense_Mutation	SNP	G	G	A	rs186113630		TCGA-04-1336-01	TCGA-04-1336-11	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr15:44066460G>A	ENST00000319359.3	-	9	1599	c.958C>T	c.(958-960)Cgt>Tgt	p.R320C	SERF2_ENST00000381359.1_5'Flank|ELL3_ENST00000497465.1_5'UTR|RP11-296A16.1_ENST00000417761.2_3'UTR	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	320					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)	p.R320C(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		GTCCCAACACGGGCATGCAGG	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20015	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15											129.0	108.0	115.0					15																	44066460		2198	4298	6496	41853752	SO:0001583	missense	80237			AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.958C>T	15.37:g.44066460G>A	ENSP00000320346:p.Arg320Cys		41853752	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	ENST00000319359.3	37	CCDS10102.1	SNP	39	WashU	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.78	3.695909	0.68386	.	.	ENSG00000128886	ENST00000319359	T	0.24723	1.84	5.92	5.0	0.66597	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.106982	0.43416	D	0.000571	T	0.54013	0.1832	M	0.85542	2.76	0.49798	D	0.999829	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.61133	-0.7124	10	0.87932	D	0	-15.1083	12.0971	0.53761	0.0:0.0:0.6878:0.3122	.	320;320;274	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	C	320	ENSP00000320346:R320C	ENSP00000320346:R320C	R	-	1	0	ELL3	41853752	0.874000	0.30092	0.437000	0.26809	0.919000	0.55068	1.740000	0.38228	1.488000	0.48433	0.557000	0.71058	CGT		0.517	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133236.2	NM_025165		Missense_Mutation
ADAMTS20	80070	genome.wustl.edu	37	12	43846438	43846438	+	Silent	SNP	A	A	G			TCGA-04-1336-01	TCGA-04-1336-11	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr12:43846438A>G	ENST00000389420.3	-	13	1820	c.1821T>C	c.(1819-1821)acT>acC	p.T607T	ADAMTS20_ENST00000553158.1_Silent_p.T607T	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	607	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T607T(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GACATGAATCAGTATTACATG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	12											86.0	73.0	77.0					12																	43846438		2203	4300	6503	42132705	SO:0001819	synonymous_variant	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1821T>C	12.37:g.43846438A>G			42132705	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	CCDS31778.2	SNP	7	WashU																																																																																				0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		Silent
FCGBP	8857	genome.wustl.edu	37	19	40354481	40354481	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr19:40354481C>T	ENST00000221347.6	-	35	15995	c.15988G>A	c.(15988-15990)Gtg>Atg	p.V5330M		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5330	VWFD 13. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.V5330M(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTACGACTCACGGACACAGAT	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											54.0	42.0	46.0					19																	40354481		2203	4300	6503	45046321	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15988G>A	19.37:g.40354481C>T	ENSP00000221347:p.Val5330Met		45046321	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356451	0.41700	.	.	ENSG00000090920	ENST00000221347	T	0.62788	0.0	5.88	1.35	0.21983	von Willebrand factor, type D domain (3);	0.287287	0.23836	U	0.044095	T	0.67069	0.2854	M	0.78801	2.425	0.09310	N	1	D	0.56746	0.977	P	0.55713	0.782	T	0.56774	-0.7923	10	0.36615	T	0.2	.	4.5713	0.12210	0.1536:0.6023:0.0:0.2441	.	5330	Q9Y6R7	FCGBP_HUMAN	M	5330	ENSP00000221347:V5330M	ENSP00000221347:V5330M	V	-	1	0	FCGBP	45046321	0.000000	0.05858	0.001000	0.08648	0.428000	0.31595	-0.402000	0.07223	0.105000	0.17753	-0.293000	0.09583	GTG		0.582	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		Missense_Mutation
GABPB1	2553	genome.wustl.edu	37	15	50596256	50596257	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-04-1336-01	TCGA-04-1336-11	AC	AC	TA	TA	AC	AC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr15:50596256_50596257AC>TA	ENST00000220429.8	-	3	350_351	c.182_183GT>TA	c.(181-183)gGT>gTA	p.G61V	GABPB1_ENST00000560825.1_Missense_Mutation_p.G61V|GABPB1_ENST00000396464.3_Missense_Mutation_p.G61V|GABPB1_ENST00000380877.3_Missense_Mutation_p.G61V|GABPB1_ENST00000359031.4_Missense_Mutation_p.G61V|GABPB1_ENST00000429662.2_Missense_Mutation_p.G61V|GABPB1_ENST00000543881.1_5'UTR			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	61					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						CTCTGCTCACACCAGCTCGCAG	0.465																																																0			15																																								48383549	SO:0001583	missense	2553			D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.182_183delinsTA	15.37:g.50596256_50596257delinsTA	ENSP00000220429:p.Gly61Val		48383548	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense	DNP	ENST00000220429.8	37	CCDS32239.1	DNP	6	WashU																																																																																				0.465	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1			Missense
KRT6A	3853	genome.wustl.edu	37	12	52886881	52886881	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr12:52886881G>C	ENST00000330722.6	-	1	160	c.92C>G	c.(91-93)tCt>tGt	p.S31C		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	31	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.S31C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTGAAGCCAGAGCGGCTGAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	12											38.0	48.0	44.0					12																	52886881		2202	4300	6502	51173148	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.92C>G	12.37:g.52886881G>C	ENSP00000369317:p.Ser31Cys		51173148	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546033	0.27652	.	.	ENSG00000205420	ENST00000330722	T	0.62639	0.01	5.24	3.36	0.38483	.	0.341865	0.25570	N	0.029761	T	0.57198	0.2037	M	0.66506	2.035	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.51340	-0.8718	10	0.42905	T	0.14	.	9.658	0.39939	0.0759:0.2822:0.6419:0.0	.	31	P02538	K2C6A_HUMAN	C	31	ENSP00000369317:S31C	ENSP00000369317:S31C	S	-	2	0	KRT6A	51173148	0.276000	0.24211	0.991000	0.47740	0.704000	0.40688	1.752000	0.38349	0.679000	0.31345	-0.325000	0.08501	TCT		0.662	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554		Missense_Mutation
MAMSTR	284358	genome.wustl.edu	37	19	49216573	49216573	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr19:49216573G>A	ENST00000318083.6	-	10	1262	c.1199C>T	c.(1198-1200)tCt>tTt	p.S400F	MAMSTR_ENST00000356751.4_Missense_Mutation_p.S297F|MAMSTR_ENST00000594582.1_Missense_Mutation_p.S232F|MAMSTR_ENST00000377367.3_Missense_Mutation_p.S232F|MAMSTR_ENST00000419611.1_Missense_Mutation_p.S297F			Q6ZN01	MASTR_HUMAN	MEF2 activating motif and SAP domain containing transcriptional regulator	400	Ser-rich.|Transcription activation. {ECO:0000250}.				positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)	p.S297F(1)		endometrium(1)|ovary(1)	2						GCTGGAGTCAGATAAGTCAGC	0.612											OREG0025608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											20.0	23.0	22.0					19																	49216573		2187	4293	6480	53908385	SO:0001583	missense	284358			AK093389	CCDS12730.1, CCDS46137.1, CCDS74415.1	19q13.33	2009-07-09			ENSG00000176909	ENSG00000176909			26689	protein-coding gene	gene with protein product	"""MEF2-activating SAP transcriptional regulator"""	610349				16818234	Standard	NM_182574		Approved	MASTR, FLJ36070	uc002pkg.2	Q6ZN01		ENST00000318083.6:c.1199C>T	19.37:g.49216573G>A	ENSP00000324175:p.Ser400Phe	960	53908385	B7ZKX4|Q3KQU9|Q8N9Y3	Missense_Mutation	SNP	ENST00000318083.6	37	CCDS46137.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642475	0.47153	.	.	ENSG00000176909	ENST00000318083;ENST00000419611;ENST00000377367;ENST00000356751	.	.	.	4.2	4.2	0.49525	.	0.152382	0.30999	N	0.008443	T	0.61286	0.2335	L	0.53249	1.67	0.32582	N	0.52835	D	0.69078	0.997	P	0.60789	0.879	T	0.66594	-0.5884	9	0.32370	T	0.25	-11.2667	12.2332	0.54500	0.0:0.0:1.0:0.0	.	400	Q6ZN01	MASTR_HUMAN	F	400;297;232;297	.	ENSP00000324175:S400F	S	-	2	0	MAMSTR	53908385	1.000000	0.71417	0.999000	0.59377	0.640000	0.38277	2.275000	0.43399	2.348000	0.79779	0.297000	0.19635	TCT		0.612	MAMSTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466179.1	NM_182574		Missense_Mutation
MLIP	90523	genome.wustl.edu	37	6	54095609	54095609	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr6:54095609C>T	ENST00000274897.5	+	11	1324	c.1211C>T	c.(1210-1212)tCa>tTa	p.S404L	MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.S939L|MLIP_ENST00000358276.5_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000370877.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	404						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)		p.S404L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						CAGACCCTCTCACATGCTGAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											295.0	261.0	272.0					6																	54095609		2203	4300	6503	54203568	SO:0001583	missense	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1211C>T	6.37:g.54095609C>T	ENSP00000274897:p.Ser404Leu		54203568	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	ENST00000274897.5	37	CCDS4954.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042296	0.55003	.	.	ENSG00000146147	ENST00000274897;ENST00000502396	T;T	0.26957	2.07;1.7	5.59	2.72	0.32119	.	0.877043	0.09565	N	0.785039	T	0.06462	0.0166	N	0.19112	0.55	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.12156	0.007;0.001	T	0.35624	-0.9781	10	0.56958	D	0.05	.	7.1714	0.25721	0.0:0.7298:0.0:0.2702	.	939;404	Q5VWP3-3;Q5VWP3	.;MLIP_HUMAN	L	404;939	ENSP00000274897:S404L;ENSP00000426290:S939L	ENSP00000274897:S404L	S	+	2	0	MLIP	54203568	0.002000	0.14202	0.093000	0.20910	0.745000	0.42441	0.406000	0.21032	1.289000	0.44618	0.650000	0.86243	TCA		0.512	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569		Missense_Mutation
SMG8	55181	genome.wustl.edu	37	17	57288520	57288520	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr17:57288520C>T	ENST00000543872.2	+	2	1372	c.1108C>T	c.(1108-1110)Cct>Tct	p.P370S	SMG8_ENST00000580498.1_Intron|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000578922.1_Missense_Mutation_p.P370S|SMG8_ENST00000300917.5_Missense_Mutation_p.P370S			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	370					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.P370S(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TTTGCTGGTGCCTGCACCCCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	17											86.0	73.0	77.0					17																	57288520		2203	4300	6503	54643302	SO:0001583	missense	55181			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1108C>T	17.37:g.57288520C>T	ENSP00000438748:p.Pro370Ser		54643302	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	CCDS11615.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104340	0.56291	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.42900	0.96;0.96	5.88	5.88	0.94601	.	0.386041	0.30930	N	0.008592	T	0.50599	0.1625	N	0.22421	0.69	0.43714	D	0.996189	D	0.62365	0.991	D	0.79108	0.992	T	0.36672	-0.9738	10	0.25106	T	0.35	-14.6927	17.3825	0.87408	0.0:1.0:0.0:0.0	.	370	Q8ND04	SMG8_HUMAN	S	370	ENSP00000300917:P370S;ENSP00000438748:P370S	ENSP00000300917:P370S	P	+	1	0	SMG8	54643302	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	4.145000	0.58065	2.769000	0.95229	0.655000	0.94253	CCT		0.532	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		Missense_Mutation
EXOC5	10640	genome.wustl.edu	37	14	57698435	57698435	+	Splice_Site	SNP	T	T	C			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr14:57698435T>C	ENST00000413566.2	-	11	1298		c.e11-2		EXOC5_ENST00000340918.7_Splice_Site	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5						cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.R315G(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TTGGTGGTTCTTTTCATGAAA	0.299																																																1	Substitution - Missense(1)	ovary(1)	14											52.0	50.0	51.0					14																	57698435		1811	4068	5879	56768188	SO:0001630	splice_region_variant	10640			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.939-2A>G	14.37:g.57698435T>C			56768188	B2R6C5	Splice_Site_SNP	SNP	ENST00000413566.2	37	CCDS45111.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379634	0.61845	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6972	0.77509	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EXOC5	56768188	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.147000	0.64851	2.176000	0.68965	0.477000	0.44152	.		0.299	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	Intron	Splice_Site_SNP
PXK	54899	genome.wustl.edu	37	3	58368240	58368240	+	Splice_Site	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr3:58368240G>T	ENST00000356151.2	+	4	310		c.e4-1		PXK_ENST00000479241.1_Splice_Site|PXK_ENST00000302779.5_Splice_Site|PXK_ENST00000484288.1_Splice_Site|PXK_ENST00000383715.4_Splice_Site|PXK_ENST00000536660.1_Intron|PXK_ENST00000463280.1_Splice_Site|PXK_ENST00000383716.3_Splice_Site	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase									p.?(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TTTTTTTAAAGATTGCAGGCC	0.333																																																1	Unknown(1)	ovary(1)	3											45.0	46.0	45.0					3																	58368240		2203	4300	6503	58343280	SO:0001630	splice_region_variant	54899			AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.202-1G>T	3.37:g.58368240G>T			58343280		Splice_Site_SNP	SNP	ENST00000356151.2	37	CCDS2889.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604215	0.66445	.	.	ENSG00000168297	ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000491164	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9857	0.97347	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PXK	58343280	1.000000	0.71417	0.991000	0.47740	0.626000	0.37791	7.370000	0.79589	2.706000	0.92434	0.655000	0.94253	.		0.333	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771	Intron	Splice_Site_SNP
ETAA1	54465	genome.wustl.edu	37	2	67631678	67631678	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr2:67631678C>G	ENST00000272342.5	+	5	1994	c.1864C>G	c.(1864-1866)Cag>Gag	p.Q622E	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	622						cytoplasm (GO:0005737)		p.Q622E(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AAGACTAACTCAGCAACAAGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											122.0	124.0	123.0					2																	67631678		2203	4300	6503	67485182	SO:0001583	missense	54465			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1864C>G	2.37:g.67631678C>G	ENSP00000272342:p.Gln622Glu		67485182	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	5.994	0.367359	0.11352	.	.	ENSG00000143971	ENST00000272342	T	0.27720	1.65	5.53	3.59	0.41128	.	0.323653	0.33477	N	0.004872	T	0.33498	0.0865	M	0.71581	2.175	0.22156	N	0.999324	B	0.15141	0.012	B	0.19666	0.026	T	0.36114	-0.9761	10	0.72032	D	0.01	-7.5543	11.0087	0.47651	0.245:0.6322:0.1227:0.0	.	622	Q9NY74	ETAA1_HUMAN	E	622	ENSP00000272342:Q622E	ENSP00000272342:Q622E	Q	+	1	0	ETAA1	67485182	1.000000	0.71417	0.982000	0.44146	0.082000	0.17680	1.602000	0.36783	1.449000	0.47699	-0.176000	0.13171	CAG		0.343	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		Missense_Mutation
CABS1	85438	genome.wustl.edu	37	4	71201818	71201818	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr4:71201818G>C	ENST00000273936.5	+	1	1136	c.1062G>C	c.(1060-1062)aaG>aaC	p.K354N		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	354					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)	p.K354N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTGTACCTAAGATCACTGAGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	95.0	95.0					4																	71201818		2203	4300	6503	71236407	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.1062G>C	4.37:g.71201818G>C	ENSP00000273936:p.Lys354Asn		71236407	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	ENST00000273936.5	37	CCDS3539.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551055	0.13374	.	.	ENSG00000145309	ENST00000273936	T	0.26067	1.76	4.47	-6.77	0.01727	.	1.193380	0.06255	N	0.692745	T	0.10208	0.0250	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.25433	-1.0132	10	0.25751	T	0.34	.	1.1651	0.01813	0.405:0.1072:0.1479:0.3399	.	354	Q96KC9	CABS1_HUMAN	N	354	ENSP00000273936:K354N	ENSP00000273936:K354N	K	+	3	2	CABS1	71236407	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.290000	0.08354	-1.449000	0.01938	-1.808000	0.00615	AAG		0.398	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122		Missense_Mutation
ELN	2006	genome.wustl.edu	37	7	73474510	73474510	+	Silent	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr7:73474510G>A	ENST00000252034.7	+	24	2016	c.1617G>A	c.(1615-1617)caG>caA	p.Q539Q	ELN_ENST00000380562.4_Silent_p.Q545Q|ELN_ENST00000320492.7_Silent_p.Q458Q|ELN_ENST00000358929.4_Silent_p.Q574Q|ELN_ENST00000445912.1_Silent_p.Q539Q|ELN_ENST00000458204.1_Silent_p.Q529Q|ELN_ENST00000357036.5_Silent_p.Q544Q|ELN_ENST00000380553.4_Silent_p.Q403Q|ELN_ENST00000380584.4_Intron|ELN_ENST00000380575.4_Silent_p.Q510Q|ELN_ENST00000380576.5_Silent_p.Q520Q|ELN_ENST00000429192.1_Silent_p.Q525Q|ELN_ENST00000320399.6_Silent_p.Q539Q|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Silent_p.Q515Q	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)	p.Q539Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CCAAAGCCCAGCTCCGTGAGT	0.642			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																Dom	yes		7	7q11.23	2006	elastin	yes	L	1	Substitution - coding silent(1)	ovary(1)	7											86.0	92.0	90.0					7																	73474510		2203	4300	6503	73112446	SO:0001819	synonymous_variant	2006				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1617G>A	7.37:g.73474510G>A			73112446	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	SNP	34	WashU																																																																																				0.642	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		Missense_Mutation
RNF213	57674	genome.wustl.edu	37	17	78349654	78349654	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr17:78349654T>A	ENST00000582970.1	+	51	13312	c.13169T>A	c.(13168-13170)cTc>cAc	p.L4390H	CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.L2463H|RNF213_ENST00000508628.2_Missense_Mutation_p.L4439H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4390					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L4439H(1)|p.L2463H(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AATGCAAGCCTCCACCCCACG	0.478																																																2	Substitution - Missense(2)	ovary(2)	17											81.0	74.0	76.0					17																	78349654		2203	4300	6503	75964249	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13169T>A	17.37:g.78349654T>A	ENSP00000464087:p.Leu4390His		75964249	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	15.30	2.791371	0.50102	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.25749	1.78	5.54	5.54	0.83059	.	0.288076	0.32785	N	0.005656	T	0.49932	0.1586	M	0.76838	2.35	0.29783	N	0.833827	D;D	0.89917	1.0;0.995	D;P	0.72338	0.977;0.781	T	0.53272	-0.8462	10	0.33141	T	0.24	.	13.4119	0.60948	0.0:0.0:0.0:1.0	.	4439;2463	C9JCP4;Q63HN8	.;RN213_HUMAN	H	4390;4439;2463	ENSP00000338218:L2463H	ENSP00000338218:L2463H	L	+	2	0	RNF213	75964249	0.759000	0.28416	0.646000	0.29493	0.027000	0.11550	5.879000	0.69690	2.099000	0.63709	0.454000	0.30748	CTC		0.478	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		Missense_Mutation
MAGI2	9863	genome.wustl.edu	37	7	77885426	77885426	+	Silent	SNP	C	C	G			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr7:77885426C>G	ENST00000354212.4	-	10	2134	c.1881G>C	c.(1879-1881)cgG>cgC	p.R627R	MAGI2_ENST00000536571.1_Silent_p.R459R|MAGI2_ENST00000419488.1_Silent_p.R627R|MAGI2_ENST00000522391.1_Silent_p.R627R|MAGI2_ENST00000535697.1_Silent_p.R464R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	627	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.R627R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTTGTTTCACCCGCTGTCCTG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	7											72.0	61.0	65.0					7																	77885426		2203	4300	6503	77723362	SO:0001819	synonymous_variant	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1881G>C	7.37:g.77885426C>G			77723362	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	37	CCDS5594.1	SNP	22	WashU																																																																																				0.512	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		Silent
ZFHX4	79776	genome.wustl.edu	37	8	77763741	77763741	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:77763741T>A	ENST00000521891.2	+	10	5032	c.4584T>A	c.(4582-4584)aaT>aaA	p.N1528K	ZFHX4_ENST00000518282.1_Missense_Mutation_p.N1502K|ZFHX4_ENST00000050961.6_Missense_Mutation_p.N1483K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.N1483K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N1528K(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGGGCCCAATTTTACGATGG	0.408										HNSCC(33;0.089)																																						1	Substitution - Missense(1)	ovary(1)	8											47.0	46.0	46.0					8																	77763741		1882	4117	5999	77926296	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4584T>A	8.37:g.77763741T>A	ENSP00000430497:p.Asn1528Lys		77926296	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939722	0.34189	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53423	0.62;0.68;0.64;0.64	5.05	-1.45	0.08828	.	0.000000	0.47455	U	0.000230	T	0.53642	0.1809	L	0.58810	1.83	0.52501	D	0.99995	D;D;D	0.63880	0.988;0.993;0.993	P;P;P	0.60789	0.76;0.879;0.879	T	0.49652	-0.8917	10	0.40728	T	0.16	.	9.7474	0.40455	0.0:0.3625:0.0:0.6375	.	1483;1483;1528	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	1528;1528;1483;1483;1502	ENSP00000430497:N1528K;ENSP00000399605:N1483K;ENSP00000050961:N1483K;ENSP00000430848:N1502K	ENSP00000050961:N1483K	N	+	3	2	ZFHX4	77926296	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	0.811000	0.27198	-0.397000	0.07691	-0.451000	0.05528	AAT		0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Missense_Mutation
DLG5	9231	genome.wustl.edu	37	10	79576319	79576319	+	Silent	SNP	T	T	G			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr10:79576319T>G	ENST00000372391.2	-	20	4020	c.4015A>C	c.(4015-4017)Aga>Cga	p.R1339R	DLG5_ENST00000372388.2_Silent_p.R999R|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1339					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.R1339R(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CTGTCCTTTCTCCGCTCCCCG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	10											155.0	132.0	140.0					10																	79576319		2203	4300	6503	79246325	SO:0001819	synonymous_variant	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4015A>C	10.37:g.79576319T>G			79246325	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	ENST00000372391.2	37	CCDS7353.2	SNP	54	WashU																																																																																				0.627	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			Silent
SPATA31D5P	347127	genome.wustl.edu	37	9	84532456	84532456	+	RNA	SNP	T	T	G			TCGA-04-1336-01	TCGA-04-1336-11	T	T	G	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr9:84532456T>G	ENST00000527857.1	+	0	2478					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		ATGATGCATCTGTCAGGGAAT	0.443																																																0			9																																								83722276								9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84532456T>G			83722276		Missense_Mutation	SNP	ENST00000527857.1	37		SNP	55	WashU																																																																																				0.443	SPATA31D5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000052810.2	NR_026851		Missense_Mutation
PSKH2	85481	genome.wustl.edu	37	8	87076291	87076291	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:87076291G>T	ENST00000276616.2	-	2	829	c.755C>A	c.(754-756)aCa>aAa	p.T252K	PSKH2_ENST00000517981.1_5'Flank	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	252	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T252K(1)		NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			TAAAGCATATGTGATCACACC	0.443																																																1	Substitution - Missense(1)	ovary(1)	8											91.0	88.0	89.0					8																	87076291		2203	4300	6503	87145407	SO:0001583	missense	85481			AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.755C>A	8.37:g.87076291G>T	ENSP00000276616:p.Thr252Lys		87145407	A0AV22	Missense_Mutation	SNP	ENST00000276616.2	37	CCDS6240.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622809	0.66787	.	.	ENSG00000147613	ENST00000276616	T	0.66099	-0.19	4.98	3.14	0.36123	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.72787	0.3504	M	0.75447	2.3	0.28573	N	0.910525	D	0.53151	0.958	P	0.57468	0.821	T	0.66019	-0.6027	9	0.72032	D	0.01	.	9.8296	0.40932	0.0:0.1518:0.6908:0.1575	.	252	Q96QS6	KPSH2_HUMAN	K	252	ENSP00000276616:T252K	ENSP00000276616:T252K	T	-	2	0	PSKH2	87145407	1.000000	0.71417	0.077000	0.20336	0.937000	0.57800	4.409000	0.59768	0.462000	0.27095	0.655000	0.94253	ACA		0.443	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126		Missense_Mutation
HERC5	51191	genome.wustl.edu	37	4	89407376	89407376	+	Silent	SNP	T	T	C			TCGA-04-1336-01	TCGA-04-1336-11	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr4:89407376T>C	ENST00000264350.3	+	14	2001	c.1848T>C	c.(1846-1848)acT>acC	p.T616T	HERC5_ENST00000508159.1_Silent_p.T254T	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	616					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.T616T(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GGAAAATGACTGTGGTAGGTA	0.373																																					Esophageal Squamous(39;887 1012 34045 50514)											1	Substitution - coding silent(1)	ovary(1)	4											111.0	112.0	112.0					4																	89407376		2203	4300	6503	89626399	SO:0001819	synonymous_variant	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1848T>C	4.37:g.89407376T>C			89626399	B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	37	CCDS3630.1	SNP	55	WashU																																																																																				0.373	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323		Silent
CDH17	1015	genome.wustl.edu	37	8	95172294	95172294	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:95172294T>C	ENST00000027335.3	-	12	1580	c.1456A>G	c.(1456-1458)Aaa>Gaa	p.K486E	CDH17_ENST00000450165.2_Missense_Mutation_p.K486E|CDH17_ENST00000441892.2_Missense_Mutation_p.K272E	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	486	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.K486E(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TACAGAATTTTAGAACTCCCA	0.438																																																1	Substitution - Missense(1)	ovary(1)	8											121.0	124.0	123.0					8																	95172294		2203	4300	6503	95241470	SO:0001583	missense	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1456A>G	8.37:g.95172294T>C	ENSP00000027335:p.Lys486Glu		95241470	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	SNP	61	WashU	.	.	.	.	.	.	.	.	.	.	T	10.93	1.491312	0.26774	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.53423	0.62;0.62;0.62	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.49916	D	0.000123	T	0.34745	0.0908	L	0.31294	0.92	0.29141	N	0.879038	B;P	0.35944	0.392;0.529	B;B	0.37943	0.261;0.137	T	0.26608	-1.0098	10	0.23302	T	0.38	-21.1446	9.4224	0.38559	0.0:0.0:0.1789:0.8211	.	272;486	E7EN24;Q12864	.;CAD17_HUMAN	E	486;272;486	ENSP00000027335:K486E;ENSP00000392811:K272E;ENSP00000401468:K486E	ENSP00000027335:K486E	K	-	1	0	CDH17	95241470	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	1.396000	0.34531	1.999000	0.58509	0.459000	0.35465	AAA		0.438	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		Missense_Mutation
AHNAK2	113146	genome.wustl.edu	37	14	105411723	105411723	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr14:105411723G>T	ENST00000333244.5	-	7	10184	c.10065C>A	c.(10063-10065)gaC>gaA	p.D3355E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3355						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D3355E(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAATGCTGAGGTCAGTGGTCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	14											131.0	139.0	136.0					14																	105411723		1995	4155	6150	104482768	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10065C>A	14.37:g.105411723G>T	ENSP00000353114:p.Asp3355Glu		104482768	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	g	12.58	1.981793	0.34942	.	.	ENSG00000185567	ENST00000333244	T	0.01228	5.14	4.65	-1.2	0.09554	.	1.100210	0.07350	U	0.882158	T	0.01489	0.0048	L	0.46670	1.46	0.09310	N	1	B	0.26363	0.147	B	0.35240	0.198	T	0.48948	-0.8989	10	0.02654	T	1	.	2.0353	0.03538	0.1507:0.3392:0.2773:0.2328	.	3355	Q8IVF2	AHNK2_HUMAN	E	3355	ENSP00000353114:D3355E	ENSP00000353114:D3355E	D	-	3	2	AHNAK2	104482768	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	-0.149000	0.10204	-0.202000	0.10268	0.491000	0.48974	GAC		0.667	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Missense_Mutation
DPYS	1807	genome.wustl.edu	37	8	105459698	105459698	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:105459698T>C	ENST00000351513.2	-	3	589	c.457A>G	c.(457-459)Aaa>Gaa	p.K153E		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	153					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)	p.K153E(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TTAACACCTTTATCTTGCACA	0.368																																																1	Substitution - Missense(1)	ovary(1)	8											121.0	110.0	114.0					8																	105459698		2203	4300	6503	105528874	SO:0001583	missense	1807			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.457A>G	8.37:g.105459698T>C	ENSP00000276651:p.Lys153Glu		105528874		Missense_Mutation	SNP	ENST00000351513.2	37	CCDS6302.1	SNP	61	WashU	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424932	0.62733	.	.	ENSG00000147647	ENST00000351513;ENST00000521573	D;D	0.89681	-2.53;-2.55	6.02	6.02	0.97574	Amidohydrolase 1 (1);	0.046077	0.85682	D	0.000000	D	0.85186	0.5639	N	0.25957	0.775	0.46927	D	0.999258	B	0.33299	0.407	B	0.38880	0.284	D	0.83846	0.0260	10	0.38643	T	0.18	-24.7732	16.5494	0.84464	0.0:0.0:0.0:1.0	.	153	Q14117	DPYS_HUMAN	E	153;100	ENSP00000276651:K153E;ENSP00000430246:K100E	ENSP00000276651:K153E	K	-	1	0	DPYS	105528874	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	5.903000	0.69877	2.299000	0.77371	0.528000	0.53228	AAA		0.368	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385		Missense_Mutation
LAMB1	3912	genome.wustl.edu	37	7	107592639	107592639	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr7:107592639G>T	ENST00000222399.6	-	23	3339	c.3109C>A	c.(3109-3111)Caa>Aaa	p.Q1037K	LAMB1_ENST00000393561.1_Missense_Mutation_p.Q1061K	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1037	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.Q1037K(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGTGCTCTTGCACGGTGCCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											72.0	57.0	62.0					7																	107592639		2203	4300	6503	107379875	SO:0001583	missense	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3109C>A	7.37:g.107592639G>T	ENSP00000222399:p.Gln1037Lys		107379875	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	2.545	-0.305322	0.05495	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.61158	0.13;0.13	5.24	3.37	0.38596	EGF-like, laminin (3);	.	.	.	.	T	0.44307	0.1287	N	0.25890	0.77	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.23261	-1.0193	9	0.30854	T	0.27	.	14.3982	0.67025	0.0:0.0:0.7229:0.2771	.	1037;1061	P07942;G3XAI2	LAMB1_HUMAN;.	K	1061;1037	ENSP00000377191:Q1061K;ENSP00000222399:Q1037K	ENSP00000222399:Q1037K	Q	-	1	0	LAMB1	107379875	0.006000	0.16342	0.124000	0.21820	0.496000	0.33645	1.614000	0.36911	0.840000	0.34995	0.655000	0.94253	CAA		0.507	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		Missense_Mutation
ALPK1	80216	genome.wustl.edu	37	4	113352162	113352162	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr4:113352162G>A	ENST00000458497.1	+	11	1738	c.1459G>A	c.(1459-1461)Gga>Aga	p.G487R	ALPK1_ENST00000504176.2_Missense_Mutation_p.G409R|ALPK1_ENST00000177648.9_Missense_Mutation_p.G487R	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	487							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G487R(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TGCAAAAACAGGAGTCTGCAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											53.0	56.0	55.0					4																	113352162		2203	4300	6503	113571611	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.1459G>A	4.37:g.113352162G>A	ENSP00000398048:p.Gly487Arg		113571611	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967183	0.53507	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.32515	1.45;1.45;1.45	5.48	4.64	0.57946	.	0.256077	0.33199	N	0.005162	T	0.29458	0.0734	L	0.59912	1.85	0.26891	N	0.967338	P;P;B	0.43287	0.717;0.802;0.39	B;B;B	0.34931	0.179;0.192;0.055	T	0.27606	-1.0069	10	0.87932	D	0	-3.7656	14.3607	0.66768	0.071:0.0:0.929:0.0	.	409;409;487	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	R	487;487;409	ENSP00000398048:G487R;ENSP00000177648:G487R;ENSP00000426044:G409R	ENSP00000177648:G487R	G	+	1	0	ALPK1	113571611	0.994000	0.37717	0.022000	0.16811	0.963000	0.63663	3.398000	0.52579	1.314000	0.45095	0.655000	0.94253	GGA		0.358	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144		Missense_Mutation
FLI1	2313	genome.wustl.edu	37	11	128680373	128680373	+	Silent	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr11:128680373G>A	ENST00000527786.2	+	9	1338	c.849G>A	c.(847-849)ctG>ctA	p.L283L	FLI1_ENST00000344954.6_Silent_p.L250L|FLI1_ENST00000534087.2_Silent_p.L250L|FLI1_ENST00000525560.1_Silent_p.L90L|FLI1_ENST00000281428.8_Silent_p.L217L	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	283					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L283L(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		AGATCCAGCTGTGGCAATTCC	0.602			T	EWSR1	Ewing sarcoma																																		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	1	Substitution - coding silent(1)	ovary(1)	11											16.0	18.0	18.0					11																	128680373		2178	4288	6466	128185583	SO:0001819	synonymous_variant	2313			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.849G>A	11.37:g.128680373G>A			128185583	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Silent	SNP	ENST00000527786.2	37	CCDS44768.1	SNP	48	WashU																																																																																				0.602	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017		Silent
OC90	729330	genome.wustl.edu	37	8	133045304	133045304	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:133045304C>A	ENST00000443356.2	-	12	975	c.889G>T	c.(889-891)Gag>Tag	p.E297*	OC90_ENST00000262283.5_Nonsense_Mutation_p.E493*|OC90_ENST00000603859.1_Nonsense_Mutation_p.E281*|OC90_ENST00000254627.3_Nonsense_Mutation_p.E281*			Q02509	OC90_HUMAN	otoconin 90	297					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.E255*(1)|p.E493*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GTGGTCTCCTCAGGATCATTT	0.483																																																2	Substitution - Nonsense(2)	ovary(2)	8											68.0	73.0	71.0					8																	133045304		1989	4172	6161	133114486	SO:0001587	stop_gained	729330			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.889G>T	8.37:g.133045304C>A	ENSP00000390050:p.Glu297*		133114486	B4DNG8	Nonsense_Mutation	SNP	ENST00000443356.2	37		SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672496	0.88348	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	.	.	.	4.67	1.71	0.24356	.	0.844176	0.10866	N	0.625492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-3.9641	12.4332	0.55584	0.0:0.4709:0.5291:0.0	.	.	.	.	X	281;297;493	.	ENSP00000254627:E281X	E	-	1	0	RP11-240B13.2;OC90	133114486	0.000000	0.05858	0.004000	0.12327	0.072000	0.16883	0.220000	0.17660	0.376000	0.24707	0.655000	0.94253	GAG		0.483	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		Nonsense_Mutation
GPR112	139378	genome.wustl.edu	37	X	135427511	135427511	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1336-01	TCGA-04-1336-11	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chrX:135427511C>T	ENST00000394143.1	+	6	1937	c.1646C>T	c.(1645-1647)tCg>tTg	p.S549L	GPR112_ENST00000287534.4_Missense_Mutation_p.S486L|GPR112_ENST00000412101.1_Missense_Mutation_p.S344L|GPR112_ENST00000394141.1_Missense_Mutation_p.S344L|GPR112_ENST00000370652.1_Missense_Mutation_p.S549L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	549					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S549L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTTCCATGTCGAAAGAGACC	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											77.0	71.0	73.0					X																	135427511		2202	4299	6501	135255177	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1646C>T	X.37:g.135427511C>T	ENSP00000377699:p.Ser549Leu		135255177	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	c	10.99	1.506855	0.26949	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.31769	1.52;1.52;1.48;1.62;1.48	3.42	2.54	0.30619	.	.	.	.	.	T	0.13841	0.0335	N	0.14661	0.345	0.09310	N	1	B;B;P	0.37663	0.128;0.049;0.604	B;B;B	0.21546	0.011;0.006;0.035	T	0.12066	-1.0562	9	0.87932	D	0	.	6.5405	0.22377	0.0:0.8491:0.0:0.1509	.	486;344;549	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	549;549;344;486;344	ENSP00000377699:S549L;ENSP00000359686:S549L;ENSP00000416526:S344L;ENSP00000287534:S486L;ENSP00000377697:S344L	ENSP00000287534:S486L	S	+	2	0	GPR112	135255177	0.004000	0.15560	0.001000	0.08648	0.020000	0.10135	1.864000	0.39469	0.569000	0.29329	0.411000	0.27672	TCG		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			Missense_Mutation
DENND2A	27147	genome.wustl.edu	37	7	140244461	140244461	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr7:140244461G>T	ENST00000275884.6	-	13	2701	c.2284C>A	c.(2284-2286)Ctg>Atg	p.L762M	DENND2A_ENST00000496613.1_Missense_Mutation_p.L762M|DENND2A_ENST00000537639.1_Missense_Mutation_p.L762M|DENND2A_ENST00000492720.1_Missense_Mutation_p.L762M			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	762	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L762M(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TCCAGAAGCAGGGAGGCAAAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											49.0	58.0	55.0					7																	140244461		2156	4271	6427	139890930	SO:0001583	missense	27147			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2284C>A	7.37:g.140244461G>T	ENSP00000275884:p.Leu762Met		139890930	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	CCDS43659.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782682	0.70222	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000469373;ENST00000492720	T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64	4.95	4.05	0.47172	DENN (3);	0.095769	0.44483	N	0.000456	T	0.27524	0.0676	L	0.53780	1.695	0.46416	D	0.999031	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.969	T	0.01316	-1.1387	10	0.38643	T	0.18	-9.7595	7.8196	0.29280	0.1226:0.0:0.7311:0.1463	.	762;762	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	M	762;762;762;109;762	ENSP00000275884:L762M;ENSP00000442245:L762M;ENSP00000419654:L762M;ENSP00000420145:L109M;ENSP00000419464:L762M	ENSP00000275884:L762M	L	-	1	2	DENND2A	139890930	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.688000	0.61715	1.290000	0.44636	0.650000	0.86243	CTG		0.582	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		Missense_Mutation
PCDHB16	57717	genome.wustl.edu	37	5	140567370	140567370	+	IGR	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr5:140567370C>A	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCACAGGATCCAGATGAAGG	0.388																																																0			5											111.0	124.0	120.0					5																	140567370		2195	4296	6491	140547554	SO:0001628	intergenic_variant	56127			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567370C>A			140547554	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	SNP	30	WashU																																																																																				0.388	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Missense_Mutation
ATP10B	23120	genome.wustl.edu	37	5	160047637	160047637	+	Silent	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr5:160047637G>A	ENST00000327245.5	-	15	2979	c.2133C>T	c.(2131-2133)gcC>gcT	p.A711A	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	711					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A711A(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTCAGGCCTGGCCAGGTCTG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	5											32.0	36.0	35.0					5																	160047637		2093	4234	6327	159980215	SO:0001819	synonymous_variant	23120			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2133C>T	5.37:g.160047637G>A			159980215	Q9H725	Silent	SNP	ENST00000327245.5	37	CCDS43394.1	SNP	47	WashU																																																																																				0.632	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		Silent
LAMC1	3915	genome.wustl.edu	37	1	183093869	183093869	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1336-01	TCGA-04-1336-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:183093869T>A	ENST00000258341.4	+	14	2762	c.2505T>A	c.(2503-2505)gaT>gaA	p.D835E		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	835	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.D835E(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						ACAACATCGATCCCAATGCAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	108.0	114.0					1																	183093869		2203	4300	6503	181360492	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2505T>A	1.37:g.183093869T>A	ENSP00000258341:p.Asp835Glu		181360492	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	18.84	3.708842	0.68615	.	.	ENSG00000135862	ENST00000258341	T	0.61392	0.11	5.51	-11.0	0.00169	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.84020	0.0353	10	0.66056	D	0.02	.	25.4619	0.99994	0.0:0.8438:0.0:0.1562	.	835	P11047	LAMC1_HUMAN	E	835	ENSP00000258341:D835E	ENSP00000258341:D835E	D	+	3	2	LAMC1	181360492	0.781000	0.28676	0.057000	0.19452	0.331000	0.28603	-0.119000	0.10676	-2.699000	0.00399	-0.924000	0.02725	GAT		0.507	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293		Missense_Mutation
MTNR1A	4543	genome.wustl.edu	37	4	187455308	187455308	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr4:187455308G>T	ENST00000307161.5	-	2	789	c.588C>A	c.(586-588)ttC>ttA	p.F196L	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	196					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)	p.F196L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TGGGGACGAGGAAGTGGAAAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	4											144.0	142.0	142.0					4																	187455308		2203	4300	6503	187692302	SO:0001583	missense	4543				CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.588C>A	4.37:g.187455308G>T	ENSP00000302811:p.Phe196Leu		187692302	A0AVC5|B0M0L2	Missense_Mutation	SNP	ENST00000307161.5	37	CCDS3848.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044599	0.36085	.	.	ENSG00000168412	ENST00000307161	T	0.76578	-1.03	4.96	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88303	0.6400	M	0.92691	3.335	0.49915	D	0.999832	P	0.50272	0.933	D	0.64687	0.928	D	0.88418	0.3026	10	0.87932	D	0	-27.4492	8.1676	0.31237	0.3128:0.0:0.6872:0.0	.	196	P48039	MTR1A_HUMAN	L	196	ENSP00000302811:F196L	ENSP00000302811:F196L	F	-	3	2	MTNR1A	187692302	1.000000	0.71417	0.688000	0.30117	0.136000	0.21042	2.855000	0.48333	1.082000	0.41137	0.655000	0.94253	TTC		0.552	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1			Missense_Mutation
PAK2	5062	genome.wustl.edu	37	3	196509539	196509539	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr3:196509539G>A	ENST00000327134.3	+	2	344	c.22G>A	c.(22-24)Gaa>Aaa	p.E8K	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	8					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.E8K(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CGGAGAACTGGAAGATAAGCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	3											96.0	101.0	99.0					3																	196509539		2203	4300	6503	197993936	SO:0001583	missense	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.22G>A	3.37:g.196509539G>A	ENSP00000314067:p.Glu8Lys		197993936	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.268189	0.95429	.	.	ENSG00000180370	ENST00000327134	T	0.72725	-0.68	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.80727	0.4678	M	0.74647	2.275	0.80722	D	1	P	0.46706	0.883	P	0.52424	0.698	D	0.83431	0.0038	10	0.87932	D	0	.	18.756	0.91833	0.0:0.0:1.0:0.0	.	8	Q13177	PAK2_HUMAN	K	8	ENSP00000314067:E8K	ENSP00000314067:E8K	E	+	1	0	PAK2	197993936	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.143000	0.94623	2.456000	0.83038	0.655000	0.94253	GAA		0.413	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577		Missense_Mutation
PLD5	200150	genome.wustl.edu	37	1	242287855	242287855	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:242287855C>A	ENST00000536534.2	-	6	1089	c.848G>T	c.(847-849)tGg>tTg	p.W283L	PLD5_ENST00000442594.2_Missense_Mutation_p.W191L|PLD5_ENST00000427495.1_Missense_Mutation_p.W221L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	283						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.W191L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCTTTTGGACCAGGTTTGAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	109.0	110.0					1																	242287855		2203	4300	6503	240354478	SO:0001583	missense	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.848G>T	1.37:g.242287855C>A	ENSP00000440896:p.Trp283Leu		240354478	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	CCDS1621.2	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585501	0.86748	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.20598	2.06;2.06;2.06	5.61	5.61	0.85477	Phospholipase D/viral envelope (1);	0.000000	0.85682	D	0.000000	T	0.47893	0.1470	M	0.89095	3.005	0.58432	D	0.999999	D;D;P	0.58970	0.97;0.984;0.944	P;P;P	0.54889	0.628;0.763;0.524	T	0.57015	-0.7883	10	0.72032	D	0.01	-8.618	17.4103	0.87484	0.0:1.0:0.0:0.0	.	191;283;221	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	L	221;191;283	ENSP00000401285:W221L;ENSP00000414188:W191L;ENSP00000440896:W283L	ENSP00000401285:W221L	W	-	2	0	PLD5	240354478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.984000	0.70548	2.636000	0.89361	0.655000	0.94253	TGG		0.383	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		Missense_Mutation
SLC12A3	6559	genome.wustl.edu	37	16	56914076	56914076	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1336-01	TCGA-04-1336-11	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr16:56914076G>T	ENST00000563236.1	+	12	1503	c.1478G>T	c.(1477-1479)gGc>gTc	p.G493V	SLC12A3_ENST00000438926.2_Missense_Mutation_p.G493V|SLC12A3_ENST00000566786.1_Missense_Mutation_p.G492V|SLC12A3_ENST00000262502.5_Missense_Mutation_p.G492V			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	493					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.G493V(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CCACTGATCGGCTTCTTCGGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	16											49.0	39.0	43.0					16																	56914076		2198	4300	6498	55471577	SO:0001583	missense	6559				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1478G>T	16.37:g.56914076G>T	ENSP00000456149:p.Gly493Val		55471577	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647988	0.67358	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.56	3.6	0.41247	Amino acid permease domain (1);	0.050269	0.85682	D	0.000000	T	0.76321	0.3971	M	0.80028	2.48	0.80722	D	1	P;D;D	0.89917	0.728;1.0;1.0	B;D;D	0.85130	0.43;0.997;0.995	T	0.74559	-0.3625	9	0.17832	T	0.49	.	12.42	0.55514	0.0813:0.0:0.9187:0.0	.	492;493;493	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	V	492;493	.	ENSP00000262502:G493V	G	+	2	0	SLC12A3	55471577	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.764000	0.55264	1.134000	0.42165	0.561000	0.74099	GGC		0.617	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			Missense_Mutation
ZFHX3	463	genome.wustl.edu	37	16	72821881	72821881	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1336-01	TCGA-04-1336-11	A	A	T	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr16:72821881A>T	ENST00000268489.5	-	10	10966	c.10294T>A	c.(10294-10296)Tcc>Acc	p.S3432T	AC004943.1_ENST00000584072.1_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.S2518T|RP5-991G20.1_ENST00000563328.2_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3432					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S3432T(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AGGAGGGGGGACACCTCACGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											56.0	64.0	61.0					16																	72821881		2198	4300	6498	71379382	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10294T>A	16.37:g.72821881A>T	ENSP00000268489:p.Ser3432Thr		71379382	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	9.692	1.152161	0.21371	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	D;D	0.87491	-2.26;-2.26	4.3	4.3	0.51218	.	0.000000	0.47852	D	0.000208	T	0.68988	0.3061	N	0.08118	0	0.44736	D	0.997732	B	0.06786	0.001	B	0.04013	0.001	T	0.62746	-0.6789	10	0.05721	T	0.95	.	9.2542	0.37573	0.9131:0.0:0.0869:0.0	.	3432	Q15911	ZFHX3_HUMAN	T	3432;2518	ENSP00000268489:S3432T;ENSP00000438926:S2518T	ENSP00000268489:S3432T	S	-	1	0	ZFHX3	71379382	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.701000	0.47094	1.719000	0.51432	0.455000	0.32223	TCC		0.562	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		Missense_Mutation
KIFC2	90990	genome.wustl.edu	37	8	145692653	145692653	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:145692653G>A	ENST00000301332.2	+	4	775	c.398G>A	c.(397-399)aGc>aAc	p.S133N	CTD-2517M22.16_ENST00000525461.1_RNA|KIFC2_ENST00000301331.5_5'Flank|CYHR1_ENST00000424149.2_5'Flank|CYHR1_ENST00000403000.2_5'Flank|CYHR1_ENST00000438911.2_5'Flank|CYHR1_ENST00000306145.5_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	133					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S133N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TGGCTTCGAAGCCCCAGGGGG	0.617											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	8											49.0	57.0	55.0					8																	145692653		2203	4300	6503	145663461	SO:0001583	missense	90990			AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.398G>A	8.37:g.145692653G>A	ENSP00000301332:p.Ser133Asn	1696	145663461	E9PHB2|Q96NN6	Missense_Mutation	SNP	ENST00000301332.2	37	CCDS6427.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075900	0.76415	.	.	ENSG00000167702	ENST00000301332	T	0.53423	0.62	5.21	3.26	0.37387	.	0.000000	0.40554	N	0.001076	T	0.32882	0.0844	L	0.29908	0.895	0.80722	D	1	B	0.29909	0.261	B	0.29353	0.101	T	0.11567	-1.0582	10	0.32370	T	0.25	-9.0519	9.8717	0.41177	0.0:0.1513:0.6924:0.1563	.	133	Q96AC6	KIFC2_HUMAN	N	133	ENSP00000301332:S133N	ENSP00000301332:S133N	S	+	2	0	KIFC2	145663461	0.016000	0.18221	0.998000	0.56505	0.863000	0.49368	2.105000	0.41825	1.302000	0.44855	0.563000	0.77884	AGC		0.617	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754		Missense_Mutation
ASTN1	460	genome.wustl.edu	37	1	176915067	176915082	+	Frame_Shift_Del	DEL	TGTTCCTTTCAGCACC	TGTTCCTTTCAGCACC	-	rs201509586|rs200570826		TCGA-04-1336-01	TCGA-04-1336-11	TGTTCCTTTCAGCACC	TGTTCCTTTCAGCACC	TGTTCCTTTCAGCACC	-	TGTTCCTTTCAGCACC	TGTTCCTTTCAGCACC	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:176915067_176915082delTGTTCCTTTCAGCACC	ENST00000367654.3	-	13	2464_2479	c.2253_2268delGGTGCTGAAAGGAACA	c.(2251-2268)caggtgctgaaaggaacafs	p.QVLKGT751fs	ASTN1_ENST00000424564.2_Frame_Shift_Del_p.QVLKGT743fs|ASTN1_ENST00000367657.3_Frame_Shift_Del_p.QVLKGT743fs|ASTN1_ENST00000361833.2_Frame_Shift_Del_p.QVLKGT743fs|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	751					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.Q743fs*11(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TTTACCTGAATGTTCCTTTCAGCACCTGTCCGGCAG	0.454																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								175181705	SO:0001589	frameshift_variant	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2253_2268delGGTGCTGAAAGGAACA	1.37:g.176915067_176915082delTGTTCCTTTCAGCACC	ENSP00000356626:p.Gln751fs		175181690	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Frame_Shift_Del	DEL	ENST00000367654.3	37		DEL	51	WashU																																																																																				0.454	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		Frame_Shift_Del
SFPQ	6421	genome.wustl.edu	37	1	35654799	35654807	+	In_Frame_Del	DEL	GATTTGCCT	GATTTGCCT	-			TCGA-04-1336-01	TCGA-04-1336-11	GATTTGCCT	GATTTGCCT	GATTTGCCT	-	GATTTGCCT	GATTTGCCT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr1:35654799_35654807delGATTTGCCT	ENST00000357214.5	-	5	1690_1698	c.1592_1600delAGGCAAATC	c.(1591-1602)caggcaaatctt>ctt	p.QAN531del		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	531					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Q531_N533del(1)	SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TGGCGCAAAAGATTTGCCTGATGTTCATG	0.349			T	TFE3	papillary renal cell																																		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	1	Deletion - In frame(1)	ovary(1)	1																																								35427394	SO:0001651	inframe_deletion	6421			X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1592_1600delAGGCAAATC	1.37:g.35654799_35654807delGATTTGCCT	ENSP00000349748:p.Gln531_Asn533del		35427386	P30808|Q5SZ71	In_Frame_Del	DEL	ENST00000357214.5	37	CCDS388.1	DEL	33	WashU																																																																																				0.349	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066		In_Frame_Del
SLC1A2	6506	genome.wustl.edu	37	11	35308473	35308479	+	Frame_Shift_Del	DEL	GAAAGGT	GAAAGGT	-	rs141932906	byFrequency	TCGA-04-1336-01	TCGA-04-1336-11	GAAAGGT	GAAAGGT	GAAAGGT	-	GAAAGGT	GAAAGGT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr11:35308473_35308479delGAAAGGT	ENST00000278379.3	-	8	1393_1399	c.1111_1117delACCTTTC	c.(1111-1119)acctttcgtfs	p.TFR371fs	SLC1A2_ENST00000606205.1_Frame_Shift_Del_p.TFR371fs|SLC1A2_ENST00000479543.1_5'Flank|SLC1A2_ENST00000395753.1_Frame_Shift_Del_p.TFR362fs|RP1-68D18.3_ENST00000532760.1_RNA|SLC1A2_ENST00000395750.1_Frame_Shift_Del_p.TFR362fs	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	371					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.T371fs*13(1)|p.R373C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			TCCAGGCAACGAAAGGTGACAGGCAAA	0.459																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	11																																								35265055	SO:0001589	frameshift_variant	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1111_1117delACCTTTC	11.37:g.35308473_35308479delGAAAGGT	ENSP00000278379:p.Thr371fs		35265049	B4DQE9|Q14417|Q541G6|U3KQQ4	Frame_Shift_Del	DEL	ENST00000278379.3	37	CCDS31459.1	DEL	37	WashU																																																																																				0.459	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171		Frame_Shift_Del
SHROOM3	57619	genome.wustl.edu	37	4	77661181	77661190	+	Frame_Shift_Del	DEL	TCTTCCAGGC	TCTTCCAGGC	-	rs140590590		TCGA-04-1336-01	TCGA-04-1336-11	TCTTCCAGGC	TCTTCCAGGC	TCTTCCAGGC	-	TCTTCCAGGC	TCTTCCAGGC	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr4:77661181_77661190delTCTTCCAGGC	ENST00000296043.6	+	5	2808_2817	c.1855_1864delTCTTCCAGGC	c.(1855-1866)tcttccaggctcfs	p.SSRL619fs		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	619					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.S619fs*25(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AGACAAGAGATCTTCCAGGCTCTCAGAGCC	0.562																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								77880214	SO:0001589	frameshift_variant	57619			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1855_1864delTCTTCCAGGC	4.37:g.77661181_77661190delTCTTCCAGGC	ENSP00000296043:p.Ser619fs		77880205	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Del	DEL	ENST00000296043.6	37	CCDS3579.2	DEL	50	WashU																																																																																				0.562	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		Frame_Shift_Del
CSMD1	64478	genome.wustl.edu	37	8	2876120	2876124	+	Frame_Shift_Del	DEL	CGTTC	CGTTC	-	rs374916113		TCGA-04-1336-01	TCGA-04-1336-11	CGTTC	CGTTC	CGTTC	-	CGTTC	CGTTC	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr8:2876120_2876124delCGTTC	ENST00000520002.1	-	53	8462_8466	c.7907_7911delGAACG	c.(7906-7911)ggaacgfs	p.GT2636fs	CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000537824.1_Frame_Shift_Del_p.GT2635fs|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Frame_Shift_Del_p.GT2636fs			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2636	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T2636T(2)|p.T2365T(2)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAACTGTCAACGTTCCAATCTTGTT	0.459																																																4	Substitution - coding silent(4)	large_intestine(2)|prostate(2)	8																																								2863531	SO:0001589	frameshift_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7907_7911delGAACG	8.37:g.2876120_2876124delCGTTC	ENSP00000430733:p.Gly2636fs		2863527	Q0H0J5|Q96QU9|Q96RM4	Frame_Shift_Del	DEL	ENST00000520002.1	37		DEL	19	WashU																																																																																				0.459	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		Frame_Shift_Del
MYO19	80179	genome.wustl.edu	37	17	34883526	34883526	+	Silent	SNP	C	C	A			TCGA-04-1336-01	TCGA-04-1336-11	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr17:34883526C>A	ENST00000431794.3	-	5	678	c.156G>T	c.(154-156)ctG>ctT	p.L52L	MYO19_ENST00000586007.1_Silent_p.L52L|MYO19_ENST00000268852.9_Silent_p.L52L|MYO19_ENST00000544606.1_Intron	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	52	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L52L(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GCAGGCACCTCAGGACTGAGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	17											58.0	61.0	60.0					17																	34883526		2006	4179	6185	31957639	SO:0001819	synonymous_variant	80179			BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.156G>T	17.37:g.34883526C>A			31957639	Q59GS4|Q9H5X2	Silent	SNP	ENST00000431794.3	37	CCDS54112.1	SNP	29	WashU																																																																																				0.512	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109		Silent
MYT1	4661	genome.wustl.edu	37	20	62871745	62871745	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1336-01	TCGA-04-1336-11	G	G	G	C	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1336-01	TCGA-04-1336-11	g.chr20:62871745G>C	ENST00000328439.1	+	23	3674	c.3310G>C	c.(3310-3312)Gag>Cag	p.E1104Q	MYT1_ENST00000536311.1_Missense_Mutation_p.E1131Q	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1104Q(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CCAGGACCCGGAGAACAAGGA	0.552																																					GBM(59;481 1041 20555 21139 33705)											1	Substitution - Missense(1)	ovary(1)	20											120.0	95.0	103.0					20																	62871745		2203	4300	6503	62342189	SO:0001583	missense	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.3310G>C	20.37:g.62871745G>C	ENSP00000327465:p.Glu1104Gln		62342189	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832626	0.71258	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.52754	0.66;0.65	5.42	5.42	0.78866	.	0.117709	0.56097	D	0.000037	T	0.67135	0.2861	M	0.78637	2.42	0.80722	D	1	P;D	0.59357	0.905;0.985	P;P	0.56865	0.745;0.808	T	0.70927	-0.4739	10	0.72032	D	0.01	-11.8077	19.5679	0.95403	0.0:0.0:1.0:0.0	.	1131;1104	F5H7M8;Q01538	.;MYT1_HUMAN	Q	1104;1131	ENSP00000327465:E1104Q;ENSP00000442412:E1131Q	ENSP00000327465:E1104Q	E	+	1	0	MYT1	62342189	1.000000	0.71417	0.820000	0.32676	0.970000	0.65996	9.725000	0.98778	2.702000	0.92279	0.655000	0.94253	GAG		0.552	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535		Missense_Mutation
