#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCA3	21	hgsc.bcm.edu	37	16	2336768	2336768	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr16:2336768G>A	ENST00000301732.5	-	22	3905	c.3205C>T	c.(3205-3207)Cac>Tac	p.H1069Y	ABCA3_ENST00000382381.3_Missense_Mutation_p.H1011Y	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1069			H -> Q (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.H1069Y(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	ATGGAGGCGTGAGGCCCGCAC	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											123.0	122.0	122.0					16																	2336768		2198	4300	6498	2276769	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3205C>T	16.37:g.2336768G>A	ENSP00000301732:p.His1069Tyr		2276769	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.014	0.758176	0.15846	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.86956	-2.19	4.5	2.29	0.28610	.	1.159090	0.06019	N	0.651037	T	0.75064	0.3799	N	0.08118	0	0.21697	N	0.999589	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.64457	-0.6403	10	0.59425	D	0.04	.	6.9728	0.24658	0.0:0.3028:0.4535:0.2437	.	1073;1069	Q4LE27;Q99758	.;ABCA3_HUMAN	Y	1069;1073	ENSP00000301732:H1069Y	ENSP00000301732:H1069Y	H	-	1	0	ABCA3	2276769	0.661000	0.27430	0.012000	0.15200	0.132000	0.20833	2.928000	0.48908	1.203000	0.43233	0.555000	0.69702	CAC		0.622	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		Missense_Mutation
ADAMTS13	11093	hgsc.bcm.edu	37	9	136310027	136310027	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:136310027G>C	ENST00000371929.3	+	20	2908	c.2464G>C	c.(2464-2466)Gca>Cca	p.A822P	ADAMTS13_ENST00000536611.1_Missense_Mutation_p.S343T|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.A791P|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.A822P	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	822	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A822P(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AGCTGGTGGAGCAGGCCTGGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											68.0	51.0	56.0					9																	136310027		2203	4300	6503	135299848	SO:0001583	missense	11093			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2464G>C	9.37:g.136310027G>C	ENSP00000360997:p.Ala822Pro		135299848	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	SNP	34	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.480|5.480	0.273556|0.273556	0.10403|0.10403	.|.	.|.	ENSG00000160323|ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589|ENST00000536611	T;T;T|T	0.69306|0.62639	-0.35;-0.39;-0.37|0.01	4.37|4.37	-2.03|-2.03	0.07365|0.07365	.|.	.|.	.|.	.|.	.|.	T|T	0.45935|0.45935	0.1367|0.1367	L|L	0.35487|0.35487	1.065|1.065	0.09310|0.09310	N|N	1|1	B;B;B|.	0.09022|.	0.002;0.001;0.001|.	B;B;B|.	0.09377|.	0.003;0.004;0.004|.	T|T	0.40156|0.40156	-0.9578|-0.9578	9|7	0.20519|0.38643	T|T	0.43|0.18	.|.	2.6047|2.6047	0.04875|0.04875	0.2693:0.4098:0.21:0.1109|0.2693:0.4098:0.21:0.1109	.|.	822;791;822|.	Q76LX8;Q76LX8-3;Q76LX8-2|.	ATS13_HUMAN;.;.|.	P|T	822;822;791|343	ENSP00000360997:A822P;ENSP00000347927:A822P;ENSP00000348997:A791P|ENSP00000444504:S343T	ENSP00000347927:A822P|ENSP00000444504:S343T	A|S	+|+	1|2	0|0	ADAMTS13|ADAMTS13	135299848|135299848	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.048000|0.048000	0.14542|0.14542	-0.814000|-0.814000	0.04486|0.04486	-0.295000|-0.295000	0.08960|0.08960	0.561000|0.561000	0.74099|0.74099	GCA|AGC		0.627	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		Missense_Mutation
AGPAT6	137964	hgsc.bcm.edu	37	8	41467253	41467253	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr8:41467253C>A	ENST00000396987.3	+	4	1242	c.315C>A	c.(313-315)gaC>gaA	p.D105E	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	105					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			AGGCTCTGGACAACACTCCAG	0.443																																																0			8											108.0	102.0	104.0					8																	41467253		2203	4300	6503	41586410	SO:0001583	missense	137964			AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.315C>A	8.37:g.41467253C>A	ENSP00000380184:p.Asp105Glu		41586410	Q86V89	Missense_Mutation	SNP	ENST00000396987.3	37	CCDS6117.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969719	0.34754	.	.	ENSG00000158669	ENST00000396987;ENST00000519853	T	0.39592	1.07	4.82	1.11	0.20524	.	0.213809	0.37715	N	0.001974	T	0.23886	0.0578	L	0.33485	1.01	0.38058	D	0.935995	B	0.12630	0.006	B	0.12156	0.007	T	0.27839	-1.0062	10	0.02654	T	1	.	8.8419	0.35146	0.0:0.5738:0.0:0.4262	.	105	Q86UL3	GPAT4_HUMAN	E	105;59	ENSP00000380184:D105E	ENSP00000380184:D105E	D	+	3	2	AGPAT6	41586410	0.986000	0.35501	0.994000	0.49952	0.982000	0.71751	0.121000	0.15667	0.089000	0.17243	-0.471000	0.05019	GAC		0.443	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819		Missense_Mutation
ANGPTL2	23452	hgsc.bcm.edu	37	9	129870335	129870335	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:129870335G>T	ENST00000373425.3	-	2	1293	c.676C>A	c.(676-678)Caa>Aaa	p.Q226K	RALGPS1_ENST00000373436.1_Intron|RALGPS1_ENST00000373434.1_Intron|ANGPTL2_ENST00000373417.1_Intron|RALGPS1_ENST00000424082.2_Intron|ANGPTL2_ENST00000491991.1_5'Flank|RALGPS1_ENST00000394022.3_Intron|RALGPS1_ENST00000259351.5_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	226					multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						GTGGGTGGTTGGTAGACCCGG	0.642																																																0			9											59.0	52.0	54.0					9																	129870335		2203	4300	6503	128910156	SO:0001583	missense	23452			AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.676C>A	9.37:g.129870335G>T	ENSP00000362524:p.Gln226Lys		128910156	Q5JT58|Q8NCH7	Missense_Mutation	SNP	ENST00000373425.3	37	CCDS6868.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.526	0.657677	0.14645	.	.	ENSG00000136859	ENST00000373425	T	0.37584	1.19	5.17	5.17	0.71159	.	0.507377	0.23718	N	0.045243	T	0.24812	0.0602	L	0.38175	1.15	0.80722	D	1	B	0.28820	0.224	B	0.21546	0.035	T	0.04140	-1.0974	10	0.06099	T	0.92	.	13.9311	0.63996	0.0:0.0:0.8479:0.1521	.	226	Q9UKU9	ANGL2_HUMAN	K	226	ENSP00000362524:Q226K	ENSP00000362524:Q226K	Q	-	1	0	ANGPTL2	128910156	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.628000	0.83189	2.564000	0.86499	0.655000	0.94253	CAA		0.642	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054129.1	NM_012098		Missense_Mutation
ANGPTL2	23452	hgsc.bcm.edu	37	9	129870339	129870339	+	Silent	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:129870339G>A	ENST00000373425.3	-	2	1289	c.672C>T	c.(670-672)gtC>gtT	p.V224V	RALGPS1_ENST00000373436.1_Intron|RALGPS1_ENST00000373434.1_Intron|ANGPTL2_ENST00000373417.1_Intron|RALGPS1_ENST00000424082.2_Intron|ANGPTL2_ENST00000491991.1_5'Flank|RALGPS1_ENST00000394022.3_Intron|RALGPS1_ENST00000259351.5_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	224					multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.V224V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						GTGGTTGGTAGACCCGGGGCG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9											54.0	48.0	50.0					9																	129870339		2203	4300	6503	128910160	SO:0001819	synonymous_variant	23452			AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.672C>T	9.37:g.129870339G>A			128910160	Q5JT58|Q8NCH7	Silent	SNP	ENST00000373425.3	37	CCDS6868.1	SNP	33	Baylor																																																																																				0.632	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054129.1	NM_012098		Silent
ARHGAP20	57569	hgsc.bcm.edu	37	11	110450220	110450221	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-04-1337-01	TCGA-04-1337-11	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:110450220_110450221delAG	ENST00000260283.4	-	16	3733_3734	c.3449_3450delCT	c.(3448-3450)tctfs	p.S1151fs	ARHGAP20_ENST00000524756.1_Frame_Shift_Del_p.S1128fs|ARHGAP20_ENST00000528829.1_Frame_Shift_Del_p.S1115fs|ARHGAP20_ENST00000529591.1_Frame_Shift_Del_p.S694fs|ARHGAP20_ENST00000357139.3_Frame_Shift_Del_p.S1125fs|ARHGAP20_ENST00000527598.1_Frame_Shift_Del_p.S1115fs|ARHGAP20_ENST00000533353.1_Frame_Shift_Del_p.S1125fs	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1151					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S1150fs*33(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GAGAACCAGAAGAGCTCTGACT	0.54																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								109955431	SO:0001589	frameshift_variant	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.3449_3450delCT	11.37:g.110450222_110450223delAG	ENSP00000260283:p.Ser1151fs		109955430	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Frame_Shift_Del	DEL	ENST00000260283.4	37	CCDS31673.1	DEL	3	Baylor																																																																																				0.540	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809		Frame_Shift_Del
ATP8B3	148229	hgsc.bcm.edu	37	19	1783212	1783212	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:1783212G>A	ENST00000310127.6	-	29	3956	c.3718C>T	c.(3718-3720)Cat>Tat	p.H1240Y	ATP8B3_ENST00000525591.1_Missense_Mutation_p.H1203Y|ATP8B3_ENST00000539485.1_Missense_Mutation_p.H1250Y	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1240					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.H1250Y(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGTGTACATGAGGCAAGGGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											39.0	40.0	40.0					19																	1783212		1982	4131	6113	1734212	SO:0001583	missense	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3718C>T	19.37:g.1783212G>A	ENSP00000311336:p.His1240Tyr		1734212	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.086	-1.174652	0.01646	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.38887	1.11;1.11;1.11	4.43	-1.19	0.09585	.	1.761390	0.03119	N	0.163422	T	0.30792	0.0776	L	0.32530	0.975	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.32052	-0.9921	10	0.02654	T	1	.	12.6059	0.56523	0.1397:0.0:0.8603:0.0	.	1240;1203	O60423;Q7Z485	AT8B3_HUMAN;.	Y	1240;1250;1203	ENSP00000311336:H1240Y;ENSP00000443574:H1250Y;ENSP00000437115:H1203Y	ENSP00000311336:H1240Y	H	-	1	0	ATP8B3	1734212	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.073000	0.11468	-0.088000	0.12506	0.549000	0.68633	CAT		0.587	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		Missense_Mutation
B3GAT1	27087	hgsc.bcm.edu	37	11	134252764	134252764	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:134252764A>G	ENST00000524765.1	-	4	5302	c.758T>C	c.(757-759)aTa>aCa	p.I253T	B3GAT1_ENST00000312527.4_Missense_Mutation_p.I253T|B3GAT1_ENST00000537389.1_Missense_Mutation_p.I266T|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000392580.1_Missense_Mutation_p.I253T			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	253	Interaction with galactose moiety of substrate glycoprotein.				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		AGCCATGTCTATTGCAAATGG	0.622																																																0			11											82.0	67.0	72.0					11																	134252764		2201	4297	6498	133757974	SO:0001583	missense	27087			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.758T>C	11.37:g.134252764A>G	ENSP00000433847:p.Ile253Thr		133757974	Q96FS7	Missense_Mutation	SNP	ENST00000524765.1	37	CCDS8500.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	33	5.241269	0.95272	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.22	5.22	0.72569	.	0.041537	0.85682	D	0.000000	T	0.81235	0.4780	M	0.64567	1.98	0.80722	D	1	P;P	0.52463	0.942;0.953	P;D	0.65987	0.901;0.94	T	0.82106	-0.0621	10	0.52906	T	0.07	-28.1408	15.2511	0.73545	1.0:0.0:0.0:0.0	.	266;253	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	T	253;253;253;266	ENSP00000376359:I253T;ENSP00000307875:I253T;ENSP00000433847:I253T;ENSP00000445983:I266T	ENSP00000307875:I253T	I	-	2	0	B3GAT1	133757974	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	9.134000	0.94467	2.197000	0.70478	0.402000	0.26972	ATA		0.622	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1	NM_018644		Missense_Mutation
BOC	91653	hgsc.bcm.edu	37	3	112998812	112998812	+	Missense_Mutation	SNP	C	C	A	rs368545065		TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr3:112998812C>A	ENST00000495514.1	+	13	2866	c.2162C>A	c.(2161-2163)aCg>aAg	p.T721K	BOC_ENST00000355385.3_Missense_Mutation_p.T721K|BOC_ENST00000273395.4_Missense_Mutation_p.T722K			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	721	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.T721K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			ATCACCTTCACGGATGCGGTC	0.637																																																1	Substitution - Missense(1)	ovary(1)	3											56.0	51.0	53.0					3																	112998812		2203	4300	6503	114481502	SO:0001583	missense	91653			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2162C>A	3.37:g.112998812C>A	ENSP00000418663:p.Thr721Lys		114481502	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474558	0.84640	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.53423	0.62;0.62;0.62	5.53	5.53	0.82687	Fibronectin, type III (4);	0.114427	0.64402	D	0.000010	T	0.69663	0.3136	M	0.70275	2.135	0.49915	D	0.999839	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.96;0.993;0.996	T	0.69510	-0.5126	10	0.49607	T	0.09	.	19.4493	0.94860	0.0:1.0:0.0:0.0	.	538;722;721	Q9BWV1-2;Q9BWV1-3;Q9BWV1	.;.;BOC_HUMAN	K	721;722;721	ENSP00000418663:T721K;ENSP00000273395:T722K;ENSP00000347546:T721K	ENSP00000273395:T722K	T	+	2	0	BOC	114481502	1.000000	0.71417	0.955000	0.39395	0.800000	0.45204	4.465000	0.60141	2.593000	0.87608	0.563000	0.77884	ACG		0.637	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		Missense_Mutation
C17orf53	78995	hgsc.bcm.edu	37	17	42225949	42225949	+	Frame_Shift_Del	DEL	C	C	-			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:42225949delC	ENST00000319977.4	+	3	1015	c.778delC	c.(778-780)cccfs	p.P260fs	C17orf53_ENST00000245382.6_Frame_Shift_Del_p.P260fs|C17orf53_ENST00000585683.1_Frame_Shift_Del_p.P260fs	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	260								p.T261fs*48(1)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTTAACAGTTCCCACTCAGCA	0.557																																																1	Deletion - Frameshift(1)	ovary(1)	17											109.0	96.0	100.0					17																	42225949		2203	4300	6503	39581475	SO:0001589	frameshift_variant	78995			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.778delC	17.37:g.42225949delC	ENSP00000313500:p.Pro260fs		39581475	A8K7A9|Q9BWM9|Q9HAI1	Frame_Shift_Del	DEL	ENST00000319977.4	37	CCDS11477.1	DEL	30	Baylor																																																																																				0.557	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032		Frame_Shift_Del
CABIN1	23523	hgsc.bcm.edu	37	22	24483449	24483449	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr22:24483449T>A	ENST00000398319.2	+	23	3693	c.3308T>A	c.(3307-3309)aTt>aAt	p.I1103N	CABIN1_ENST00000263119.5_Missense_Mutation_p.I1103N|CABIN1_ENST00000405822.2_Missense_Mutation_p.I1053N	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1103					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.Q1104fs*4(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCCAGCCGCATTCAGGACAAG	0.542																																																1	Deletion - Frameshift(1)	ovary(1)	22											65.0	60.0	61.0					22																	24483449		2203	4300	6503	22813449	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3308T>A	22.37:g.24483449T>A	ENSP00000381364:p.Ile1103Asn		22813449	G5E9F3|Q6PHY0|Q9Y460	Indel	Indel	ENST00000398319.2	37	CCDS13823.1	Indel	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610513	0.87258	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.77229	-1.08;-1.08;-1.08	5.1	5.1	0.69264	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.86859	0.6034	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	D	0.88443	0.3043	10	0.87932	D	0	.	14.4385	0.67298	0.0:0.0:0.0:1.0	.	1053;1103	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	N	1103;1053;1103	ENSP00000263119:I1103N;ENSP00000384694:I1053N;ENSP00000381364:I1103N	ENSP00000263119:I1103N	I	+	2	0	CABIN1	22813449	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.923000	0.87546	2.077000	0.62373	0.529000	0.55759	ATT		0.542	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295		Indel
CACNG3	10368	hgsc.bcm.edu	37	16	24358110	24358110	+	Nonsense_Mutation	SNP	C	C	A	rs368528326		TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr16:24358110C>A	ENST00000005284.3	+	2	1469	c.267C>A	c.(265-267)taC>taA	p.Y89*		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	89					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.Y89*(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ATGCTGACTACGAACAGGACA	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	16											88.0	80.0	83.0					16																	24358110		2197	4300	6497	24265611	SO:0001587	stop_gained	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.267C>A	16.37:g.24358110C>A	ENSP00000005284:p.Tyr89*		24265611		Nonsense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	46	12.147800	0.99640	.	.	ENSG00000006116	ENST00000005284	.	.	.	5.61	-8.54	0.00912	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4901	19.5557	0.95347	0.0:0.1875:0.0:0.8125	.	.	.	.	X	89	.	ENSP00000005284:Y89X	Y	+	3	2	CACNG3	24265611	0.000000	0.05858	0.533000	0.28001	0.920000	0.55202	-2.072000	0.01377	-1.727000	0.01368	-0.126000	0.14955	TAC		0.562	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		Nonsense_Mutation
CCDC60	160777	hgsc.bcm.edu	37	12	119942987	119942987	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr12:119942987G>A	ENST00000327554.2	+	7	1227	c.762G>A	c.(760-762)atG>atA	p.M254I	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	254										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AGAGCAGCATGATCTCTGTGA	0.577																																																0			12											133.0	137.0	136.0					12																	119942987		2203	4300	6503	118427370	SO:0001583	missense	160777			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.762G>A	12.37:g.119942987G>A	ENSP00000333374:p.Met254Ile		118427370		Missense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036953	0.54896	.	.	ENSG00000183273	ENST00000327554	T	0.22945	1.93	5.07	5.07	0.68467	.	0.113777	0.40640	N	0.001050	T	0.49029	0.1533	M	0.72479	2.2	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.45977	-0.9224	9	.	.	.	-38.803	13.9816	0.64308	0.0:0.0:1.0:0.0	.	254	Q8IWA6	CCD60_HUMAN	I	254	ENSP00000333374:M254I	.	M	+	3	0	CCDC60	118427370	0.999000	0.42202	0.965000	0.40720	0.829000	0.46940	4.489000	0.60309	2.340000	0.79590	0.650000	0.86243	ATG		0.577	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499		Missense_Mutation
CCDC93	54520	hgsc.bcm.edu	37	2	118705717	118705717	+	Silent	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr2:118705717C>T	ENST00000376300.2	-	15	1325	c.1188G>A	c.(1186-1188)ctG>ctA	p.L396L	CCDC93_ENST00000319432.5_Silent_p.L395L	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	396										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CTTGACTTTTCAGATTTTCAT	0.373																																																0			2											245.0	244.0	244.0					2																	118705717		2203	4300	6503	118422187	SO:0001819	synonymous_variant	54520			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.1188G>A	2.37:g.118705717C>T			118422187	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Silent	SNP	ENST00000376300.2	37	CCDS2121.2	SNP	29	Baylor																																																																																				0.373	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044		Silent
CD79A	973	hgsc.bcm.edu	37	19	42385046	42385046	+	Silent	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:42385046G>A	ENST00000221972.3	+	5	865	c.680G>A	c.(679-681)tGa>tAa	p.*227*	ARHGEF1_ENST00000354532.3_5'Flank|ARHGEF1_ENST00000599846.1_5'Flank|ARHGEF1_ENST00000347545.4_5'Flank|CD79A_ENST00000444740.2_Silent_p.*189*	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	0					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						GAGAAGCCGTGACACCCCTAC	0.622			"""O, S"""		DLBCL																																		Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	0			19											23.0	17.0	19.0					19																	42385046		2190	4274	6464	47076886	SO:0001819	synonymous_variant	973			M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.680G>A	19.37:g.42385046G>A			47076886	A0N775|Q53FB8	Silent	SNP	ENST00000221972.3	37	CCDS12589.1	SNP	45	Baylor																																																																																				0.622	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463058.1			Silent
CDC27	996	hgsc.bcm.edu	37	17	45216160	45216160	+	Missense_Mutation	SNP	A	A	C	rs199626169		TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:45216160A>C	ENST00000066544.3	-	13	1742	c.1649T>G	c.(1648-1650)gTt>gGt	p.V550G	CDC27_ENST00000531206.1_Missense_Mutation_p.V556G|CDC27_ENST00000446365.2_Missense_Mutation_p.V489G|CDC27_ENST00000527547.1_Missense_Mutation_p.V549G	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	550					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V550G(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAAAGAGCAACATCTTTTTG	0.353																																																1	Substitution - Missense(1)	ovary(1)	17											46.0	52.0	50.0					17																	45216160		2202	4298	6500	42571159	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1649T>G	17.37:g.45216160A>C	ENSP00000066544:p.Val550Gly		42571159	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.9	4.578520	0.86645	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.69306	-0.39;-0.39;-0.12;-0.38	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.81197	0.4772	M	0.78637	2.42	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.74023	0.964;0.982;0.982;0.964	D	0.83770	0.0219	10	0.87932	D	0	-17.0982	13.6948	0.62572	1.0:0.0:0.0:0.0	.	489;549;556;550	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	G	550;556;489;549	ENSP00000066544:V550G;ENSP00000434614:V556G;ENSP00000392802:V489G;ENSP00000437339:V549G	ENSP00000066544:V550G	V	-	2	0	CDC27	42571159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.117000	0.64856	0.528000	0.53228	GTT		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			Missense_Mutation
CDK11A	728642	hgsc.bcm.edu	37	1	1650797	1650797	+	Splice_Site	SNP	A	A	G	rs1059830	byFrequency	TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr1:1650797A>G	ENST00000378633.1	-	4	404	c.325T>C	c.(325-327)Tgg>Cgg	p.W109R	CDK11A_ENST00000358779.5_Splice_Site_p.W109R|CDK11A_ENST00000404249.3_Missense_Mutation_p.C109R|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000378638.2_Missense_Mutation_p.C75R|CDK11A_ENST00000356200.3_Missense_Mutation_p.C75R|CDK11A_ENST00000378635.3_Splice_Site_p.W109R|CDK11A_ENST00000357760.2_Splice_Site_p.W109R			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	109	Glu-rich.			Missing (in Ref. 1; AAA19594/AAA19595). {ECO:0000305}.	apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.W109R(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TGATGCCTACATTTTTCTTTT	0.408																																					Pancreas(186;965 2119 30274 40311 50569)											1	Substitution - Missense(1)	ovary(1)	1																																								1640657	SO:0001630	splice_region_variant	984			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.325+1T>C	1.37:g.1650797A>G			1640657	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Splice_Site_SNP	SNP	ENST00000378633.1	37		SNP	8	Baylor	1091|1091	0.49954212454212454|0.49954212454212454	246|246	0.5|0.5	181|181	0.5|0.5	286|286	0.5|0.5	378|378	0.49868073878627966|0.49868073878627966	-|-	3.151|3.151	-0.174157|-0.174157	0.06421|0.06421	.|.	.|.	ENSG00000008128|ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000378638;ENST00000378630|ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378635;ENST00000479362	T;T;T|T;T;T;T;T	0.19394|0.06142	2.15;2.15;2.15|3.34;3.34;3.34;3.34;3.34	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	.|0.367032	.|0.23296	.|N	.|0.049733	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.01168|0.01168	-0.975|-0.975	0.21822|0.21822	N|N	0.999521|0.999521	B;B;B;B|B;B;B	0.15141|0.15930	0.002;0.0;0.012;0.007|0.002;0.015;0.0	B;B;B;B|B;B;B	0.04013|0.10450	0.0;0.001;0.0;0.0|0.0;0.005;0.0	T|T	0.48410|0.48410	-0.9038|-0.9038	9|9	0.02654|.	T|.	1|.	.|.	12.4561|12.4561	0.55706|0.55706	0.0807:0.0:0.9193:0.0|0.0807:0.0:0.9193:0.0	rs1059830;rs17845217;rs17858030|rs1059830;rs17845217;rs17858030	109;109;109;75|109;109;109	B4E0M9;E7ESP2;Q9UQ88-2;Q5QPR4|B4E0N4;Q5QPR3;Q9UQ88-4	.;.;.;.|.;.;.	R|R	75;109;75;75|109	ENSP00000348529:C75R;ENSP00000384442:C109R;ENSP00000367905:C75R|ENSP00000350403:W109R;ENSP00000351629:W109R;ENSP00000367900:W109R;ENSP00000367902:W109R;ENSP00000423900:W109R	ENSP00000348529:C75R|.	C|W	-|-	1|1	0|0	CDK11A|CDK11A	1640657|1640657	1.000000|1.000000	0.71417|0.71417	0.936000|0.936000	0.37596|0.37596	0.980000|0.980000	0.70556|0.70556	4.389000|4.389000	0.59639|0.59639	1.053000|1.053000	0.40415|0.40415	-0.119000|-0.119000	0.15052|0.15052	TGT|TGG		0.408	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1	NM_024011	Missense_Mutation	Splice_Site_SNP
CDH1	999	hgsc.bcm.edu	37	16	68845700	68845700	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr16:68845700A>G	ENST00000261769.5	+	7	1137	c.946A>G	c.(946-948)Atg>Gtg	p.M316V	CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Missense_Mutation_p.M316V	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	316	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.M316V(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGACAAAAATATGTTCACCAT	0.547			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|breast(1)	16											112.0	96.0	101.0					16																	68845700		2198	4300	6498	67403201	SO:0001583	missense	999	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.946A>G	16.37:g.68845700A>G	ENSP00000261769:p.Met316Val		67403201	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	37	CCDS10869.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.19	1.280944	0.23392	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.52057	0.68;0.68	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.094167	0.46758	D	0.000262	T	0.56645	0.1999	L	0.39085	1.19	0.45250	D	0.998251	D;P	0.61080	0.989;0.903	P;P	0.62435	0.902;0.527	T	0.60052	-0.7338	10	0.66056	D	0.02	.	15.0395	0.71777	1.0:0.0:0.0:0.0	.	316;316	Q9UII8;P12830	.;CADH1_HUMAN	V	316	ENSP00000261769:M316V;ENSP00000414946:M316V	ENSP00000261769:M316V	M	+	1	0	CDH1	67403201	1.000000	0.71417	0.911000	0.35937	0.033000	0.12548	4.751000	0.62169	2.090000	0.63153	0.459000	0.35465	ATG		0.547	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360		Missense_Mutation
CDH23	64072	hgsc.bcm.edu	37	10	73461787	73461787	+	Silent	SNP	T	T	G			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr10:73461787T>G	ENST00000224721.6	+	22	2426	c.2421T>G	c.(2419-2421)gcT>gcG	p.A807A	CDH23_ENST00000299366.7_Silent_p.A847A	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	802	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGGTGGTGGCTGTTGACCCAG	0.637																																																0			10											58.0	70.0	66.0					10																	73461787		2089	4206	6295	73131793	SO:0001819	synonymous_variant	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2421T>G	10.37:g.73461787T>G			73131793	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	37		SNP	55	Baylor																																																																																				0.637	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		Silent
CEACAM18	729767	hgsc.bcm.edu	37	19	51981792	51981792	+	5'Flank	SNP	C	C	T	rs140323408	byFrequency	TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:51981792C>T	ENST00000396477.4	+	0	0				CEACAM18_ENST00000451626.1_Nonsense_Mutation_p.R27*	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18									p.R27*(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGCTGGGAGACGAGACCGGCA	0.647													c|||	14	0.00279553	0.0098	0.0014	5008	,	,		12918	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Nonsense(1)	ovary(1)	19						C	stop/ARG	6,3882		0,6,1938	13.0	16.0	15.0		79	-5.0	0.0	19	dbSNP_134	15	0,8278		0,0,4139	yes	stop-gained	CEACAM18	NM_001080405.1		0,6,6077	TT,TC,CC		0.0,0.1543,0.0493		27/399	51981792	6,12160	1944	4139	6083	56673604	SO:0001631	upstream_gene_variant	729767					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9			19.37:g.51981792C>T	Exception_encountered		56673604	C9JN24	Nonsense_Mutation	SNP	ENST00000396477.4	37		SNP	19	Baylor	15	0.006868131868131868	15	0.03048780487804878	0	0.0	0	0.0	0	0.0	.	13.75	2.330880	0.41297	0.001543	0.0	ENSG00000213822	ENST00000451626	.	.	.	2.51	-5.01	0.02991	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.3422	0.02156	0.2541:0.3772:0.2242:0.1444	.	.	.	.	X	27	.	ENSP00000402203:R27X	R	+	1	2	CEACAM18	56673604	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.690000	0.05138	-0.948000	0.03668	-2.366000	0.00237	CGA		0.647	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			Nonsense_Mutation
CELSR3	1951	hgsc.bcm.edu	37	3	48684346	48684346	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr3:48684346C>T	ENST00000164024.4	-	21	7425	c.7145G>A	c.(7144-7146)aGc>aAc	p.S2382N	MIR4793_ENST00000577502.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.S2387N	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2382					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S2382N(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TTCTATGCTGCTGCTTGTGGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	3											41.0	38.0	39.0					3																	48684346		2181	4285	6466	48659350	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.7145G>A	3.37:g.48684346C>T	ENSP00000164024:p.Ser2382Asn		48659350	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	c	5.495	0.276319	0.10403	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70631	-0.5;-0.5	5.36	4.47	0.54385	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.58047	0.2095	L	0.36672	1.1	0.09310	N	1	B;B	0.25904	0.137;0.001	B;B	0.24394	0.053;0.008	T	0.42413	-0.9453	9	0.16420	T	0.52	.	10.3429	0.43889	0.0:0.7903:0.1366:0.073	.	2382;2452	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	N	2382;2387	ENSP00000164024:S2382N;ENSP00000445694:S2387N	ENSP00000164024:S2382N	S	-	2	0	CELSR3	48659350	0.998000	0.40836	0.393000	0.26258	0.253000	0.25986	2.971000	0.49248	1.247000	0.43917	0.556000	0.70494	AGC		0.572	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Missense_Mutation
CFP	5199	hgsc.bcm.edu	37	X	47489234	47489234	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:47489234C>T	ENST00000396992.3	-	1	130	c.10G>A	c.(10-12)Gag>Aag	p.E4K	CFP_ENST00000247153.3_Missense_Mutation_p.E4K|CFP_ENST00000480317.1_5'UTR|CFP_ENST00000377005.2_Missense_Mutation_p.E4K	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	4					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.E4K(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						TGCGCTCCCTCTGTGATCATG	0.632																																																1	Substitution - Missense(1)	ovary(1)	X											25.0	23.0	24.0					X																	47489234		2109	4034	6143	47374178	SO:0001583	missense	5199			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.10G>A	X.37:g.47489234C>T	ENSP00000380189:p.Glu4Lys		47374178	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	37	CCDS14282.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536078	0.27475	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	T;T;T	0.40756	1.02;1.02;1.03	4.78	0.365	0.16131	.	2.446700	0.01046	N	0.004391	T	0.20861	0.0502	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.10177	-1.0641	10	0.14656	T	0.56	.	2.3105	0.04185	0.1222:0.3744:0.3341:0.1694	.	4	P27918	PROP_HUMAN	K	4	ENSP00000380189:E4K;ENSP00000247153:E4K;ENSP00000366204:E4K	ENSP00000247153:E4K	E	-	1	0	CFP	47374178	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.014000	0.12656	0.107000	0.17824	-1.090000	0.02178	GAG		0.632	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621		Missense_Mutation
DLC1	10395	hgsc.bcm.edu	37	8	12947764	12947765	+	Frame_Shift_Ins	INS	-	-	T			TCGA-04-1337-01	TCGA-04-1337-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr8:12947764_12947765insT	ENST00000276297.4	-	15	4479_4480	c.4070_4071insA	c.(4069-4071)aagfs	p.K1357fs	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Frame_Shift_Ins_p.K954fs|DLC1_ENST00000520226.1_Frame_Shift_Ins_p.K846fs|DLC1_ENST00000358919.2_Frame_Shift_Ins_p.K920fs	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1357	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.K1358fs*16(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCCTTACCTTCTTATAGGACAG	0.495																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								12992136	SO:0001589	frameshift_variant	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4071dupA	8.37:g.12947766_12947766dupT	ENSP00000276297:p.Lys1357fs		12992135	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Frame_Shift_Ins	INS	ENST00000276297.4	37	CCDS5989.1	INS	32	Baylor																																																																																				0.495	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		Frame_Shift_Ins
CHRNA2	1135	hgsc.bcm.edu	37	8	27321224	27321224	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr8:27321224C>A	ENST00000520933.2	-	5	889	c.736G>T	c.(736-738)Gac>Tac	p.D246Y	CHRNA2_ENST00000240132.2_Missense_Mutation_p.D231Y|CHRNA2_ENST00000407991.1_Missense_Mutation_p.D246Y			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	246					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	GCGCAGCAGTCGTACTTCTTG	0.602																																																0			8											242.0	199.0	214.0					8																	27321224		2203	4300	6503	27377141	SO:0001583	missense	1135			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.736G>T	8.37:g.27321224C>A	ENSP00000429616:p.Asp246Tyr		27377141	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	ENST00000520933.2	37	CCDS6059.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034392	0.75617	.	.	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132	T;T;T	0.79749	-1.3;-1.3;-1.3	4.97	4.97	0.65823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.86422	0.5929	L	0.51422	1.61	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70227	0.968;0.968	D	0.87293	0.2300	10	0.66056	D	0.02	.	15.7706	0.78164	0.0:1.0:0.0:0.0	.	231;246	B4DK19;Q15822	.;ACHA2_HUMAN	Y	246;246;231	ENSP00000385026:D246Y;ENSP00000429616:D246Y;ENSP00000240132:D231Y	ENSP00000240132:D231Y	D	-	1	0	CHRNA2	27377141	1.000000	0.71417	0.991000	0.47740	0.676000	0.39594	7.651000	0.83577	2.590000	0.87494	0.561000	0.74099	GAC		0.602	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4			Missense_Mutation
DOCK6	57572	hgsc.bcm.edu	37	19	11311647	11311647	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:11311647G>A	ENST00000294618.7	-	45	5781	c.5770C>T	c.(5770-5772)Cca>Tca	p.P1924S	DOCK6_ENST00000586702.1_5'UTR|CTC-510F12.2_ENST00000588634.1_RNA|DOCK6_ENST00000319867.7_Missense_Mutation_p.P1263S	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1924	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.P1926S(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCATCTGGTGGGTCCTGCTCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	67.0	67.0					19																	11311647		2102	4233	6335	11172647	SO:0001583	missense	57572				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5770C>T	19.37:g.11311647G>A	ENSP00000294618:p.Pro1924Ser		11172647	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720335	0.89205	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.17370	2.28;2.28	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.38746	0.1052	M	0.65320	2	0.80722	D	1	D;P;D	0.71674	0.995;0.786;0.998	P;P;D	0.70016	0.882;0.665;0.967	T	0.26326	-1.0106	10	0.62326	D	0.03	-30.3233	15.8801	0.79197	0.0:0.0:1.0:0.0	.	1263;1924;1263	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	S	1924;1263	ENSP00000294618:P1924S;ENSP00000321556:P1263S	ENSP00000294618:P1924S	P	-	1	0	DOCK6	11172647	1.000000	0.71417	0.991000	0.47740	0.880000	0.50808	9.738000	0.98835	2.026000	0.59711	0.650000	0.86243	CCA		0.637	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812		Missense_Mutation
E2F2	1870	hgsc.bcm.edu	37	1	23836447	23836447	+	Silent	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr1:23836447C>A	ENST00000361729.2	-	7	1665	c.1239G>T	c.(1237-1239)ctG>ctT	p.L413L		NM_004091.3	NP_004082.1	Q14209	E2F2_HUMAN	E2F transcription factor 2	413	Retinoblastoma protein binding. {ECO:0000255}.|Transactivation. {ECO:0000255}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L413L(1)		endometrium(4)|large_intestine(2)|lung(1)|ovary(3)|skin(2)|urinary_tract(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)		CCAAGCCCCACAGGTAGTCGT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											57.0	43.0	48.0					1																	23836447		2203	4300	6503	23709034	SO:0001819	synonymous_variant	1870			L22846	CCDS236.1	1p36	2008-02-05			ENSG00000007968	ENSG00000007968			3114	protein-coding gene	gene with protein product		600426				8246995, 8246996	Standard	NM_004091		Approved	E2F-2	uc001bhe.2	Q14209	OTTHUMG00000003223	ENST00000361729.2:c.1239G>T	1.37:g.23836447C>A			23709034	B2R9W1|Q7Z6H1	Silent	SNP	ENST00000361729.2	37	CCDS236.1	SNP	17	Baylor																																																																																				0.622	E2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008885.1	NM_004091		Silent
ECE2	9718	hgsc.bcm.edu	37	3	184001628	184001628	+	Missense_Mutation	SNP	G	G	T	rs547918400		TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr3:184001628G>T	ENST00000402825.3	+	8	1226	c.1226G>T	c.(1225-1227)cGg>cTg	p.R409L	ECE2_ENST00000359140.4_Missense_Mutation_p.R262L|ECE2_ENST00000404464.3_Missense_Mutation_p.R291L|ECE2_ENST00000357474.5_Missense_Mutation_p.R337L|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	409	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGGGTGGGCGGCCCACCTCC	0.622																																																0			3											57.0	52.0	54.0					3																	184001628		2203	4300	6503	185484322	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1226G>T	3.37:g.184001628G>T	ENSP00000384223:p.Arg409Leu		185484322	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.050	0.564321	0.13498	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58	4.65	-8.61	0.00885	Peptidase M13 (1);	1.280690	0.05067	N	0.481042	T	0.69305	0.3096	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B	0.20052	0.003;0.041;0.041;0.002;0.033;0.005;0.005	B;B;B;B;B;B;B	0.30401	0.049;0.115;0.115;0.003;0.043;0.043;0.026	T	0.62440	-0.6854	10	0.72032	D	0.01	-1.3039	14.5866	0.68328	0.1831:0.1137:0.7032:0.0	.	11;262;280;291;337;262;409	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	L	409;262;291;337;283	ENSP00000384223:R409L;ENSP00000352052:R262L;ENSP00000385846:R291L;ENSP00000350066:R337L;ENSP00000398444:R283L	ENSP00000350066:R337L	R	+	2	0	ECE2	185484322	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.246000	0.08878	-1.840000	0.01184	-1.000000	0.02509	CGG		0.622	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693		Missense_Mutation
EHD1	10938	hgsc.bcm.edu	37	11	64641976	64641976	+	Frame_Shift_Del	DEL	T	T	-			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:64641976delT	ENST00000320631.3	-	2	673	c.419delA	c.(418-420)cagfs	p.Q140fs	EHD1_ENST00000359393.2_Frame_Shift_Del_p.Q140fs	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	140	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)	p.Q140fs*64(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						GTTGGGCAGCTGGGCACACAT	0.562																																																1	Deletion - Frameshift(1)	ovary(1)	11											74.0	56.0	62.0					11																	64641976		2201	4297	6498	64398552	SO:0001589	frameshift_variant	10938			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.419delA	11.37:g.64641976delT	ENSP00000320516:p.Gln140fs		64398552	O14611|Q2M3Q4|Q9UNR3	Frame_Shift_Del	DEL	ENST00000320631.3	37	CCDS8084.1	DEL	55	Baylor																																																																																				0.562	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143229.2	NM_006795		Frame_Shift_Del
ELF4	2000	hgsc.bcm.edu	37	X	129205183	129205183	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:129205183A>G	ENST00000308167.5	-	7	1020	c.641T>C	c.(640-642)tTc>tCc	p.F214S	ELF4_ENST00000335997.7_Missense_Mutation_p.F214S	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AGCCAGGAGGAACTCCCACAG	0.607			T	ERG	AML																																		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	0			X											98.0	81.0	87.0					X																	129205183		2203	4300	6503	129032864	SO:0001583	missense	2000			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.641T>C	X.37:g.129205183A>G	ENSP00000311280:p.Phe214Ser		129032864		Missense_Mutation	SNP	ENST00000308167.5	37	CCDS14617.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.1	4.606344	0.87157	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.73258	-0.73;-0.73	5.32	5.32	0.75619	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (5);	0.000000	0.85682	D	0.000000	D	0.88032	0.6328	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90906	0.4772	10	0.87932	D	0	.	12.1905	0.54268	1.0:0.0:0.0:0.0	.	214	Q99607	ELF4_HUMAN	S	214	ENSP00000338608:F214S;ENSP00000311280:F214S	ENSP00000311280:F214S	F	-	2	0	ELF4	129032864	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.307000	0.96226	1.782000	0.52362	0.356000	0.21956	TTC		0.607	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421		Missense_Mutation
F10	2159	hgsc.bcm.edu	37	13	113803786	113803786	+	Silent	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr13:113803786C>A	ENST00000375559.3	+	8	1460	c.1422C>A	c.(1420-1422)gcC>gcA	p.A474A	F10_ENST00000375551.3_3'UTR	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	474					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	TGCCCAAGGCCAAGAGCCATG	0.577																																																0			13											113.0	97.0	102.0					13																	113803786		2203	4300	6503	112851787	SO:0001819	synonymous_variant	2159				CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.1422C>A	13.37:g.113803786C>A			112851787	Q14340	Silent	SNP	ENST00000375559.3	37	CCDS9530.1	SNP	21	Baylor																																																																																				0.577	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3			Silent
F11	2160	hgsc.bcm.edu	37	4	187194255	187194255	+	Silent	SNP	A	A	T			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:187194255A>T	ENST00000403665.2	+	4	601	c.249A>T	c.(247-249)acA>acT	p.T83T	F11_ENST00000492972.2_Silent_p.T83T|F11_ENST00000264692.4_Silent_p.T83T	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	83	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	ACAGTGTTACAGAAACACTGC	0.328																																																0			4											86.0	81.0	83.0					4																	187194255		2203	4300	6503	187431249	SO:0001819	synonymous_variant	2160			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.249A>T	4.37:g.187194255A>T			187431249	D3DP64|Q4W5C2|Q9Y495	Silent	SNP	ENST00000403665.2	37	CCDS3847.1	SNP	7	Baylor																																																																																				0.328	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			Silent
Unknown	0	hgsc.bcm.edu	37	13	0	0	+	IGR	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Invalid:failed_liftOver	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr13:0G>A								None (None upstream) : None (None downstream)																							NNNNNNNNNN	0.0																																																0			13																																								113644828	SO:0001628	intergenic_variant	348013																															13.37:g.0G>A			113644828		Missense_Mutation	SNP		37		SNP	37	Baylor																																																																																			0	0.000									Missense_Mutation
FARSA	2193	hgsc.bcm.edu	37	19	13041253	13041253	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:13041253A>G	ENST00000314606.4	-	3	392	c.374T>C	c.(373-375)gTg>gCg	p.V125A	FARSA_ENST00000588025.1_Missense_Mutation_p.V165A|CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Missense_Mutation_p.V125A	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	125					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CACTCGGAACACCCGGGGCCC	0.637																																																0			19											84.0	84.0	84.0					19																	13041253		2203	4300	6503	12902253	SO:0001583	missense	2193			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.374T>C	19.37:g.13041253A>G	ENSP00000320309:p.Val125Ala		12902253	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	37	CCDS12287.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056788	0.76074	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.65364	-0.15;0.41	5.38	5.38	0.77491	.	0.194792	0.44483	D	0.000458	T	0.72574	0.3477	M	0.85197	2.74	0.58432	D	0.999996	P;P	0.46706	0.864;0.883	B;P	0.48030	0.345;0.564	T	0.77907	-0.2412	10	0.59425	D	0.04	-18.8109	14.3605	0.66768	1.0:0.0:0.0:0.0	.	125;125	B4E363;Q9Y285	.;SYFA_HUMAN	A	125	ENSP00000320309:V125A;ENSP00000396548:V125A	ENSP00000320309:V125A	V	-	2	0	FARSA	12902253	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	8.413000	0.90235	2.045000	0.60652	0.379000	0.24179	GTG		0.637	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461		Missense_Mutation
GABRB1	2560	hgsc.bcm.edu	37	4	47427958	47427958	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:47427958G>C	ENST00000295454.3	+	9	1640	c.1348G>C	c.(1348-1350)Gac>Cac	p.D450H	GABRB1_ENST00000538619.1_Missense_Mutation_p.D380H	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	450					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)	p.D450H(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAATTCCATAGACAAGTGGTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	4											109.0	106.0	107.0					4																	47427958		2203	4300	6503	47122715	SO:0001583	missense	2560				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1348G>C	4.37:g.47427958G>C	ENSP00000295454:p.Asp450His		47122715	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	CCDS3474.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619535	0.87460	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.98437	-4.93;-4.93	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.99266	0.9744	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99072	1.0834	10	0.87932	D	0	-24.5045	19.2334	0.93849	0.0:0.0:1.0:0.0	.	380;450	F5GXV5;P18505	.;GBRB1_HUMAN	H	450;380	ENSP00000295454:D450H;ENSP00000440330:D380H	ENSP00000295454:D450H	D	+	1	0	GABRB1	47122715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.519000	0.98025	2.781000	0.95711	0.650000	0.86243	GAC		0.507	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			Missense_Mutation
FBXW7	55294	hgsc.bcm.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	4											253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His		153468834	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		0.408	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1			Missense_Mutation
GALNT8	26290	hgsc.bcm.edu	37	12	4829991	4829991	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr12:4829991A>G	ENST00000252318.2	+	1	485	c.148A>G	c.(148-150)Aat>Gat	p.N50D	RP11-234B24.2_ENST00000527518.1_lincRNA|RP11-234B24.6_ENST00000544741.2_Intron	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	50					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						TTTACATCTGAATAAACGCTA	0.468																																					Colon(108;631 1558 7270 20097 39846)											0			12											92.0	95.0	94.0					12																	4829991		2203	4300	6503	4700252	SO:0001583	missense	26290			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.148A>G	12.37:g.4829991A>G	ENSP00000252318:p.Asn50Asp		4700252	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.03	1.239097	0.22711	.	.	ENSG00000130035	ENST00000252318	T	0.51817	0.69	3.62	-3.87	0.04218	.	1334.800000	0.00166	N	0.000000	T	0.24547	0.0595	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.11966	-1.0566	10	0.06757	T	0.87	.	0.0726	0.00024	0.3417:0.1772:0.2141:0.267	.	50	Q9NY28	GALT8_HUMAN	D	50	ENSP00000252318:N50D	ENSP00000252318:N50D	N	+	1	0	GALNT8	4700252	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.312000	0.01127	-0.757000	0.04697	-0.914000	0.02751	AAT		0.468	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		Missense_Mutation
GNPAT	8443	hgsc.bcm.edu	37	1	231401797	231401797	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr1:231401797A>C	ENST00000366647.4	+	7	979	c.810A>C	c.(808-810)agA>agC	p.R270S	GNPAT_ENST00000366646.3_Missense_Mutation_p.R209S	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	270					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.R270S(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TTTTTAAAAGAGAAGTTTTTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	92.0	92.0					1																	231401797		2202	4300	6502	229468420	SO:0001583	missense	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.810A>C	1.37:g.231401797A>C	ENSP00000355607:p.Arg270Ser		229468420	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	37	CCDS1592.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.739	0.918610	0.17982	.	.	ENSG00000116906	ENST00000436239;ENST00000366647;ENST00000366646;ENST00000416000	D;T;T;T	0.85484	-1.99;0.01;0.01;0.0	5.6	4.48	0.54585	Phospholipid/glycerol acyltransferase (2);	0.062231	0.64402	D	0.000002	T	0.60392	0.2265	N	0.01257	-0.925	0.40282	D	0.978409	B;B	0.26318	0.146;0.012	B;B	0.27715	0.082;0.05	T	0.56257	-0.8009	10	0.44086	T	0.13	.	3.9138	0.09214	0.5963:0.0:0.1538:0.2499	.	209;270	B4DNM9;O15228	.;GNPAT_HUMAN	S	209;270;209;260	ENSP00000402811:R209S;ENSP00000355607:R270S;ENSP00000355606:R209S;ENSP00000411640:R260S	ENSP00000355606:R209S	R	+	3	2	GNPAT	229468420	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	0.431000	0.21444	0.952000	0.37798	-0.621000	0.04028	AGA		0.368	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			Missense_Mutation
GRIPAP1	56850	hgsc.bcm.edu	37	X	48831566	48831566	+	Splice_Site	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:48831566C>T	ENST00000376441.1	-	25	2468		c.e25+1		GRIPAP1_ENST00000376425.3_Splice_Site|GRIPAP1_ENST00000376444.3_Splice_Site|GRIPAP1_ENST00000473581.1_5'Flank	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1							blood microparticle (GO:0072562)|endosome (GO:0005768)		p.?(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GCCACACTTGCCTTGTGCAAG	0.587																																																1	Unknown(1)	ovary(1)	X											59.0	46.0	50.0					X																	48831566		2203	4300	6503	48716510	SO:0001630	splice_region_variant	56850			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2433+1G>A	X.37:g.48831566C>T			48716510	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Splice_Site_SNP	SNP	ENST00000376441.1	37	CCDS35248.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605237	0.66445	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291	.	.	.	3.66	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6458	0.51261	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIPAP1	48716510	1.000000	0.71417	0.989000	0.46669	0.869000	0.49853	5.154000	0.64894	1.674000	0.50907	0.488000	0.48403	.		0.587	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	Intron	Splice_Site_SNP
GRIPAP1	56850	hgsc.bcm.edu	37	X	48853699	48853699	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:48853699C>T	ENST00000376441.1	-	5	303	c.269G>A	c.(268-270)cGt>cAt	p.R90H	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.R90H|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.R90H|GRIPAP1_ENST00000376444.3_Intron	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	90						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.R90H(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GTTCTGCAAACGGAAGTCCTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											100.0	65.0	77.0					X																	48853699		2203	4297	6500	48738643	SO:0001583	missense	56850			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.269G>A	X.37:g.48853699C>T	ENSP00000365624:p.Arg90His		48738643	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	c	24.8	4.574175	0.86542	.	.	ENSG00000068400	ENST00000376425;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T	0.26957	1.7;1.7;1.7	5.5	4.62	0.57501	.	0.147481	0.43260	D	0.000583	T	0.47673	0.1458	M	0.71581	2.175	0.26607	N	0.972919	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.938	T	0.42916	-0.9423	10	0.56958	D	0.05	-4.7	12.0373	0.53433	0.173:0.827:0.0:0.0	.	90;90	Q4V328-2;Q4V328	.;GRAP1_HUMAN	H	90	ENSP00000365608:R90H;ENSP00000365624:R90H;ENSP00000365606:R90H	ENSP00000365606:R90H	R	-	2	0	GRIPAP1	48738643	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	4.719000	0.61937	1.086000	0.41228	0.515000	0.50301	CGT		0.547	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672		Missense_Mutation
ARHGAP35	2909	hgsc.bcm.edu	37	19	47423159	47423159	+	Silent	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:47423159C>A	ENST00000404338.3	+	1	1227	c.1227C>A	c.(1225-1227)acC>acA	p.T409T		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	409	FF 2.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.T409T(1)									TAATGGATACCGTCCCTGCAG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	19											124.0	117.0	119.0					19																	47423159		1915	4115	6030	52114999	SO:0001819	synonymous_variant	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1227C>A	19.37:g.47423159C>A			52114999	A7E2A4|Q14452|Q9C0E1	Silent	SNP	ENST00000404338.3	37	CCDS46127.1	SNP	23	Baylor																																																																																				0.468	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		Silent
HINT2	84681	hgsc.bcm.edu	37	9	35813088	35813088	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:35813088A>T	ENST00000259667.5	-	5	496	c.455T>A	c.(454-456)gTa>gAa	p.V152E	SPAG8_ENST00000396638.2_5'Flank|SPAG8_ENST00000340291.2_5'Flank|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000484764.1_5'Flank|HINT2_ENST00000474908.1_5'UTR|SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	152	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)	p.V152E(1)		NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			GCCCCCAAGTACATGAATGTG	0.517																																					GBM(185;1694 2122 5473 25431 37228)											1	Substitution - Missense(1)	ovary(1)	9											142.0	149.0	146.0					9																	35813088		2203	4300	6503	35803088	SO:0001583	missense	84681			AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.455T>A	9.37:g.35813088A>T	ENSP00000259667:p.Val152Glu		35803088	Q5TCW3	Missense_Mutation	SNP	ENST00000259667.5	37	CCDS6594.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.6	4.315990	0.81469	.	.	ENSG00000137133	ENST00000259667	D	0.93763	-3.28	5.15	5.15	0.70609	Histidine triad, conserved site (1);Histidine triad motif (1);Histidine triad-like motif (1);	0.078147	0.51477	D	0.000093	D	0.97579	0.9207	H	0.96547	3.84	0.54753	D	0.999989	D	0.71674	0.998	D	0.77004	0.989	D	0.98417	1.0575	10	0.87932	D	0	-36.6166	12.4674	0.55766	1.0:0.0:0.0:0.0	.	152	Q9BX68	HINT2_HUMAN	E	152	ENSP00000259667:V152E	ENSP00000259667:V152E	V	-	2	0	HINT2	35803088	0.997000	0.39634	0.999000	0.59377	0.987000	0.75469	7.312000	0.78968	2.164000	0.68074	0.533000	0.62120	GTA		0.517	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052390.1	NM_032593		Missense_Mutation
HTR5A	3361	hgsc.bcm.edu	37	7	154863324	154863324	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr7:154863324G>A	ENST00000287907.2	+	1	1291	c.715G>A	c.(715-717)Gtc>Atc	p.V239I	HTR5A-AS1_ENST00000543018.1_5'Flank|HTR5A-AS1_ENST00000493904.1_5'Flank|HTR5A-AS1_ENST00000395731.2_5'Flank	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	239					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.V239I(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	GACCAATAGCGTCTCACCCAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											69.0	67.0	68.0					7																	154863324		2203	4300	6503	154494257	SO:0001583	missense	3361				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.715G>A	7.37:g.154863324G>A	ENSP00000287907:p.Val239Ile		154494257	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	6.576	0.474657	0.12521	.	.	ENSG00000157219	ENST00000287907	T	0.72051	-0.62	4.76	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.322217	0.30547	N	0.009399	T	0.41396	0.1157	N	0.04297	-0.235	0.39167	D	0.962523	B	0.20459	0.045	B	0.16722	0.016	T	0.22452	-1.0216	10	0.14656	T	0.56	.	5.4171	0.16380	0.3403:0.0:0.6597:0.0	.	239	P47898	5HT5A_HUMAN	I	239	ENSP00000287907:V239I	ENSP00000287907:V239I	V	+	1	0	HTR5A	154494257	1.000000	0.71417	0.966000	0.40874	0.282000	0.26991	3.433000	0.52834	1.240000	0.43803	0.650000	0.86243	GTC		0.547	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012		Missense_Mutation
INSC	387755	hgsc.bcm.edu	37	11	15247329	15247330	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-04-1337-01	TCGA-04-1337-11	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:15247329_15247330delCT	ENST00000379554.3	+	9	1312_1313	c.1266_1267delCT	c.(1264-1269)gcctgcfs	p.C423fs	INSC_ENST00000447214.2_3'UTR|INSC_ENST00000379556.3_Frame_Shift_Del_p.C376fs|INSC_ENST00000424273.1_Frame_Shift_Del_p.C334fs|INSC_ENST00000530161.1_Frame_Shift_Del_p.C376fs|INSC_ENST00000525218.1_Frame_Shift_Del_p.C334fs|INSC_ENST00000528567.1_Frame_Shift_Del_p.C376fs	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	423					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.C423fs*2(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TCCTGGAAGCCTGCAGTGACAA	0.564																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								15203906	SO:0001589	frameshift_variant	387755			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1266_1267delCT	11.37:g.15247329_15247330delCT	ENSP00000368872:p.Cys423fs		15203905	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Frame_Shift_Del	DEL	ENST00000379554.3	37	CCDS41621.1	DEL	24	Baylor																																																																																				0.564	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		Frame_Shift_Del
KATNA1	11104	hgsc.bcm.edu	37	6	149919436	149919436	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr6:149919436G>C	ENST00000335647.5	-	7	983	c.939C>G	c.(937-939)atC>atG	p.I313M	KATNA1_ENST00000494504.1_5'UTR|KATNA1_ENST00000335643.8_Missense_Mutation_p.I237M|KATNA1_ENST00000367411.2_Missense_Mutation_p.I313M					katanin p60 (ATPase containing) subunit A 1									p.I313M(1)|p.I313I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		GGCGACTACAGATGGAGTCTA	0.413																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	6											103.0	102.0	103.0					6																	149919436		2203	4300	6503	149961129	SO:0001583	missense	11104			AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.939C>G	6.37:g.149919436G>C	ENSP00000335106:p.Ile313Met		149961129		Missense_Mutation	SNP	ENST00000335647.5	37	CCDS5217.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.92	3.256245	0.59321	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411	D;D;D	0.94046	-3.34;-3.34;-3.34	5.68	-2.52	0.06346	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.043122	0.85682	D	0.000000	D	0.90321	0.6972	M	0.70903	2.155	0.49483	D	0.999793	P;P;P	0.50272	0.933;0.562;0.882	P;B;P	0.53102	0.718;0.439;0.718	D	0.87512	0.2440	9	.	.	.	.	8.4271	0.32735	0.4087:0.0:0.4779:0.1133	.	313;237;313	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	M	313;237;313	ENSP00000335106:I313M;ENSP00000335180:I237M;ENSP00000356381:I313M	.	I	-	3	3	KATNA1	149961129	0.975000	0.34042	0.984000	0.44739	0.984000	0.73092	0.220000	0.17660	-0.319000	0.08652	-0.312000	0.09012	ATC		0.413	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044		Missense_Mutation
KCNA4	3739	hgsc.bcm.edu	37	11	30033628	30033628	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:30033628T>C	ENST00000328224.6	-	2	1831	c.598A>G	c.(598-600)Act>Gct	p.T200A	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	200					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.T200A(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCCAACAAAGTCTCTGGAAAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											63.0	61.0	62.0					11																	30033628		1907	4123	6030	29990204	SO:0001583	missense	3739			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.598A>G	11.37:g.30033628T>C	ENSP00000328511:p.Thr200Ala		29990204		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950237	0.73787	.	.	ENSG00000182255	ENST00000328224	T	0.81247	-1.47	4.81	4.81	0.61882	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.92593	0.7647	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.94784	0.7956	10	0.87932	D	0	.	14.382	0.66916	0.0:0.0:0.0:1.0	.	200	P22459	KCNA4_HUMAN	A	200	ENSP00000328511:T200A	ENSP00000328511:T200A	T	-	1	0	KCNA4	29990204	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.008000	0.88588	1.808000	0.52836	0.459000	0.35465	ACT		0.473	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		Missense_Mutation
KIF24	347240	hgsc.bcm.edu	37	9	34256771	34256771	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:34256771T>G	ENST00000402558.2	-	10	2858	c.2834A>C	c.(2833-2835)gAt>gCt	p.D945A	KIF24_ENST00000379166.2_Missense_Mutation_p.D945A|KIF24_ENST00000379174.3_Missense_Mutation_p.D811A|KIF24_ENST00000345050.2_Missense_Mutation_p.D811A			Q5T7B8	KIF24_HUMAN	kinesin family member 24	945					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			ATATATGAAATCTACCTGTGA	0.517																																																0			9											80.0	87.0	84.0					9																	34256771		2203	4300	6503	34246771	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.2834A>C	9.37:g.34256771T>G	ENSP00000384433:p.Asp945Ala		34246771	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269686	0.59540	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	5.71	0.736	0.18307	.	0.558503	0.15828	N	0.242674	T	0.26085	0.0636	M	0.66939	2.045	0.09310	N	1	B	0.32918	0.39	B	0.27380	0.079	T	0.17137	-1.0379	10	0.66056	D	0.02	.	5.8769	0.18834	0.0:0.2047:0.1292:0.6661	.	945	Q5T7B8	KIF24_HUMAN	A	945;811;945;811;945	ENSP00000384433:D945A;ENSP00000368472:D811A;ENSP00000368464:D945A;ENSP00000340179:D811A	ENSP00000340179:D811A	D	-	2	0	KIF24	34246771	0.039000	0.19947	0.004000	0.12327	0.089000	0.18198	0.491000	0.22419	0.100000	0.17581	0.460000	0.39030	GAT		0.517	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			Missense_Mutation
KIRREL3	84623	hgsc.bcm.edu	37	11	126305187	126305187	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:126305187T>C	ENST00000525144.2	-	13	1813	c.1564A>G	c.(1564-1566)Aag>Gag	p.K522E	KIRREL3_ENST00000525704.2_Missense_Mutation_p.K522E|KIRREL3_ENST00000416561.2_Intron|KIRREL3_ENST00000529097.2_Intron	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	522					hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		GCTCCCGACTTCATTTCCGAA	0.612																																																0			11											63.0	69.0	67.0					11																	126305187		1877	4097	5974	125810397	SO:0001583	missense	84623			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1564A>G	11.37:g.126305187T>C	ENSP00000435466:p.Lys522Glu		125810397	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.81	2.647720	0.47258	.	.	ENSG00000149571	ENST00000525144;ENST00000525704	T;T	0.70869	-0.52;-0.38	5.07	5.07	0.68467	.	0.250471	0.35525	N	0.003156	T	0.50820	0.1638	N	0.14661	0.345	0.80722	D	1	B;B	0.32101	0.356;0.147	B;B	0.30401	0.115;0.037	T	0.50767	-0.8789	10	0.24483	T	0.36	-15.8172	10.8921	0.47002	0.0:0.0:0.1574:0.8426	.	522;522	Q8IZU9-2;Q8IZU9	.;KIRR3_HUMAN	E	522	ENSP00000435466:K522E;ENSP00000435094:K522E	ENSP00000435466:K522E	K	-	1	0	KIRREL3	125810397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.449000	0.52950	2.037000	0.60232	0.460000	0.39030	AAG		0.612	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		Missense_Mutation
L1CAM	3897	hgsc.bcm.edu	37	X	153130288	153130288	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:153130288T>G	ENST00000370060.1	-	23	3223	c.3034A>C	c.(3034-3036)Atg>Ctg	p.M1012L	L1CAM_ENST00000361699.4_Missense_Mutation_p.M1012L|L1CAM_ENST00000370057.3_Missense_Mutation_p.M1012L|L1CAM_ENST00000361981.3_Missense_Mutation_p.M1007L|L1CAM_ENST00000538883.1_Missense_Mutation_p.M1014L|L1CAM_ENST00000370055.1_Missense_Mutation_p.M1007L|L1CAM_ENST00000543994.1_Missense_Mutation_p.M1014L	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1012	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.M1012L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACAAGGCCATAGTGCCTCCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	99.0	102.0					X																	153130288		2203	4300	6503	152783482	SO:0001583	missense	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3034A>C	X.37:g.153130288T>G	ENSP00000359077:p.Met1012Leu		152783482	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.63	2.295395	0.40594	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.57595	0.39;0.4;0.39;0.4;0.42;0.42;0.39	5.17	5.17	0.71159	.	0.161283	0.41194	D	0.000926	T	0.34250	0.0891	N	0.19112	0.55	0.37628	D	0.921553	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.001;0.004;0.001	T	0.25916	-1.0118	10	0.10377	T	0.69	.	11.936	0.52874	0.0:0.0:0.0:1.0	.	1007;1012;1012	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	L	1012;1014;1012;1014;1007;1007;1012	ENSP00000359077:M1012L;ENSP00000438430:M1014L;ENSP00000359074:M1012L;ENSP00000439645:M1014L;ENSP00000354712:M1007L;ENSP00000359072:M1007L;ENSP00000355380:M1012L	ENSP00000355380:M1012L	M	-	1	0	L1CAM	152783482	1.000000	0.71417	0.970000	0.41538	0.915000	0.54546	2.884000	0.48562	1.721000	0.51461	0.430000	0.28490	ATG		0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Missense_Mutation
LEPRE1	64175	hgsc.bcm.edu	37	1	43213048	43213048	+	Frame_Shift_Del	DEL	T	T	-			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr1:43213048delT	ENST00000296388.5	-	14	2001	c.1950delA	c.(1948-1950)ggafs	p.G650fs	LEPRE1_ENST00000397054.3_Frame_Shift_Del_p.G650fs|LEPRE1_ENST00000462474.1_5'UTR|LEPRE1_ENST00000236040.4_Frame_Shift_Del_p.G650fs			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	650	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)	p.F651fs*11(1)		large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CTGAAGAGAATCCCACGGCTC	0.587											OREG0013422	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - Frameshift(1)	ovary(1)	1											54.0	55.0	55.0					1																	43213048		2200	4290	6490	42985635	SO:0001589	frameshift_variant	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1950delA	1.37:g.43213048delT	ENSP00000296388:p.Gly650fs	914	42985635	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Frame_Shift_Del	DEL	ENST00000296388.5	37	CCDS472.2	DEL	50	Baylor																																																																																				0.587	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356		Frame_Shift_Del
LPCAT1	79888	hgsc.bcm.edu	37	5	1489918	1489919	+	Frame_Shift_Ins	INS	-	-	CC	rs369672145		TCGA-04-1337-01	TCGA-04-1337-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr5:1489918_1489919insCC	ENST00000283415.3	-	4	680_681	c.548_549insGG	c.(547-549)cgcfs	p.R183fs		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	183					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.R184fs*5(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		CTGTTTTCCTGCGAGAATCCTG	0.535																																																1	Insertion - Frameshift(1)	ovary(1)	5																																								1542919	SO:0001589	frameshift_variant	79888			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.548_549insGG	5.37:g.1489918_1489919insCC	ENSP00000283415:p.Arg183fs		1542918	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Frame_Shift_Ins	INS	ENST00000283415.3	37	CCDS3864.1	INS	46	Baylor																																																																																				0.535	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830		Frame_Shift_Ins
MAGEC3	139081	hgsc.bcm.edu	37	X	140984668	140984668	+	Splice_Site	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chrX:140984668A>G	ENST00000298296.1	+	7	1124	c.1124A>G	c.(1123-1125)gAa>gGa	p.E375G	MAGEC3_ENST00000536088.1_Missense_Mutation_p.E77G|MAGEC3_ENST00000443323.2_5'UTR|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000544766.1_Missense_Mutation_p.E77G|MAGEC3_ENST00000409007.1_Missense_Mutation_p.E77G	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	375	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.E77G(1)|p.E375G(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGTTCCAGAAGATGAGGAT	0.552																																																2	Substitution - Missense(2)	ovary(2)	X											73.0	51.0	59.0					X																	140984668		2196	4284	6480	140812334	SO:0001630	splice_region_variant	139081			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1124-1A>G	X.37:g.140984668A>G			140812334	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	a	4.759	0.141042	0.09083	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000544766;ENST00000409007	T;T;T;T	0.04603	3.82;3.59;3.59;3.59	0.89	-1.78	0.07957	.	.	.	.	.	T	0.02688	0.0081	L	0.29908	0.895	0.21627	N	0.999619	B;B	0.32409	0.37;0.37	B;B	0.20955	0.017;0.032	T	0.36986	-0.9725	8	0.51188	T	0.08	.	.	.	.	.	375;77	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	G	375;77;77;77	ENSP00000298296:E375G;ENSP00000441107:E77G;ENSP00000440444:E77G;ENSP00000386566:E77G	ENSP00000298296:E375G	E	+	2	0	MAGEC3	140812334	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.367000	0.20382	-1.612000	0.01579	-1.042000	0.02369	GAA		0.552	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	Missense_Mutation	Missense_Mutation
MAP1A	4130	hgsc.bcm.edu	37	15	43821296	43821296	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr15:43821296T>A	ENST00000300231.5	+	4	8075	c.7625T>A	c.(7624-7626)gTg>gAg	p.V2542E	MAP1A_ENST00000382031.1_Missense_Mutation_p.V2780E|MAP1A_ENST00000399453.1_Missense_Mutation_p.V2542E			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2542					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TTCCTACCTGTGGACAAAGCT	0.612																																																0			15											83.0	86.0	85.0					15																	43821296		2022	4183	6205	41608588	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7625T>A	15.37:g.43821296T>A	ENSP00000300231:p.Val2542Glu		41608588	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.68	2.309765	0.40895	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.02015	4.51;4.5;4.51	5.14	5.14	0.70334	.	.	.	.	.	T	0.09024	0.0223	L	0.48642	1.525	0.45914	D	0.998756	D	0.89917	1.0	D	0.77004	0.989	T	0.03344	-1.1046	9	0.87932	D	0	-12.7339	15.1101	0.72349	0.0:0.0:0.0:1.0	.	2542	P78559	MAP1A_HUMAN	E	2780;2542;2542	ENSP00000371462:V2780E;ENSP00000382380:V2542E;ENSP00000300231:V2542E	ENSP00000300231:V2542E	V	+	2	0	MAP1A	41608588	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.915000	0.63355	2.148000	0.66965	0.379000	0.24179	GTG		0.612	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		Missense_Mutation
MEP1B	4225	hgsc.bcm.edu	37	18	29795144	29795144	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr18:29795144G>C	ENST00000269202.6	+	12	1726	c.1679G>C	c.(1678-1680)aGt>aCt	p.S560T	MEP1B_ENST00000581447.1_Missense_Mutation_p.S560T	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	560	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S560T(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TATGGAACCAGTGCCTTTATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	18											90.0	90.0	90.0					18																	29795144		1835	4088	5923	28049142	SO:0001583	missense	4225			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.1679G>C	18.37:g.29795144G>C	ENSP00000269202:p.Ser560Thr		28049142	B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	ENST00000269202.6	37	CCDS45846.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622319	0.28889	.	.	ENSG00000141434	ENST00000269202	T	0.43294	0.95	5.97	1.84	0.25277	TRAF-type (1);TRAF-like (1);MATH (3);	0.652472	0.17858	N	0.159611	T	0.38612	0.1047	L	0.43152	1.355	0.09310	N	1	B	0.20368	0.044	B	0.34093	0.175	T	0.39482	-0.9612	10	0.38643	T	0.18	-10.0308	11.8641	0.52482	0.0947:0.5493:0.356:0.0	.	560	Q16820	MEP1B_HUMAN	T	560	ENSP00000269202:S560T	ENSP00000269202:S560T	S	+	2	0	MEP1B	28049142	0.000000	0.05858	0.524000	0.27887	0.952000	0.60782	0.590000	0.23954	0.371000	0.24564	0.655000	0.94253	AGT		0.398	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925		Missense_Mutation
MUS81	80198	hgsc.bcm.edu	37	11	65632780	65632780	+	Nonsense_Mutation	SNP	C	C	G			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:65632780C>G	ENST00000308110.4	+	14	1840	c.1491C>G	c.(1489-1491)taC>taG	p.Y497*	MUS81_ENST00000533035.1_Nonsense_Mutation_p.Y422*|EFEMP2_ENST00000532648.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	497					DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y497*(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		TGGATCGATACAGCACCCCTG	0.632								Homologous recombination																																								1	Substitution - Nonsense(1)	ovary(1)	11											76.0	76.0	76.0					11																	65632780		2201	4296	6497	65389356	SO:0001587	stop_gained	80198				CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.1491C>G	11.37:g.65632780C>G	ENSP00000307853:p.Tyr497*		65389356	Q9H7D9	Nonsense_Mutation	SNP	ENST00000308110.4	37	CCDS8115.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	40	7.929773	0.98565	.	.	ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855;ENST00000529742	.	.	.	5.75	4.84	0.62591	.	0.058325	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3281	12.3547	0.55167	0.0:0.9183:0.0:0.0817	.	.	.	.	X	422;497;497;30	.	ENSP00000307853:Y497X	Y	+	3	2	MUS81	65389356	1.000000	0.71417	0.997000	0.53966	0.935000	0.57460	3.682000	0.54656	1.437000	0.47472	0.511000	0.50034	TAC		0.632	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128		Nonsense_Mutation
MYH1	4619	hgsc.bcm.edu	37	17	10399470	10399470	+	Splice_Site	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:10399470C>A	ENST00000226207.5	-	35	5060	c.4966G>T	c.(4966-4968)Gat>Tat	p.D1656Y	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1656					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D1656Y(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AGCTGGGTATCCTGTGGAACA	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											82.0	73.0	76.0					17																	10399470		2203	4300	6503	10340195	SO:0001630	splice_region_variant	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4966-1G>T	17.37:g.10399470C>A			10340195	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611933	0.66558	.	.	ENSG00000109061	ENST00000226207	T	0.80994	-1.44	5.53	5.53	0.82687	Myosin tail (1);	0.000000	0.45126	U	0.000391	D	0.93213	0.7838	H	0.96460	3.825	0.80722	D	1	D	0.59357	0.985	D	0.67103	0.949	D	0.94736	0.7914	10	0.87932	D	0	.	19.8241	0.96610	0.0:1.0:0.0:0.0	.	1656	P12882	MYH1_HUMAN	Y	1656	ENSP00000226207:D1656Y	ENSP00000226207:D1656Y	D	-	1	0	MYH1	10340195	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	7.538000	0.82048	2.758000	0.94735	0.655000	0.94253	GAT		0.542	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	Missense_Mutation	Missense_Mutation
NAGLU	4669	hgsc.bcm.edu	37	17	40690745	40690745	+	Frame_Shift_Del	DEL	G	G	-			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:40690745delG	ENST00000225927.2	+	4	837	c.736delG	c.(736-738)gcgfs	p.A246fs	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	246			A -> P (in MPS3B; produces 12.7% residual enzyme activity). {ECO:0000269|PubMed:16151907}.		carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)	p.A246fs*54(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GCCTGCATTCGCGGGGCATGT	0.572																																																1	Deletion - Frameshift(1)	ovary(1)	17	GRCh37	CM053339	NAGLU	M							61.0	48.0	52.0					17																	40690745		2203	4300	6503	37944271	SO:0001589	frameshift_variant	4669				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.736delG	17.37:g.40690745delG	ENSP00000225927:p.Ala246fs		37944271		Frame_Shift_Del	DEL	ENST00000225927.2	37	CCDS11427.1	DEL	38	Baylor																																																																																				0.572	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263		Frame_Shift_Del
NCKAP5	344148	hgsc.bcm.edu	37	2	133541716	133541716	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr2:133541716T>A	ENST00000409261.1	-	14	3041	c.2668A>T	c.(2668-2670)Agt>Tgt	p.S890C	NCKAP5_ENST00000317721.6_Missense_Mutation_p.S890C|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	890								p.S890G(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGAGTCTGACTCTTGGGGCAC	0.587																																																1	Substitution - Missense(1)	large_intestine(1)	2											50.0	52.0	51.0					2																	133541716		1970	4153	6123	133258186	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2668A>T	2.37:g.133541716T>A	ENSP00000387128:p.Ser890Cys		133258186	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	t	12.94	2.089809	0.36855	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.16743	2.32;2.32	4.76	3.6	0.41247	.	0.148426	0.30611	U	0.009250	T	0.23572	0.0570	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	P	0.59288	0.855	T	0.01301	-1.1391	10	0.87932	D	0	.	9.2995	0.37835	0.0:0.0819:0.0:0.9181	.	890	O14513	NCKP5_HUMAN	C	890	ENSP00000387128:S890C;ENSP00000380603:S890C	ENSP00000380603:S890C	S	-	1	0	NCKAP5	133258186	0.438000	0.25602	0.877000	0.34402	0.037000	0.13140	2.069000	0.41481	0.971000	0.38288	0.525000	0.51046	AGT		0.587	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		Missense_Mutation
NDUFAF3	25915	hgsc.bcm.edu	37	3	49060371	49060371	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr3:49060371A>C	ENST00000326925.6	+	4	1534	c.400A>C	c.(400-402)Atg>Ctg	p.M134L	NDUFAF3_ENST00000451378.2_Missense_Mutation_p.M77L|DALRD3_ENST00000313778.5_5'Flank|NDUFAF3_ENST00000326912.4_Missense_Mutation_p.M77L|DALRD3_ENST00000496568.1_5'Flank|MIR425_ENST00000362162.1_RNA|NDUFAF3_ENST00000395458.2_Missense_Mutation_p.M77L|DALRD3_ENST00000440857.1_5'Flank|MIR191_ENST00000384873.1_RNA	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3	134					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						GCTTCAAGCCATGAGGCAGCG	0.632																																																0			3											72.0	80.0	78.0					3																	49060371		2203	4300	6503	49035375	SO:0001583	missense	25915				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773	ENST00000326925.6:c.400A>C	3.37:g.49060371A>C	ENSP00000323076:p.Met134Leu		49035375		Missense_Mutation	SNP	ENST00000326925.6	37	CCDS2784.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.338	1.062201	0.19987	.	.	ENSG00000178057	ENST00000326912;ENST00000326925;ENST00000395458;ENST00000451378	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.56	0.118	0.14667	.	0.193591	0.56097	N	0.000038	T	0.29749	0.0743	N	0.02192	-0.645	0.42293	D	0.99214	B	0.02656	0.0	B	0.13407	0.009	T	0.34601	-0.9822	10	0.02654	T	1	-18.2693	6.5457	0.22404	0.6272:0.2415:0.1313:0.0	.	134	Q9BU61	NDUF3_HUMAN	L	77;134;77;77	ENSP00000323003:M77L;ENSP00000323076:M134L;ENSP00000378843:M77L;ENSP00000402465:M77L	ENSP00000323003:M77L	M	+	1	0	NDUFAF3	49035375	1.000000	0.71417	0.957000	0.39632	0.655000	0.38815	2.563000	0.45922	-0.196000	0.10366	-0.254000	0.11334	ATG		0.632	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069		Missense_Mutation
NFXL1	152518	hgsc.bcm.edu	37	4	47853937	47853937	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:47853937C>T	ENST00000507489.1	-	21	2620	c.2444G>A	c.(2443-2445)cGt>cAt	p.R815H	NFXL1_ENST00000381538.3_Missense_Mutation_p.R815H	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	815						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R815H(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CTGATTTTCACGTACTTTGTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											181.0	162.0	168.0					4																	47853937		2203	4300	6503	47548694	SO:0001583	missense	152518			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2444G>A	4.37:g.47853937C>T	ENSP00000422037:p.Arg815His		47548694	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502008	0.85176	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.29917	1.55;1.55	5.82	5.82	0.92795	.	0.086607	0.49916	D	0.000125	T	0.40670	0.1126	M	0.67397	2.05	0.80722	D	1	D	0.61080	0.989	P	0.47981	0.563	T	0.30880	-0.9963	10	0.59425	D	0.04	-33.223	14.2902	0.66273	0.0:0.9273:0.0:0.0727	.	815	Q6ZNB6	NFXL1_HUMAN	H	815	ENSP00000370949:R815H;ENSP00000422037:R815H	ENSP00000370949:R815H	R	-	2	0	NFXL1	47548694	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.576000	0.36504	2.760000	0.94817	0.655000	0.94253	CGT		0.358	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995		Missense_Mutation
NOL6	65083	hgsc.bcm.edu	37	9	33469658	33469658	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:33469658A>C	ENST00000379471.2	-	5	653	c.566T>G	c.(565-567)cTa>cGa	p.L189R	NOL6_ENST00000464829.1_5'UTR|NOL6_ENST00000455041.2_Missense_Mutation_p.L129R			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	189					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CTTGTCCTGTAGGATTTCCTG	0.617																																																0			9											83.0	93.0	90.0					9																	33469658		2203	4300	6503	33459658	SO:0001583	missense	65083			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.566T>G	9.37:g.33469658A>C	ENSP00000368784:p.Leu189Arg		33459658	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		SNP	15	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.1	4.245861	0.80024	.	.	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.68	5.68	0.88126	.	0.129105	0.50627	D	0.000101	T	0.71099	0.3300	M	0.68317	2.08	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;D;D	0.80764	0.994;0.989;0.989;0.975;0.991	T	0.74435	-0.3666	10	0.87932	D	0	.	15.9269	0.79624	1.0:0.0:0.0:0.0	.	129;189;189;189;189	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	R	189;189;189;189;129	ENSP00000313978:L189R;ENSP00000297990:L189R;ENSP00000368784:L189R;ENSP00000395915:L129R	ENSP00000297990:L189R	L	-	2	0	NOL6	33459658	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.709000	0.74665	2.174000	0.68829	0.459000	0.35465	CTA		0.617	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917		Missense_Mutation
NR1H3	10062	hgsc.bcm.edu	37	11	47281408	47281408	+	Frame_Shift_Del	DEL	G	G	-			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:47281408delG	ENST00000467728.1	+	2	1348	c.110delG	c.(109-111)agcfs	p.S37fs	NR1H3_ENST00000527949.1_5'Flank|NR1H3_ENST00000441012.2_Frame_Shift_Del_p.S37fs|NR1H3_ENST00000407404.1_Frame_Shift_Del_p.S37fs|NR1H3_ENST00000405576.1_5'UTR|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405853.3_Frame_Shift_Del_p.S37fs|NR1H3_ENST00000481889.2_5'UTR|NR1H3_ENST00000395397.3_5'UTR			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	37					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S37fs*77(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GGAGGCAGCAGCTGCATCCTC	0.652											OREG0020956	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - Frameshift(1)	ovary(1)	11											28.0	28.0	28.0					11																	47281408		2201	4298	6499	47237984	SO:0001589	frameshift_variant	10062			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.110delG	11.37:g.47281408delG	ENSP00000420656:p.Ser37fs	945	47237984	A8K3J9|D3DQR1|Q8IW13|Q96H87	Frame_Shift_Del	DEL	ENST00000467728.1	37	CCDS7929.1	DEL	34	Baylor																																																																																				0.652	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3			Frame_Shift_Del
NUP188	23511	hgsc.bcm.edu	37	9	131761508	131761508	+	Silent	SNP	G	G	T			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:131761508G>T	ENST00000372577.2	+	33	3594	c.3573G>T	c.(3571-3573)gtG>gtT	p.V1191V		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1191					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TGGAGGGAGTGCTGCAGGCCG	0.532											OREG0003925	type=REGULATORY REGION|Gene=AK025292|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			9											95.0	84.0	88.0					9																	131761508		2203	4300	6503	130801329	SO:0001819	synonymous_variant	23511			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3573G>T	9.37:g.131761508G>T		1590	130801329	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	ENST00000372577.2	37	CCDS35156.1	SNP	46	Baylor																																																																																				0.532	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			Silent
NUP85	79902	hgsc.bcm.edu	37	17	73231685	73231685	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:73231685G>C	ENST00000245544.4	+	19	1953	c.1882G>C	c.(1882-1884)Gag>Cag	p.E628Q	NUP85_ENST00000579298.1_Missense_Mutation_p.E583Q|NUP85_ENST00000541827.1_Missense_Mutation_p.E582Q|NUP85_ENST00000540768.1_Missense_Mutation_p.E231Q|NUP85_ENST00000447371.2_3'UTR|NUP85_ENST00000579324.1_Missense_Mutation_p.E516Q	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	628					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.E628Q(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TGATGACATAGAGACCACCAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	17											80.0	75.0	77.0					17																	73231685		2203	4300	6503	70743280	SO:0001583	missense	79902			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.1882G>C	17.37:g.73231685G>C	ENSP00000245544:p.Glu628Gln		70743280	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	ENST00000245544.4	37	CCDS32730.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679183	0.88542	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000540768	.	.	.	5.91	5.91	0.95273	.	0.046847	0.85682	D	0.000000	T	0.45418	0.1341	N	0.08118	0	0.80722	D	1	D;D	0.57899	0.981;0.981	P;P	0.52109	0.69;0.69	T	0.35992	-0.9766	9	0.15499	T	0.54	-23.556	20.2985	0.98592	0.0:0.0:1.0:0.0	.	582;628	B4DMQ3;Q9BW27	.;NUP85_HUMAN	Q	628;582;231	.	ENSP00000245544:E628Q	E	+	1	0	NUP85	70743280	1.000000	0.71417	0.991000	0.47740	0.613000	0.37349	7.026000	0.76455	2.793000	0.96121	0.655000	0.94253	GAG		0.502	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1	NM_024844		Missense_Mutation
TENM4	26011	hgsc.bcm.edu	37	11	78372634	78372634	+	Frame_Shift_Del	DEL	C	C	-			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:78372634delC	ENST00000278550.7	-	33	7873	c.7411delG	c.(7411-7413)gttfs	p.V2471fs		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2471					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.V2471fs*15(1)									CAGCTGTTAACATCTGGATGG	0.522																																																1	Deletion - Frameshift(1)	ovary(1)	11											89.0	88.0	88.0					11																	78372634		2043	4204	6247	78050282	SO:0001589	frameshift_variant	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7411delG	11.37:g.78372634delC	ENSP00000278550:p.Val2471fs		78050282	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Frame_Shift_Del	DEL	ENST00000278550.7	37	CCDS44688.1	DEL	17	Baylor																																																																																				0.522	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			Frame_Shift_Del
PCSK1	5122	hgsc.bcm.edu	37	5	95728746	95728746	+	Silent	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr5:95728746G>A	ENST00000311106.3	-	14	2458	c.2221C>T	c.(2221-2223)Ctg>Ttg	p.L741L	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR|PCSK1_ENST00000508626.1_Silent_p.L694L	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	741					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.L741L(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCTTGAAGCAGCCGGTCGTCT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	5											164.0	171.0	169.0					5																	95728746		2203	4300	6503	95754502	SO:0001819	synonymous_variant	5122				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.2221C>T	5.37:g.95728746G>A			95754502	B7Z8T7|E9PHA1|P78478|Q92532	Silent	SNP	ENST00000311106.3	37	CCDS4081.1	SNP	34	Baylor																																																																																				0.398	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439		Silent
PDZD3	79849	hgsc.bcm.edu	37	11	119059206	119059207	+	In_Frame_Ins	INS	-	-	TCATAA			TCGA-04-1337-01	TCGA-04-1337-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:119059206_119059207insTCATAA	ENST00000531114.1	+	6	1752_1753	c.1203_1204insTCATAA	c.(1204-1206)tcc>TCATAAtcc	p.402_402S>S*S	PDZD3_ENST00000525131.1_In_Frame_Ins_p.323_323S>S*S|PDZD3_ENST00000392817.2_In_Frame_Ins_p.402_402S>S*S|PDZD3_ENST00000322712.4_In_Frame_Ins_p.322_322S>S*S|PDZD3_ENST00000355547.5_In_Frame_Ins_p.336_336S>S*S			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	402	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)	p.G321_S322insS*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		AGGGGCAGGGCTCCTGTGTCTC	0.683																																																1	Insertion - In frame(1)	ovary(1)	11																																								118564417	SO:0001652	inframe_insertion	79849			AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	Exception_encountered	11.37:g.119059206_119059207insTCATAA	Exception_encountered		118564416	Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	In_Frame_Ins	INS	ENST00000531114.1	37		INS	28	Baylor																																																																																				0.683	PDZD3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388471.1	NM_024791		In_Frame_Ins
PDZK1IP1	10158	hgsc.bcm.edu	37	1	47655583	47655583	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr1:47655583T>C	ENST00000294338.2	-	1	144	c.22A>G	c.(22-24)Att>Gtt	p.I8V	PDZK1IP1_ENST00000371885.1_Missense_Mutation_p.I8V	NM_005764.3	NP_005755.1	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	8						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)	3						AGGCCCAGAATGAGGAGGCTG	0.652																																																0			1											40.0	35.0	37.0					1																	47655583		2201	4298	6499	47428170	SO:0001583	missense	10158			U21049	CCDS546.1	1p33	2008-02-05			ENSG00000162366	ENSG00000162366			16887	protein-coding gene	gene with protein product		607178				9815914, 8701988, 12754212, 12837682	Standard	NM_005764		Approved	DD96, MAP17, SPAP	uc001cqw.3	Q13113	OTTHUMG00000007852	ENST00000294338.2:c.22A>G	1.37:g.47655583T>C	ENSP00000294338:p.Ile8Val		47428170	Q6ICT9|Q96EI1	Missense_Mutation	SNP	ENST00000294338.2	37	CCDS546.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.838	0.941602	0.18281	.	.	ENSG00000162366	ENST00000294338;ENST00000371885	.	.	.	4.56	-7.61	0.01299	.	2.351580	0.01517	N	0.018203	T	0.16041	0.0386	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11108	-1.0601	9	0.17832	T	0.49	0.053	1.2192	0.01921	0.2357:0.3252:0.2664:0.1727	.	8	Q13113	PDZ1I_HUMAN	V	8	.	ENSP00000294338:I8V	I	-	1	0	PDZK1IP1	47428170	0.000000	0.05858	0.004000	0.12327	0.916000	0.54674	-1.621000	0.02044	-1.157000	0.02815	0.533000	0.62120	ATT		0.652	PDZK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021655.1	NM_005764		Missense_Mutation
PEG3	5178	hgsc.bcm.edu	37	19	57328017	57328017	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:57328017C>T	ENST00000326441.9	-	10	2156	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H	ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R474H|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R472H|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R598H|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	598					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R598H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ttcacgttcacgttcatgttc	0.458																																																2	Substitution - Missense(2)	ovary(2)	19											106.0	83.0	91.0					19																	57328017		2203	4300	6503	62019829	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1793G>A	19.37:g.57328017C>T	ENSP00000326581:p.Arg598His		62019829	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.743	-0.775804	0.02951	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02863	4.13;4.13	1.08	-0.0769	0.13721	.	.	.	.	.	T	0.02193	0.0068	L	0.50333	1.59	.	.	.	B;B;P	0.40107	0.055;0.291;0.703	B;B;B	0.23150	0.001;0.013;0.044	T	0.41251	-0.9519	8	0.56958	D	0.05	.	3.4582	0.07523	0.0:0.7126:0.0:0.2874	.	474;598;533	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	H	598	ENSP00000326581:R598H;ENSP00000403051:R598H	ENSP00000326581:R598H	R	-	2	0	ZIM2	62019829	0.000000	0.05858	0.010000	0.14722	0.165000	0.22458	-0.044000	0.12023	0.063000	0.16370	0.525000	0.51046	CGT		0.458	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			Missense_Mutation
PIGB	9488	hgsc.bcm.edu	37	15	55631510	55631510	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr15:55631510T>A	ENST00000164305.5	+	7	1131	c.840T>A	c.(838-840)ttT>ttA	p.F280L	CCPG1_ENST00000563294.1_5'Flank|PIGB_ENST00000539642.1_Missense_Mutation_p.F85L	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	280					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		GTATTTTTTTTGGCCAAGTAA	0.289																																																0			15											126.0	103.0	110.0					15																	55631510		1780	4031	5811	53418802	SO:0001583	missense	9488			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.840T>A	15.37:g.55631510T>A	ENSP00000164305:p.Phe280Leu		53418802	Q53FF9|Q8WVN7	Missense_Mutation	SNP	ENST00000164305.5	37		SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.0	4.592487	0.86953	.	.	ENSG00000069943	ENST00000164305;ENST00000539642	T;T	0.67171	-0.25;-0.25	5.55	4.44	0.53790	.	0.120183	0.64402	D	0.000015	T	0.73961	0.3654	M	0.80982	2.52	0.51012	D	0.999902	P	0.42620	0.785	P	0.48873	0.593	T	0.75637	-0.3249	10	0.66056	D	0.02	-13.4847	10.5002	0.44802	0.0:0.0758:0.0:0.9242	.	280	Q92521	PIGB_HUMAN	L	280;85	ENSP00000164305:F280L;ENSP00000438963:F85L	ENSP00000164305:F280L	F	+	3	2	PIGB	53418802	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.480000	0.45206	0.946000	0.37632	0.528000	0.53228	TTT		0.289	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855		Missense_Mutation
PIGO	84720	hgsc.bcm.edu	37	9	35091522	35091523	+	Frame_Shift_Ins	INS	-	-	G	rs144233446		TCGA-04-1337-01	TCGA-04-1337-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:35091522_35091523insG	ENST00000378617.3	-	7	2755_2756	c.2361_2362insC	c.(2359-2364)cccactfs	p.T788fs	PIGO_ENST00000361778.2_Intron|PIGO_ENST00000341666.3_Frame_Shift_Ins_p.T788fs|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	788					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.T788fs*5(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GCTTGAGAAGTGGGGGGGCCTG	0.604																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								35081523	SO:0001589	frameshift_variant	84720			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2362dupC	9.37:g.35091529_35091529dupG	ENSP00000367880:p.Thr788fs		35081522	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Frame_Shift_Ins	INS	ENST00000378617.3	37	CCDS6575.1	INS	59	Baylor																																																																																				0.604	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634		Frame_Shift_Ins
PRSS53	339105	hgsc.bcm.edu	37	16	31098208	31098208	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr16:31098208G>T	ENST00000280606.6	-	4	407	c.254C>A	c.(253-255)aCa>aAa	p.T85K	RP11-196G11.1_ENST00000529564.1_Missense_Mutation_p.T160K	NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	85	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						ATTCAGTTCTGTTGCTGCTGC	0.612																																																0			16											36.0	38.0	37.0					16																	31098208		2081	4232	6313	31005709	SO:0001583	missense	339105				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.254C>A	16.37:g.31098208G>T	ENSP00000280606:p.Thr85Lys		31005709		Missense_Mutation	SNP	ENST00000280606.6	37	CCDS42153.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.195	0.221436	0.09863	.	.	ENSG00000151006;ENSG00000255439	ENST00000280606;ENST00000529564	T;D	0.91894	-1.49;-2.93	5.75	3.8	0.43715	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.434355	0.16682	U	0.203901	D	0.85695	0.5756	N	0.17278	0.47	0.09310	N	0.999998	P	0.39717	0.684	B	0.43623	0.425	T	0.72475	-0.4282	10	0.07644	T	0.81	.	13.5794	0.61893	0.1186:0.0:0.8814:0.0	.	85	Q2L4Q9	PRS53_HUMAN	K	85;160	ENSP00000280606:T85K;ENSP00000431371:T160K	ENSP00000280606:T85K	T	-	2	0	RP11-196G11.1;PRSS53	31005709	0.808000	0.29022	0.070000	0.20053	0.000000	0.00434	4.221000	0.58574	0.380000	0.24823	-1.731000	0.00696	ACA		0.612	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108580.4	NM_001081268		Missense_Mutation
PPHLN1	51535	hgsc.bcm.edu	37	12	42768739	42768739	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr12:42768739G>C	ENST00000395568.2	+	5	458	c.374G>C	c.(373-375)aGg>aCg	p.R125T	PPHLN1_ENST00000449194.2_Missense_Mutation_p.R125T|PPHLN1_ENST00000317560.9_Missense_Mutation_p.R77T|PPHLN1_ENST00000395580.3_Missense_Mutation_p.R132T|PPHLN1_ENST00000432191.2_Missense_Mutation_p.R70T|PPHLN1_ENST00000549190.1_Missense_Mutation_p.R143T|PPHLN1_ENST00000256678.8_Missense_Mutation_p.R24T|PPHLN1_ENST00000358314.7_Missense_Mutation_p.R125T|PPHLN1_ENST00000552761.1_Missense_Mutation_p.R77T|PPHLN1_ENST00000337898.6_Missense_Mutation_p.R70T	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	125					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R125T(1)		breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		CCTTATAAAAGGGACAATACT	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	80.0	80.0					12																	42768739		2203	4300	6503	41055006	SO:0001583	missense	51535			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.374G>C	12.37:g.42768739G>C	ENSP00000378935:p.Arg125Thr		41055006	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	ENST00000395568.2	37	CCDS31777.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915699	0.52546	.	.	ENSG00000134283	ENST00000549190;ENST00000395580;ENST00000337898;ENST00000358314;ENST00000395568;ENST00000256678;ENST00000449194;ENST00000552761;ENST00000317560;ENST00000432191;ENST00000546750;ENST00000547847	.	.	.	6.17	5.29	0.74685	.	0.108809	0.64402	D	0.000011	T	0.78285	0.4259	M	0.71036	2.16	0.52501	D	0.999955	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.995;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.998;0.996;0.996;0.996;0.995;0.996;0.997;0.999;0.999;0.999;1.0;0.999	T	0.80961	-0.1148	9	0.72032	D	0.01	-6.6921	15.336	0.74255	0.0662:0.0:0.9338:0.0	.	77;24;70;70;77;70;125;125;125;77;132;77;143	F8WF16;F8W6A0;B7Z695;B7Z8L1;B7Z615;Q8NEY8-3;Q8NEY8;E9PAX8;Q8NEY8-8;Q8NEY8-6;Q8NEY8-2;Q8NEY8-5;F8W0Q9	.;.;.;.;.;.;PPHLN_HUMAN;.;.;.;.;.;.	T	143;132;70;125;125;24;125;77;77;70;132;125	.	ENSP00000256678:R24T	R	+	2	0	PPHLN1	41055006	1.000000	0.71417	0.980000	0.43619	0.086000	0.17979	3.733000	0.55029	1.630000	0.50440	0.655000	0.94253	AGG		0.403	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515		Missense_Mutation
PTPN12	5782	hgsc.bcm.edu	37	7	77166940	77166940	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr7:77166940A>C	ENST00000248594.6	+	1	349	c.77A>C	c.(76-78)gAc>gCc	p.D26A	PTPN12_ENST00000435495.2_5'Flank|PTPN12_ENST00000415482.2_5'Flank	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	26					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.D26A(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						AATGGGGAGGACAACTTCGCC	0.657																																																1	Substitution - Missense(1)	ovary(1)	7											47.0	41.0	43.0					7																	77166940		2201	4300	6501	77004876	SO:0001583	missense	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.77A>C	7.37:g.77166940A>C	ENSP00000248594:p.Asp26Ala		77004876	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	a	11.05	1.524014	0.27299	.	.	ENSG00000127947	ENST00000248594	T	0.30714	1.52	2.69	2.69	0.31865	.	0.457359	0.18754	N	0.132083	T	0.23886	0.0578	L	0.48642	1.525	0.80722	D	1	B	0.17667	0.023	B	0.15052	0.012	T	0.04767	-1.0928	10	0.18710	T	0.47	.	9.8064	0.40795	1.0:0.0:0.0:0.0	.	26	Q05209	PTN12_HUMAN	A	26	ENSP00000248594:D26A	ENSP00000248594:D26A	D	+	2	0	PTPN12	77004876	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	4.812000	0.62613	1.479000	0.48272	0.375000	0.23000	GAC		0.657	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			Missense_Mutation
RNFT2	84900	hgsc.bcm.edu	37	12	117287151	117287151	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr12:117287151G>C	ENST00000257575.4	+	11	1466	c.1233G>C	c.(1231-1233)tgG>tgC	p.W411C	RNFT2_ENST00000392549.2_Missense_Mutation_p.W411C|RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000319176.7_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	411						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TCTGCCTGTGGCTGGACCGTG	0.662																																																0			12											19.0	21.0	20.0					12																	117287151		2110	4128	6238	115771534	SO:0001583	missense	84900			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.1233G>C	12.37:g.117287151G>C	ENSP00000257575:p.Trp411Cys		115771534	E9PAM7|Q96SU5	Missense_Mutation	SNP	ENST00000257575.4	37	CCDS44987.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638651	0.87760	.	.	ENSG00000135119	ENST00000257575;ENST00000392549	T;T	0.75154	-0.91;-0.91	5.19	5.19	0.71726	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	D	0.87617	0.6222	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89459	0.3735	9	0.87932	D	0	-12.0764	18.2978	0.90153	0.0:0.0:1.0:0.0	.	411	Q96EX2	RNFT2_HUMAN	C	411	ENSP00000257575:W411C;ENSP00000376332:W411C	ENSP00000257575:W411C	W	+	3	0	RNFT2	115771534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.363000	0.97131	2.404000	0.81709	0.549000	0.68633	TGG		0.662	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814		Missense_Mutation
SEC24B	10427	hgsc.bcm.edu	37	4	110415906	110415906	+	Missense_Mutation	SNP	A	A	G	rs370271043		TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:110415906A>G	ENST00000265175.5	+	6	1437	c.1382A>G	c.(1381-1383)tAt>tGt	p.Y461C	SEC24B_ENST00000504968.2_Missense_Mutation_p.Y492C|SEC24B_ENST00000399100.2_Missense_Mutation_p.Y426C	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	461					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.Y426C(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CCTTTTGGCTATGGCTATCCA	0.512																																																1	Substitution - Missense(1)	ovary(1)	4						A	CYS/TYR,CYS/TYR	0,4252		0,0,2126	111.0	115.0	114.0		1277,1382	4.3	1.0	4		114	2,8558		0,2,4278	no	missense,missense	SEC24B	NM_001042734.1,NM_006323.2	194,194	0,2,6404	GG,GA,AA		0.0234,0.0,0.0156	benign,benign	426/1234,461/1269	110415906	2,12810	2126	4280	6406	110635355	SO:0001583	missense	10427			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1382A>G	4.37:g.110415906A>G	ENSP00000265175:p.Tyr461Cys		110635355	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.25	2.181377	0.38511	0.0	2.34E-4	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.24151	1.87;1.87;1.87	5.47	4.28	0.50868	.	.	.	.	.	T	0.34077	0.0885	L	0.61218	1.895	0.50813	D	0.999896	B;P;B;B;B	0.50819	0.003;0.939;0.006;0.001;0.001	B;P;B;B;B	0.50490	0.005;0.642;0.008;0.018;0.008	T	0.04360	-1.0957	9	0.40728	T	0.16	4.5137	9.9254	0.41489	0.9214:0.0:0.0786:0.0	.	376;60;492;426;461	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	C	492;426;461	ENSP00000428564:Y492C;ENSP00000382051:Y426C;ENSP00000265175:Y461C	ENSP00000265175:Y461C	Y	+	2	0	SEC24B	110635355	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	3.723000	0.54955	0.890000	0.36211	0.533000	0.62120	TAT		0.512	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			Missense_Mutation
SH3PXD2A	9644	hgsc.bcm.edu	37	10	105386926	105386926	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr10:105386926C>A	ENST00000369774.4	-	9	914	c.638G>T	c.(637-639)gGc>gTc	p.G213V	SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.G80V|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.G48V|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.G213V|SH3PXD2A_ENST00000427662.2_Missense_Mutation_p.G75V			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	213	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		AGGGACCCAGCCCTGCTCCTC	0.607																																																0			10											97.0	83.0	87.0					10																	105386926		2203	4300	6503	105376916	SO:0001583	missense	9644			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.638G>T	10.37:g.105386926C>A	ENSP00000358789:p.Gly213Val		105376916	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863658	0.91511	.	.	ENSG00000107957	ENST00000427662;ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	D;D;D;D;D	0.95103	-3.61;-2.35;-2.35;-2.35;-2.35	5.33	5.33	0.75918	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.98592	0.9529	H	0.99273	4.495	0.80722	D	1	D;P;D;P;D	0.76494	0.992;0.951;0.999;0.526;0.979	D;P;D;B;D	0.70487	0.969;0.861;0.959;0.403;0.947	D	0.99764	1.1022	10	0.87932	D	0	-25.9245	17.7929	0.88561	0.0:1.0:0.0:0.0	.	213;90;75;86;213	Q5TCZ1;B7Z9L8;F8WCK5;B7Z3B0;Q5TCZ1-3	SPD2A_HUMAN;.;.;.;.	V	75;213;213;48;128;80;48	ENSP00000392664:G75V;ENSP00000358789:G213V;ENSP00000348215:G213V;ENSP00000443663:G80V;ENSP00000441514:G48V	ENSP00000318135:G48V	G	-	2	0	SH3PXD2A	105376916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.468000	0.80943	2.503000	0.84419	0.561000	0.74099	GGC		0.607	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631		Missense_Mutation
SLC12A5	57468	hgsc.bcm.edu	37	20	44665931	44665931	+	Silent	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr20:44665931C>T	ENST00000454036.2	+	6	637	c.588C>T	c.(586-588)ggC>ggT	p.G196G	SLC12A5_ENST00000243964.3_Silent_p.G173G|SLC12A5_ENST00000372315.1_Silent_p.G173G	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	196					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGTCTCTGGGCCCAGAGTTTG	0.597																																																0			20											77.0	70.0	72.0					20																	44665931		2203	4300	6503	44099338	SO:0001819	synonymous_variant	57468			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.588C>T	20.37:g.44665931C>T			44099338	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	CCDS46610.1	SNP	26	Baylor																																																																																				0.597	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			Silent
SLC12A6	9990	hgsc.bcm.edu	37	15	34542845	34542849	+	Frame_Shift_Del	DEL	GGTCA	GGTCA	-			TCGA-04-1337-01	TCGA-04-1337-11	GGTCA	GGTCA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr15:34542845_34542849delGGTCA	ENST00000354181.3	-	12	2066_2070	c.1574_1578delTGACC	c.(1573-1578)ctgaccfs	p.LT525fs	SLC12A6_ENST00000397707.2_Frame_Shift_Del_p.LT510fs|SLC12A6_ENST00000558589.1_Frame_Shift_Del_p.LT516fs|SLC12A6_ENST00000558667.1_Frame_Shift_Del_p.LT525fs|SLC12A6_ENST00000397702.2_Frame_Shift_Del_p.LT466fs|SLC12A6_ENST00000451844.2_Frame_Shift_Del_p.LT337fs|SLC12A6_ENST00000458406.2_Frame_Shift_Del_p.LT466fs|SLC12A6_ENST00000560611.1_Frame_Shift_Del_p.LT525fs|SLC12A6_ENST00000560164.1_Frame_Shift_Del_p.LT337fs|SLC12A6_ENST00000290209.5_Frame_Shift_Del_p.LT474fs			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	525					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.L474L(1)|p.L516L(1)|p.L474fs*17(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CAAAGGAGGTGGTCAGGATGGCAAG	0.41																																																3	Substitution - coding silent(2)|Deletion - Frameshift(1)	lung(2)|ovary(1)	15																																								32330141	SO:0001589	frameshift_variant	9990			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1574_1578delTGACC	15.37:g.34542845_34542849delGGTCA	ENSP00000346112:p.Leu525fs		32330137	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Frame_Shift_Del	DEL	ENST00000354181.3	37	CCDS58352.1	DEL	47	Baylor																																																																																				0.410	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		Frame_Shift_Del
SLC1A5	6510	hgsc.bcm.edu	37	19	47280263	47280263	+	Missense_Mutation	SNP	T	T	G	rs79376478	byFrequency	TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:47280263T>G	ENST00000542575.2	-	7	1985	c.1357A>C	c.(1357-1359)Atc>Ctc	p.I453L	SLC1A5_ENST00000412532.2_Missense_Mutation_p.I225L|SLC1A5_ENST00000434726.2_Missense_Mutation_p.I251L|SLC1A5_ENST00000594991.1_Missense_Mutation_p.I277L	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	453				I -> V (in Ref. 2; AAD09812). {ECO:0000305}.	amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	ATCAAGGAGATATGGTCGACC	0.627													T|||	13	0.00259585	0.0	0.0043	5008	,	,		21395	0.0		0.007	False		,,,				2504	0.0031															0			19						T	LEU/ILE,LEU/ILE,LEU/ILE	9,4397	15.5+/-35.6	0,9,2194	107.0	89.0	95.0		673,751,1357	4.6	0.9	19	dbSNP_131	95	102,8498	56.4+/-117.6	2,98,4200	yes	missense,missense,missense	SLC1A5	NM_001145144.1,NM_001145145.1,NM_005628.2	5,5,5	2,107,6394	GG,GT,TT		1.186,0.2043,0.8535	benign,benign,benign	225/314,251/340,453/542	47280263	111,12895	2203	4300	6503	51972103	SO:0001583	missense	6510			U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1357A>C	19.37:g.47280263T>G	ENSP00000444408:p.Ile453Leu		51972103	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	ENST00000542575.2	37	CCDS12692.1	SNP	49	Baylor	8	0.003663003663003663	0	0.0	3	0.008287292817679558	0	0.0	5	0.006596306068601583	T	11.98	1.799774	0.31869	0.002043	0.01186	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.58940	0.3;0.3;0.3	5.66	4.59	0.56863	.	0.168732	0.52532	N	0.000078	T	0.33644	0.0870	N	0.16790	0.44	0.42518	D	0.992995	B;B;B	0.14438	0.01;0.005;0.005	B;B;B	0.24269	0.052;0.019;0.042	T	0.15263	-1.0443	10	0.33940	T	0.23	-36.5449	12.0443	0.53471	0.0:0.0:0.1779:0.8221	.	251;453;453	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	L	453;251;225;460	ENSP00000444408:I453L;ENSP00000406532:I251L;ENSP00000397924:I225L	ENSP00000303623:I460L	I	-	1	0	SLC1A5	51972103	1.000000	0.71417	0.911000	0.35937	0.408000	0.30992	1.789000	0.38724	1.020000	0.39573	0.374000	0.22700	ATC		0.627	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1			Missense_Mutation
SLC34A1	6569	hgsc.bcm.edu	37	5	176813281	176813281	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr5:176813281A>C	ENST00000324417.5	+	4	410	c.319A>C	c.(319-321)Atg>Ctg	p.M107L	SLC34A1_ENST00000512593.1_Missense_Mutation_p.M107L	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	107					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGCCACTGATGCTCACCTT	0.652																																																0			5											131.0	114.0	120.0					5																	176813281		2203	4300	6503	176745887	SO:0001583	missense	6569			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.319A>C	5.37:g.176813281A>C	ENSP00000321424:p.Met107Leu		176745887	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	CCDS4418.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256252	0.39896	.	.	ENSG00000131183	ENST00000504577;ENST00000512593;ENST00000324417	T;T	0.39229	1.09;1.81	5.06	5.06	0.68205	.	0.061993	0.64402	D	0.000002	T	0.28466	0.0704	L	0.32530	0.975	0.33139	D	0.544162	B	0.06786	0.001	B	0.04013	0.001	T	0.24728	-1.0152	10	0.02654	T	1	-34.0253	13.5482	0.61717	1.0:0.0:0.0:0.0	.	107	Q06495	NPT2A_HUMAN	L	107	ENSP00000423022:M107L;ENSP00000321424:M107L	ENSP00000321424:M107L	M	+	1	0	SLC34A1	176745887	1.000000	0.71417	0.996000	0.52242	0.537000	0.34900	4.598000	0.61069	2.135000	0.66039	0.459000	0.35465	ATG		0.652	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		Missense_Mutation
SLC5A6	8884	hgsc.bcm.edu	37	2	27427689	27427689	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr2:27427689A>G	ENST00000310574.3	-	8	1318	c.845T>C	c.(844-846)cTc>cCc	p.L282P	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Missense_Mutation_p.L282P	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	282					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	GCGGGAACTGAGGTACCGCTG	0.597																																																0			2											84.0	77.0	79.0					2																	27427689		2203	4300	6503	27281193	SO:0001583	missense	8884			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.845T>C	2.37:g.27427689A>G	ENSP00000310208:p.Leu282Pro		27281193	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	37	CCDS1740.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703126	0.88924	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.90788	-2.73;-2.73	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	D	0.96343	0.8807	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97208	0.9869	10	0.87932	D	0	.	13.494	0.61414	1.0:0.0:0.0:0.0	.	282	Q9Y289	SC5A6_HUMAN	P	282	ENSP00000310208:L282P;ENSP00000384853:L282P	ENSP00000310208:L282P	L	-	2	0	SLC5A6	27281193	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.166000	0.94766	2.064000	0.61679	0.533000	0.62120	CTC		0.597	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095		Missense_Mutation
SMARCAL1	50485	hgsc.bcm.edu	37	2	217311806	217311806	+	Silent	SNP	G	G	A	rs372995559		TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr2:217311806G>A	ENST00000357276.4	+	11	2106	c.1776G>A	c.(1774-1776)acG>acA	p.T592T	SMARCAL1_ENST00000358207.5_Silent_p.T592T	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	592	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.T592T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		AGCTCTACACGCAGATCATCG	0.527									Schimke Immuno-Osseous Dysplasia																																							1	Substitution - coding silent(1)	ovary(1)	2						G	,	0,4406		0,0,2203	150.0	138.0	142.0		1776,1776	-11.0	0.4	2		142	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SMARCAL1	NM_001127207.1,NM_014140.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	592/955,592/955	217311806	1,13005	2203	4300	6503	217020051	SO:0001819	synonymous_variant	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1776G>A	2.37:g.217311806G>A			217020051	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	37	CCDS2403.1	SNP	38	Baylor																																																																																				0.527	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			Silent
SNX19	399979	hgsc.bcm.edu	37	11	130750635	130750635	+	Frame_Shift_Del	DEL	A	A	-	rs372192550		TCGA-04-1337-01	TCGA-04-1337-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:130750635delA	ENST00000265909.4	-	9	3209	c.2640delT	c.(2638-2640)cttfs	p.L880fs	SNX19_ENST00000545537.1_Frame_Shift_Del_p.L120fs|SNX19_ENST00000539184.1_Frame_Shift_Del_p.L323fs|SNX19_ENST00000533318.1_5'UTR|SNX19_ENST00000530356.1_Frame_Shift_Del_p.L260fs|SNX19_ENST00000528555.1_Frame_Shift_Del_p.L260fs|SNX19_ENST00000534726.1_Frame_Shift_Del_p.L120fs|SNX19_ENST00000426933.2_Frame_Shift_Del_p.L48fs	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	880					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.Q881fs*17(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TGGACTCCTGAAGAAGCAGGA	0.522																																																1	Deletion - Frameshift(1)	ovary(1)	11											76.0	82.0	80.0					11																	130750635		2201	4297	6498	130255845	SO:0001589	frameshift_variant	399979			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.2640delT	11.37:g.130750635delA	ENSP00000265909:p.Leu880fs		130255845	E9PKB9|Q8IV55	Frame_Shift_Del	DEL	ENST00000265909.4	37	CCDS31721.1	DEL	9	Baylor																																																																																				0.522	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		Frame_Shift_Del
TAF6	6878	hgsc.bcm.edu	37	7	99711330	99711330	+	Silent	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr7:99711330C>T	ENST00000344095.4	-	4	831	c.306G>A	c.(304-306)cgG>cgA	p.R102R	TAF6_ENST00000418432.2_Silent_p.R45R|TAF6_ENST00000472509.1_Silent_p.R159R|TAF6_ENST00000437822.2_Silent_p.R139R|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000453269.2_Silent_p.R102R|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000452041.1_Silent_p.R102R	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	102					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGTAAAGCTCCCGGCCCCCAC	0.597																																																0			7											51.0	53.0	52.0					7																	99711330		2203	4300	6503	99549266	SO:0001819	synonymous_variant	6878				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.306G>A	7.37:g.99711330C>T			99549266	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	CCDS5686.1	SNP	22	Baylor																																																																																				0.597	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		Silent
TBX4	9496	hgsc.bcm.edu	37	17	59560377	59560377	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:59560377C>T	ENST00000240335.1	+	8	1183	c.1138C>T	c.(1138-1140)Ccc>Tcc	p.P380S	TBX4_ENST00000589449.1_3'UTR|TBX4_ENST00000393853.4_Missense_Mutation_p.P381S	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	380					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P380S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AATGCTGAGCCCCTCCTACTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											68.0	61.0	63.0					17																	59560377		2203	4300	6503	56915159	SO:0001583	missense	9496			AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1138C>T	17.37:g.59560377C>T	ENSP00000240335:p.Pro380Ser		56915159	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866544	0.72065	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	T;T	0.39056	1.1;1.1	5.51	5.51	0.81932	.	0.844484	0.11134	N	0.596045	T	0.57066	0.2028	L	0.33485	1.01	0.53005	D	0.999963	D;P	0.71674	0.998;0.808	D;B	0.77557	0.99;0.173	T	0.48163	-0.9059	9	.	.	.	.	18.4117	0.90554	0.0:1.0:0.0:0.0	.	381;380	A5PKU7;P57082	.;TBX4_HUMAN	S	381;380	ENSP00000377435:P381S;ENSP00000240335:P380S	.	P	+	1	0	TBX4	56915159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.438000	0.80431	2.590000	0.87494	0.655000	0.94253	CCC		0.607	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488		Missense_Mutation
TMEM181	57583	hgsc.bcm.edu	37	6	159052417	159052417	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr6:159052417T>G	ENST00000367090.3	+	16	1767	c.1756T>G	c.(1756-1758)Tat>Gat	p.Y586D		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	586					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TGATGTGATTTATGGGTAAGT	0.463																																																0			6											152.0	144.0	147.0					6																	159052417		1999	4161	6160	158972405	SO:0001583	missense	57583			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.1756T>G	6.37:g.159052417T>G	ENSP00000356057:p.Tyr586Asp		158972405	Q5VTU1	Missense_Mutation	SNP	ENST00000367090.3	37	CCDS43520.1	SNP	61	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.5	4.744815	0.89663	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	L	0.47190	1.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72969	-0.4130	9	0.72032	D	0.01	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	586	Q9P2C4	TM181_HUMAN	D	493;586	.	ENSP00000323755:Y493D	Y	+	1	0	TMEM181	158972405	1.000000	0.71417	0.995000	0.50966	0.719000	0.41307	7.866000	0.87056	2.367000	0.80283	0.528000	0.53228	TAT		0.463	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823		Missense_Mutation
TNFRSF10D	8793	hgsc.bcm.edu	37	8	23003231	23003231	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr8:23003231C>A	ENST00000312584.3	-	5	780	c.686G>T	c.(685-687)gGc>gTc	p.G229V		NM_003840.4	NP_003831.2	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain	229					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		ACATGAAAAGCCAACCACAAC	0.512																																																0			8											120.0	104.0	109.0					8																	23003231		2203	4300	6503	23059176	SO:0001583	missense	8793			AF029761	CCDS6038.1	8p21	2006-02-22			ENSG00000173530	ENSG00000173530		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11907	protein-coding gene	gene with protein product		603614				9382840, 9537512	Standard	NM_003840		Approved	DcR2, TRUNDD, TRAILR4, CD264	uc003xcz.2	Q9UBN6	OTTHUMG00000097845	ENST00000312584.3:c.686G>T	8.37:g.23003231C>A	ENSP00000310263:p.Gly229Val		23059176	B2R8W0|Q9Y6Q4	Missense_Mutation	SNP	ENST00000312584.3	37	CCDS6038.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	c	0.015	-1.552657	0.00918	.	.	ENSG00000173530	ENST00000312584	T	0.81330	-1.48	1.65	-3.29	0.05017	.	1.216040	0.06210	U	0.684792	T	0.44456	0.1294	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29458	-1.0011	10	0.14656	T	0.56	.	2.8197	0.05468	0.2117:0.3089:0.0:0.4794	.	229	Q9UBN6	TR10D_HUMAN	V	229	ENSP00000310263:G229V	ENSP00000310263:G229V	G	-	2	0	TNFRSF10D	23059176	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.342000	0.02645	-1.173000	0.02758	-0.501000	0.04562	GGC		0.512	TNFRSF10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215135.1			Missense_Mutation
TNFRSF1A	7132	hgsc.bcm.edu	37	12	6442573	6442573	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr12:6442573G>C	ENST00000162749.2	-	4	731	c.432C>G	c.(430-432)ttC>ttG	p.F144L	TNFRSF1A_ENST00000437813.3_5'UTR|TNFRSF1A_ENST00000540022.1_Missense_Mutation_p.F101L|TNFRSF1A_ENST00000366159.4_Missense_Mutation_p.F144L	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	144					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.F144L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						GGCTGCAATTGAAGCACTGGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											63.0	62.0	62.0					12																	6442573		2203	4300	6503	6312834	SO:0001583	missense	7132			M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.432C>G	12.37:g.6442573G>C	ENSP00000162749:p.Phe144Leu		6312834	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	ENST00000162749.2	37	CCDS8542.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230933	0.79688	.	.	ENSG00000067182	ENST00000162749;ENST00000540022;ENST00000539372;ENST00000366159;ENST00000440083	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	5.06	-5.46	0.02608	TNFR/CD27/30/40/95 cysteine-rich region (4);	5.930690	0.00166	N	0.000006	T	0.64940	0.2644	N	0.00347	-1.61	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.62492	-0.6843	10	0.25106	T	0.35	3.578	9.4428	0.38679	0.2813:0.3071:0.4116:0.0	.	144;101;144	B5M0B5;F5H061;P19438	.;.;TNR1A_HUMAN	L	144;101;144;144;144	ENSP00000162749:F144L;ENSP00000438343:F101L;ENSP00000442059:F144L;ENSP00000380389:F144L;ENSP00000413224:F144L	ENSP00000162749:F144L	F	-	3	2	TNFRSF1A	6312834	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.712000	0.05013	-0.527000	0.06374	0.561000	0.74099	TTC		0.592	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399038.1	NM_001065		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578527	7578527	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1337-01	TCGA-04-1337-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:7578527A>G	ENST00000269305.4	-	5	592	c.403T>C	c.(403-405)Tgc>Cgc	p.C135R	TP53_ENST00000359597.4_Missense_Mutation_p.C135R|TP53_ENST00000445888.2_Missense_Mutation_p.C135R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C135R|TP53_ENST00000420246.2_Missense_Mutation_p.C135R|TP53_ENST00000413465.2_Missense_Mutation_p.C135R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135R(11)|p.0?(8)|p.C135G(6)|p.C135fs*35(4)|p.C135S(4)|p.N131fs*27(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.K132_A138delKMFCQLA(1)|p.C135fs*36(1)|p.S127_Q136del10(1)|p.C135T(1)|p.F134fs*14(1)|p.C42R(1)|p.M133fs*13(1)|p.C3R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCAGTTGGCAAAACATCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	49	Substitution - Missense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(5)|biliary_tract(5)|breast(5)|large_intestine(4)|oesophagus(4)|lung(4)|bone(4)|upper_aerodigestive_tract(2)|urinary_tract(2)|pancreas(2)|stomach(1)|skin(1)|penis(1)|ovary(1)	17											49.0	50.0	49.0					17																	7578527		2203	4300	6503	7519252	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.403T>C	17.37:g.7578527A>G	ENSP00000269305:p.Cys135Arg		7519252	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.8	4.340491	0.81911	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99743	0.9898	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D	0.97110	0.997;1.0;0.904;1.0;1.0;1.0;1.0	D	0.97181	0.9851	10	0.87932	D	0	-26.815	13.8301	0.63375	1.0:0.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135R;ENSP00000352610:C135R;ENSP00000269305:C135R;ENSP00000398846:C135R;ENSP00000391127:C135R;ENSP00000391478:C135R;ENSP00000425104:C3R;ENSP00000423862:C42R;ENSP00000424104:C135R	ENSP00000269305:C135R	C	-	1	0	TP53	7519252	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	TGC		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRAF1	7185	hgsc.bcm.edu	37	9	123671654	123671655	+	Frame_Shift_Ins	INS	-	-	G			TCGA-04-1337-01	TCGA-04-1337-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr9:123671654_123671655insG	ENST00000373887.3	-	7	3330_3331	c.885_886insC	c.(883-888)gccttcfs	p.F296fs	TRAF1_ENST00000540010.1_Frame_Shift_Ins_p.F296fs|TRAF1_ENST00000546084.1_Frame_Shift_Ins_p.F174fs	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	296	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F296fs*39(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						GCAGTGTAGAAGGCTGAAACGC	0.535																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								122711476	SO:0001589	frameshift_variant	7185			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.886dupC	9.37:g.123671656_123671656dupG	ENSP00000362994:p.Phe296fs		122711475	B4DJ77|Q658U1|Q8NF13	Frame_Shift_Ins	INS	ENST00000373887.3	37	CCDS6825.1	INS	3	Baylor																																																																																				0.535	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658		Frame_Shift_Ins
TRIM65	201292	hgsc.bcm.edu	37	17	73887034	73887034	+	Frame_Shift_Del	DEL	G	G	-			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr17:73887034delG	ENST00000269383.3	-	6	1445	c.1380delC	c.(1378-1380)ggcfs	p.G460fs		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	460	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.C461fs*37(1)		endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGTGAGGCAGCCTGAGGCCA	0.667																																																1	Deletion - Frameshift(1)	ovary(1)	17											26.0	29.0	28.0					17																	73887034		2162	4223	6385	71398629	SO:0001589	frameshift_variant	201292			BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.1380delC	17.37:g.73887034delG	ENSP00000269383:p.Gly460fs		71398629	Q4G0F0|Q6DKJ6|Q9BRP6	Frame_Shift_Del	DEL	ENST00000269383.3	37	CCDS11732.1	DEL	34	Baylor																																																																																				0.667	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547		Frame_Shift_Del
TSPYL1	7259	hgsc.bcm.edu	37	6	116600321	116600321	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr6:116600321C>A	ENST00000368608.3	-	1	745	c.673G>T	c.(673-675)Gag>Tag	p.E225*	DSE_ENST00000540275.1_Intron|RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000452085.3_5'Flank	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	225					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.E225*(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		CGGAGAGCCTCATGCAAAGGC	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	6											56.0	52.0	54.0					6																	116600321		2203	4300	6503	116707014	SO:0001587	stop_gained	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.673G>T	6.37:g.116600321C>A	ENSP00000357597:p.Glu225*		116707014	O75885|Q5TFE6	Nonsense_Mutation	SNP	ENST00000368608.3	37	CCDS34518.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.252194	0.95336	.	.	ENSG00000189241	ENST00000368608	.	.	.	3.95	-6.44	0.01920	.	4.611710	0.00616	N	0.000431	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	1.7063	5.9728	0.19361	0.2458:0.1516:0.0:0.6026	.	.	.	.	X	225	.	ENSP00000357597:E225X	E	-	1	0	TSPYL1	116707014	0.000000	0.05858	0.000000	0.03702	0.867000	0.49689	-0.699000	0.05087	-1.648000	0.01510	0.462000	0.41574	GAG		0.592	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			Nonsense_Mutation
UBE3C	9690	hgsc.bcm.edu	37	7	157024012	157024012	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr7:157024012G>C	ENST00000348165.5	+	18	2832	c.2472G>C	c.(2470-2472)atG>atC	p.M824I		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	824	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TAGGCAGAATGCTTGGAAAGG	0.398																																																0			7											66.0	70.0	69.0					7																	157024012		2202	4300	6502	156716773	SO:0001583	missense	9690			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2472G>C	7.37:g.157024012G>C	ENSP00000309198:p.Met824Ile		156716773	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.958	0.360744	0.11296	.	.	ENSG00000009335	ENST00000348165	T	0.37411	1.2	5.37	5.37	0.77165	HECT (4);	0.165377	0.64402	D	0.000003	T	0.15696	0.0378	N	0.01686	-0.76	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.006	T	0.20405	-1.0276	10	0.02654	T	1	.	19.1506	0.93487	0.0:0.0:1.0:0.0	.	824;677	Q15386;B4DHJ9	UBE3C_HUMAN;.	I	824	ENSP00000309198:M824I	ENSP00000309198:M824I	M	+	3	0	UBE3C	156716773	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.293000	0.65680	2.542000	0.85734	0.485000	0.47835	ATG		0.398	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671		Missense_Mutation
USO1	8615	hgsc.bcm.edu	37	4	76721617	76721617	+	Nonsense_Mutation	SNP	C	C	G			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:76721617C>G	ENST00000538159.1	+	16	1704	c.1704C>G	c.(1702-1704)taC>taG	p.Y568*	USO1_ENST00000514213.2_Nonsense_Mutation_p.Y544*			O60763	USO1_HUMAN	USO1 vesicle transport factor	559	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.Y487*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTGAGAGCTACATGAAGTAAG	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	4											93.0	80.0	84.0					4																	76721617		1844	4096	5940	76940641	SO:0001587	stop_gained	8615			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.1704C>G	4.37:g.76721617C>G	ENSP00000440586:p.Tyr568*		76940641	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Nonsense_Mutation	SNP	ENST00000538159.1	37		SNP	17	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.79|18.79	3.698682|3.698682	0.68501|0.68501	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000441296|ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904	.|.	.|.	.|.	5.83|5.83	1.55|1.55	0.23275|0.23275	.|.	.|0.181231	.|0.50627	.|D	.|0.000117	T|.	0.21468|.	0.0517|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38308|.	-0.9667|.	3|.	.|0.02654	.|T	.|1	.|.	9.2364|9.2364	0.37468|0.37468	0.0:0.5543:0.0:0.4457|0.0:0.5543:0.0:0.4457	.|.	.|.	.|.	.|.	R|X	235|394;568;544;487	.|.	.|ENSP00000264904:Y487X	T|Y	+|+	2|3	0|2	USO1|USO1	76940641|76940641	0.959000|0.959000	0.32827|0.32827	0.721000|0.721000	0.30653|0.30653	0.641000|0.641000	0.38312|0.38312	0.082000|0.082000	0.14847|0.14847	0.361000|0.361000	0.24292|0.24292	0.563000|0.563000	0.77884|0.77884	ACA|TAC		0.363	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715		Nonsense_Mutation
USO1	8615	hgsc.bcm.edu	37	4	76721619	76721619	+	Frame_Shift_Del	DEL	T	T	-			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr4:76721619delT	ENST00000538159.1	+	16	1706	c.1706delT	c.(1705-1707)atgfs	p.M569fs	USO1_ENST00000514213.2_Frame_Shift_Del_p.M545fs			O60763	USO1_HUMAN	USO1 vesicle transport factor	560	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.M488fs*5(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAGAGCTACATGAAGTAAGTA	0.363																																																1	Deletion - Frameshift(1)	ovary(1)	4											93.0	80.0	84.0					4																	76721619		1845	4096	5941	76940643	SO:0001589	frameshift_variant	8615			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.1706delT	4.37:g.76721619delT	ENSP00000440586:p.Met569fs		76940643	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Frame_Shift_Del	DEL	ENST00000538159.1	37		DEL	51	Baylor																																																																																				0.363	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715		Frame_Shift_Del
VSIG2	23584	hgsc.bcm.edu	37	11	124617502	124617502	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1337-01	TCGA-04-1337-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr11:124617502C>G	ENST00000326621.5	-	7	1013	c.913G>C	c.(913-915)Ggg>Cgg	p.G305R	RP11-677M14.2_ENST00000531241.1_RNA	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	305						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.G305R(1)		central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		TCCAGGAACCCCTTGCTAGAA	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	90.0	94.0					11																	124617502		2201	4299	6500	124122712	SO:0001583	missense	23584			AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.913G>C	11.37:g.124617502C>G	ENSP00000318684:p.Gly305Arg		124122712	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	37	CCDS8452.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.864	0.947592	0.18356	.	.	ENSG00000019102	ENST00000326621	T	0.72615	-0.67	5.35	4.43	0.53597	.	0.205187	0.34932	N	0.003564	T	0.65523	0.2699	M	0.63428	1.95	0.80722	D	1	B	0.22080	0.064	B	0.20767	0.031	T	0.61073	-0.7136	10	0.23891	T	0.37	.	11.966	0.53035	0.0:0.8262:0.1738:0.0	.	305	Q96IQ7	VSIG2_HUMAN	R	305	ENSP00000318684:G305R	ENSP00000318684:G305R	G	-	1	0	VSIG2	124122712	0.049000	0.20398	0.495000	0.27527	0.019000	0.09904	0.454000	0.21827	1.472000	0.48140	0.650000	0.86243	GGG		0.567	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312		Missense_Mutation
WBSCR22	114049	hgsc.bcm.edu	37	7	73112015	73112015	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1337-01	TCGA-04-1337-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr7:73112015G>A	ENST00000265758.2	+	11	840	c.782G>A	c.(781-783)cGc>cAc	p.R261H	WBSCR22_ENST00000423497.1_Missense_Mutation_p.R278H|WBSCR22_ENST00000423166.2_3'UTR|STX1A_ENST00000484736.1_5'Flank	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	261					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				CGGCACAGGCGCCAGGGCAGG	0.607																																																0			7											32.0	33.0	33.0					7																	73112015		2203	4300	6503	72749951	SO:0001583	missense	114049			AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.782G>A	7.37:g.73112015G>A	ENSP00000265758:p.Arg261His		72749951	A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Missense_Mutation	SNP	ENST00000265758.2	37	CCDS5557.1	SNP	38	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.642414|4.642414	0.87859|0.87859	.|.	.|.	ENSG00000071462|ENSG00000071462	ENST00000442099|ENST00000265758;ENST00000423497	.|T;T	.|0.49139	.|0.81;0.79	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68778|0.68778	0.3038|0.3038	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.80764	.|0.994;0.994;0.994	T|T	0.70539|0.70539	-0.4844|-0.4844	6|10	0.11485|0.66056	T|D	0.65|0.02	-14.5682|-14.5682	15.6279|15.6279	0.76878|0.76878	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|261;278;261	.|A8K501;C9K060;O43709	.|.;.;WBS22_HUMAN	T|H	121|261;278	.|ENSP00000265758:R261H;ENSP00000401191:R278H	ENSP00000398732:A121T|ENSP00000265758:R261H	A|R	+|+	1|2	0|0	WBSCR22|WBSCR22	72749951|72749951	1.000000|1.000000	0.71417|0.71417	0.276000|0.276000	0.24689|0.24689	0.735000|0.735000	0.41995|0.41995	7.923000|7.923000	0.87546|0.87546	2.768000|2.768000	0.95171|0.95171	0.561000|0.561000	0.74099|0.74099	GCC|CGC		0.607	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252303.1			Missense_Mutation
ZNF236	7776	hgsc.bcm.edu	37	18	74561567	74561567	+	Silent	SNP	T	T	A			TCGA-04-1337-01	TCGA-04-1337-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr18:74561567T>A	ENST00000253159.8	+	2	333	c.135T>A	c.(133-135)tcT>tcA	p.S45S	ZNF236_ENST00000320610.9_Silent_p.S47S	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	45					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GTCTACTATCTTTTCCAAAAG	0.368																																																0			18											75.0	75.0	75.0					18																	74561567		1859	4104	5963	72690555	SO:0001819	synonymous_variant	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.135T>A	18.37:g.74561567T>A			72690555	B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	37	CCDS42447.1	SNP	56	Baylor																																																																																				0.368	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			Silent
ZNF582	147948	hgsc.bcm.edu	37	19	56895794	56895794	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1337-01	TCGA-04-1337-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1337-01	TCGA-04-1337-11	g.chr19:56895794G>C	ENST00000301310.4	-	5	1150	c.992C>G	c.(991-993)aCt>aGt	p.T331S	ZNF582_ENST00000586929.1_Missense_Mutation_p.T331S|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T331S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		AGTATGAACAGTCTGATGTTG	0.388																																					Ovarian(183;1887 2032 4349 30507 51343)											1	Substitution - Missense(1)	ovary(1)	19											92.0	91.0	92.0					19																	56895794		2203	4300	6503	61587606	SO:0001583	missense	147948			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.992C>G	19.37:g.56895794G>C	ENSP00000301310:p.Thr331Ser		61587606	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	37	CCDS33121.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044416	0.36085	.	.	ENSG00000018869	ENST00000301310	T	0.16597	2.33	4.6	-9.2	0.00682	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36665	N	0.002466	T	0.08714	0.0216	N	0.04355	-0.22	0.09310	N	1	P;P	0.49185	0.915;0.92	P;P	0.45071	0.468;0.468	T	0.40664	-0.9551	10	0.72032	D	0.01	.	20.3771	0.98923	0.0:0.7835:0.1283:0.0882	.	331;362	Q96NG8;B4DQZ9	ZN582_HUMAN;.	S	331	ENSP00000301310:T331S	ENSP00000301310:T331S	T	-	2	0	ZNF582	61587606	0.000000	0.05858	0.002000	0.10522	0.055000	0.15305	-0.585000	0.05794	-1.290000	0.02372	-0.181000	0.13052	ACT		0.388	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690		Missense_Mutation
