#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
A2M	2	hgsc.bcm.edu	37	12	9230420	9230420	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:9230420T>G	ENST00000318602.7	-	26	3460	c.3153A>C	c.(3151-3153)caA>caC	p.Q1051H	A2M_ENST00000542567.1_5'UTR	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1051					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.Q1051H(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AGGCTCGAGCTTGGGCAAAAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											110.0	115.0	113.0					12																	9230420		2202	4300	6502	9121687	SO:0001583	missense	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3153A>C	12.37:g.9230420T>G	ENSP00000323929:p.Gln1051His		9121687	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.23	3.578091	0.65878	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.35605	1.3	5.54	3.71	0.42584	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.353602	0.28088	N	0.016653	T	0.65428	0.2690	M	0.94021	3.485	0.31240	N	0.695256	D	0.76494	0.999	D	0.76071	0.987	T	0.71537	-0.4563	10	0.87932	D	0	.	8.5507	0.33449	0.0:0.7015:0.0:0.2985	.	1051	P01023	A2MG_HUMAN	H	1051;1066	ENSP00000323929:Q1051H	ENSP00000323929:Q1051H	Q	-	3	2	A2M	9121687	0.980000	0.34600	1.000000	0.80357	0.983000	0.72400	0.213000	0.17521	0.692000	0.31613	-0.472000	0.04984	CAA		0.473	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		Missense_Mutation
A2M	2	hgsc.bcm.edu	37	12	9264782	9264782	+	Silent	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:9264782A>G	ENST00000318602.7	-	4	763	c.456T>C	c.(454-456)gaT>gaC	p.D152D		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	152					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GAAAGTTTTCATCCATGGAGA	0.403																																																0			12											67.0	66.0	66.0					12																	9264782		1822	4071	5893	9156049	SO:0001819	synonymous_variant	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.456T>C	12.37:g.9264782A>G			9156049	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	ENST00000318602.7	37	CCDS44827.1	SNP	8	Baylor																																																																																				0.403	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		Silent
ABCA9	10350	hgsc.bcm.edu	37	17	67012439	67012439	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:67012439A>C	ENST00000340001.4	-	22	3205	c.2994T>G	c.(2992-2994)ttT>ttG	p.F998L	ABCA9_ENST00000453985.2_Missense_Mutation_p.F998L|ABCA9-AS1_ENST00000458677.1_RNA|ABCA9_ENST00000370732.2_Missense_Mutation_p.F998L	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	998					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.F998L(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CTGACGAATTAAAAATTCCAA	0.328																																																1	Substitution - Missense(1)	ovary(1)	17											108.0	106.0	107.0					17																	67012439		2203	4300	6503	64524034	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2994T>G	17.37:g.67012439A>C	ENSP00000342216:p.Phe998Leu		64524034	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	SNP	13	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.397	-0.920274	0.02396	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.86097	-2.07;-2.07	5.1	2.78	0.32641	.	0.493912	0.16964	N	0.192376	T	0.66268	0.2772	N	0.20357	0.565	0.36133	D	0.846278	B;B	0.13145	0.007;0.001	B;B	0.19666	0.026;0.02	T	0.56001	-0.8051	10	0.02654	T	1	.	2.0088	0.03483	0.578:0.1705:0.0883:0.1632	.	998;998	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	L	998;981;998;993	ENSP00000342216:F998L;ENSP00000359767:F998L	ENSP00000342216:F998L	F	-	3	2	ABCA9	64524034	0.949000	0.32298	0.967000	0.41034	0.023000	0.10783	0.326000	0.19646	0.239000	0.21243	0.482000	0.46254	TTT		0.328	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		Missense_Mutation
ACTR8	93973	hgsc.bcm.edu	37	3	53911334	53911334	+	Silent	SNP	A	A	T			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:53911334A>T	ENST00000335754.3	-	5	691	c.591T>A	c.(589-591)ccT>ccA	p.P197P	ACTR8_ENST00000482349.1_Silent_p.P86P|ACTR8_ENST00000231909.7_5'Flank	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	197					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.P197P(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		GAGAGCCCCCAGGGCCTGGGT	0.428																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	74.0	72.0					3																	53911334		2203	4300	6503	53886374	SO:0001819	synonymous_variant	93973				CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.591T>A	3.37:g.53911334A>T			53886374	B3KSW7|Q8N566|Q9H663	Silent	SNP	ENST00000335754.3	37	CCDS2875.1	SNP	7	Baylor																																																																																				0.428	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899		Silent
ALB	213	hgsc.bcm.edu	37	4	74279229	74279229	+	Silent	SNP	C	C	T	rs140421861		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:74279229C>T	ENST00000503124.1	+	6	693	c.486C>T	c.(484-486)caC>caT	p.H162H	ALB_ENST00000415165.2_Silent_p.H120H|ALB_ENST00000509063.1_Silent_p.H312H|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_Silent_p.H312H|ALB_ENST00000401494.3_Silent_p.H197H			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.H312H(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAAATCCCACTGCATTGCCG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	4						C		0,4406		0,0,2203	137.0	130.0	132.0		936	-2.6	0.7	4	dbSNP_134	132	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ALB	NM_000477.5		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		312/610	74279229	1,13005	2203	4300	6503	74498093	SO:0001819	synonymous_variant	213			V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.486C>T	4.37:g.74279229C>T			74498093	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000503124.1	37		SNP	20	Baylor																																																																																				0.413	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477		Silent
ALDH2	217	hgsc.bcm.edu	37	12	112229926	112229927	+	Frame_Shift_Ins	INS	-	-	G	rs554937672		TCGA-04-1338-01	TCGA-04-1338-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:112229926_112229927insG	ENST00000261733.2	+	8	918_919	c.857_858insG	c.(856-861)ctggggfs	p.LG286fs	ALDH2_ENST00000416293.3_Frame_Shift_Ins_p.LG239fs	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	286					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)	p.K289fs*45(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	ACCTTGGAGCTGGGGGGGAAGA	0.574			T	HMGA2	leiomyoma																																		Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	2	Insertion - Frameshift(2)	ovary(2)	12							,	7,4257		0,7,2125					,	5.4	1.0			54	5,8249		0,5,4122	no	frameshift,frameshift	ALDH2	NM_001204889.1,NM_000690.3	,	0,12,6247	A1A1,A1R,RR		0.0606,0.1642,0.0959	,	,		12,12506				110714310	SO:0001589	frameshift_variant	217			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.864dupG	12.37:g.112229933_112229933dupG	ENSP00000261733:p.Leu286fs		110714309	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Frame_Shift_Ins	INS	ENST00000261733.2	37	CCDS9155.1	INS	55	Baylor																																																																																				0.574	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1	NM_000690		Frame_Shift_Ins
AMPD2	271	hgsc.bcm.edu	37	1	110168974	110168974	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:110168974C>A	ENST00000256578.3	+	5	978	c.618C>A	c.(616-618)gaC>gaA	p.D206E	AMPD2_ENST00000358729.4_Missense_Mutation_p.D131E|AMPD2_ENST00000528454.1_Missense_Mutation_p.D88E|AMPD2_ENST00000393688.3_Missense_Mutation_p.D87E|AMPD2_ENST00000528667.1_Missense_Mutation_p.D206E|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.D125E	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	206					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.D206E(1)|p.D125E(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGCAGGGTGACCGGAGCCTGC	0.622																																																2	Substitution - Missense(2)	ovary(2)	1											45.0	42.0	43.0					1																	110168974		2203	4300	6503	109970497	SO:0001583	missense	271			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.618C>A	1.37:g.110168974C>A	ENSP00000256578:p.Asp206Glu		109970497	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	CCDS805.1	SNP	18	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.24|10.24	1.296975|1.296975	0.23650|0.23650	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688|ENST00000369840	D;D;D;T;T;D|.	0.85013|.	-1.9;-1.93;-1.93;1.34;1.34;-1.9|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.531595|.	0.19307|.	N|.	0.117484|.	T|T	0.20577|0.20577	0.0495|0.0495	N|N	0.16743|0.16743	0.435|0.435	0.33178|0.33178	D|D	0.549232|0.549232	B;B;B;B|.	0.11235|.	0.004;0.004;0.003;0.001|.	B;B;B;B|.	0.11329|.	0.006;0.003;0.002;0.003|.	T|T	0.10405|0.10405	-1.0631|-1.0631	10|5	0.12766|.	T|.	0.61|.	-41.0992|-41.0992	10.8398|10.8398	0.46708|0.46708	0.0:0.9115:0.0:0.0885|0.0:0.9115:0.0:0.0885	.|.	131;87;206;125|.	Q01433-4;Q01433-3;Q01433;Q01433-2|.	.;.;AMPD2_HUMAN;.|.	E|T	125;206;206;131;173;88;87|177	ENSP00000345498:D125E;ENSP00000436541:D206E;ENSP00000256578:D206E;ENSP00000351573:D131E;ENSP00000437164:D88E;ENSP00000377292:D87E|.	ENSP00000256578:D206E|.	D|P	+|+	3|1	2|0	AMPD2|AMPD2	109970497|109970497	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	1.242000|1.242000	0.32755|0.32755	2.337000|2.337000	0.79520|0.79520	0.462000|0.462000	0.41574|0.41574	GAC|CCG		0.622	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			Missense_Mutation
ANXA2	302	hgsc.bcm.edu	37	15	60674597	60674598	+	Frame_Shift_Ins	INS	-	-	TATA			TCGA-04-1338-01	TCGA-04-1338-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr15:60674597_60674598insTATA	ENST00000396024.3	-	4	250_251	c.91_92insTATA	c.(91-93)actfs	p.T31fs	ANXA2_ENST00000421017.2_Frame_Shift_Ins_p.T31fs|ANXA2_ENST00000332680.4_Frame_Shift_Ins_p.T49fs|ANXA2_ENST00000557937.1_5'UTR|ANXA2_ENST00000451270.2_Frame_Shift_Ins_p.T31fs	NM_001136015.2	NP_001129487.1	P07355	ANXA2_HUMAN	annexin A2	31					angiogenesis (GO:0001525)|body fluid secretion (GO:0007589)|cellular response to acid chemical (GO:0071229)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|membrane budding (GO:0006900)|membrane raft assembly (GO:0001765)|negative regulation of catalytic activity (GO:0043086)|osteoclast development (GO:0036035)|positive regulation of binding (GO:0051099)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vesicle fusion (GO:0031340)|protein heterotetramerization (GO:0051290)|protein targeting to plasma membrane (GO:0072661)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell surface (GO:0009986)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|late endosome membrane (GO:0031902)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)|midbody (GO:0030496)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|sarcolemma (GO:0042383)|Schmidt-Lanterman incisure (GO:0043220)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phospholipase A2 inhibitor activity (GO:0019834)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.T49fs*3(1)		kidney(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9					Tenecteplase(DB00031)	ATCAAAGTTAGTATAGGCTTTG	0.406																																																1	Insertion - Frameshift(1)	ovary(1)	15																																								58461890	SO:0001589	frameshift_variant	302			D00017	CCDS10175.1, CCDS32256.1	15q22.2	2012-10-02			ENSG00000182718	ENSG00000182718		"""Annexins"""	537	protein-coding gene	gene with protein product	"""annexin II"""	151740		ANX2, ANX2L4, CAL1H, LPC2D		7961821	Standard	NM_001136015		Approved	LIP2	uc002agm.3	P07355	OTTHUMG00000132763	ENST00000396024.3:c.88_91dupTATA	15.37:g.60674598_60674601dupTATA	ENSP00000379342:p.Thr31fs		58461889	Q567R4|Q6N0B3|Q8TBV2|Q96DD5|Q9UDH8	Frame_Shift_Ins	INS	ENST00000396024.3	37	CCDS10175.1	INS	36	Baylor																																																																																				0.406	ANXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256135.1	NM_001002857		Frame_Shift_Ins
APC	324	hgsc.bcm.edu	37	5	112175148	112175148	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:112175148A>G	ENST00000457016.1	+	16	4237	c.3857A>G	c.(3856-3858)gAa>gGa	p.E1286G	APC_ENST00000257430.4_Missense_Mutation_p.E1286G|APC_ENST00000508376.2_Missense_Mutation_p.E1286G|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1286	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.I1287fs*1(1)|p.K1192fs*3(1)|p.?(1)|p.E1286G(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCTGAAGATGAAATAGGATGT	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	4	Deletion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	ovary(1)|large_intestine(1)|soft_tissue(1)|skin(1)	5											55.0	57.0	56.0					5																	112175148		2202	4300	6502	112203047	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3857A>G	5.37:g.112175148A>G	ENSP00000413133:p.Glu1286Gly		112203047	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.18	1.861329	0.32884	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D	0.91843	-2.64;-2.64;-2.64;-2.92	6.03	6.03	0.97812	.	0.179817	0.47455	D	0.000223	D	0.92883	0.7736	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64144	0.922;0.922	D	0.92115	0.5699	9	.	.	.	-25.935	16.2316	0.82347	1.0:0.0:0.0:0.0	.	1288;1286	Q4LE70;P25054	.;APC_HUMAN	G	1286	ENSP00000413133:E1286G;ENSP00000257430:E1286G;ENSP00000427089:E1286G;ENSP00000423828:E1286G	.	E	+	2	0	APC	112203047	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.472000	0.66768	2.308000	0.77769	0.533000	0.62120	GAA		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
ARMC4	55130	hgsc.bcm.edu	37	10	28101521	28101521	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:28101521C>A	ENST00000305242.5	-	20	3147	c.3055G>T	c.(3055-3057)Gat>Tat	p.D1019Y	ARMC4_ENST00000545014.1_Missense_Mutation_p.R584S|ARMC4_ENST00000537576.1_Intron	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	1019					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.D1019Y(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TCCTGGAGATCCTGGTCAGGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	84.0	83.0					10																	28101521		2203	4300	6503	28141527	SO:0001583	missense	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.3055G>T	10.37:g.28101521C>A	ENSP00000306410:p.Asp1019Tyr		28141527	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.139|9.139	1.013296|1.013296	0.19277|0.19277	.|.	.|.	ENSG00000169126|ENSG00000169126	ENST00000305242|ENST00000545014	T|T	0.68903|0.58060	-0.36|0.36	5.78|5.78	5.78|5.78	0.91487|0.91487	Armadillo-like helical (1);Armadillo-type fold (1);|.	1.050840|.	0.07413|.	N|.	0.892753|.	T|T	0.36468|0.36468	0.0968|0.0968	N|N	0.19112|0.19112	0.55|0.55	0.47905|0.47905	D|D	0.999544|0.999544	P|B	0.45240|0.20368	0.854|0.044	P|B	0.49477|0.19148	0.612|0.024	T|T	0.27054|0.27054	-1.0085|-1.0085	10|9	0.62326|0.72032	D|D	0.03|0.01	-8.6351|-8.6351	7.9666|7.9666	0.30102|0.30102	0.0:0.8076:0.0:0.1924|0.0:0.8076:0.0:0.1924	.|.	1019|584	Q5T2S8|B7Z7I1	ARMC4_HUMAN|.	Y|S	1019|584	ENSP00000306410:D1019Y|ENSP00000441076:R584S	ENSP00000306410:D1019Y|ENSP00000441076:R584S	D|R	-|-	1|3	0|2	ARMC4|ARMC4	28141527|28141527	0.112000|0.112000	0.22096|0.22096	0.041000|0.041000	0.18516|0.18516	0.396000|0.396000	0.30629|0.30629	1.358000|1.358000	0.34102|0.34102	2.714000|2.714000	0.92807|0.92807	0.650000|0.650000	0.86243|0.86243	GAT|AGG		0.418	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		Missense_Mutation
ATP1A2	477	hgsc.bcm.edu	37	1	160104401	160104401	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:160104401T>C	ENST00000361216.3	+	14	2044	c.1955T>C	c.(1954-1956)gTc>gCc	p.V652A	ATP1A2_ENST00000392233.3_Missense_Mutation_p.V652A	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	652					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.V652A(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ATGAGTCAAGTCAACCCCAGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	93.0	100.0					1																	160104401		2203	4300	6503	158371025	SO:0001583	missense	477			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1955T>C	1.37:g.160104401T>C	ENSP00000354490:p.Val652Ala		158371025	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	SNP	58	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.0|21.0	4.077445|4.077445	0.76528|0.76528	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|D;D	.|0.94828	.|-3.52;-3.53	5.0|5.0	5.0|5.0	0.66597|0.66597	.|Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93916|0.93916	0.8053|0.8053	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P	.|0.40398	.|0.668;0.716	.|P;P	.|0.59546	.|0.78;0.859	D|D	0.94807|0.94807	0.7975|0.7975	5|10	.|0.56958	.|D	.|0.05	.|.	13.994|13.994	0.64386|0.64386	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|552;652	.|F5GXJ7;P50993	.|.;AT1A2_HUMAN	P|A	363|652;652;355	.|ENSP00000354490:V652A;ENSP00000376066:V652A	.|ENSP00000354490:V652A	S|V	+|+	1|2	0|0	ATP1A2|ATP1A2	158371025|158371025	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.997000|7.997000	0.88414|0.88414	1.997000|1.997000	0.58415|0.58415	0.459000|0.459000	0.35465|0.35465	TCA|GTC		0.552	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702		Missense_Mutation
ATP6V1C2	245973	hgsc.bcm.edu	37	2	10904525	10904525	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:10904525G>C	ENST00000272238.4	+	5	461	c.352G>C	c.(352-354)Gtg>Ctg	p.V118L	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.V118L	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	118					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.V118M(1)|p.V118L(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GCAGCCGCTCGTGAGTGTGGT	0.522																																					NSCLC(188;1042 2136 10807 16813 47705)											2	Substitution - Missense(2)	ovary(2)	2											134.0	121.0	125.0					2																	10904525		2203	4300	6503	10821976	SO:0001583	missense	245973			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.352G>C	2.37:g.10904525G>C	ENSP00000272238:p.Val118Leu		10821976	Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	CCDS42653.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209526	0.39003	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.42131	0.98;0.98	5.71	3.9	0.45041	.	0.415587	0.24229	N	0.040376	T	0.30916	0.0780	L	0.38531	1.155	0.22982	N	0.998476	B;B	0.13145	0.007;0.003	B;B	0.23852	0.029;0.049	T	0.26503	-1.0101	10	0.54805	T	0.06	-9.111	5.2725	0.15632	0.2287:0.1527:0.6186:0.0	.	118;118	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	L	118	ENSP00000272238:V118L;ENSP00000371077:V118L	ENSP00000272238:V118L	V	+	1	0	ATP6V1C2	10821976	1.000000	0.71417	0.836000	0.33094	0.795000	0.44927	3.260000	0.51523	0.747000	0.32809	0.655000	0.94253	GTG		0.522	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583		Missense_Mutation
ATP8B1	5205	hgsc.bcm.edu	37	18	55321238	55321238	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr18:55321238C>A	ENST00000283684.4	-	23	3000	c.3001G>T	c.(3001-3003)Ggg>Tgg	p.G1001W	RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000536015.1_Missense_Mutation_p.G1001W|RP11-35G9.5_ENST00000588925.1_RNA|RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.3_ENST00000591854.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	1001					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G1001W(1)		breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TCGAGCAGCCCCATGAGGAGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	18											114.0	82.0	93.0					18																	55321238		2203	4300	6503	53472236	SO:0001583	missense	5205			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.3001G>T	18.37:g.55321238C>A	ENSP00000283684:p.Gly1001Trp		53472236	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900944	0.92035	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	D;D	0.90563	-2.69;-2.69	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.97754	0.9263	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98936	1.0789	10	0.87932	D	0	.	19.5773	0.95450	0.0:1.0:0.0:0.0	.	1001	O43520	AT8B1_HUMAN	W	1001	ENSP00000283684:G1001W;ENSP00000445359:G1001W	ENSP00000283684:G1001W	G	-	1	0	ATP8B1	53472236	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.776000	0.85560	2.788000	0.95919	0.650000	0.86243	GGG		0.542	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603		Missense_Mutation
BAZ2B	29994	hgsc.bcm.edu	37	2	160294820	160294820	+	Silent	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:160294820G>T	ENST00000392783.2	-	8	1782	c.1287C>A	c.(1285-1287)tcC>tcA	p.S429S	BAZ2B_ENST00000392782.1_Silent_p.S427S|BAZ2B_ENST00000343439.5_Silent_p.S427S|BAZ2B_ENST00000355831.2_Silent_p.S429S	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	429					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S429S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TCACCCGTTTGGATCTCAATT	0.299																																																1	Substitution - coding silent(1)	ovary(1)	2											44.0	41.0	42.0					2																	160294820		1798	4063	5861	160003066	SO:0001819	synonymous_variant	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1287C>A	2.37:g.160294820G>T			160003066	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Silent	SNP	ENST00000392783.2	37	CCDS2209.2	SNP	47	Baylor																																																																																				0.299	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			Silent
BIRC2	329	hgsc.bcm.edu	37	11	102220912	102220912	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:102220912C>T	ENST00000227758.2	+	2	1726	c.327C>T	c.(325-327)agC>agT	p.S109S	BIRC2_ENST00000530675.1_Silent_p.S60S|BIRC2_ENST00000532672.1_Silent_p.S88S|BIRC2_ENST00000527910.1_3'UTR	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	109					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S109S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		TATATCCTAGCTGTAGCTTTA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	11											95.0	95.0	95.0					11																	102220912		2203	4299	6502	101726122	SO:0001819	synonymous_variant	329			L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.327C>T	11.37:g.102220912C>T			101726122	B4E026|Q16516|Q4TTG0	Silent	SNP	ENST00000227758.2	37	CCDS8316.1	SNP	28	Baylor																																																																																				0.418	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166		Silent
BNC1	646	hgsc.bcm.edu	37	15	83932824	83932824	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr15:83932824G>T	ENST00000345382.2	-	4	1264	c.1179C>A	c.(1177-1179)aaC>aaA	p.N393K	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.N386K	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	393					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N393K(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TGAACACCATGTTACACCCTT	0.507																																																1	Substitution - Missense(1)	ovary(1)	15											155.0	141.0	146.0					15																	83932824		2203	4300	6503	81723828	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1179C>A	15.37:g.83932824G>T	ENSP00000307041:p.Asn393Lys		81723828	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203808	0.58234	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.28255	1.62	5.75	4.65	0.58169	Zinc finger, C2H2-like (1);	0.138847	0.64402	D	0.000007	T	0.54464	0.1860	M	0.78801	2.425	0.53688	D	0.999979	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.57516	-0.7798	10	0.87932	D	0	-49.6156	11.6579	0.51328	0.1902:0.0:0.8098:0.0	.	386;393	F5GY04;Q01954	.;BNC1_HUMAN	K	393;386	ENSP00000307041:N393K	ENSP00000307041:N393K	N	-	3	2	BNC1	81723828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.724000	0.38064	2.716000	0.92895	0.655000	0.94253	AAC		0.507	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		Missense_Mutation
C11orf30	56946	hgsc.bcm.edu	37	11	76174951	76174951	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:76174951G>T	ENST00000529032.1	+	6	658	c.658G>T	c.(658-660)Gtt>Ttt	p.V220F	C11orf30_ENST00000525919.1_Missense_Mutation_p.V221F|C11orf30_ENST00000334736.3_Missense_Mutation_p.V220F|C11orf30_ENST00000533248.1_Missense_Mutation_p.V234F|C11orf30_ENST00000524490.1_Missense_Mutation_p.V221F|C11orf30_ENST00000524767.1_Missense_Mutation_p.V235F|C11orf30_ENST00000343878.3_Missense_Mutation_p.V220F|C11orf30_ENST00000525038.1_Missense_Mutation_p.V235F			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	220	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V220F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						TCTAAAGGAAGTTCCAAAGGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											185.0	184.0	184.0					11																	76174951		2200	4292	6492	75852599	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.658G>T	11.37:g.76174951G>T	ENSP00000432327:p.Val220Phe		75852599	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252072	0.80135	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.55924	0.1951	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.998;0.998;0.998;1.0;1.0;0.999;0.998;0.999	D;D;D;D;D;D;D;D	0.85130	0.991;0.991;0.991;0.997;0.997;0.994;0.991;0.994	T	0.56667	-0.7941	10	0.56958	D	0.05	-8.2232	19.6753	0.95930	0.0:0.0:1.0:0.0	.	234;235;235;220;170;221;221;220	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;.;EMSY_HUMAN	F	221;220;220;170;235;234;221;235;220	ENSP00000431166:V221F;ENSP00000334130:V220F;ENSP00000344688:V220F;ENSP00000433205:V235F;ENSP00000433634:V234F;ENSP00000432010:V221F;ENSP00000436968:V235F;ENSP00000432327:V220F	ENSP00000334130:V220F	V	+	1	0	C11orf30	75852599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.648000	0.89879	0.563000	0.77884	GTT		0.473	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		Missense_Mutation
TICRR	90381	hgsc.bcm.edu	37	15	90145159	90145159	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr15:90145159A>C	ENST00000268138.7	+	12	2624	c.2519A>C	c.(2518-2520)gAa>gCa	p.E840A	TICRR_ENST00000560985.1_Missense_Mutation_p.E839A			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	840					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E840A(1)									GGCAGCCCTGAATCTGATGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	15											101.0	92.0	95.0					15																	90145159		1908	4127	6035	87946163	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2519A>C	15.37:g.90145159A>C	ENSP00000268138:p.Glu840Ala		87946163	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918553	0.52546	.	.	ENSG00000140534	ENST00000268138	T	0.15718	2.4	5.76	5.76	0.90799	.	0.364300	0.31909	N	0.006865	T	0.29588	0.0738	L	0.55834	1.745	0.33059	D	0.533774	P	0.49559	0.925	P	0.52159	0.691	T	0.30327	-0.9982	10	0.41790	T	0.15	-6.5289	16.3634	0.83296	1.0:0.0:0.0:0.0	.	840	Q7Z2Z1	TICRR_HUMAN	A	840	ENSP00000268138:E840A	ENSP00000268138:E840A	E	+	2	0	C15orf42	87946163	0.995000	0.38212	0.223000	0.23860	0.292000	0.27327	3.980000	0.56895	2.324000	0.78689	0.533000	0.62120	GAA		0.408	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		Missense_Mutation
THEMIS2	9473	hgsc.bcm.edu	37	1	28206221	28206221	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:28206221C>T	ENST00000373921.3	+	3	306	c.302C>T	c.(301-303)aCt>aTt	p.T101I	THEMIS2_ENST00000328928.7_Missense_Mutation_p.T101I|THEMIS2_ENST00000373925.1_Missense_Mutation_p.T101I|THEMIS2_ENST00000373927.3_Intron	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2	101	CABIT 1.				cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T101I(1)									TCTGCCACAACTCAGAGCTCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	96.0	97.0					1																	28206221		2203	4300	6503	28078808	SO:0001583	missense	9473			AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.302C>T	1.37:g.28206221C>T	ENSP00000363031:p.Thr101Ile		28078808	A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	Missense_Mutation	SNP	ENST00000373921.3	37	CCDS41290.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057937	0.36277	.	.	ENSG00000130775	ENST00000373925;ENST00000328928;ENST00000427466;ENST00000373921	T;T	0.23147	1.93;1.92	4.37	1.26	0.21427	.	0.376195	0.30168	N	0.010259	T	0.27663	0.0680	L	0.60455	1.87	0.09310	N	1	P;P;P;P	0.50443	0.815;0.815;0.642;0.935	B;B;B;P	0.49708	0.295;0.39;0.393;0.62	T	0.14476	-1.0471	10	0.22706	T	0.39	-1.0002	7.1238	0.25461	0.3476:0.4839:0.1685:0.0	.	101;101;101;101	Q5TEJ8-5;Q5TEJ8-6;Q5TEJ8;Q5TEJ8-2	.;.;THMS2_HUMAN;.	I	101;101;54;101	ENSP00000329862:T101I;ENSP00000363031:T101I	ENSP00000329862:T101I	T	+	2	0	C1orf38	28078808	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.029000	0.13666	0.034000	0.15491	-0.268000	0.10319	ACT		0.592	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011148.1	NM_004848		Missense_Mutation
C1QL3	389941	hgsc.bcm.edu	37	10	16556654	16556654	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:16556654C>G	ENST00000298943.3	-	2	1580	c.641G>C	c.(640-642)aGt>aCt	p.S214T		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	214	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.S214T(1)		breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						CACACTGTTACTGGCATAGTC	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											106.0	91.0	96.0					10																	16556654		2203	4299	6502	16596660	SO:0001583	missense	389941				CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.641G>C	10.37:g.16556654C>G	ENSP00000298943:p.Ser214Thr		16596660	A0PJY4|A0PJY5	Missense_Mutation	SNP	ENST00000298943.3	37	CCDS31156.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937741	0.73557	.	.	ENSG00000165985	ENST00000298943;ENST00000448557	T	0.79940	-1.32	5.76	4.86	0.63082	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.86310	0.5902	L	0.51914	1.62	0.54753	D	0.999983	D	0.71674	0.998	D	0.72338	0.977	D	0.86671	0.1910	10	0.51188	T	0.08	.	14.8565	0.70341	0.0:0.931:0.0:0.069	.	214	Q5VWW1	C1QL3_HUMAN	T	214;191	ENSP00000298943:S214T	ENSP00000298943:S214T	S	-	2	0	C1QL3	16596660	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.818000	0.86416	1.446000	0.47643	0.655000	0.94253	AGT		0.428	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047003.1	XM_372305		Missense_Mutation
PAXBP1	94104	hgsc.bcm.edu	37	21	34134621	34134621	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr21:34134621A>C	ENST00000331923.4	-	4	846	c.657T>G	c.(655-657)atT>atG	p.I219M	PAXBP1_ENST00000290178.4_Missense_Mutation_p.I219M|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	219					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I219M(1)									CTGCATCTGGAATTTCTCCTA	0.403																																																1	Substitution - Missense(1)	ovary(1)	21											39.0	40.0	40.0					21																	34134621		2203	4300	6503	33056492	SO:0001583	missense	94104			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.657T>G	21.37:g.34134621A>C	ENSP00000328992:p.Ile219Met		33056492	D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	ENST00000331923.4	37	CCDS13619.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.82	3.483231	0.63962	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.57907	0.75;0.37	5.72	0.467	0.16721	.	0.000000	0.85682	D	0.000000	T	0.69975	0.3171	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.67448	-0.5668	10	0.87932	D	0	-21.1051	5.5164	0.16908	0.4552:0.0:0.409:0.1358	.	219;219	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	M	219	ENSP00000328992:I219M;ENSP00000290178:I219M	ENSP00000290178:I219M	I	-	3	3	GCFC1	33056492	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	0.729000	0.26028	0.091000	0.17302	0.455000	0.32223	ATT		0.403	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329		Missense_Mutation
C3orf30	152405	hgsc.bcm.edu	37	3	118866331	118866331	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:118866331T>C	ENST00000295622.1	+	1	1335	c.1295T>C	c.(1294-1296)tTc>tCc	p.F432S	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_Missense_Mutation_p.F37S	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	432								p.F432S(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		ACCAGTAACTTCCAAGCAAAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											130.0	129.0	129.0					3																	118866331		2203	4300	6503	120349021	SO:0001583	missense	152405			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.1295T>C	3.37:g.118866331T>C	ENSP00000295622:p.Phe432Ser		120349021	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	CCDS2984.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.46	2.542625	0.45280	.	.	ENSG00000163424;ENSG00000163424;ENSG00000251012	ENST00000295622;ENST00000470341;ENST00000490594	T;T	0.57273	2.4;0.41	4.41	-0.884	0.10597	.	0.700454	0.12454	N	0.467467	T	0.33294	0.0858	L	0.46157	1.445	0.09310	N	1	B;P	0.37276	0.426;0.589	B;B	0.33392	0.128;0.163	T	0.16247	-1.0409	10	0.16896	T	0.51	0.2944	2.6004	0.04865	0.3368:0.1916:0.0:0.4716	.	432;432	E9PFE5;Q96M34	.;CC030_HUMAN	S	432;432;37	ENSP00000295622:F432S;ENSP00000424708:F37S	ENSP00000295622:F432S	F	+	2	0	C3orf30;RP11-484M3.5	120349021	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.547000	0.23299	-0.121000	0.11787	-0.333000	0.08304	TTC		0.433	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		Missense_Mutation
ARMC12	221481	hgsc.bcm.edu	37	6	35716375	35716375	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:35716375G>T	ENST00000373866.3	+	6	773	c.751G>T	c.(751-753)Gta>Tta	p.V251L	ARMC12_ENST00000288065.2_Missense_Mutation_p.V278L|ARMC12_ENST00000373869.3_Missense_Mutation_p.V241L			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	251						nucleus (GO:0005634)		p.V278L(1)									CCTGTATGAGGTACTGGTGTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	86.0	89.0					6																	35716375		2203	4300	6503	35824353	SO:0001583	missense	221481			AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.751G>T	6.37:g.35716375G>T	ENSP00000362973:p.Val251Leu		35824353	Q8NEB2|Q96LL8	Missense_Mutation	SNP	ENST00000373866.3	37		SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.490	0.861808	0.17178	.	.	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.30714	1.52;1.52;1.52	5.0	3.22	0.36961	.	0.404164	0.20852	N	0.084501	T	0.05364	0.0142	N	0.17082	0.46	0.24328	N	0.995014	B;B	0.09022	0.001;0.002	B;B	0.13407	0.009;0.003	T	0.36841	-0.9731	10	0.27785	T	0.31	.	4.7944	0.13265	0.1816:0.0:0.6484:0.17	.	241;278	Q5T9G4-3;Q5T9G4-2	.;.	L	241;278;251	ENSP00000362976:V241L;ENSP00000288065:V278L;ENSP00000362973:V251L	ENSP00000288065:V278L	V	+	1	0	C6orf81	35824353	0.756000	0.28383	0.123000	0.21794	0.589000	0.36550	0.322000	0.19576	0.530000	0.28619	-0.145000	0.13849	GTA		0.512	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040311.2	NM_145028		Missense_Mutation
C8orf76	84933	hgsc.bcm.edu	37	8	124232410	124232410	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:124232410C>A	ENST00000276704.4	-	6	1127	c.1076G>T	c.(1075-1077)aGa>aTa	p.R359I		NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	359								p.R359I(1)		NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TTTGATCTTTCTGAACCACTT	0.393																																																1	Substitution - Missense(1)	ovary(1)	8											106.0	97.0	100.0					8																	124232410		2203	4300	6503	124301591	SO:0001583	missense	84933			AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.1076G>T	8.37:g.124232410C>A	ENSP00000276704:p.Arg359Ile		124301591	Q53HC1	Missense_Mutation	SNP	ENST00000276704.4	37	CCDS6341.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.82	3.484294	0.63962	.	.	ENSG00000189376	ENST00000276704	.	.	.	6.02	2.89	0.33648	.	0.879500	0.10394	N	0.680090	T	0.46268	0.1384	M	0.63428	1.95	0.25383	N	0.988593	P	0.40875	0.731	P	0.45071	0.468	T	0.34900	-0.9810	9	0.66056	D	0.02	-5.7682	7.9835	0.30198	0.0:0.6186:0.0:0.3814	.	359	Q96K31	CH076_HUMAN	I	359	.	ENSP00000276704:R359I	R	-	2	0	C8orf76	124301591	0.000000	0.05858	0.218000	0.23776	0.993000	0.82548	-0.146000	0.10250	0.381000	0.24851	0.655000	0.94253	AGA		0.393	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847		Missense_Mutation
CACNA1A	773	hgsc.bcm.edu	37	19	13323516	13323521	+	In_Frame_Del	DEL	CGGGGG	CGGGGG	-	rs540390772		TCGA-04-1338-01	TCGA-04-1338-11	CGGGGG	CGGGGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr19:13323516_13323521delCGGGGG	ENST00000360228.5	-	41	5973_5978	c.5974_5979delCCCCCG	c.(5974-5979)cccccgdel	p.PP1992del	CACNA1A_ENST00000573710.2_In_Frame_Del_p.PP1993del	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1993					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.P1994S(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GCGTTGGGGACGGGGGCTCCATGCGC	0.675																																																1	Substitution - Missense(1)	central_nervous_system(1)	19																																								13184521	SO:0001651	inframe_deletion	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5974_5979delCCCCCG	19.37:g.13323516_13323521delCGGGGG	ENSP00000353362:p.Pro1992_Pro1993del		13184516	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	ENST00000360228.5	37	CCDS45998.1	DEL	19	Baylor																																																																																				0.675	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068		In_Frame_Del
CCDC141	285025	hgsc.bcm.edu	37	2	179718205	179718205	+	Missense_Mutation	SNP	C	C	A	rs373260016		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:179718205C>A	ENST00000420890.2	-	20	3324	c.3207G>T	c.(3205-3207)agG>agT	p.R1069S	CCDC141_ENST00000295723.5_Missense_Mutation_p.R494S	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1069								p.R494S(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CCTCCTGAATCCTTTCTTCTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	2						C	SER/ARG	1,4405	2.1+/-5.4	0,1,2202	167.0	165.0	166.0		3207	1.6	1.0	2		166	0,8600		0,0,4300	no	missense	CCDC141	NM_173648.3	110	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging	1069/1531	179718205	1,13005	2203	4300	6503	179426450	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3207G>T	2.37:g.179718205C>A	ENSP00000395995:p.Arg1069Ser		179426450	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046340	0.55110	2.27E-4	0.0	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.35605	1.3;1.3;1.3	5.39	1.62	0.23740	.	0.111291	0.39985	N	0.001220	T	0.39172	0.1068	L	0.32530	0.975	0.26169	N	0.979897	D	0.69078	0.997	P	0.57101	0.813	T	0.31530	-0.9940	10	0.41790	T	0.15	-8.13	11.9098	0.52733	0.0:0.5661:0.0:0.4339	.	494	Q6ZP82	CC141_HUMAN	S	1069;513;494	ENSP00000395995:R1069S;ENSP00000344627:R513S;ENSP00000295723:R494S	ENSP00000295723:R494S	R	-	3	2	CCDC141	179426450	1.000000	0.71417	0.992000	0.48379	0.876000	0.50452	1.042000	0.30303	-0.184000	0.10567	-1.731000	0.00696	AGG		0.423	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		Missense_Mutation
CCNF	899	hgsc.bcm.edu	37	16	2495506	2495506	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:2495506T>C	ENST00000397066.4	+	10	1065	c.977T>C	c.(976-978)tTc>tCc	p.F326S		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	326	Cyclin N-terminal.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.F326S(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				ATGAAGGACTTCACAAGCCTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	16											107.0	72.0	84.0					16																	2495506		2198	4300	6498	2435507	SO:0001583	missense	899			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.977T>C	16.37:g.2495506T>C	ENSP00000380256:p.Phe326Ser		2435507	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	27.4	4.824045	0.90873	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.12039	2.72	5.5	5.5	0.81552	Cyclin, N-terminal (2);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.40791	0.1131	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.41233	-0.9520	10	0.87932	D	0	-34.5098	14.4299	0.67243	0.0:0.0:0.0:1.0	.	326	P41002	CCNF_HUMAN	S	326;241	ENSP00000380256:F326S	ENSP00000293968:F241S	F	+	2	0	CCNF	2435507	1.000000	0.71417	0.981000	0.43875	0.988000	0.76386	7.754000	0.85163	2.090000	0.63153	0.455000	0.32223	TTC		0.617	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761		Missense_Mutation
CDH11	1009	hgsc.bcm.edu	37	16	64981959	64981959	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1338-01	TCGA-04-1338-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:64981959T>A	ENST00000268603.4	-	13	2553	c.1938A>T	c.(1936-1938)gaA>gaT	p.E646D	CDH11_ENST00000394156.3_3'UTR|CDH11_ENST00000566827.1_Missense_Mutation_p.E520D	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	646					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E646D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CAATGAGTGGTTCTTTCTTTT	0.418			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	1	Substitution - Missense(1)	ovary(1)	16											81.0	76.0	78.0					16																	64981959		2203	4300	6503	63539460	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1938A>T	16.37:g.64981959T>A	ENSP00000268603:p.Glu646Asp		63539460	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.76	2.331963	0.41297	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.77229	-1.08	5.61	0.776	0.18532	Cadherin, cytoplasmic domain (1);	0.105878	0.64402	D	0.000002	T	0.74550	0.3731	L	0.58810	1.83	0.52501	D	0.999956	P	0.39022	0.655	B	0.43018	0.405	T	0.71227	-0.4655	10	0.66056	D	0.02	.	10.1368	0.42712	0.0:0.363:0.0:0.637	.	646	P55287	CAD11_HUMAN	D	646;629	ENSP00000268603:E646D	ENSP00000268603:E646D	E	-	3	2	CDH11	63539460	0.992000	0.36948	0.997000	0.53966	0.984000	0.73092	0.285000	0.18883	-0.141000	0.11374	0.533000	0.62120	GAA		0.418	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664		Missense_Mutation
CDH18	1016	hgsc.bcm.edu	37	5	19721516	19721516	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:19721516C>T	ENST00000507958.1	-	7	1573	c.583G>A	c.(583-585)Gct>Act	p.A195T	CDH18_ENST00000506372.1_Missense_Mutation_p.A195T|CDH18_ENST00000382275.1_Missense_Mutation_p.A195T|CDH18_ENST00000511273.1_Missense_Mutation_p.A195T|CDH18_ENST00000274170.4_Missense_Mutation_p.A195T|CDH18_ENST00000502796.1_Missense_Mutation_p.A195T			Q13634	CAD18_HUMAN	cadherin 18, type 2	195	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A195T(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACCACCCGAGCGCTGTTTCCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	5											153.0	136.0	142.0					5																	19721516		2203	4300	6503	19757273	SO:0001583	missense	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.583G>A	5.37:g.19721516C>T	ENSP00000425093:p.Ala195Thr		19757273	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	36	5.694576	0.96793	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16;0.16;0.16	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78863	-0.2036	9	.	.	.	.	17.9639	0.89094	0.0:1.0:0.0:0.0	.	195;195	B4DHG6;Q13634	.;CAD18_HUMAN	T	195;195;195;195;195;195;141;195	ENSP00000371710:A195T;ENSP00000425093:A195T;ENSP00000274170:A195T;ENSP00000424931:A195T;ENSP00000422138:A195T;ENSP00000427383:A141T;ENSP00000425854:A195T	.	A	-	1	0	CDH18	19757273	1.000000	0.71417	0.900000	0.35374	0.910000	0.53928	7.764000	0.85297	2.571000	0.86741	0.650000	0.86243	GCT		0.463	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		Missense_Mutation
CEACAM20	125931	hgsc.bcm.edu	37	19	45016138	45016138	+	RNA	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr19:45016138T>C	ENST00000454753.1	-	0	1793							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TCAGGCTTTCTAGAAAAAGTG	0.512																																																0			19											40.0	38.0	39.0					19																	45016138		1970	4148	6118	49707978			125931			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45016138T>C			49707978		Splice_Site_SNP	SNP	ENST00000454753.1	37		SNP	53	Baylor																																																																																				0.512	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444		Splice_Site_SNP
CLIP4	79745	hgsc.bcm.edu	37	2	29366687	29366687	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:29366687C>T	ENST00000320081.5	+	7	1016	c.761C>T	c.(760-762)gCg>gTg	p.A254V	CLIP4_ENST00000401617.2_Missense_Mutation_p.A147V|CLIP4_ENST00000401605.1_Missense_Mutation_p.A254V|CLIP4_ENST00000404424.1_Missense_Mutation_p.A254V	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	254								p.A254V(2)		endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					CTTCTAGATGCGGTGCCTCTG	0.502																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	2											170.0	153.0	159.0					2																	29366687		2203	4300	6503	29220191	SO:0001583	missense	79745			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.761C>T	2.37:g.29366687C>T	ENSP00000327009:p.Ala254Val		29220191	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.15	3.558807	0.65538	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.77750	-1.12;-0.84;-0.79;-0.79	5.64	5.64	0.86602	Cytoskeleton-associated protein, Gly-rich domain (1);	0.113685	0.64402	D	0.000015	D	0.82305	0.5008	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.60160	0.987;0.987	P;P	0.47864	0.536;0.559	D	0.84531	0.0633	10	0.66056	D	0.02	.	19.6883	0.95987	0.0:1.0:0.0:0.0	.	254;254	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	V	254;147;254;254;254;255;236	ENSP00000384242:A254V;ENSP00000385148:A147V;ENSP00000385594:A254V;ENSP00000327009:A254V	ENSP00000327009:A254V	A	+	2	0	CLIP4	29220191	1.000000	0.71417	0.046000	0.18839	0.034000	0.12701	4.550000	0.60733	2.654000	0.90174	0.650000	0.86243	GCG		0.502	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692		Missense_Mutation
CLU	1191	hgsc.bcm.edu	37	8	27462569	27462569	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:27462569G>A	ENST00000316403.10	-	5	1106	c.701C>T	c.(700-702)cCg>cTg	p.P234L	CLU_ENST00000546343.1_Missense_Mutation_p.P245L|CLU_ENST00000405140.3_Missense_Mutation_p.P234L|CLU_ENST00000560366.1_Missense_Mutation_p.P286L|CLU_ENST00000523500.1_Missense_Mutation_p.P234L			P10909	CLUS_HUMAN	clusterin	234					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)	p.P286L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		GGGCTCGTACGGAGAGAAGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	8											117.0	112.0	114.0					8																	27462569		2203	4300	6503	27518486	SO:0001583	missense	1191			M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.701C>T	8.37:g.27462569G>A	ENSP00000315130:p.Pro234Leu		27518486	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	37	CCDS47832.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.750	-0.260285	0.05791	.	.	ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012;ENST00000523589	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.66	-3.72	0.04411	Clusterin, C-terminal (1);	2.240620	0.01623	N	0.023112	T	0.08044	0.0201	N	0.05510	-0.035	0.09310	N	1	B;B;B;B	0.15473	0.013;0.002;0.002;0.001	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.15867	-1.0422	10	0.08599	T	0.76	-0.057	1.7188	0.02907	0.3672:0.1304:0.3645:0.138	.	99;286;245;234	E7ETA7;P10909-2;P10909-5;P10909	.;.;.;CLUS_HUMAN	L	286;245;234;234;59;99;200	ENSP00000446413:P245L;ENSP00000385419:P234L;ENSP00000429620:P234L;ENSP00000431070:P200L	ENSP00000315130:P286L	P	-	2	0	CLU	27518486	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.644000	0.05415	-0.623000	0.05618	0.563000	0.77884	CCG		0.592	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831		Missense_Mutation
CNGA1	1259	hgsc.bcm.edu	37	4	47939097	47939097	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:47939097C>G	ENST00000514170.1	-	11	1733	c.1414G>C	c.(1414-1416)Gac>Cac	p.D472H	CNGA1_ENST00000544810.1_Missense_Mutation_p.D472H|CNGA1_ENST00000420489.2_Missense_Mutation_p.D472H|CNGA1_ENST00000402813.3_Missense_Mutation_p.D541H|CNGA1_ENST00000358519.4_Missense_Mutation_p.D472H			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	472					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.D472H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TTTAATGTGTCTAAGTGAACG	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											184.0	172.0	176.0					4																	47939097		1902	4133	6035	47633854	SO:0001583	missense	1259			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1414G>C	4.37:g.47939097C>G	ENSP00000426862:p.Asp472His		47633854	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035930	0.35893	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17	5.22	5.22	0.72569	Cyclic nucleotide-binding-like (1);	0.045880	0.85682	D	0.000000	D	0.95695	0.8600	M	0.85710	2.77	0.53688	D	0.999973	P;P	0.39624	0.681;0.681	B;B	0.29353	0.101;0.101	D	0.96357	0.9263	10	0.72032	D	0.01	.	18.8003	0.92013	0.0:1.0:0.0:0.0	.	472;472	Q4W5E3;P29973	.;CNGA1_HUMAN	H	541;472;472;472;472	ENSP00000384264:D541H;ENSP00000426862:D472H;ENSP00000443401:D472H;ENSP00000351320:D472H;ENSP00000389881:D472H	ENSP00000351320:D472H	D	-	1	0	CNGA1	47633854	1.000000	0.71417	0.998000	0.56505	0.163000	0.22366	7.487000	0.81328	2.433000	0.82419	0.491000	0.48974	GAC		0.393	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087		Missense_Mutation
CREBBP	1387	hgsc.bcm.edu	37	16	3789724	3789724	+	Splice_Site	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:3789724A>C	ENST00000262367.5	-	25	4944	c.4135T>G	c.(4135-4137)Ttt>Gtt	p.F1379V	CREBBP_ENST00000382070.3_Splice_Site_p.F1341V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1379	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.F1379V(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAATCCACAAACCTGAAACAA	0.473			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - Missense(1)	ovary(1)	16											59.0	57.0	58.0					16																	3789724		2197	4300	6497	3729725	SO:0001630	splice_region_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4134-1T>G	16.37:g.3789724A>C			3729725	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	a	20.6	4.022932	0.75275	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.93659	-3.26;-3.26	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.97554	0.9199	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.996	D	0.98645	1.0677	10	0.87932	D	0	-12.0421	15.969	0.79998	1.0:0.0:0.0:0.0	.	1409;1379	Q4LE28;Q92793	.;CBP_HUMAN	V	1379;1409;1341	ENSP00000262367:F1379V;ENSP00000371502:F1341V	ENSP00000262367:F1379V	F	-	1	0	CREBBP	3729725	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.210000	0.95106	2.234000	0.73211	0.459000	0.35465	TTT		0.473	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	Missense_Mutation	Missense_Mutation
CSF1	1435	hgsc.bcm.edu	37	1	110464475	110464475	+	Missense_Mutation	SNP	G	G	A	rs377085953		TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:110464475G>A	ENST00000329608.6	+	5	794	c.403G>A	c.(403-405)Gtc>Atc	p.V135I	CSF1_ENST00000344188.5_Missense_Mutation_p.V135I|CSF1_ENST00000526001.1_3'UTR|CSF1_ENST00000369801.1_Missense_Mutation_p.V135I|CSF1_ENST00000420111.2_Missense_Mutation_p.V135I|CSF1_ENST00000369802.3_Missense_Mutation_p.V135I	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	135					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)	p.V135I(1)		breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCAGGCCTGCGTCCGAACTTT	0.463																																																1	Substitution - Missense(1)	ovary(1)	1						G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	148.0	150.0	149.0		403,403,403,403	2.3	1.0	1		149	0,8600		0,0,4300	no	missense,missense,missense,missense	CSF1	NM_000757.5,NM_172210.2,NM_172211.2,NM_172212.2	29,29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	135/555,135/439,135/257,135/555	110464475	1,13005	2203	4300	6503	110265998	SO:0001583	missense	1435			BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.403G>A	1.37:g.110464475G>A	ENSP00000327513:p.Val135Ile		110265998	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	37	CCDS816.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078755	0.36662	2.27E-4	0.0	ENSG00000184371	ENST00000527192;ENST00000525659;ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000420111;ENST00000369801	T;T;T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67;2.67;2.67	5.23	2.33	0.28932	Four-helical cytokine-like, core (1);	0.374640	0.23799	N	0.044453	T	0.14614	0.0353	L	0.56769	1.78	0.28155	N	0.929234	D;D;D	0.76494	0.97;0.996;0.999	B;P;D	0.72075	0.368;0.782;0.976	T	0.03443	-1.1036	10	0.40728	T	0.16	.	8.0045	0.30317	0.2662:0.0:0.7338:0.0	.	135;135;135	P09603-3;P09603;P09603-2	.;CSF1_HUMAN;.	I	142;94;135;135;94;135;135;135	ENSP00000434527:V142I;ENSP00000431547:V94I;ENSP00000342718:V135I;ENSP00000327513:V135I;ENSP00000433837:V94I;ENSP00000358817:V135I;ENSP00000407317:V135I;ENSP00000358816:V135I	ENSP00000327513:V135I	V	+	1	0	CSF1	110265998	0.978000	0.34361	0.956000	0.39512	0.228000	0.25075	0.795000	0.26972	0.611000	0.30052	-0.333000	0.08304	GTC		0.463	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757		Missense_Mutation
CSF2RB	1439	hgsc.bcm.edu	37	22	37322081	37322081	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr22:37322081G>T	ENST00000403662.3	+	4	475	c.253G>T	c.(253-255)Gcc>Tcc	p.A85S	CSF2RB_ENST00000406230.1_Missense_Mutation_p.A85S|CSF2RB_ENST00000262825.5_Missense_Mutation_p.A85S|CSF2RB_ENST00000536485.1_Missense_Mutation_p.A26S			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	85					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A85S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GCCCTGGTCAGCCTGCCCCCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	22											124.0	91.0	102.0					22																	37322081		2203	4300	6503	35652027	SO:0001583	missense	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.253G>T	22.37:g.37322081G>T	ENSP00000384053:p.Ala85Ser		35652027	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.738	0.320643	0.10845	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	5.26	-2.86	0.05717	Fibronectin, type III (1);Immunoglobulin-like fold (1);	2.319440	0.01709	N	0.027596	T	0.35219	0.0924	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.17531	-1.0366	10	0.15952	T	0.53	-3.9479	5.4444	0.16527	0.3488:0.2733:0.3779:0.0	.	85;85	P32927-2;P32927	.;IL3RB_HUMAN	S	85;85;85;85;5;26	ENSP00000384053:A85S;ENSP00000262825:A85S;ENSP00000385271:A85S;ENSP00000393585:A5S;ENSP00000440003:A26S	ENSP00000262825:A85S	A	+	1	0	CSF2RB	35652027	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.203000	0.09438	-0.269000	0.09298	-0.258000	0.10820	GCC		0.582	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		Missense_Mutation
DDB1	1642	hgsc.bcm.edu	37	11	61079464	61079464	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:61079464G>A	ENST00000301764.7	-	17	2559	c.2162C>T	c.(2161-2163)cCa>cTa	p.P721L	DDB1_ENST00000545930.1_5'Flank|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	721	Interaction with CDT1.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)	p.P721L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						GCCTCACCTTGGAGACTCATA	0.542								Nucleotide excision repair (NER)																																								1	Substitution - Missense(1)	ovary(1)	11											163.0	158.0	160.0					11																	61079464		2203	4299	6502	60836040	SO:0001583	missense	1642			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2162C>T	11.37:g.61079464G>A	ENSP00000301764:p.Pro721Leu		60836040	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	37	CCDS31576.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	31	5.082846	0.94050	.	.	ENSG00000167986	ENST00000301764;ENST00000535147	T;T	0.29917	1.55;1.55	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71586	-0.4548	10	0.72032	D	0.01	.	20.2704	0.98474	0.0:0.0:1.0:0.0	.	721	Q16531	DDB1_HUMAN	L	721;188	ENSP00000301764:P721L;ENSP00000444650:P188L	ENSP00000301764:P721L	P	-	2	0	DDB1	60836040	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	9.869000	0.99810	2.793000	0.96121	0.591000	0.81541	CCA		0.542	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923		Missense_Mutation
DNMBP	23268	hgsc.bcm.edu	37	10	101716493	101716493	+	Silent	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:101716493G>T	ENST00000324109.4	-	4	829	c.738C>A	c.(736-738)acC>acA	p.T246T	DNMBP_ENST00000342239.3_Silent_p.T246T|DNMBP-AS1_ENST00000434409.1_RNA	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	246	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T246T(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CGACCCCATAGGTCCCTGGCT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	10											78.0	84.0	82.0					10																	101716493		2203	4300	6503	101706483	SO:0001819	synonymous_variant	23268			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.738C>A	10.37:g.101716493G>T			101706483	Q8IVY3|Q9Y2L3	Silent	SNP	ENST00000324109.4	37	CCDS7485.1	SNP	35	Baylor																																																																																				0.512	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221		Silent
DSP	1832	hgsc.bcm.edu	37	6	7583708	7583708	+	Silent	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:7583708T>C	ENST00000379802.3	+	24	6554	c.6213T>C	c.(6211-6213)agT>agC	p.S2071S	DSP_ENST00000418664.2_Silent_p.S1472S	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2071	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTGTCGACAGTGCCATAGCTC	0.478																																																0			6											103.0	105.0	104.0					6																	7583708		2203	4300	6503	7528707	SO:0001819	synonymous_variant	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6213T>C	6.37:g.7583708T>C			7528707	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1	SNP	59	Baylor																																																																																				0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		Silent
DYRK1A	1859	hgsc.bcm.edu	37	21	38862659	38862659	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr21:38862659A>G	ENST00000398960.2	+	6	922	c.847A>G	c.(847-849)Atc>Gtc	p.I283V	DYRK1A_ENST00000338785.3_Missense_Mutation_p.I283V|DYRK1A_ENST00000455387.2_Missense_Mutation_p.I55V|DYRK1A_ENST00000339659.4_Missense_Mutation_p.I274V|DYRK1A_ENST00000398956.2_Missense_Mutation_p.I283V|DYRK1A_ENST00000451934.1_Missense_Mutation_p.I283V|DYRK1A_ENST00000321219.8_Missense_Mutation_p.I283V	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)	p.I283V(1)		breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGAACTTAGTATCATTCACTG	0.438																																					Melanoma(114;464 1602 31203 43785 45765)											1	Substitution - Missense(1)	ovary(1)	21											102.0	94.0	97.0					21																	38862659		2203	4300	6503	37784529	SO:0001583	missense	1859			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.847A>G	21.37:g.38862659A>G	ENSP00000381932:p.Ile283Val		37784529	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	37	CCDS42925.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680821	0.68042	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	N	0.21324	0.655	0.80722	D	1	B;B;B;B;B	0.29085	0.232;0.232;0.19;0.158;0.232	B;B;B;B;B	0.43251	0.413;0.413;0.177;0.111;0.413	T	0.66196	-0.5984	10	0.54805	T	0.06	.	16.3446	0.83118	1.0:0.0:0.0:0.0	.	283;283;283;274;283	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	V	283;274;283;283;283;283;55	ENSP00000342690:I283V;ENSP00000340373:I274V;ENSP00000319032:I283V;ENSP00000416089:I283V;ENSP00000381932:I283V;ENSP00000381929:I283V;ENSP00000407854:I55V	ENSP00000319032:I283V	I	+	1	0	DYRK1A	37784529	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.244000	0.95423	2.254000	0.74563	0.467000	0.42956	ATC		0.438	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396		Missense_Mutation
ECT2	1894	hgsc.bcm.edu	37	3	172473089	172473089	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:172473089G>C	ENST00000392692.3	+	3	311	c.135G>C	c.(133-135)gaG>gaC	p.E45D	ECT2_ENST00000441497.2_Missense_Mutation_p.E45D|ECT2_ENST00000417960.1_Splice_Site_p.E44D|ECT2_ENST00000427830.1_Missense_Mutation_p.E45D|ECT2_ENST00000232458.5_Missense_Mutation_p.E45D|ECT2_ENST00000540509.1_Missense_Mutation_p.E45D	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	45					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.E45D(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TAACAGAAGAGATGCCTCAGA	0.318																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	92.0	90.0					3																	172473089		2203	4296	6499	173955783	SO:0001583	missense	1894			AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.135G>C	3.37:g.172473089G>C	ENSP00000376457:p.Glu45Asp		173955783	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	37	CCDS58860.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830324	0.32329	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000428567;ENST00000426894;ENST00000366090;ENST00000415665;ENST00000438041;ENST00000441497;ENST00000540509	T;T;T;T;T;T;T;T;T;T;T	0.67698	-0.25;-0.23;-0.28;-0.28;0.76;0.79;0.78;0.79;0.79;-0.25;-0.23	5.58	4.43	0.53597	.	0.153445	0.64402	D	0.000020	T	0.58666	0.2138	L	0.50333	1.59	0.38089	D	0.936891	B;B;B;B	0.23058	0.03;0.079;0.079;0.051	B;B;B;B	0.22386	0.01;0.039;0.016;0.009	T	0.56329	-0.7997	10	0.31617	T	0.26	-22.7044	10.7727	0.46332	0.9242:0.0:0.0758:0.0	.	45;45;45;44	Q9H8V3;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.	D	45;45;45;44;44;45;45;45;45;45;45	ENSP00000232458:E45D;ENSP00000376457:E45D;ENSP00000401910:E45D;ENSP00000415876:E44D;ENSP00000403501:E44D;ENSP00000412331:E45D;ENSP00000403446:E45D;ENSP00000412028:E45D;ENSP00000389108:E45D;ENSP00000412259:E45D;ENSP00000443160:E45D	ENSP00000232458:E45D	E	+	3	2	ECT2	173955783	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.932000	0.48940	0.959000	0.37980	-0.339000	0.08088	GAG		0.318	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098		Missense_Mutation
EFHC2	80258	hgsc.bcm.edu	37	X	44120529	44120529	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chrX:44120529C>T	ENST00000420999.1	-	4	481	c.398G>A	c.(397-399)cGt>cAt	p.R133H		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	133	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)	p.R133H(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						AATCCGATGACGCCGGATAGA	0.418													C|||	1	0.000264901	0.0	0.0	3775	,	,		14280	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	X											52.0	45.0	47.0					X																	44120529		1853	4089	5942	44005473	SO:0001583	missense	80258			AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.398G>A	X.37:g.44120529C>T	ENSP00000404232:p.Arg133His		44005473	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	37	CCDS55405.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975656	0.92919	.	.	ENSG00000183690	ENST00000333807;ENST00000420999	T;T	0.78246	-1.16;-1.16	5.83	5.83	0.93111	Uncharacterised domain DM10 (2);	0.000000	0.85682	D	0.000000	D	0.91509	0.7319	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93146	0.6545	10	0.66056	D	0.02	-4.6236	19.0508	0.93043	0.0:1.0:0.0:0.0	.	133	Q5JST6	EFHC2_HUMAN	H	133;161	ENSP00000333823:R133H;ENSP00000404232:R161H	ENSP00000333823:R133H	R	-	2	0	EFHC2	44005473	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	6.775000	0.75018	2.448000	0.82819	0.600000	0.82982	CGT		0.418	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184		Missense_Mutation
ENTPD5	957	hgsc.bcm.edu	37	14	74449771	74449771	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr14:74449771C>G	ENST00000334696.6	-	6	710	c.391G>C	c.(391-393)Gca>Cca	p.A131P	ENTPD5_ENST00000557325.1_Missense_Mutation_p.A131P	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	131					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)	p.A131P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CGTAGTCCTGCTGTTGCCTTT	0.483																																																1	Substitution - Missense(1)	ovary(1)	14											241.0	222.0	229.0					14																	74449771		2203	4300	6503	73519524	SO:0001583	missense	957			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.391G>C	14.37:g.74449771C>G	ENSP00000335246:p.Ala131Pro		73519524	A1L4C5|Q96RX0	Missense_Mutation	SNP	ENST00000334696.6	37	CCDS9825.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498826	0.85069	.	.	ENSG00000187097	ENST00000557325;ENST00000334696;ENST00000553284	T;T;T	0.37584	1.19;1.19;1.19	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.74442	0.3717	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84419	0.0570	10	0.72032	D	0.01	-13.0948	16.2422	0.82418	0.0:1.0:0.0:0.0	.	131;131	O75356;G3V4I0	ENTP5_HUMAN;.	P	131	ENSP00000451810:A131P;ENSP00000335246:A131P;ENSP00000451591:A131P	ENSP00000335246:A131P	A	-	1	0	ENTPD5	73519524	1.000000	0.71417	0.978000	0.43139	0.703000	0.40648	6.469000	0.73555	2.593000	0.87608	0.655000	0.94253	GCA		0.483	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249		Missense_Mutation
ERCC6L	54821	hgsc.bcm.edu	37	X	71424880	71424880	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chrX:71424880T>G	ENST00000334463.3	-	2	3872	c.3737A>C	c.(3736-3738)cAa>cCa	p.Q1246P	ERCC6L_ENST00000373657.1_Missense_Mutation_p.Q1123P|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	1246					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q1246P(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					GTTATTAAGTTGCTTATACAA	0.338																																																1	Substitution - Missense(1)	ovary(1)	X											50.0	45.0	47.0					X																	71424880		2203	4300	6503	71341605	SO:0001583	missense	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.3737A>C	X.37:g.71424880T>G	ENSP00000334675:p.Gln1246Pro		71341605	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.73	3.687333	0.68157	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	T;T	0.74421	-0.84;-0.84	5.64	4.43	0.53597	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.80732	0.4679	M	0.62723	1.935	0.38092	D	0.936981	D	0.71674	0.998	P	0.62014	0.897	D	0.83576	0.0115	9	0.72032	D	0.01	-6.2092	9.3946	0.38394	0.1605:0.0:0.0:0.8394	.	1246	Q2NKX8	ERC6L_HUMAN	P	1123;1246	ENSP00000362761:Q1123P;ENSP00000334675:Q1246P	ENSP00000334675:Q1246P	Q	-	2	0	ERCC6L	71341605	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	3.974000	0.56852	1.896000	0.54893	0.430000	0.28490	CAA		0.338	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		Missense_Mutation
FAM171A1	221061	hgsc.bcm.edu	37	10	15296825	15296825	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:15296825C>A	ENST00000378116.4	-	4	478	c.472G>T	c.(472-474)Gag>Tag	p.E158*		NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	158						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E158*(1)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CTGGTGTTCTCAGGCAACCTC	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	10											61.0	58.0	59.0					10																	15296825		2203	4300	6503	15336831	SO:0001587	stop_gained	221061			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.472G>T	10.37:g.15296825C>A	ENSP00000367356:p.Glu158*		15336831	D3DRT9|Q32M49|Q8N4I0	Nonsense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.193582	0.94960	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	.	.	.	5.11	5.11	0.69529	.	0.364462	0.29616	N	0.011647	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-25.5114	18.9182	0.92515	0.0:1.0:0.0:0.0	.	.	.	.	X	158;159	.	ENSP00000367356:E158X	E	-	1	0	FAM171A1	15336831	0.994000	0.37717	0.941000	0.38009	0.896000	0.52359	3.047000	0.49854	2.545000	0.85829	0.650000	0.86243	GAG		0.562	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		Nonsense_Mutation
ESYT1	23344	hgsc.bcm.edu	37	12	56522339	56522339	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:56522339G>T	ENST00000394048.5	+	1	500	c.236G>T	c.(235-237)gGt>gTt	p.G79V	RP11-603J24.5_ENST00000550947.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA|ESYT1_ENST00000541590.1_Missense_Mutation_p.G79V|ESYT1_ENST00000267113.4_Missense_Mutation_p.G79V	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	79					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.G79V(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CTCAGCGTGGGTTTCGTGCTC	0.667																																																1	Substitution - Missense(1)	ovary(1)	12											145.0	139.0	141.0					12																	56522339		2203	4300	6503	54808606	SO:0001583	missense	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.236G>T	12.37:g.56522339G>T	ENSP00000377612:p.Gly79Val		54808606	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582028	0.86748	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.77229	-1.08;-1.08;-1.08	4.86	4.86	0.63082	.	0.206931	0.49916	D	0.000131	T	0.70570	0.3239	N	0.25201	0.72	0.80722	D	1	P;P	0.47034	0.826;0.889	P;B	0.45712	0.491;0.444	T	0.74355	-0.3692	10	0.54805	T	0.06	-18.1451	15.3752	0.74598	0.0:0.0:1.0:0.0	.	79;79	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	V	79	ENSP00000377612:G79V;ENSP00000267113:G79V;ENSP00000445952:G79V	ENSP00000267113:G79V	G	+	2	0	ESYT1	54808606	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	2.172000	0.42463	2.709000	0.92574	0.561000	0.74099	GGT		0.667	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292		Missense_Mutation
RMDN1	51115	hgsc.bcm.edu	37	8	87498713	87498713	+	Splice_Site	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:87498713C>T	ENST00000406452.3	-	4	654	c.495G>A	c.(493-495)aaG>aaA	p.K165K	RMDN1_ENST00000519966.1_Splice_Site_p.K165K|RMDN1_ENST00000430676.2_Splice_Site_p.K165K|RMDN1_ENST00000523911.1_Splice_Site_p.K121K|CPNE3_ENST00000198765.4_Intron	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	165						microtubule (GO:0005874)|mitochondrion (GO:0005739)		p.K165K(1)									AGCAACTCACCTTATGAGATG	0.333																																																1	Substitution - coding silent(1)	ovary(1)	8											120.0	103.0	109.0					8																	87498713		2203	4300	6503	87567829	SO:0001630	splice_region_variant	51115			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.495+1G>A	8.37:g.87498713C>T			87567829	A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Silent	SNP	ENST00000406452.3	37	CCDS34918.1	SNP	24	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.22|14.22	2.469987|2.469987	0.43839|0.43839	.|.	.|.	ENSG00000176623|ENSG00000176623	ENST00000519639|ENST00000519789	.|.	.|.	.|.	5.88|5.88	5.01|5.01	0.66863|0.66863	.|.	.|.	.|.	.|.	.|.	T|T	0.71117|0.71117	0.3302|0.3302	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.70557|0.70557	-0.4839|-0.4839	4|4	.|.	.|.	.|.	-15.1964|-15.1964	15.3063|15.3063	0.73995|0.73995	0.0:0.9329:0.0:0.0671|0.0:0.9329:0.0:0.0671	.|.	.|.	.|.	.|.	N|M	11|111	.|.	.|.	S|V	-|-	2|1	0|0	FAM82B|FAM82B	87567829|87567829	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	2.623000|2.623000	0.46435|0.46435	1.492000|1.492000	0.48499|0.48499	0.650000|0.650000	0.86243|0.86243	AGT|GTG		0.333	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	Silent	Silent
FAM8A1	51439	hgsc.bcm.edu	37	6	17605166	17605166	+	Missense_Mutation	SNP	T	T	C	rs111827800	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:17605166T>C	ENST00000259963.3	+	3	918	c.863T>C	c.(862-864)aTa>aCa	p.I288T		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	288	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			ATGCATTATATAATAGAAGAA	0.308																																																0			6																																								17713145	SO:0001583	missense	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.863T>C	6.37:g.17605166T>C	ENSP00000259963:p.Ile288Thr		17713145	B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.36	3.811866	0.70797	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.84	5.84	0.93424	RDD (1);	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	L	0.35414	1.06	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.59225	-0.7494	9	0.39692	T	0.17	-10.6709	16.2109	0.82158	0.0:0.0:0.0:1.0	.	288	Q9UBU6	FA8A1_HUMAN	T	38;288	.	ENSP00000259963:I288T	I	+	2	0	FAM8A1	17713145	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.921000	0.70028	2.230000	0.72887	0.455000	0.32223	ATA		0.308	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1			Missense_Mutation
FARP2	9855	hgsc.bcm.edu	37	2	242429383	242429383	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:242429383G>C	ENST00000264042.3	+	22	2598	c.2428G>C	c.(2428-2430)Gaa>Caa	p.E810Q		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	810	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E810Q(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACAGGTGGAAGAAAGTGATAA	0.527																																																1	Substitution - Missense(1)	large_intestine(1)	2											98.0	86.0	90.0					2																	242429383		2203	4300	6503	242078056	SO:0001583	missense	9855			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2428G>C	2.37:g.242429383G>C	ENSP00000264042:p.Glu810Gln		242078056	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	SNP	33	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.629374|4.629374	0.87660|0.87660	.|.	.|.	ENSG00000006607|ENSG00000006607	ENST00000264042|ENST00000444371	T|.	0.76186|.	-1.0|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.110586|.	0.64402|.	D|.	0.000012|.	T|T	0.77405|0.77405	0.4125|0.4125	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D|.	0.58620|.	0.983|.	P|.	0.57057|.	0.812|.	T|T	0.76661|0.76661	-0.2877|-0.2877	10|5	0.54805|.	T|.	0.06|.	.|.	19.4258|19.4258	0.94741|0.94741	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	810|.	O94887|.	FARP2_HUMAN|.	Q|T	810|3	ENSP00000264042:E810Q|.	ENSP00000264042:E810Q|.	E|R	+|+	1|2	0|0	FARP2|FARP2	242078056|242078056	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.021000|0.021000	0.10359|0.10359	9.666000|9.666000	0.98612|0.98612	2.582000|2.582000	0.87167|0.87167	0.650000|0.650000	0.86243|0.86243	GAA|AGA		0.527	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1			Missense_Mutation
FAT1	2195	hgsc.bcm.edu	37	4	187525621	187525621	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:187525621C>G	ENST00000441802.2	-	18	10667	c.10458G>C	c.(10456-10458)gaG>gaC	p.E3486D		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3486	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E3486D(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CAAAAGCCTTCTCATCATTTC	0.463										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											95.0	93.0	94.0					4																	187525621		1913	4121	6034	187762615	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10458G>C	4.37:g.187525621C>G	ENSP00000406229:p.Glu3486Asp		187762615		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.710	-0.787562	0.02884	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.02552	4.25	5.42	-6.69	0.01772	Cadherin (4);Cadherin-like (1);	0.320590	0.37261	N	0.002180	T	0.01092	0.0036	N	0.12182	0.205	0.20764	N	0.999857	B	0.02656	0.0	B	0.06405	0.002	T	0.43686	-0.9376	10	0.09084	T	0.74	.	4.6317	0.12506	0.31:0.2834:0.3378:0.0688	.	3486	Q14517	FAT1_HUMAN	D	3486;3488	ENSP00000406229:E3486D	ENSP00000260147:E3488D	E	-	3	2	FAT1	187762615	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.293000	0.08320	-1.251000	0.02494	-1.097000	0.02148	GAG		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
FAT2	2196	hgsc.bcm.edu	37	5	150924102	150924102	+	Silent	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:150924102G>T	ENST00000261800.5	-	9	6598	c.6586C>A	c.(6586-6588)Cgg>Agg	p.R2196R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2196	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTGGACTCCGGGCCTGGGTG	0.473																																																0			5											83.0	95.0	91.0					5																	150924102		2203	4300	6503	150904295	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6586C>A	5.37:g.150924102G>T			150904295	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1	SNP	39	Baylor																																																																																				0.473	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		Silent
FGD3	89846	hgsc.bcm.edu	37	9	95765242	95765242	+	Silent	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:95765242G>A	ENST00000375482.3	+	4	985	c.489G>A	c.(487-489)caG>caA	p.Q163Q	FGD3_ENST00000416701.2_Silent_p.Q163Q|FGD3_ENST00000337352.6_Silent_p.Q163Q	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	163	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.Q163Q(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						ACATTGCCCAGGAGCTCCTGC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	9											110.0	120.0	117.0					9																	95765242		1991	4176	6167	94805063	SO:0001819	synonymous_variant	89846			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.489G>A	9.37:g.95765242G>A			94805063	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Silent	SNP	ENST00000375482.3	37	CCDS43849.1	SNP	35	Baylor																																																																																				0.592	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086		Silent
FGD6	55785	hgsc.bcm.edu	37	12	95566398	95566398	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:95566398G>T	ENST00000343958.4	-	3	2787	c.2564C>A	c.(2563-2565)cCt>cAt	p.P855H	FGD6_ENST00000549499.1_Missense_Mutation_p.P855H|FGD6_ENST00000546711.1_Missense_Mutation_p.P855H	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	855					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.P855H(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CAGTGGGTCAGGCTCTCCTTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											206.0	202.0	203.0					12																	95566398		2203	4300	6503	94090529	SO:0001583	missense	55785			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.2564C>A	12.37:g.95566398G>T	ENSP00000344446:p.Pro855His		94090529	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.823	0.938094	0.18206	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.69685	-0.31;-0.42;-0.34	5.94	4.12	0.48240	Dbl homology (DH) domain (2);	0.150261	0.31335	N	0.007827	T	0.72748	0.3499	M	0.62723	1.935	0.30940	N	0.725907	D	0.76494	0.999	P	0.59703	0.862	T	0.73582	-0.3937	10	0.52906	T	0.07	-7.4924	8.051	0.30577	0.177:0.0:0.823:0.0	.	855	Q6ZV73	FGD6_HUMAN	H	855	ENSP00000344446:P855H;ENSP00000450342:P855H;ENSP00000449005:P855H	ENSP00000344446:P855H	P	-	2	0	FGD6	94090529	1.000000	0.71417	0.996000	0.52242	0.457000	0.32468	2.854000	0.48325	1.520000	0.48965	0.561000	0.74099	CCT		0.428	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351		Missense_Mutation
FRMD4B	23150	hgsc.bcm.edu	37	3	69244235	69244235	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:69244235G>T	ENST00000398540.3	-	16	1509	c.1426C>A	c.(1426-1428)Cag>Aag	p.Q476K	FRMD4B_ENST00000478263.1_Missense_Mutation_p.Q128K|FRMD4B_ENST00000542259.1_Missense_Mutation_p.Q422K	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	476					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)		p.Q422K(1)		NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTTCTGACCTGAGGAGGCTTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											108.0	102.0	104.0					3																	69244235		1915	4136	6051	69326925	SO:0001583	missense	23150			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1426C>A	3.37:g.69244235G>T	ENSP00000381549:p.Gln476Lys		69326925	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	6.866	0.529054	0.13127	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.82081	-1.57;-1.56	5.62	5.62	0.85841	.	0.270551	0.39985	N	0.001214	T	0.70710	0.3255	L	0.28014	0.82	0.31885	N	0.617896	P;B	0.39717	0.684;0.008	B;B	0.37780	0.258;0.024	T	0.69075	-0.5241	10	0.05721	T	0.95	-13.5841	14.8288	0.70132	0.0:0.0:0.8561:0.1439	.	320;476	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	K	476;422;128	ENSP00000381549:Q476K;ENSP00000437658:Q422K	ENSP00000381549:Q476K	Q	-	1	0	FRMD4B	69326925	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.106000	0.64597	2.810000	0.96702	0.585000	0.79938	CAG		0.458	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1			Missense_Mutation
FGF12	2257	hgsc.bcm.edu	37	3	192078254	192078254	+	Silent	SNP	A	A	T	rs111916094		TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:192078254A>T	ENST00000454309.2	-	2	1098	c.273T>A	c.(271-273)ggT>ggA	p.G91G	FGF12_ENST00000445105.2_Silent_p.G29G|FGF12_ENST00000450716.1_Silent_p.G29G|FGF12_ENST00000430714.1_Intron|FGF12_ENST00000264730.3_Silent_p.G29G	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	91					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.G91G(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		CATCAATGGTACCATCTGGGT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	3											175.0	150.0	159.0					3																	192078254		2203	4300	6503	193560948	SO:0001819	synonymous_variant	2257			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.273T>A	3.37:g.192078254A>T			193560948	B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Silent	SNP	ENST00000454309.2	37	CCDS3301.1	SNP	14	Baylor																																																																																				0.408	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032		Silent
FSTL5	56884	hgsc.bcm.edu	37	4	162680656	162680656	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:162680656C>G	ENST00000306100.5	-	6	1070	c.634G>C	c.(634-636)Gat>Cat	p.D212H	FSTL5_ENST00000379164.4_Missense_Mutation_p.D211H|FSTL5_ENST00000536695.1_Missense_Mutation_p.D211H|FSTL5_ENST00000427802.2_Missense_Mutation_p.D211H	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	212	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D212H(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TCAAAGAGATCCTTGCCAAGT	0.289																																																1	Substitution - Missense(1)	ovary(1)	4											87.0	95.0	92.0					4																	162680656		2203	4300	6503	162900106	SO:0001583	missense	56884			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.634G>C	4.37:g.162680656C>G	ENSP00000305334:p.Asp212His		162900106	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892385	0.33442	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.37	4.53	0.55603	EF-hand-like domain (1);	0.186026	0.48767	D	0.000179	T	0.29288	0.0729	L	0.45051	1.395	0.44227	D	0.997069	D;P;P	0.54047	0.964;0.938;0.877	P;P;B	0.53035	0.541;0.716;0.436	T	0.01578	-1.1320	10	0.45353	T	0.12	.	13.1141	0.59289	0.0:0.9225:0.0:0.0774	.	211;211;212	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	H	212;211;211;211	ENSP00000305334:D212H;ENSP00000368462:D211H;ENSP00000389270:D211H;ENSP00000440409:D211H	ENSP00000305334:D212H	D	-	1	0	FSTL5	162900106	1.000000	0.71417	0.221000	0.23827	0.266000	0.26442	4.072000	0.57563	1.268000	0.44264	-0.245000	0.11935	GAT		0.289	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		Missense_Mutation
GABARAPL2	11345	hgsc.bcm.edu	37	16	75611250	75611250	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:75611250A>G	ENST00000037243.2	+	4	473	c.337A>G	c.(337-339)Aac>Gac	p.N113D	GABARAPL2_ENST00000565985.1_3'UTR|GABARAPL2_ENST00000568455.1_Missense_Mutation_p.N53D|GABARAPL2_ENST00000563744.1_3'UTR|RP11-77K12.8_ENST00000564489.1_RNA	NM_007285.6	NP_009216.1	P60520	GBRL2_HUMAN	GABA(A) receptor-associated protein-like 2	113					autophagy (GO:0006914)|intra-Golgi vesicle-mediated transport (GO:0006891)|negative regulation of proteasomal protein catabolic process (GO:1901799)|positive regulation of ATPase activity (GO:0032781)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular (GO:0005622)	ATPase binding (GO:0051117)|beta-tubulin binding (GO:0048487)|GABA receptor binding (GO:0050811)|microtubule binding (GO:0008017)|SNARE binding (GO:0000149)	p.N113D(1)		lung(1)|ovary(1)	2						CAGCGGAGAGAACACTTTTGG	0.423																																																1	Substitution - Missense(1)	ovary(1)	16											119.0	123.0	122.0					16																	75611250		2198	4300	6498	74168751	SO:0001583	missense	11345			AF087848	CCDS10921.1	16q22.1	2014-02-12			ENSG00000034713	ENSG00000034713			13291	protein-coding gene	gene with protein product		607452				11414770	Standard	NM_007285		Approved	GEF2, ATG8, GATE16, GATE-16, ATG8C	uc002fen.3	P60520	OTTHUMG00000137613	ENST00000037243.2:c.337A>G	16.37:g.75611250A>G	ENSP00000037243:p.Asn113Asp		74168751	O08765|Q6FG91|Q9DCP8|Q9UQF7	Missense_Mutation	SNP	ENST00000037243.2	37	CCDS10921.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.8	4.947562	0.92593	.	.	ENSG00000034713	ENST00000037243	T	0.44482	0.92	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.52354	0.1729	M	0.71036	2.16	0.58432	D	0.999999	B	0.32245	0.361	B	0.40825	0.341	T	0.54180	-0.8332	10	0.62326	D	0.03	-31.976	15.6411	0.77001	1.0:0.0:0.0:0.0	.	113	P60520	GBRL2_HUMAN	D	113	ENSP00000037243:N113D	ENSP00000037243:N113D	N	+	1	0	GABARAPL2	74168751	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.310000	0.96267	2.367000	0.80283	0.528000	0.53228	AAC		0.423	GABARAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269029.1	NM_007285		Missense_Mutation
GART	2618	hgsc.bcm.edu	37	21	34893293	34893293	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr21:34893293C>G	ENST00000381831.3	-	13	1686	c.1423G>C	c.(1423-1425)Ggt>Cgt	p.G475R	GART_ENST00000381815.4_Missense_Mutation_p.G475R|GART_ENST00000381839.3_Missense_Mutation_p.G475R|GART_ENST00000543717.1_Missense_Mutation_p.G27R	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	475	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.G475R(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	TCAAAAAGACCAGCAAAACCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	21											87.0	90.0	89.0					21																	34893293		2203	4300	6503	33815163	SO:0001583	missense	2618			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.1423G>C	21.37:g.34893293C>G	ENSP00000371253:p.Gly475Arg		33815163	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.069515	0.93950	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000543717	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.59	5.59	0.84812	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.000000	0.85682	D	0.000000	T	0.75406	0.3845	H	0.97415	4	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.84576	0.0658	10	0.87932	D	0	-13.2227	19.5805	0.95465	0.0:1.0:0.0:0.0	.	475	P22102	PUR2_HUMAN	R	475;475;475;27	ENSP00000371236:G475R;ENSP00000371253:G475R;ENSP00000371261:G475R;ENSP00000443579:G27R	ENSP00000371236:G475R	G	-	1	0	GART	33815163	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.336000	0.79245	2.631000	0.89168	0.462000	0.41574	GGT		0.358	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819		Missense_Mutation
GAS2	2620	hgsc.bcm.edu	37	11	22707267	22707267	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:22707267C>A	ENST00000454584.2	+	3	504	c.199C>A	c.(199-201)Ctc>Atc	p.L67I	GAS2_ENST00000533092.1_3'UTR|RNA5SP338_ENST00000410495.1_RNA|GAS2_ENST00000278187.3_Missense_Mutation_p.L67I|GAS2_ENST00000433790.1_Missense_Mutation_p.L67I	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	67	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)		p.L67I(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						TGGTGCCTTGCTCTGTCAACT	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											110.0	108.0	109.0					11																	22707267		2203	4300	6503	22663843	SO:0001583	missense	2620			BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.199C>A	11.37:g.22707267C>A	ENSP00000401145:p.Leu67Ile		22663843	B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	ENST00000454584.2	37	CCDS7858.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345734	0.82022	.	.	ENSG00000148935	ENST00000528582;ENST00000454584;ENST00000533363;ENST00000278187;ENST00000534801;ENST00000532398;ENST00000433790	T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.42	5.42	0.78866	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.89674	0.6783	M	0.91038	3.17	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.91420	0.5158	10	0.87932	D	0	-10.0723	19.5786	0.95455	0.0:1.0:0.0:0.0	.	67	O43903	GAS2_HUMAN	I	67	ENSP00000432584:L67I;ENSP00000401145:L67I;ENSP00000434478:L67I;ENSP00000278187:L67I;ENSP00000433182:L67I;ENSP00000435946:L67I;ENSP00000396708:L67I	ENSP00000278187:L67I	L	+	1	0	GAS2	22663843	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.643000	0.54374	2.711000	0.92665	0.655000	0.94253	CTC		0.383	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387717.1	NM_177553		Missense_Mutation
GHRL	51738	hgsc.bcm.edu	37	3	10328459	10328459	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:10328459C>A	ENST00000335542.8	-	5	1133	c.263G>T	c.(262-264)gGg>gTg	p.G88V	GHRL_ENST00000450603.1_Missense_Mutation_p.G88V|GHRL_ENST00000287656.7_Missense_Mutation_p.G87V|GHRL_ENST00000476283.1_5'UTR|GHRL_ENST00000457360.1_Missense_Mutation_p.G88V|LINC00852_ENST00000538717.1_RNA|GHRLOS_ENST00000605105.1_RNA|GHRL_ENST00000446937.2_Intron|GHRLOS_ENST00000439539.3_RNA|GHRL_ENST00000430179.1_Missense_Mutation_p.G87V|GHRLOS_ENST00000605014.1_RNA|GHRL_ENST00000439975.2_Missense_Mutation_p.G37V|GHRL_ENST00000449554.2_Missense_Mutation_p.G87V|GHRL_ENST00000437422.2_Missense_Mutation_p.G76V|LINC00852_ENST00000475197.1_RNA|GHRL_ENST00000449238.2_Missense_Mutation_p.G75V|GHRLOS_ENST00000603771.1_RNA|GHRL_ENST00000429122.1_Missense_Mutation_p.G88V|GHRL_ENST00000422159.1_Intron			Q9UBU3	GHRL_HUMAN	ghrelin/obestatin prepropeptide	88					actin polymerization or depolymerization (GO:0008154)|activation of MAPK activity (GO:0000187)|adult feeding behavior (GO:0008343)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|cortisol secretion (GO:0043400)|decidualization (GO:0046697)|dendrite development (GO:0016358)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|glucose metabolic process (GO:0006006)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of locomotion (GO:0040013)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of synapse assembly (GO:0051965)|regulation of cell proliferation (GO:0042127)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to estrogen (GO:0043627)|response to hormone (GO:0009725)	axon (GO:0030424)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|ghrelin receptor binding (GO:0031768)|growth hormone-releasing hormone activity (GO:0016608)|protein tyrosine kinase activator activity (GO:0030296)	p.G88V(1)		breast(2)|large_intestine(1)|lung(1)|ovary(1)	5						GTACTGAACCCCTGACAGCTT	0.577											OREG0015386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											70.0	57.0	61.0					3																	10328459		2203	4300	6503	10303459	SO:0001583	missense	51738			AF296558	CCDS33700.1, CCDS46747.1, CCDS46748.1, CCDS46749.1, CCDS46750.1	3p26-p25	2013-02-26	2008-07-02		ENSG00000157017	ENSG00000157017		"""Endogenous ligands"""	18129	protein-coding gene	gene with protein product	"""prepro-appetite regulatory hormone"""	605353	"""ghrelin, growth hormone secretagogue receptor ligand"""			10930375, 10604470, 16284174	Standard	NR_024133		Approved	MTLRP, ghrelin, obestatin	uc010hdj.2	Q9UBU3	OTTHUMG00000155360	ENST00000335542.8:c.263G>T	3.37:g.10328459C>A	ENSP00000335074:p.Gly88Val	663	10303459	A8CF34|A8CF38|A8CF42|A8DN29|A8DN30|Q86YP8|Q8TAT9|Q9H3R3	Missense_Mutation	SNP	ENST00000335542.8	37	CCDS33700.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137341	0.56936	.	.	ENSG00000157017	ENST00000335542;ENST00000430179;ENST00000450603;ENST00000449554;ENST00000449238;ENST00000437422;ENST00000287656;ENST00000457360;ENST00000439975;ENST00000429122	T;T;T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	4.76	1.65	0.23941	Motilin/ghrelin-associated peptide (1);	0.224693	0.31177	N	0.008101	T	0.50633	0.1627	M	0.73962	2.25	0.48236	D	0.999613	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.484	D;D;D;D;B	0.97110	1.0;1.0;0.994;1.0;0.16	T	0.47420	-0.9119	10	0.51188	T	0.08	-14.1785	3.0853	0.06276	0.213:0.5562:0.0:0.2308	.	75;76;88;87;37	Q9UBU3-4;Q9UBU3-3;Q9UBU3;Q9UBU3-2;Q9UBU3-5	.;.;GHRL_HUMAN;.;.	V	88;87;88;87;75;76;87;88;37;88	ENSP00000335074:G88V;ENSP00000399922:G87V;ENSP00000389192:G88V;ENSP00000415521:G87V;ENSP00000388145:G75V;ENSP00000416768:G76V;ENSP00000287656:G87V;ENSP00000391406:G88V;ENSP00000403725:G37V;ENSP00000414819:G88V	ENSP00000287656:G87V	G	-	2	0	GHRL	10303459	0.993000	0.37304	0.957000	0.39632	0.995000	0.86356	1.750000	0.38329	0.576000	0.29452	0.655000	0.94253	GGG		0.577	GHRL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000339625.1	NM_016362		Missense_Mutation
GJB6	10804	hgsc.bcm.edu	37	13	20797042	20797042	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr13:20797042A>T	ENST00000356192.6	-	5	1198	c.578T>A	c.(577-579)aTt>aAt	p.I193N	GJB6_ENST00000400066.3_Missense_Mutation_p.I193N|GJB6_ENST00000241124.6_Missense_Mutation_p.I193N|GJB6_ENST00000400065.3_Missense_Mutation_p.I193N	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	193					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)		p.I193N(1)		biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		AATCATAAAAATGGTAAACAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	13											80.0	71.0	74.0					13																	20797042		2203	4300	6503	19695042	SO:0001583	missense	10804			AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.578T>A	13.37:g.20797042A>T	ENSP00000348521:p.Ile193Asn		19695042	B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Missense_Mutation	SNP	ENST00000356192.6	37	CCDS9291.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.19	2.164537	0.38217	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84	5.45	5.45	0.79879	Gap junction protein, cysteine-rich domain (1);	0.497156	0.18713	N	0.133230	D	0.96744	0.8937	M	0.63208	1.945	0.43874	D	0.996481	D	0.69078	0.997	D	0.73380	0.98	D	0.96582	0.9431	10	0.87932	D	0	.	10.7156	0.46011	0.8577:0.0:0.0:0.1423	.	193	O95452	CXB6_HUMAN	N	193	ENSP00000241124:I193N;ENSP00000382938:I193N;ENSP00000382939:I193N;ENSP00000348521:I193N	ENSP00000241124:I193N	I	-	2	0	GJB6	19695042	1.000000	0.71417	0.205000	0.23548	0.026000	0.11368	7.282000	0.78630	2.059000	0.61396	0.533000	0.62120	ATT		0.478	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272906.1			Missense_Mutation
HKDC1	80201	hgsc.bcm.edu	37	10	71010108	71010108	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:71010108A>G	ENST00000354624.5	+	11	1766	c.1633A>G	c.(1633-1635)Atc>Gtc	p.I545V	HKDC1_ENST00000395086.2_Missense_Mutation_p.I545V	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	545	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.I545V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CCTGGTGAAGATCAGAAGTGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	10											123.0	121.0	122.0					10																	71010108		2203	4300	6503	70680114	SO:0001583	missense	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1633A>G	10.37:g.71010108A>G	ENSP00000346643:p.Ile545Val		70680114	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	3.482	-0.105603	0.06967	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98978	-5.29;-5.29	5.09	2.69	0.31865	Hexokinase, N-terminal (1);	0.106703	0.64402	D	0.000009	D	0.94509	0.8232	N	0.11724	0.165	0.41567	D	0.98866	B	0.06786	0.001	B	0.17433	0.018	D	0.88459	0.3054	10	0.11794	T	0.64	-14.7861	6.9706	0.24646	0.7945:0.0:0.0727:0.1328	.	545	Q2TB90	HKDC1_HUMAN	V	545	ENSP00000346643:I545V;ENSP00000378521:I545V	ENSP00000346643:I545V	I	+	1	0	HKDC1	70680114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.241000	0.51376	0.380000	0.24823	0.459000	0.35465	ATC		0.547	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130		Missense_Mutation
IBTK	25998	hgsc.bcm.edu	37	6	82921274	82921274	+	Missense_Mutation	SNP	G	G	C	rs184558709		TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:82921274G>C	ENST00000306270.7	-	14	2856	c.2307C>G	c.(2305-2307)gaC>gaG	p.D769E	IBTK_ENST00000510291.1_Missense_Mutation_p.D769E|RNU6-130P_ENST00000411112.1_RNA|IBTK_ENST00000503631.1_Missense_Mutation_p.D568E	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	769	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.D769E(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TCATGGTCACGTCACACAGAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	6											72.0	68.0	70.0					6																	82921274		2203	4300	6503	82977993	SO:0001583	missense	25998			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2307C>G	6.37:g.82921274G>C	ENSP00000305721:p.Asp769Glu		82977993	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604145	0.66445	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	D;D;D	0.91237	-2.81;-2.81;-2.81	5.74	4.51	0.55191	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.96109	0.8732	H	0.97874	4.095	0.54753	D	0.999987	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95922	0.8931	10	0.87932	D	0	-23.0271	8.8585	0.35242	0.8547:0.0:0.1453:0.0	.	568;769;769;769	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	E	769;568;769	ENSP00000305721:D769E;ENSP00000422762:D568E;ENSP00000426405:D769E	ENSP00000305721:D769E	D	-	3	2	IBTK	82977993	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.545000	0.53648	0.995000	0.38917	-0.438000	0.05819	GAC		0.333	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525		Missense_Mutation
IFFO1	25900	hgsc.bcm.edu	37	12	6660116	6660129	+	Frame_Shift_Del	DEL	CTCATTTACACGGT	CTCATTTACACGGT	-	rs201471948|rs375866509	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	CTCATTTACACGGT	CTCATTTACACGGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:6660116_6660129delCTCATTTACACGGT	ENST00000396840.2	-	2	853_866	c.812_825delACCGTGTAAATGAG	c.(811-825)gaccgtgtaaatgagfs	p.DRVNE271fs	IFFO1_ENST00000356896.4_Frame_Shift_Del_p.DRVNE271fs|IFFO1_ENST00000465801.1_5'UTR|IFFO1_ENST00000436152.2_5'UTR|IFFO1_ENST00000336604.4_Frame_Shift_Del_p.DRVNE271fs			Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan 1	271						intermediate filament (GO:0005882)		p.D271fs*9(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	20						CCTCCTGGAGCTCATTTACACGGTCTTGCAGCTG	0.621																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								6530390	SO:0001589	frameshift_variant	25900			AF124432	CCDS8550.1, CCDS41741.1, CCDS8550.2, CCDS73425.1	12p13.31	2013-01-16	2008-09-11	2008-09-11	ENSG00000010295	ENSG00000010295		"""Intermediate filament family orphans"""	24970	protein-coding gene	gene with protein product		610495	"""intermediate filament family orphan"""	IFFO		8771189, 3052284	Standard	NM_001193457		Approved	HOM-TES-103	uc010sfe.2	Q0D2I5	OTTHUMG00000141264	ENST00000396840.2:c.812_825delACCGTGTAAATGAG	12.37:g.6660116_6660129delCTCATTTACACGGT	ENSP00000380052:p.Asp271fs		6530377	Q24JT6|Q7L5J9|Q7Z5X4|Q9BQ46	Frame_Shift_Del	DEL	ENST00000396840.2	37		DEL	28	Baylor																																																																																				0.621	IFFO1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000280428.1	NM_080730		Frame_Shift_Del
IL20RB	53833	hgsc.bcm.edu	37	3	136708314	136708314	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:136708314C>T	ENST00000329582.4	+	4	687	c.438C>T	c.(436-438)acC>acT	p.T146T	IL20RB_ENST00000309741.5_Silent_p.T99T|IL20RB_ENST00000484501.1_3'UTR	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	146	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)		p.T146T(1)		kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						TGGAGATCACCAAAGATGGCT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	3											88.0	82.0	84.0					3																	136708314		2203	4300	6503	138191004	SO:0001819	synonymous_variant	53833			BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.438C>T	3.37:g.136708314C>T			138191004	B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Silent	SNP	ENST00000329582.4	37	CCDS3093.1	SNP	21	Baylor																																																																																				0.567	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357277.2	NM_144717		Silent
IMMT	10989	hgsc.bcm.edu	37	2	86398441	86398441	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:86398441G>A	ENST00000410111.3	-	5	836	c.449C>T	c.(448-450)tCt>tTt	p.S150F	IMMT_ENST00000449247.2_Intron|IMMT_ENST00000442664.2_Missense_Mutation_p.S150F|IMMT_ENST00000490238.1_5'Flank|IMMT_ENST00000254636.5_Intron|IMMT_ENST00000409051.2_Intron	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	150				EAAQIISA -> ARAPASLT (in Ref. 9; AAF73126). {ECO:0000305}.	mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.S150F(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ACCTGCTGCAGAAATAATTTG	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											53.0	53.0	53.0					2																	86398441		1922	4131	6053	86251952	SO:0001583	missense	10989			D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.449C>T	2.37:g.86398441G>A	ENSP00000387262:p.Ser150Phe		86251952	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341221	0.81911	.	.	ENSG00000132305	ENST00000410111;ENST00000442664;ENST00000377310	T;T	0.38077	1.16;1.22	5.09	5.09	0.68999	.	0.069203	0.64402	D	0.000011	T	0.38719	0.1051	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;0.999;1.0	D;D;D;D	0.83275	0.996;0.98;0.98;0.992	T	0.36040	-0.9764	9	.	.	.	-10.1436	15.1994	0.73122	0.0:0.0:1.0:0.0	.	147;150;150;150	Q05DN3;F8W9I1;Q16891-3;Q16891	.;.;.;IMMT_HUMAN	F	150	ENSP00000387262:S150F;ENSP00000407788:S150F	.	S	-	2	0	IMMT	86251952	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.177000	0.65032	2.378000	0.81104	0.491000	0.48974	TCT		0.423	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839		Missense_Mutation
IRF6	3664	hgsc.bcm.edu	37	1	209964227	209964227	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:209964227C>G	ENST00000367021.3	-	7	845	c.673G>C	c.(673-675)Gac>Cac	p.D225H	IRF6_ENST00000542854.1_Missense_Mutation_p.D130H	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	225					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D225H(1)		cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		ATGTCCAGGTCAGTCACTGCA	0.537										HNSCC(57;0.16)																																						1	Substitution - Missense(1)	ovary(1)	1											96.0	85.0	89.0					1																	209964227		2203	4300	6503	208030850	SO:0001583	missense	3664			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.673G>C	1.37:g.209964227C>G	ENSP00000355988:p.Asp225His		208030850	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	CCDS1492.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864541	0.91511	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.94280	-3.39;-3.39;-3.39	5.91	5.91	0.95273	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.97062	0.9040	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96442	0.9327	9	.	.	.	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	225	O14896	IRF6_HUMAN	H	225;130;225	ENSP00000355988:D225H;ENSP00000440532:D130H;ENSP00000403855:D225H	.	D	-	1	0	IRF6	208030850	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.311000	0.78958	2.793000	0.96121	0.655000	0.94253	GAC		0.537	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147		Missense_Mutation
ITIH5	80760	hgsc.bcm.edu	37	10	7621907	7621907	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:7621907G>C	ENST00000256861.6	-	9	1307	c.1229C>G	c.(1228-1230)aCg>aGg	p.T410R	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Missense_Mutation_p.T196R|ITIH5_ENST00000446830.2_Missense_Mutation_p.T192R|ITIH5_ENST00000397145.2_Missense_Mutation_p.T410R|ITIH5_ENST00000397146.2_Missense_Mutation_p.T410R	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	410	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T410R(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTCCCCGACCGTGGGCTTCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											116.0	102.0	107.0					10																	7621907		2203	4300	6503	7661913	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1229C>G	10.37:g.7621907G>C	ENSP00000256861:p.Thr410Arg		7661913	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648851	0.87958	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.33	5.33	0.75918	von Willebrand factor, type A (3);	0.086607	0.85682	D	0.000000	D	0.89058	0.6607	.	.	.	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.996	D;D;D	0.85130	0.997;0.972;0.953	D	0.90300	0.4329	9	0.87932	D	0	-34.6867	18.9935	0.92803	0.0:0.0:1.0:0.0	.	410;410;196	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	R	410;410;196;192;410	ENSP00000256861:T410R;ENSP00000380333:T410R;ENSP00000298441:T196R;ENSP00000387969:T192R;ENSP00000380332:T410R	ENSP00000256861:T410R	T	-	2	0	ITIH5	7661913	1.000000	0.71417	0.946000	0.38457	0.726000	0.41606	9.145000	0.94634	2.491000	0.84063	0.561000	0.74099	ACG		0.617	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		Missense_Mutation
KCNJ12	3768	hgsc.bcm.edu	37	17	21319682	21319682	+	Missense_Mutation	SNP	C	C	T	rs80203231	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:21319682C>T	ENST00000583088.1	+	3	1923	c.1028C>T	c.(1027-1029)tCg>tTg	p.S343L	KCNJ12_ENST00000331718.5_Missense_Mutation_p.S343L	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	343				S -> L (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.S343L(3)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	ATTGACTACTCGCACTTCCAC	0.582										Prostate(3;0.18)																																						3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	17											155.0	153.0	154.0					17																	21319682		2203	4300	6503	21260275	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1028C>T	17.37:g.21319682C>T	ENSP00000463778:p.Ser343Leu		21260275	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857121	0.71834	.	.	ENSG00000184185	ENST00000331718	D	0.92858	-3.12	5.76	5.76	0.90799	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.057257	0.64402	D	0.000001	D	0.92551	0.7634	M	0.77486	2.375	0.80722	D	1	B	0.27013	0.166	B	0.25140	0.058	D	0.90235	0.4282	10	0.62326	D	0.03	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	343	Q14500	IRK12_HUMAN	L	343	ENSP00000328150:S343L	ENSP00000328150:S343L	S	+	2	0	KCNJ12	21260275	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.686000	0.84128	2.732000	0.93576	0.655000	0.94253	TCG		0.582	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		Missense_Mutation
KCNJ15	3772	hgsc.bcm.edu	37	21	39672138	39672138	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr21:39672138A>T	ENST00000328656.4	+	4	1258	c.955A>T	c.(955-957)Aaa>Taa	p.K319*	KCNJ15_ENST00000398938.2_Nonsense_Mutation_p.K319*|KCNJ15_ENST00000398930.1_Nonsense_Mutation_p.K319*|KCNJ15_ENST00000398932.1_Nonsense_Mutation_p.K319*|KCNJ15_ENST00000398934.1_Nonsense_Mutation_p.K319*	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	319					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.K319*(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	ATCTCTCTCCAAAAATGGAAA	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	21											65.0	64.0	64.0					21																	39672138		2203	4300	6503	38594008	SO:0001587	stop_gained	3772			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.955A>T	21.37:g.39672138A>T	ENSP00000331698:p.Lys319*		38594008	D3DSH5|O00564|Q96L28|Q99446	Nonsense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	38	7.065478	0.98040	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000398930;ENST00000398934	.	.	.	5.83	5.83	0.93111	.	0.161373	0.53938	D	0.000058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4498	0.55671	0.8219:0.1781:0.0:0.0	.	.	.	.	X	319	.	.	K	+	1	0	KCNJ15	38594008	0.904000	0.30761	1.000000	0.80357	0.979000	0.70002	3.653000	0.54446	2.236000	0.73375	0.533000	0.62120	AAA		0.448	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243		Nonsense_Mutation
KRT38	8687	hgsc.bcm.edu	37	17	39595593	39595593	+	Silent	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:39595593G>C	ENST00000246646.3	-	3	593	c.594C>G	c.(592-594)tcC>tcG	p.S198S		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	198	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.S198S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				GCTGGCGCAGGGAGCGCTCAC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											72.0	67.0	69.0					17																	39595593		2203	4300	6503	36849119	SO:0001819	synonymous_variant	8687			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.594C>G	17.37:g.39595593G>C			36849119	A2RRM5|Q6A164	Silent	SNP	ENST00000246646.3	37	CCDS11392.1	SNP	43	Baylor																																																																																				0.627	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771		Silent
LARP1	23367	hgsc.bcm.edu	37	5	154174736	154174736	+	Splice_Site	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:154174736G>A	ENST00000336314.4	+	8	1027	c.1003G>A	c.(1003-1005)Gaa>Aaa	p.E335K		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	412					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.E412K(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCACTTAGTGAATACTACTT	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											152.0	137.0	142.0					5																	154174736		2203	4300	6503	154154929	SO:0001630	splice_region_variant	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1002-1G>A	5.37:g.154174736G>A			154154929	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	CCDS4328.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	37	6.047118	0.97231	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248;ENST00000523163;ENST00000518742	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	6.07	6.07	0.98685	Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	0.000000	0.85682	D	0.000000	D	0.90345	0.6979	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93294	0.6671	10	0.87932	D	0	-20.253	20.6439	0.99570	0.0:0.0:1.0:0.0	.	412;335	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	K	335;412;207;120;19	ENSP00000336721:E335K;ENSP00000428589:E412K;ENSP00000429904:E207K;ENSP00000430438:E120K;ENSP00000431072:E19K	ENSP00000336721:E335K	E	+	1	0	LARP1	154154929	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.787000	0.99055	2.884000	0.98904	0.655000	0.94253	GAA		0.458	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	Missense_Mutation	Missense_Mutation
LRRC63	220416	hgsc.bcm.edu	37	13	46802066	46802066	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr13:46802066C>A	ENST00000595396.1	+	2	505	c.505C>A	c.(505-507)Caa>Aaa	p.Q169K	LRRC63_ENST00000446175.1_Missense_Mutation_p.Q169K			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	169								p.Q169K(1)		lung(1)|ovary(1)	2						AGTTATCGCTCAAAAACTTGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	13																																								45700067	SO:0001583	missense	220416				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.505C>A	13.37:g.46802066C>A	ENSP00000469337:p.Gln169Lys		45700067	Q5TBN0	Missense_Mutation	SNP	ENST00000595396.1	37		SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.971	1.225364	0.22457	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.01265	5.08;5.12	5.0	-10.0	0.00425	.	2.738770	0.01186	N	0.007213	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48927	-0.8991	10	0.05436	T	0.98	4.5771	2.3468	0.04273	0.4772:0.0952:0.0898:0.3377	.	169	Q05C16	LRC63_HUMAN	K	169	ENSP00000368082:Q169K;ENSP00000408828:Q169K	ENSP00000368082:Q169K	Q	+	1	0	LRRC63	45700067	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.605000	0.05661	-2.571000	0.00468	-1.476000	0.00998	CAA		0.378	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463266.1	XM_001718341		Missense_Mutation
MAP3K7	6885	hgsc.bcm.edu	37	6	91281513	91281513	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:91281513C>A	ENST00000369329.3	-	2	295	c.134G>T	c.(133-135)gGa>gTa	p.G45V	MAP3K7_ENST00000369325.3_Missense_Mutation_p.G45V|MAP3K7_ENST00000369332.3_Missense_Mutation_p.G45V|MAP3K7_ENST00000369327.3_Missense_Mutation_p.G45V	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	45	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.G45V(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TCCAAAGGCTCCTCTTCCAAC	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											97.0	93.0	95.0					6																	91281513		2203	4299	6502	91338234	SO:0001583	missense	6885			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.134G>T	6.37:g.91281513C>A	ENSP00000358335:p.Gly45Val		91338234	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	37	CCDS5028.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688104	0.88639	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	5.57	5.57	0.84162	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.044917	0.85682	D	0.000000	D	0.96442	0.8839	H	0.99634	4.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98312	1.0524	10	0.87932	D	0	.	19.5591	0.95366	0.0:1.0:0.0:0.0	.	45;45;45;45	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	V	45	ENSP00000358338:G45V;ENSP00000358335:G45V;ENSP00000358331:G45V;ENSP00000358333:G45V	ENSP00000358331:G45V	G	-	2	0	MAP3K7	91338234	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.574000	0.82434	2.626000	0.88956	0.557000	0.71058	GGA		0.343	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331		Missense_Mutation
MED24	9862	hgsc.bcm.edu	37	17	38182907	38182907	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:38182907G>A	ENST00000394128.2	-	18	1883	c.1802C>T	c.(1801-1803)tCc>tTc	p.S601F	MED24_ENST00000394127.2_Missense_Mutation_p.S588F|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000356271.3_Missense_Mutation_p.S588F|MED24_ENST00000394126.1_Missense_Mutation_p.S626F|MED24_ENST00000501516.3_Missense_Mutation_p.S620F	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	601					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.S601F(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TACCTGGATGGACTCGAAGGC	0.557											OREG0024386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											42.0	34.0	37.0					17																	38182907		2203	4300	6503	35436433	SO:0001583	missense	9862			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1802C>T	17.37:g.38182907G>A	ENSP00000377686:p.Ser601Phe	876	35436433	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300985	0.40694	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000501516;ENST00000431269	T;T;T	0.46063	0.88;0.88;0.88	4.89	4.89	0.63831	Mediator complex, subunit Med24, N-terminal (1);	0.056540	0.64402	D	0.000001	T	0.47248	0.1435	L	0.34521	1.04	0.44330	D	0.997213	P;P;P;P;P	0.48998	0.899;0.899;0.899;0.918;0.899	P;P;P;P;P	0.52267	0.568;0.667;0.568;0.694;0.667	T	0.50338	-0.8840	10	0.62326	D	0.03	-22.7389	18.0862	0.89458	0.0:0.0:1.0:0.0	.	551;511;588;601;543	F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;MED24_HUMAN;.	F	601;601;601;551;588;543;72;511	ENSP00000377686:S601F;ENSP00000443344:S551F;ENSP00000377685:S588F	ENSP00000348610:S601F	S	-	2	0	MED24	35436433	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.514000	0.81750	2.245000	0.73994	0.655000	0.94253	TCC		0.557	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815		Missense_Mutation
KMT2C	58508	hgsc.bcm.edu	37	7	151873627	151873627	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr7:151873627A>C	ENST00000262189.6	-	38	9129	c.8911T>G	c.(8911-8913)Tct>Gct	p.S2971A	KMT2C_ENST00000355193.2_Missense_Mutation_p.S2971A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2971					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S2971A(1)									GTCACATTAGAATTCATGGCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											45.0	46.0	45.0					7																	151873627		2203	4300	6503	151504560	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8911T>G	7.37:g.151873627A>C	ENSP00000262189:p.Ser2971Ala		151504560	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	SNP	9	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.36|12.36	1.913378|1.913378	0.33815|0.33815	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193	.|D;D	.|0.83755	.|-1.76;-1.75	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.000000	.|0.46145	.|D	.|0.000304	T|T	0.72574|0.72574	0.3477|0.3477	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.38195	.|0.622;0.571;0.571	.|B;B;B	.|0.33960	.|0.152;0.173;0.173	T|T	0.72824|0.72824	-0.4176|-0.4176	5|10	.|0.37606	.|T	.|0.19	.|.	10.8714|10.8714	0.46885|0.46885	0.9269:0.0:0.0731:0.0|0.9269:0.0:0.0731:0.0	.|.	.|2971;2032;2971	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	C|A	476|2971	.|ENSP00000262189:S2971A;ENSP00000347325:S2971A	.|ENSP00000262189:S2971A	F|S	-|-	2|1	0|0	MLL3|MLL3	151504560|151504560	1.000000|1.000000	0.71417|0.71417	0.505000|0.505000	0.27651|0.27651	0.929000|0.929000	0.56500|0.56500	1.910000|1.910000	0.39927|0.39927	2.115000|2.115000	0.64714|0.64714	0.533000|0.533000	0.62120|0.62120	TTC|TCT		0.488	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			Missense_Mutation
MTERF3	51001	hgsc.bcm.edu	37	8	97251801	97251801	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:97251801A>G	ENST00000287025.3	-	8	1270	c.1172T>C	c.(1171-1173)gTa>gCa	p.V391A	MTERFD1_ENST00000524341.1_Missense_Mutation_p.V147A|MTERFD1_ENST00000523821.1_3'UTR|KB-1043D8.6_ENST00000520575.1_RNA|MTERFD1_ENST00000522822.1_Missense_Mutation_p.V270A	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		391					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.V391A(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					AGGAATAGATACTAGTTTGTC	0.328																																																1	Substitution - Missense(1)	ovary(1)	8											78.0	81.0	80.0					8																	97251801		2203	4297	6500	97320977	SO:0001583	missense	51001																														ENST00000287025.3:c.1172T>C	8.37:g.97251801A>G	ENSP00000287025:p.Val391Ala		97320977	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	CCDS6270.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497420	0.85069	.	.	ENSG00000156469	ENST00000522822;ENST00000524341;ENST00000287025	T;T;T	0.51071	1.27;0.72;1.08	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.62514	0.2434	M	0.71296	2.17	0.80722	D	1	P	0.38167	0.621	P	0.50825	0.651	T	0.63804	-0.6554	10	0.56958	D	0.05	-4.0601	15.1469	0.72662	1.0:0.0:0.0:0.0	.	391	Q96E29	MTER1_HUMAN	A	270;147;391	ENSP00000430138:V270A;ENSP00000429267:V147A;ENSP00000287025:V391A	ENSP00000287025:V391A	V	-	2	0	MTERFD1	97320977	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.221000	0.58574	2.371000	0.80710	0.533000	0.62120	GTA		0.328	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			Missense_Mutation
MTOR	2475	hgsc.bcm.edu	37	1	11291383	11291383	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:11291383C>T	ENST00000361445.4	-	17	2699	c.2623G>A	c.(2623-2625)Gag>Aag	p.E875K		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	875					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E875K(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TGGTTCTGCTCAGTCTTCAGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											242.0	230.0	234.0					1																	11291383		2203	4300	6503	11213970	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2623G>A	1.37:g.11291383C>T	ENSP00000354558:p.Glu875Lys		11213970	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	36	5.625038	0.96660	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.10382	2.88	5.84	5.84	0.93424	Domain of unknown function DUF3385,  target of rapamycin protein (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42471	0.1204	M	0.90252	3.1	0.80722	D	1	D	0.65815	0.995	D	0.64506	0.926	T	0.47923	-0.9079	10	0.87932	D	0	-21.4548	20.1346	0.98019	0.0:1.0:0.0:0.0	.	875	P42345	MTOR_HUMAN	K	875	ENSP00000354558:E875K	ENSP00000354558:E875K	E	-	1	0	MTOR	11213970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.381000	0.79718	2.765000	0.95021	0.655000	0.94253	GAG		0.512	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		Missense_Mutation
MYO18A	399687	hgsc.bcm.edu	37	17	27419382	27419382	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:27419382G>C	ENST00000527372.1	-	34	5346	c.5166C>G	c.(5164-5166)gaC>gaG	p.D1722E	MYO18A_ENST00000354329.4_Missense_Mutation_p.D1722E|MYO18A_ENST00000533112.1_Missense_Mutation_p.D1685E|TIAF1_ENST00000408971.2_5'Flank|MYO18A_ENST00000529578.1_5'Flank|MYO18A_ENST00000531253.1_Missense_Mutation_p.D1722E	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1722					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.D1722E(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CTTTGGCGATGTCATCAATCT	0.607																																					Esophageal Squamous(182;472 2015 7001 15270 22562)											1	Substitution - Missense(1)	ovary(1)	17											49.0	54.0	52.0					17																	27419382		2195	4288	6483	24443508	SO:0001583	missense	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5166C>G	17.37:g.27419382G>C	ENSP00000437073:p.Asp1722Glu		24443508	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793952	0.50102	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.82255	-0.82;-1.59;-0.82;-0.82	5.2	4.23	0.50019	Myosin tail (1);	0.000000	0.85682	D	0.000000	T	0.81427	0.4820	L	0.28694	0.88	0.33317	D	0.566851	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.976	T	0.77867	-0.2428	10	0.02654	T	1	.	9.367	0.38230	0.1677:0.0:0.8323:0.0	.	1325;1685;1722;1722	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	E	1722;1685;1685;1722;1722;618;618;1325	ENSP00000346291:D1722E;ENSP00000435932:D1685E;ENSP00000434228:D1722E;ENSP00000437073:D1722E	ENSP00000346291:D1722E	D	-	3	2	MYO18A	24443508	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.562000	0.36353	1.332000	0.45431	0.591000	0.81541	GAC		0.607	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		Missense_Mutation
N4BP1	9683	hgsc.bcm.edu	37	16	48595734	48595734	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:48595734C>G	ENST00000262384.3	-	2	1056	c.820G>C	c.(820-822)Gag>Cag	p.E274Q	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	274					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)		p.E274Q(1)		breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GAAAGTGCCTCTTCATCTGGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	16											65.0	62.0	63.0					16																	48595734		1859	4091	5950	47153235	SO:0001583	missense	9683			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.820G>C	16.37:g.48595734C>G	ENSP00000262384:p.Glu274Gln		47153235	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.349	0.432453	0.12045	.	.	ENSG00000102921	ENST00000262384	T	0.45668	0.89	5.75	5.75	0.90469	.	0.388557	0.26995	N	0.021455	T	0.27241	0.0668	N	0.24115	0.695	0.22571	N	0.998975	P	0.39391	0.671	B	0.32289	0.143	T	0.21793	-1.0235	10	0.31617	T	0.26	-5.8783	14.1449	0.65344	0.0:0.9287:0.0:0.0713	.	274	O75113	N4BP1_HUMAN	Q	274	ENSP00000262384:E274Q	ENSP00000262384:E274Q	E	-	1	0	N4BP1	47153235	0.992000	0.36948	0.990000	0.47175	0.050000	0.14768	1.525000	0.35953	2.719000	0.93026	0.655000	0.94253	GAG		0.408	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664		Missense_Mutation
NFX1	4799	hgsc.bcm.edu	37	9	33313762	33313762	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:33313762G>A	ENST00000379540.3	+	7	1621	c.1559G>A	c.(1558-1560)tGc>tAc	p.C520Y	NFX1_ENST00000318524.6_Missense_Mutation_p.C520Y|NFX1_ENST00000379521.4_Missense_Mutation_p.C520Y	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	520					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C520Y(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GGGGGTCAGTGCCAGCCTTGC	0.488																																																1	Substitution - Missense(1)	ovary(1)	9											99.0	91.0	93.0					9																	33313762		2203	4300	6503	33303762	SO:0001583	missense	4799			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1559G>A	9.37:g.33313762G>A	ENSP00000368856:p.Cys520Tyr		33303762	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583420	0.46006	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	D;D;D	0.82255	-1.59;-1.59;-1.59	5.51	5.51	0.81932	Zinc finger, NF-X1-type (2);	0.000000	0.85682	D	0.000000	D	0.93838	0.8029	H	0.96365	3.81	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.999	D	0.95330	0.8429	10	0.87932	D	0	-2.9278	14.9589	0.71141	0.0:0.0:1.0:0.0	.	520;404;520;520;520	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	Y	520	ENSP00000368856:C520Y;ENSP00000368836:C520Y;ENSP00000317695:C520Y	ENSP00000317695:C520Y	C	+	2	0	NFX1	33303762	1.000000	0.71417	0.998000	0.56505	0.017000	0.09413	8.344000	0.90055	2.597000	0.87782	0.579000	0.79373	TGC		0.488	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1			Missense_Mutation
NOS1	4842	hgsc.bcm.edu	37	12	117726007	117726007	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:117726007C>G	ENST00000338101.4	-	4	1003	c.999G>C	c.(997-999)gaG>gaC	p.E333D	NOS1_ENST00000344089.3_Missense_Mutation_p.S352T|NOS1_ENST00000317775.6_Missense_Mutation_p.E333D			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.E333D(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGCAGATGTACTCAGTGCATC	0.512																																					Esophageal Squamous(162;1748 2599 51982 52956)											1	Substitution - Missense(1)	ovary(1)	12											114.0	111.0	112.0					12																	117726007		1968	4161	6129	116210390	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.999G>C	12.37:g.117726007C>G	ENSP00000337459:p.Glu333Asp		116210390		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	SNP	20	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.44|10.44	1.351123|1.351123	0.24512|0.24512	.|.	.|.	ENSG00000089250|ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101|ENST00000344089	T;T|T	0.44083|0.07216	0.93;0.93|3.21	5.93|5.93	3.08|3.08	0.35506|0.35506	Nitric oxide synthase, oxygenase domain (2);|.	0.104108|.	0.64402|.	D|.	0.000005|.	T|T	0.14527|0.14527	0.0351|0.0351	M|M	0.61703|0.61703	1.905|1.905	0.20196|0.20196	N|N	0.99993|0.99993	B|.	0.15141|.	0.012|.	B|.	0.13407|.	0.009|.	T|T	0.11084|0.11084	-1.0602|-1.0602	10|7	0.22706|0.87932	T|D	0.39|0	-20.8517|-20.8517	7.048|7.048	0.25056|0.25056	0.0:0.6778:0.1237:0.1986|0.0:0.6778:0.1237:0.1986	.|.	333|.	P29475|.	NOS1_HUMAN|.	D|T	333|352	ENSP00000320758:E333D;ENSP00000337459:E333D|ENSP00000339862:S352T	ENSP00000320758:E333D|ENSP00000339862:S352T	E|S	-|-	3|2	2|0	NOS1|NOS1	116210390|116210390	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.762000|0.762000	0.43233|0.43233	1.588000|1.588000	0.36633|0.36633	0.837000|0.837000	0.34925|0.34925	0.563000|0.563000	0.77884|0.77884	GAG|AGT		0.512	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			Missense_Mutation
NT5E	4907	hgsc.bcm.edu	37	6	86200329	86200329	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:86200329C>T	ENST00000257770.3	+	7	1363	c.1314C>T	c.(1312-1314)agC>agT	p.S438S	NT5E_ENST00000369651.3_Intron	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	438					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.S438S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TTGAGCATAGCGTGCACCGCT	0.547																																					Melanoma(140;797 1765 2035 2752 18208)											1	Substitution - coding silent(1)	ovary(1)	6											106.0	96.0	99.0					6																	86200329		2203	4300	6503	86257048	SO:0001819	synonymous_variant	4907			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.1314C>T	6.37:g.86200329C>T			86257048	B3KQI8|O75520|Q5W116	Silent	SNP	ENST00000257770.3	37	CCDS5002.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.571	0.473662	0.12521	.	.	ENSG00000135318	ENST00000437581	.	.	.	5.93	-10.0	0.00425	.	.	.	.	.	T	0.53270	0.1786	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72124	-0.4385	4	.	.	.	-19.3006	19.9911	0.97363	0.0:0.5901:0.0:0.4099	.	.	.	.	V	134	.	.	A	+	2	0	NT5E	86257048	0.000000	0.05858	0.485000	0.27403	0.712000	0.41017	-4.104000	0.00294	-1.874000	0.01133	-0.140000	0.14226	GCG		0.547	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1			Silent
OR4F4	26682	hgsc.bcm.edu	37	15	102463187	102463188	+	Frame_Shift_Ins	INS	-	-	A			TCGA-04-1338-01	TCGA-04-1338-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr15:102463187_102463188insA	ENST00000326183.3	-	1	110_111	c.75_76insT	c.(73-78)tttgtafs	p.V26fs		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V26fs*20(1)		ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CCATAGAATACAAAAAACAACA	0.406																																																1	Insertion - Frameshift(1)	ovary(1)	15																																								100280711	SO:0001589	frameshift_variant	26682				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.76dupT	15.37:g.102463193_102463193dupA	ENSP00000317482:p.Val26fs		100280710	B2RNI5|Q6IFN9	Frame_Shift_Ins	INS	ENST00000326183.3	37	CCDS32343.1	INS	17	Baylor																																																																																				0.406	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417599.1	NM_001004195		Frame_Shift_Ins
OR8I2	120586	hgsc.bcm.edu	37	11	55861307	55861307	+	Frame_Shift_Del	DEL	A	A	-	rs201548817|rs112181516|rs144690814	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:55861307delA	ENST00000302124.2	+	1	555	c.524delA	c.(523-525)catfs	p.H175fs		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H175fs*10(1)|p.C178fs*2(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					AGCATCAATCATTTTTTTTGT	0.443													A|A|-|deletion	195	0.0389377	0.0121	0.0447	5008	,	,		21866	0.001		0.0944	False		,,,				2504	0.0532															2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	ovary(1)|large_intestine(1)	11								95,4169		0,95,2037	153.0	141.0	145.0			4.3	1.0	11	dbSNP_134	151	669,7585		32,605,3490	no	frameshift	OR8I2	NM_001003750.1		32,700,5527	A1A1,A1R,RR		8.1052,2.228,6.1032			55861307	764,11754	2201	4296	6497	55617883	SO:0001589	frameshift_variant	120586			AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.524delA	11.37:g.55861307delA	ENSP00000303864:p.His175fs		55617883	B2RNN4|Q6IFC0|Q96RC5	Frame_Shift_Del	DEL	ENST00000302124.2	37	CCDS31517.1	DEL	8	Baylor																																																																																				0.443	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750		Frame_Shift_Del
OR9G4	283189	hgsc.bcm.edu	37	11	56510430	56510430	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:56510430G>C	ENST00000302957.3	-	1	857	c.858C>G	c.(856-858)gaC>gaG	p.D286E		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D286E(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						CAGCTACTTTGTCCCTCTCTA	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											195.0	159.0	171.0					11																	56510430		2201	4296	6497	56267006	SO:0001583	missense	283189			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.858C>G	11.37:g.56510430G>C	ENSP00000307515:p.Asp286Glu		56267006	Q6IF62|Q96RA9	Missense_Mutation	SNP	ENST00000302957.3	37	CCDS31537.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.18	3.048951	0.55110	.	.	ENSG00000172457	ENST00000302957	T	0.00227	8.5	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41823	D	0.000803	T	0.00440	0.0014	M	0.73753	2.245	0.30873	N	0.732296	D	0.89917	1.0	D	0.87578	0.998	T	0.42783	-0.9431	10	0.54805	T	0.06	-33.1987	6.4984	0.22155	0.0888:0.0:0.7299:0.1812	.	286	Q8NGQ1	OR9G4_HUMAN	E	286	ENSP00000307515:D286E	ENSP00000307515:D286E	D	-	3	2	OR9G4	56267006	0.058000	0.20735	1.000000	0.80357	0.749000	0.42624	0.546000	0.23284	2.636000	0.89361	0.643000	0.83706	GAC		0.463	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284		Missense_Mutation
OTOA	146183	hgsc.bcm.edu	37	16	21739658	21739658	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:21739658G>A	ENST00000286149.4	+	19	2156	c.2155G>A	c.(2155-2157)Gct>Act	p.A719T	OTOA_ENST00000388958.3_Missense_Mutation_p.A705T|OTOA_ENST00000388956.4_Missense_Mutation_p.A626T|OTOA_ENST00000388957.3_Missense_Mutation_p.A381T			Q7RTW8	OTOAN_HUMAN	otoancorin	719					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.A705T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		CTCCCCCAGGGCTTGGGCGAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											85.0	76.0	79.0					16																	21739658		2198	4300	6498	21647159	SO:0001583	missense	146183			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2155G>A	16.37:g.21739658G>A	ENSP00000286149:p.Ala719Thr		21647159	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37		SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668628	0.47677	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957;ENST00000338456	T;T;T;T	0.74421	-0.74;-0.72;-0.74;-0.84	5.29	5.29	0.74685	.	0.085674	0.52532	D	0.000080	T	0.74442	0.3717	M	0.64997	1.995	0.45427	D	0.998402	P;P;P;P	0.49783	0.89;0.89;0.928;0.89	B;B;P;B	0.45428	0.396;0.396;0.48;0.396	T	0.75587	-0.3266	10	0.40728	T	0.16	-15.7776	14.4211	0.67183	0.0:0.0:1.0:0.0	.	719;626;381;705	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	T	705;719;626;381;114	ENSP00000373610:A705T;ENSP00000286149:A719T;ENSP00000373608:A626T;ENSP00000373609:A381T	ENSP00000286149:A719T	A	+	1	0	OTOA	21647159	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	5.308000	0.65768	2.457000	0.83068	0.655000	0.94253	GCT		0.592	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			Missense_Mutation
PABPC1	26986	hgsc.bcm.edu	37	8	101719201	101719201	+	Missense_Mutation	SNP	A	A	G	rs72681439		TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:101719201A>G	ENST00000318607.5	-	10	2489	c.1361T>C	c.(1360-1362)aTc>aCc	p.I454T	PABPC1_ENST00000519004.1_Missense_Mutation_p.I409T|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000519596.1_Intron|PABPC1_ENST00000522387.1_Missense_Mutation_p.I422T	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	454					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			AGCTGGGCGGATAGCACCGGG	0.433																																																0			8											72.0	69.0	70.0					8																	101719201		2203	4300	6503	101788377	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1361T>C	8.37:g.101719201A>G	ENSP00000313007:p.Ile454Thr		101788377	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	SNP	12	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.57|17.57	3.422927|3.422927	0.62733|0.62733	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000318607;ENST00000519004;ENST00000522387;ENST00000522658|ENST00000517403	T;T;T;T|.	0.50548|.	1.64;1.55;2.61;0.74|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.63558|0.63558	0.2521|0.2521	L|L	0.47016|0.47016	1.485|1.485	0.46654|0.46654	D|D	0.999149|0.999149	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.09377|.	0.001;0.004;0.002|.	T|T	0.60424|0.60424	-0.7266|-0.7266	9|5	.|.	.|.	.|.	.|.	16.1251|16.1251	0.81386|0.81386	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	422;454;454|.	E7ERJ7;B3KT93;P11940|.	.;.;PABP1_HUMAN|.	T|P	454;409;422;1|107	ENSP00000313007:I454T;ENSP00000429594:I409T;ENSP00000429395:I422T;ENSP00000428840:I1T|.	.|.	I|S	-|-	2|1	0|0	PABPC1|PABPC1	101788377|101788377	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.628000|8.628000	0.90979|0.90979	2.272000|2.272000	0.75746|0.75746	0.528000|0.528000	0.53228|0.53228	ATC|TCC		0.433	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568		Missense_Mutation
PAOX	196743	hgsc.bcm.edu	37	10	135194999	135195004	+	In_Frame_Del	DEL	CCCTGC	CCCTGC	-			TCGA-04-1338-01	TCGA-04-1338-11	CCCTGC	CCCTGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:135194999_135195004delCCCTGC	ENST00000278060.5	+	3	787_792	c.704_709delCCCTGC	c.(703-711)gccctgccg>gcg	p.LP236del	PAOX_ENST00000368535.2_3'UTR|AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000357296.3_In_Frame_Del_p.LP236del|PAOX_ENST00000368539.4_3'UTR|PAOX_ENST00000480071.2_In_Frame_Del_p.LP236del	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	374					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		ATGATGGCCGCCCTGCCGGAGGACAC	0.568																																																0			10																																								135044994	SO:0001651	inframe_deletion	196743			BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.704_709delCCCTGC	10.37:g.135194999_135195004delCCCTGC	ENSP00000278060:p.Leu236_Pro237del		135044989	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	In_Frame_Del	DEL	ENST00000278060.5	37	CCDS7683.1	DEL	26	Baylor																																																																																				0.568	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911		In_Frame_Del
PLA2G15	23659	hgsc.bcm.edu	37	16	68283281	68283281	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:68283281C>T	ENST00000219345.5	+	2	299	c.216C>T	c.(214-216)taC>taT	p.Y72Y	PLA2G15_ENST00000566188.1_Silent_p.Y72Y|PLA2G15_ENST00000444212.2_Intron|PLA2G15_ENST00000413021.2_Intron|PLA2G15_ENST00000568599.1_3'UTR	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	72					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)	p.Y72Y(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						CCGAAAGCTACTTCACAATCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	16											128.0	99.0	109.0					16																	68283281		2198	4300	6498	66840782	SO:0001819	synonymous_variant	23659			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.216C>T	16.37:g.68283281C>T			66840782	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Silent	SNP	ENST00000219345.5	37	CCDS10864.1	SNP	20	Baylor																																																																																				0.562	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320		Silent
PON3	5446	hgsc.bcm.edu	37	7	94993257	94993257	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr7:94993257G>C	ENST00000265627.5	-	6	623	c.613C>G	c.(613-615)Ctt>Gtt	p.L205V	PON3_ENST00000427422.1_Missense_Mutation_p.L205V|PON3_ENST00000451904.1_Missense_Mutation_p.L205V|PON1_ENST00000542556.1_Intron	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	205					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.L205F(1)|p.L205V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CTGTAGAAAAGAACATAAGTC	0.443																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	7											183.0	187.0	186.0					7																	94993257		2203	4300	6503	94831193	SO:0001583	missense	5446			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.613C>G	7.37:g.94993257G>C	ENSP00000265627:p.Leu205Val		94831193	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	ENST00000265627.5	37	CCDS5639.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.216	-0.379588	0.05000	.	.	ENSG00000105852	ENST00000265627;ENST00000427422	T;T	0.35789	1.29;1.29	5.27	-3.24	0.05094	Six-bladed beta-propeller, TolB-like (1);	0.387835	0.28442	N	0.015332	T	0.09423	0.0232	N	0.02658	-0.545	0.09310	N	1	B;B	0.17465	0.022;0.001	B;B	0.12837	0.008;0.002	T	0.37549	-0.9701	10	0.02654	T	1	-2.1494	7.7473	0.28877	0.0707:0.5718:0.1756:0.1819	.	253;205	B4E2I0;Q15166	.;PON3_HUMAN	V	205	ENSP00000265627:L205V;ENSP00000413276:L205V	ENSP00000265627:L205V	L	-	1	0	PON3	94831193	0.982000	0.34865	0.001000	0.08648	0.263000	0.26337	0.808000	0.27154	-0.217000	0.10033	0.655000	0.94253	CTT		0.443	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940		Missense_Mutation
POPDC3	64208	hgsc.bcm.edu	37	6	105609554	105609554	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:105609554T>C	ENST00000254765.3	-	2	509	c.231A>G	c.(229-231)atA>atG	p.I77M	POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000580854.1_RNA|BVES-AS1_ENST00000369122.3_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	77					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.I77M(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TCCAGGAAAATATGTCAGCTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	6											126.0	139.0	135.0					6																	105609554		2203	4300	6503	105716247	SO:0001583	missense	64208			BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.231A>G	6.37:g.105609554T>C	ENSP00000254765:p.Ile77Met		105716247	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	37	CCDS5052.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.03	1.815546	0.32145	.	.	ENSG00000132429	ENST00000254765	T	0.46063	0.88	5.72	-1.77	0.07982	.	0.218136	0.49305	N	0.000142	T	0.15349	0.0370	L	0.59436	1.845	0.38795	D	0.95507	B	0.06786	0.001	B	0.04013	0.001	T	0.04796	-1.0926	10	0.46703	T	0.11	-9.4158	3.8618	0.08999	0.1117:0.1299:0.4606:0.2978	.	77	Q9HBV1	POPD3_HUMAN	M	77	ENSP00000254765:I77M	ENSP00000254765:I77M	I	-	3	3	POPDC3	105716247	0.199000	0.23386	0.997000	0.53966	0.983000	0.72400	-0.516000	0.06282	-0.168000	0.10853	-0.316000	0.08728	ATA		0.443	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361		Missense_Mutation
PSMC3	5702	hgsc.bcm.edu	37	11	47446256	47446256	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:47446256C>G	ENST00000298852.3	-	4	449	c.292G>C	c.(292-294)Gat>Cat	p.D98H	PSMC3_ENST00000602866.1_Missense_Mutation_p.D82H|PSMC3_ENST00000530912.1_Missense_Mutation_p.D56H	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	98					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.D98H(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGATCAACATCCAGGAGCTGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											86.0	76.0	79.0					11																	47446256		2201	4298	6499	47402832	SO:0001583	missense	5702			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.292G>C	11.37:g.47446256C>G	ENSP00000298852:p.Asp98His		47402832	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	ENST00000298852.3	37	CCDS7935.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597540	0.66332	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000524447;ENST00000531051;ENST00000530887;ENST00000530651;ENST00000527906;ENST00000526993;ENST00000531653;ENST00000528362	D;D	0.95069	-3.6;-3.5	5.35	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.97309	0.9120	M	0.93594	3.435	0.80722	D	1	D;D	0.64830	0.994;0.977	P;P	0.58391	0.838;0.717	D	0.97679	1.0171	10	0.66056	D	0.02	-21.5707	13.4286	0.61042	0.0:0.9237:0.0:0.0763	.	56;98	E9PM69;P17980	.;PRS6A_HUMAN	H	98;56;63;63;63;63;63;106;82;82	ENSP00000298852:D98H;ENSP00000433097:D56H	ENSP00000298852:D98H	D	-	1	0	PSMC3	47402832	1.000000	0.71417	0.837000	0.33122	0.599000	0.36880	7.530000	0.81962	1.244000	0.43870	0.561000	0.74099	GAT		0.512	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804		Missense_Mutation
PSORS1C1	170679	hgsc.bcm.edu	37	6	31106233	31106233	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:31106233C>G	ENST00000259881.9	+	4	329	c.40C>G	c.(40-42)Ctc>Gtc	p.L14V	PSORS1C1_ENST00000481450.2_5'UTR|PSORS1C1_ENST00000547221.1_5'UTR|PSORS1C2_ENST00000259845.4_Intron	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1	14								p.L14V(1)		kidney(1)|ovary(2)|prostate(1)|skin(1)	5						TCAAAGAGCTCTCGGTAGGTT	0.517																																																1	Substitution - Missense(1)	ovary(1)	6											79.0	80.0	80.0					6																	31106233		1511	2709	4220	31214212	SO:0001583	missense	170679			AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.40C>G	6.37:g.31106233C>G	ENSP00000259881:p.Leu14Val		31214212	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	CCDS34390.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557299	0.27827	.	.	ENSG00000204540	ENST00000259881	T	0.15256	2.44	3.07	3.07	0.35406	.	.	.	.	.	T	0.10551	0.0258	N	0.08118	0	0.28164	N	0.928838	D	0.60575	0.988	D	0.68621	0.959	T	0.16867	-1.0388	9	0.87932	D	0	.	9.822	0.40887	0.0:1.0:0.0:0.0	.	14	Q9UIG5	PS1C1_HUMAN	V	14	ENSP00000259881:L14V	ENSP00000259881:L14V	L	+	1	0	PSORS1C1	31214212	0.005000	0.15991	0.015000	0.15790	0.124000	0.20399	0.290000	0.18975	2.037000	0.60232	0.478000	0.44815	CTC		0.517	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068		Missense_Mutation
PTPN3	5774	hgsc.bcm.edu	37	9	112144675	112144675	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:112144675T>A	ENST00000374541.2	-	24	2539	c.2435A>T	c.(2434-2436)cAc>cTc	p.H812L	PTPN3_ENST00000412145.1_Missense_Mutation_p.H681L|PTPN3_ENST00000262539.3_Missense_Mutation_p.H658L|PTPN3_ENST00000394827.3_Missense_Mutation_p.H280L|PTPN3_ENST00000446349.1_Missense_Mutation_p.H636L	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	812	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.H812L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GGGCACACCGTGGTCAGGCCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	9											210.0	154.0	173.0					9																	112144675		2203	4300	6503	111184496	SO:0001583	missense	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2435A>T	9.37:g.112144675T>A	ENSP00000363667:p.His812Leu		111184496	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	36	5.604749	0.96626	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000394827;ENST00000262539	T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43	5.24	5.24	0.73138	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.85682	D	0.000000	T	0.46054	0.1373	H	0.94222	3.51	0.80722	D	1	P;P;P	0.50819	0.939;0.66;0.904	B;B;P	0.52672	0.428;0.345;0.706	T	0.63134	-0.6705	10	0.87932	D	0	.	15.1578	0.72759	0.0:0.0:0.0:1.0	.	658;767;812	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	L	812;681;636;812;280;658	ENSP00000416654:H681L;ENSP00000395384:H636L;ENSP00000363667:H812L;ENSP00000378304:H280L;ENSP00000262539:H658L	ENSP00000262539:H658L	H	-	2	0	PTPN3	111184496	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.033000	0.88852	1.971000	0.57363	0.454000	0.30748	CAC		0.562	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4			Missense_Mutation
PTPN3	5774	hgsc.bcm.edu	37	9	112144677	112144677	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:112144677G>T	ENST00000374541.2	-	24	2537	c.2433C>A	c.(2431-2433)gaC>gaA	p.D811E	PTPN3_ENST00000412145.1_Missense_Mutation_p.D680E|PTPN3_ENST00000262539.3_Missense_Mutation_p.D657E|PTPN3_ENST00000394827.3_Missense_Mutation_p.D279E|PTPN3_ENST00000446349.1_Missense_Mutation_p.D635E	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	811	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.D811E(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GCACACCGTGGTCAGGCCATG	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											215.0	157.0	177.0					9																	112144677		2203	4300	6503	111184498	SO:0001583	missense	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2433C>A	9.37:g.112144677G>T	ENSP00000363667:p.Asp811Glu		111184498	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654520	0.67472	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000394827;ENST00000262539	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.24	4.14	0.48551	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.85682	D	0.000000	T	0.32912	0.0845	M	0.83223	2.63	0.49051	D	0.999745	P;B;B	0.41450	0.75;0.255;0.401	B;B;B	0.40702	0.32;0.176;0.338	T	0.31052	-0.9957	10	0.87932	D	0	.	9.0594	0.36425	0.2154:0.0:0.7846:0.0	.	657;766;811	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	E	811;680;635;811;279;657	ENSP00000416654:D680E;ENSP00000395384:D635E;ENSP00000363667:D811E;ENSP00000378304:D279E;ENSP00000262539:D657E	ENSP00000262539:D657E	D	-	3	2	PTPN3	111184498	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.509000	0.53386	2.433000	0.82419	0.555000	0.69702	GAC		0.557	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4			Missense_Mutation
PURG	29942	hgsc.bcm.edu	37	8	30889499	30889500	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-04-1338-01	TCGA-04-1338-11	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:30889499_30889500delAA	ENST00000475541.1	-	1	1731_1732	c.799_800delTT	c.(799-801)ttcfs	p.F267fs	PURG_ENST00000339382.2_Frame_Shift_Del_p.F267fs|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	267						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.F267fs*5(2)		endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GTCCACTCTGAAAGAAGTCCCC	0.441																																																2	Deletion - Frameshift(2)	ovary(2)	8																																								31009042	SO:0001589	frameshift_variant	29942			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.799_800delTT	8.37:g.30889499_30889500delAA	ENSP00000418721:p.Phe267fs		31009041	Q8TE64	Frame_Shift_Del	DEL	ENST00000475541.1	37	CCDS6081.1	DEL	9	Baylor																																																																																				0.441	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348565.1	NM_013357		Frame_Shift_Del
PXDNL	137902	hgsc.bcm.edu	37	8	52336197	52336197	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:52336197T>C	ENST00000356297.4	-	14	1833	c.1733A>G	c.(1732-1734)tAt>tGt	p.Y578C	PXDNL_ENST00000543296.1_Missense_Mutation_p.Y578C	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	578	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.Y578C(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CACACATTCATATCTTCCCTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	8											111.0	121.0	118.0					8																	52336197		2142	4257	6399	52498750	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1733A>G	8.37:g.52336197T>C	ENSP00000348645:p.Tyr578Cys		52498750	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.11	1.260626	0.23051	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.93366	-3.21;-3.21	4.59	0.628	0.17681	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.97179	0.9078	H	0.99425	4.56	0.09310	N	1	D	0.53151	0.958	P	0.57244	0.816	D	0.90663	0.4592	9	0.66056	D	0.02	.	4.3228	0.11025	0.0:0.1703:0.1707:0.6589	.	578	A1KZ92	PXDNL_HUMAN	C	578	ENSP00000348645:Y578C;ENSP00000444865:Y578C	ENSP00000348645:Y578C	Y	-	2	0	PXDNL	52498750	0.972000	0.33761	0.000000	0.03702	0.002000	0.02628	2.522000	0.45572	-0.076000	0.12775	0.528000	0.53228	TAT		0.468	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		Missense_Mutation
ARR3	407	hgsc.bcm.edu	37	X	69504160	69504160	+	IGR	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chrX:69504160A>G	ENST00000307959.8	+	0	1292				RAB41_ENST00000276066.4_Silent_p.S197S|RAB41_ENST00000374473.2_Silent_p.S198S	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)						endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)		p.S198S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						CAAGGACTTCACCTCCACCAA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	X											67.0	59.0	62.0					X																	69504160		2203	4300	6503	69420885	SO:0001628	intergenic_variant	347517				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768		X.37:g.69504160A>G			69420885	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Silent	SNP	ENST00000307959.8	37	CCDS14399.1	SNP	6	Baylor																																																																																				0.463	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312		Silent
RABEP1	9135	hgsc.bcm.edu	37	17	5286419	5286419	+	Silent	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:5286419G>A	ENST00000546142.2	+	18	2677	c.2490G>A	c.(2488-2490)gtG>gtA	p.V830V	NUP88_ENST00000573169.1_Intron|RABEP1_ENST00000341923.6_Silent_p.V797V|RABEP1_ENST00000262477.6_Silent_p.V830V|RABEP1_ENST00000408982.2_Silent_p.V797V|RABEP1_ENST00000537505.1_Silent_p.V787V			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	830					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)	p.V830V(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						TTCTCCAGGTGCAGTTAGAGC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	17											66.0	70.0	69.0					17																	5286419		2138	4294	6432	5227143	SO:0001819	synonymous_variant	9135			AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.2490G>A	17.37:g.5286419G>A			5227143	B2RAG7|O95369|Q8IVX3	Silent	SNP	ENST00000546142.2	37	CCDS45592.1	SNP	46	Baylor																																																																																				0.463	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703		Silent
RBPJL	11317	hgsc.bcm.edu	37	20	43942111	43942111	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr20:43942111G>T	ENST00000343694.3	+	7	695	c.623G>T	c.(622-624)tGc>tTc	p.C208F	RBPJL_ENST00000372743.1_Missense_Mutation_p.C208F|RBPJL_ENST00000372741.3_Missense_Mutation_p.C208F	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	208					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C208F(1)		NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				ctcacAGTGTGCATATCCTCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											98.0	75.0	83.0					20																	43942111		2203	4300	6503	43375525	SO:0001583	missense	11317			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.623G>T	20.37:g.43942111G>T	ENSP00000341243:p.Cys208Phe		43375525	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	ENST00000343694.3	37	CCDS13349.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466644	0.84425	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.39592	1.07;1.07;1.07	5.06	5.06	0.68205	LAG1, DNA binding (1);Beta-trefoil (2);	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.71031	-0.4710	10	0.87932	D	0	-36.075	17.6043	0.88034	0.0:0.0:1.0:0.0	.	208;208	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	F	208	ENSP00000361828:C208F;ENSP00000361826:C208F;ENSP00000341243:C208F	ENSP00000341243:C208F	C	+	2	0	RBPJL	43375525	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.202000	0.95026	2.618000	0.88619	0.557000	0.71058	TGC		0.587	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276		Missense_Mutation
REV1	51455	hgsc.bcm.edu	37	2	100020219	100020219	+	Silent	SNP	C	C	G	rs183307465	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:100020219C>G	ENST00000258428.3	-	19	3333	c.3105G>C	c.(3103-3105)gcG>gcC	p.A1035A	REV1_ENST00000393445.3_Silent_p.A1034A|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1035					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.A1035A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTTGATCATACGCTGCTTTCA	0.498								Direct reversal of damage					c|||	5	0.000998403	0.0	0.0014	5008	,	,		19364	0.0		0.004	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2						G	,	1,4405	2.1+/-5.4	0,1,2202	114.0	104.0	107.0		3102,3105	-12.1	0.0	2		107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	REV1	NM_001037872.1,NM_016316.2	,	0,2,6501	GG,GC,CC		0.0116,0.0227,0.0154	,	1034/1251,1035/1252	100020219	2,13004	2203	4300	6503	99386651	SO:0001819	synonymous_variant	51455			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3105G>C	2.37:g.100020219C>G			99386651	O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	ENST00000258428.3	37	CCDS2045.1	SNP	19	Baylor																																																																																				0.498	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316		Silent
RIPK3	11035	hgsc.bcm.edu	37	14	24807486	24807486	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr14:24807486C>T	ENST00000216274.5	-	5	851	c.633G>A	c.(631-633)atG>atA	p.M211I	RIPK3_ENST00000554338.1_5'Flank|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.M211I(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		GCACTGCCCACATTAGGATCC	0.532																																					Pancreas(58;918 1191 4668 13304 15331)											1	Substitution - Missense(1)	ovary(1)	14											94.0	94.0	94.0					14																	24807486		2203	4300	6503	23877326	SO:0001583	missense	11035			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.633G>A	14.37:g.24807486C>T	ENSP00000216274:p.Met211Ile		23877326	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	CCDS9628.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593310	0.28357	.	.	ENSG00000129465	ENST00000216274	T	0.62941	-0.01	4.07	3.16	0.36331	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.618655	0.15423	N	0.263108	T	0.36552	0.0971	N	0.05510	-0.035	0.24403	N	0.994699	B	0.22909	0.077	B	0.22152	0.038	T	0.14783	-1.0460	10	0.31617	T	0.26	-11.465	5.4122	0.16354	0.1971:0.6991:0.0:0.1038	.	211	Q9Y572	RIPK3_HUMAN	I	211	ENSP00000216274:M211I	ENSP00000216274:M211I	M	-	3	0	RIPK3	23877326	0.095000	0.21747	0.993000	0.49108	0.807000	0.45602	0.024000	0.13555	1.293000	0.44690	0.655000	0.94253	ATG		0.532	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871		Missense_Mutation
LTN1	26046	hgsc.bcm.edu	37	21	30339206	30339206	+	Frame_Shift_Del	DEL	T	T	-	rs560176639	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr21:30339206delT	ENST00000361371.5	-	10	1686	c.1607delA	c.(1606-1608)aatfs	p.N536fs	LTN1_ENST00000389195.2_Frame_Shift_Del_p.N582fs|LTN1_ENST00000389194.2_Frame_Shift_Del_p.N582fs			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	536					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N536fs*33(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						AACCTTACCATTTTTTTTTTT	0.378													|||unknown(HR)	455	0.0908546	0.1248	0.0461	5008	,	,		18798	0.0714		0.0586	False		,,,				2504	0.1299															1	Deletion - Frameshift(1)	ovary(1)	21											50.0	47.0	48.0					21																	30339206		2203	4300	6503	29261077	SO:0001589	frameshift_variant	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1607delA	21.37:g.30339206delT	ENSP00000354977:p.Asn536fs		29261077	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Frame_Shift_Del	DEL	ENST00000361371.5	37		DEL	52	Baylor																																																																																				0.378	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565		Frame_Shift_Del
RNF25	64320	hgsc.bcm.edu	37	2	219529146	219529146	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:219529146G>A	ENST00000295704.2	-	10	1354	c.914C>T	c.(913-915)cCa>cTa	p.P305L		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	305					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P305L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGAGGAGGTGGCAAAGTGGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											88.0	84.0	85.0					2																	219529146		2203	4300	6503	219237390	SO:0001583	missense	64320				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.914C>T	2.37:g.219529146G>A	ENSP00000295704:p.Pro305Leu		219237390	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.711	1.157090	0.21454	.	.	ENSG00000163481	ENST00000295704	T	0.48522	0.81	5.09	5.09	0.68999	.	0.623617	0.15383	N	0.265228	T	0.35189	0.0923	N	0.22421	0.69	0.09310	N	0.999997	B	0.26635	0.155	B	0.26517	0.07	T	0.25293	-1.0136	10	0.62326	D	0.03	-11.3804	11.3123	0.49370	0.0:0.0:0.8186:0.1813	.	305	Q96BH1	RNF25_HUMAN	L	305	ENSP00000295704:P305L	ENSP00000295704:P305L	P	-	2	0	RNF25	219237390	0.420000	0.25457	0.576000	0.28549	0.376000	0.30014	4.842000	0.62831	2.826000	0.97356	0.561000	0.74099	CCA		0.542	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453		Missense_Mutation
SAMD12	401474	hgsc.bcm.edu	37	8	119391906	119391906	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr8:119391906A>C	ENST00000314727.4	-	4	492	c.356T>G	c.(355-357)cTc>cGc	p.L119R	SAMD12_ENST00000527515.1_5'Flank|AC023590.1_ENST00000430457.1_Intron|SAMD12_ENST00000409003.4_Missense_Mutation_p.L119R	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	119	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.L119R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CATTCGCTCGAGCTTTTTGTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	8											113.0	103.0	107.0					8																	119391906		2203	4300	6503	119461087	SO:0001583	missense	401474			AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.356T>G	8.37:g.119391906A>C	ENSP00000314173:p.Leu119Arg		119461087	Q0P502	Missense_Mutation	SNP	ENST00000314727.4	37	CCDS6325.1	SNP	11	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.7|27.7	4.851985|4.851985	0.91355|0.91355	.|.	.|.	ENSG00000177570|ENSG00000177570	ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328|ENST00000526765	D;D;D;D|.	0.96041|.	-3.89;-3.89;-3.89;-3.89|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|D	0.85362|0.85362	0.5679|0.5679	M|M	0.91561|0.91561	3.22|3.22	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	D|D	0.88334|0.88334	0.2970|0.2970	9|5	.|.	.|.	.|.	-9.4277|-9.4277	16.8222|16.8222	0.85835|0.85835	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	119;119|.	B8ZZB7;Q8N8I0|.	.;SAM12_HUMAN|.	R|A	119;111;119;119|134	ENSP00000387133:L119R;ENSP00000435927:L111R;ENSP00000314173:L119R;ENSP00000431360:L119R|.	.|.	L|S	-|-	2|1	0|0	SAMD12|SAMD12	119461087|119461087	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.881000|0.881000	0.50899|0.50899	8.962000|8.962000	0.93254|0.93254	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	CTC|TCG		0.468	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506		Missense_Mutation
SCUBE3	222663	hgsc.bcm.edu	37	6	35207534	35207534	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:35207534G>C	ENST00000274938.7	+	8	835	c.835G>C	c.(835-837)Gat>Cat	p.D279H	SCUBE3_ENST00000394681.1_Missense_Mutation_p.D295H	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3									p.D279H(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TTCAGATATAGATGAGTGCCG	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											113.0	115.0	114.0					6																	35207534		2203	4300	6503	35315512	SO:0001583	missense	222663			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.835G>C	6.37:g.35207534G>C	ENSP00000274938:p.Asp279His		35315512		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.138921	0.94560	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	T;T	0.35973	1.28;1.28	5.66	5.66	0.87406	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.74137	0.3677	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84729	0.0744	10	0.87932	D	0	.	19.7503	0.96265	0.0:0.0:1.0:0.0	.	295;279	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	H	295;279	ENSP00000378174:D295H;ENSP00000274938:D279H	ENSP00000274938:D279H	D	+	1	0	SCUBE3	35315512	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	2.648000	0.89879	0.655000	0.94253	GAT		0.448	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753		Missense_Mutation
SEMA3A	10371	hgsc.bcm.edu	37	7	83640541	83640541	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr7:83640541C>A	ENST00000265362.4	-	8	1197	c.883G>T	c.(883-885)Gtg>Ttg	p.V295L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.V295L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	295	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.V295L(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GGACCTGGCACTGAGCAAATC	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											134.0	123.0	126.0					7																	83640541		2203	4300	6503	83478477	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.883G>T	7.37:g.83640541C>A	ENSP00000265362:p.Val295Leu		83478477		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.331379	0.95733	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.23147	1.92;1.92	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.46054	0.1373	L	0.45285	1.41	0.80722	D	1	D	0.71674	0.998	D	0.67725	0.953	T	0.15607	-1.0431	10	0.59425	D	0.04	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	295	Q14563	SEM3A_HUMAN	L	295	ENSP00000265362:V295L;ENSP00000415260:V295L	ENSP00000265362:V295L	V	-	1	0	SEMA3A	83478477	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GTG		0.413	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		Missense_Mutation
SHQ1	55164	hgsc.bcm.edu	37	3	72866458	72866458	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr3:72866458G>T	ENST00000325599.8	-	7	944	c.805C>A	c.(805-807)Cgt>Agt	p.R269S	SHQ1_ENST00000463369.1_Missense_Mutation_p.R241S	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	269					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R269G(1)|p.R269S(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CACACTTGACGACAGGCTCTC	0.383																																																2	Substitution - Missense(2)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	3											151.0	135.0	141.0					3																	72866458		2203	4299	6502	72949148	SO:0001583	missense	55164			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.805C>A	3.37:g.72866458G>T	ENSP00000315182:p.Arg269Ser		72949148	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	CCDS33788.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.386	1.074261	0.20227	.	.	ENSG00000144736	ENST00000325599;ENST00000463369	T;T	0.31510	1.51;1.49	5.79	0.241	0.15494	SHQ1 protein (1);	0.849897	0.10755	N	0.637868	T	0.15825	0.0381	N	0.20685	0.6	0.09310	N	1	B	0.32968	0.392	B	0.32583	0.148	T	0.28554	-1.0040	10	0.10111	T	0.7	-10.8533	7.4868	0.27439	0.2774:0.0:0.6115:0.1111	.	269	Q6PI26	SHQ1_HUMAN	S	269;241	ENSP00000315182:R269S;ENSP00000417452:R241S	ENSP00000315182:R269S	R	-	1	0	SHQ1	72949148	0.012000	0.17670	0.025000	0.17156	0.868000	0.49771	1.034000	0.30204	0.081000	0.16988	-0.293000	0.09583	CGT		0.383	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130		Missense_Mutation
SIRPD	128646	hgsc.bcm.edu	37	20	1532452	1532452	+	Silent	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr20:1532452G>T	ENST00000381623.3	-	2	1495	c.306C>A	c.(304-306)acC>acA	p.T102T	SIRPD_ENST00000381621.1_Silent_p.T102T			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	102	Ig-like V-type.					extracellular region (GO:0005576)		p.T102T(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CACGGATGCGGGTGGAAAAGT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	20											162.0	159.0	160.0					20																	1532452		2203	4300	6503	1480452	SO:0001819	synonymous_variant	128646			AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.306C>A	20.37:g.1532452G>T			1480452	B3KS88|Q5TFQ6	Silent	SNP	ENST00000381623.3	37	CCDS13018.1	SNP	43	Baylor																																																																																				0.463	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460		Silent
SLC30A5	64924	hgsc.bcm.edu	37	5	68412417	68412417	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:68412417G>T	ENST00000396591.3	+	10	1879	c.1269G>T	c.(1267-1269)ttG>ttT	p.L423F	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	423					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.L423F(2)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTTACTTCTTGTGCTTGAATC	0.318																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	5											48.0	50.0	49.0					5																	68412417		2203	4299	6502	68448173	SO:0001583	missense	64924			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1269G>T	5.37:g.68412417G>T	ENSP00000379836:p.Leu423Phe		68448173	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	37	CCDS3996.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049276	0.55218	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.68765	-0.35	5.76	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.75781	0.3896	L	0.60957	1.885	0.80722	D	1	P;D;P	0.63880	0.933;0.993;0.933	D;D;P	0.67103	0.928;0.949;0.888	T	0.78081	-0.2343	10	0.87932	D	0	.	11.1361	0.48375	0.0701:0.1284:0.8014:0.0	.	252;252;423	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	F	423;36	ENSP00000379836:L423F	ENSP00000379836:L423F	L	+	3	2	SLC30A5	68448173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.338000	0.33873	1.581000	0.49865	0.655000	0.94253	TTG		0.318	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2			Missense_Mutation
SLC35F5	80255	hgsc.bcm.edu	37	2	114500277	114500277	+	Frame_Shift_Del	DEL	A	A	-			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:114500277delA	ENST00000245680.2	-	7	1155	c.742delT	c.(742-744)tgcfs	p.C248fs	SLC35F5_ENST00000409342.1_Frame_Shift_Del_p.C242fs	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	248					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.C248fs*22(2)|p.?(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						ACCACAAAGCAAAAAAAAAAG	0.343																																																3	Deletion - Frameshift(2)|Unknown(1)	ovary(2)|skin(1)	2											105.0	103.0	104.0					2																	114500277		2203	4300	6503	114216747	SO:0001589	frameshift_variant	80255			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.742delT	2.37:g.114500277delA	ENSP00000245680:p.Cys248fs		114216747	Q9H6P8|Q9H7D8	Frame_Shift_Del	DEL	ENST00000245680.2	37	CCDS2119.1	DEL	5	Baylor																																																																																				0.343	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181		Frame_Shift_Del
SLC36A3	285641	hgsc.bcm.edu	37	5	150657103	150657103	+	Missense_Mutation	SNP	C	C	G	rs13155272		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:150657103C>G	ENST00000335230.3	-	10	1675	c.1264G>C	c.(1264-1266)Gag>Cag	p.E422Q	SLC36A3_ENST00000377713.3_Missense_Mutation_p.E463Q	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	422						integral component of membrane (GO:0016021)		p.E422Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCATGTCCTCAGAGTAAAAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	5											112.0	100.0	104.0					5																	150657103		2203	4300	6503	150637296	SO:0001583	missense	285641			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1264G>C	5.37:g.150657103C>G	ENSP00000334750:p.Glu422Gln		150637296	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	37	CCDS4314.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642445	0.67244	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02682	4.2;4.2	4.69	4.69	0.59074	.	0.117279	0.56097	D	0.000024	T	0.11281	0.0275	M	0.64170	1.965	0.58432	D	0.999999	P;D;D	0.65815	0.877;0.967;0.995	P;P;P	0.62014	0.561;0.838;0.897	T	0.22068	-1.0227	10	0.24483	T	0.36	.	18.1858	0.89792	0.0:1.0:0.0:0.0	.	463;422;407	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	Q	422;463	ENSP00000334750:E422Q;ENSP00000366942:E463Q	ENSP00000334750:E422Q	E	-	1	0	SLC36A3	150637296	1.000000	0.71417	0.998000	0.56505	0.265000	0.26407	5.436000	0.66538	2.593000	0.87608	0.655000	0.94253	GAG		0.547	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774		Missense_Mutation
SLC44A5	204962	hgsc.bcm.edu	37	1	75684941	75684941	+	Splice_Site	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:75684941C>G	ENST00000370855.5	-	16	1380		c.e16+1		SLC44A5_ENST00000370859.3_Splice_Site|SLC44A5_ENST00000535611.1_Splice_Site	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CTTGTACTTACCTCTGGGTCA	0.408																																																1	Unknown(1)	ovary(1)	1											93.0	88.0	89.0					1																	75684941		2203	4300	6503	75457529	SO:0001630	splice_region_variant	204962			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1266+1G>C	1.37:g.75684941C>G			75457529	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Splice_Site_SNP	SNP	ENST00000370855.5	37	CCDS667.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.7	4.453092	0.84209	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3248	0.90250	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC44A5	75457529	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.117000	0.77129	2.397000	0.81536	0.655000	0.94253	.		0.408	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	Intron	Splice_Site_SNP
SLC6A15	55117	hgsc.bcm.edu	37	12	85285812	85285812	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr12:85285812C>T	ENST00000266682.5	-	2	629	c.88G>A	c.(88-90)Gct>Act	p.A30T	SLC6A15_ENST00000450363.3_Missense_Mutation_p.A30T|SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000552192.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	30					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.A30T(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GCATCATCAGCTGCGTCTTCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											233.0	215.0	221.0					12																	85285812		2203	4300	6503	83809943	SO:0001583	missense	55117			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.88G>A	12.37:g.85285812C>T	ENSP00000266682:p.Ala30Thr		83809943	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992313	0.35131	.	.	ENSG00000072041	ENST00000266682;ENST00000450363;ENST00000549540	T;T;T	0.72942	-0.7;-0.38;0.95	5.44	5.44	0.79542	.	0.242929	0.42964	D	0.000637	T	0.62356	0.2421	L	0.44542	1.39	0.21782	N	0.999545	B;B	0.20550	0.046;0.005	B;B	0.23275	0.045;0.027	T	0.45614	-0.9249	10	0.14252	T	0.57	.	15.3462	0.74340	0.1481:0.8519:0.0:0.0	.	30;30	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	T	30	ENSP00000266682:A30T;ENSP00000390706:A30T;ENSP00000448308:A30T	ENSP00000266682:A30T	A	-	1	0	SLC6A15	83809943	0.594000	0.26849	1.000000	0.80357	0.960000	0.62799	1.284000	0.33249	2.702000	0.92279	0.591000	0.81541	GCT		0.403	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767		Missense_Mutation
SOSTDC1	25928	hgsc.bcm.edu	37	7	16502439	16502439	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr7:16502439C>T	ENST00000307068.4	-	2	535	c.355G>A	c.(355-357)Gga>Aga	p.G119R	SOSTDC1_ENST00000396652.1_Missense_Mutation_p.G143R	NM_015464.2	NP_056279.1	Q6X4U4	SOSD1_HUMAN	sclerostin domain containing 1	119	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				hair follicle morphogenesis (GO:0031069)|mammary gland bud morphogenesis (GO:0060648)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell fate commitment (GO:0010454)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.G119R(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(2)	6	Lung NSC(10;0.185)			UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		TACTTTGTTCCATAGCCTCCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											97.0	90.0	92.0					7																	16502439		2203	4300	6503	16468964	SO:0001583	missense	25928			AB059270	CCDS5360.1	7p21.2	2007-08-01			ENSG00000171243	ENSG00000171243			21748	protein-coding gene	gene with protein product	"""ectodin"""	609675					Standard	NM_015464		Approved	DKFZp564D206, USAG1	uc003stg.3	Q6X4U4	OTTHUMG00000090807	ENST00000307068.4:c.355G>A	7.37:g.16502439C>T	ENSP00000304930:p.Gly119Arg		16468964	A8MUA6|Q96HJ7|Q9Y3U3	Missense_Mutation	SNP	ENST00000307068.4	37	CCDS5360.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810873	0.70797	.	.	ENSG00000171243	ENST00000307068;ENST00000396652	T;T	0.63744	-0.06;-0.06	5.71	5.71	0.89125	Cystine knot, C-terminal (1);	0.105462	0.64402	D	0.000006	T	0.77658	0.4163	L	0.57536	1.79	0.58432	D	0.999997	D;P	0.76494	0.999;0.8	D;P	0.75020	0.985;0.525	T	0.77970	-0.2387	10	0.66056	D	0.02	-11.0461	19.8677	0.96824	0.0:1.0:0.0:0.0	.	143;119	A8MUA6;Q6X4U4	.;SOSD1_HUMAN	R	119;143	ENSP00000304930:G119R;ENSP00000379889:G143R	ENSP00000304930:G119R	G	-	1	0	SOSTDC1	16468964	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.770000	0.68873	2.709000	0.92574	0.655000	0.94253	GGA		0.582	SOSTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207603.1	NM_015464		Missense_Mutation
SPDEF	25803	hgsc.bcm.edu	37	6	34507169	34507169	+	Silent	SNP	C	C	A	rs374206315		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:34507169C>A	ENST00000374037.3	-	5	1101	c.687G>T	c.(685-687)tcG>tcT	p.S229S	SPDEF_ENST00000544425.1_Silent_p.S213S	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	229					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						CCTCACTGGTCGAGGCTGGGT	0.672																																																0			6											80.0	76.0	77.0					6																	34507169		2203	4300	6503	34615147	SO:0001819	synonymous_variant	25803			AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.687G>T	6.37:g.34507169C>A			34615147	B4DWH8|F5H778	Silent	SNP	ENST00000374037.3	37	CCDS4794.1	SNP	31	Baylor																																																																																				0.672	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391		Silent
SPDYE4	388333	hgsc.bcm.edu	37	17	8661674	8661682	+	In_Frame_Del	DEL	CGGGGGGCG	CGGGGGGCG	-	rs528196076|rs571433068|rs371237439	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	CGGGGGGCG	CGGGGGGCG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:8661674_8661682delCGGGGGGCG	ENST00000328794.6	-	1	195_203	c.19_27delCGCCCCCCG	c.(19-27)cgccccccgdel	p.RPP7del		NM_001128076.1	NP_001121548.1	A6NLX3	SPDE4_HUMAN	speedy/RINGO cell cycle regulator family member E4	7										breast(1)|endometrium(2)|kidney(1)	4						CCTCCTCAAACGGGGGGCGCGCTTGACCA	0.569																																																0			17																																								8602407	SO:0001651	inframe_deletion	388333			BC146949	CCDS45609.1	17p13.1	2013-05-08	2013-05-08			ENSG00000183318		"""Speedy homologs"""	35463	protein-coding gene	gene with protein product			"""speedy homolog E4 (Xenopus laevis)"""				Standard	NM_001128076		Approved		uc010cnz.1	A6NLX3		ENST00000328794.6:c.19_27delCGCCCCCCG	17.37:g.8661674_8661682delCGGGGGGCG	ENSP00000329522:p.Arg7_Pro9del		8602399	B2RUZ6	In_Frame_Del	DEL	ENST00000328794.6	37	CCDS45609.1	DEL	19	Baylor																																																																																				0.569	SPDYE4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442494.1	NM_001128076		In_Frame_Del
SPG11	80208	hgsc.bcm.edu	37	15	44912464	44912464	+	Silent	SNP	G	G	A	rs200338880		TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr15:44912464G>A	ENST00000261866.7	-	15	2774	c.2758C>T	c.(2758-2760)Ctg>Ttg	p.L920L	SPG11_ENST00000427534.2_Silent_p.L920L|SPG11_ENST00000535302.2_Silent_p.L920L|SPG11_ENST00000558319.1_Silent_p.L920L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	920					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.L920L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TCAACAGTCAGAAGGGGCCAT	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		15682	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15											144.0	131.0	136.0					15																	44912464		2198	4298	6496	42699756	SO:0001819	synonymous_variant	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.2758C>T	15.37:g.44912464G>A			42699756	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1	SNP	33	Baylor																																																																																				0.378	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1			Silent
SVEP1	79987	hgsc.bcm.edu	37	9	113169539	113169539	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:113169539C>T	ENST00000401783.2	-	38	8677	c.8341G>A	c.(8341-8343)Gtc>Atc	p.V2781I	SVEP1_ENST00000297826.5_Missense_Mutation_p.V707I|SVEP1_ENST00000374469.1_Missense_Mutation_p.V2758I	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2781	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.V2784I(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCATTCATGACTGGATTTGGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	9											118.0	118.0	118.0					9																	113169539		2040	4190	6230	112209360	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8341G>A	9.37:g.113169539C>T	ENSP00000384917:p.Val2781Ile		112209360	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.277976	0.00254	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.63580	-0.05;-0.05;-0.05	5.47	-10.9	0.00192	Complement control module (2);Sushi/SCR/CCP (3);	0.613800	0.16396	N	0.216256	T	0.21267	0.0512	N	0.01515	-0.825	0.23607	N	0.997306	B	0.09022	0.002	B	0.06405	0.002	T	0.20672	-1.0268	10	0.02654	T	1	.	12.9611	0.58458	0.0:0.1655:0.3244:0.5102	.	2781	Q4LDE5	SVEP1_HUMAN	I	2781;2758;707;453	ENSP00000384917:V2781I;ENSP00000363593:V2758I;ENSP00000297826:V707I	ENSP00000297826:V707I	V	-	1	0	SVEP1	112209360	0.000000	0.05858	0.000000	0.03702	0.354000	0.29330	-2.165000	0.01274	-3.197000	0.00218	-2.016000	0.00434	GTC		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
SVEP1	79987	hgsc.bcm.edu	37	9	113241982	113241982	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:113241982G>C	ENST00000401783.2	-	13	2756	c.2420C>G	c.(2419-2421)gCt>gGt	p.A807G	SVEP1_ENST00000302728.8_Missense_Mutation_p.A807G|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.A784G|SVEP1_ENST00000374461.1_Missense_Mutation_p.A784G	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	807					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.A807G(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATCACAACGAGCTGCTTTGTA	0.383																																																1	Substitution - Missense(1)	ovary(1)	9											236.0	226.0	229.0					9																	113241982		1844	4094	5938	112281803	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2420C>G	9.37:g.113241982G>C	ENSP00000384917:p.Ala807Gly		112281803	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922264	0.73213	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.76709	-0.9;-0.91;-1.04;1.32	5.62	5.62	0.85841	.	0.103647	0.64402	D	0.000003	T	0.62196	0.2408	N	0.03608	-0.345	0.33416	D	0.579255	B;B;B	0.22211	0.005;0.002;0.066	B;B;B	0.24394	0.003;0.002;0.053	T	0.67348	-0.5693	10	0.59425	D	0.04	.	19.251	0.93925	0.0:0.0:1.0:0.0	.	807;807;807	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	G	807;784;807;784	ENSP00000384917:A807G;ENSP00000363593:A784G;ENSP00000304118:A807G;ENSP00000363585:A784G	ENSP00000304118:A807G	A	-	2	0	SVEP1	112281803	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.093000	0.94163	2.646000	0.89796	0.557000	0.71058	GCT		0.383	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
TBC1D7	51256	hgsc.bcm.edu	37	6	13321193	13321193	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:13321193G>A	ENST00000379300.3	-	4	571	c.328C>T	c.(328-330)Cgc>Tgc	p.R110C	TBC1D7_ENST00000607658.1_Missense_Mutation_p.R83C|TBC1D7_ENST00000343141.4_Missense_Mutation_p.R110C|TBC1D7_ENST00000607532.1_5'UTR|TBC1D7_ENST00000356436.4_Missense_Mutation_p.R110C|TBC1D7_ENST00000379307.2_Missense_Mutation_p.R83C	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	110	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.R110C(2)|p.R110S(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			TGATACATGCGGAGATAGACT	0.488																																																3	Substitution - Missense(3)	ovary(1)|lung(1)|large_intestine(1)	6											254.0	219.0	231.0					6																	13321193		2203	4300	6503	13429172	SO:0001583	missense	51256			AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.328C>T	6.37:g.13321193G>A	ENSP00000368602:p.Arg110Cys		13429172	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Missense_Mutation	SNP	ENST00000379300.3	37	CCDS4523.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122642	0.77436	.	.	ENSG00000145979	ENST00000334971;ENST00000421203;ENST00000356436;ENST00000379300;ENST00000379307;ENST00000343141;ENST00000452989;ENST00000450347;ENST00000422136;ENST00000446018;ENST00000420456;ENST00000428109;ENST00000416436;ENST00000379291	T;T;T;T;T;T;T;T;T;T;T;T;T	0.47528	2.15;2.15;2.15;1.41;1.44;1.41;1.41;2.15;1.45;1.45;2.15;2.15;0.84	5.85	4.94	0.65067	Rab-GAP/TBC domain (1);	0.185905	0.64402	D	0.000012	T	0.56262	0.1973	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D	0.89917	0.992;0.983;0.99;0.992;1.0	P;P;P;P;D	0.73380	0.785;0.707;0.53;0.785;0.98	T	0.62737	-0.6791	10	0.59425	D	0.04	-3.4931	10.0087	0.41972	0.1598:0.0:0.8402:0.0	.	110;83;83;83;110	Q2TU37;Q5JPB9;Q5SZL5;Q9P0N9-2;Q9P0N9	.;.;.;.;TBCD7_HUMAN	C	51;110;110;110;83;110;83;83;110;83;83;110;110;110	ENSP00000401438:R110C;ENSP00000348813:R110C;ENSP00000368602:R110C;ENSP00000368609:R83C;ENSP00000343100:R110C;ENSP00000414292:R83C;ENSP00000404680:R83C;ENSP00000394425:R110C;ENSP00000417005:R83C;ENSP00000412102:R83C;ENSP00000414101:R110C;ENSP00000401339:R110C;ENSP00000368593:R110C	ENSP00000334212:R51C	R	-	1	0	TBC1D7	13429172	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	5.390000	0.66261	1.385000	0.46445	0.555000	0.69702	CGC		0.488	TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039896.2	NM_016495		Missense_Mutation
SYNE1	23345	hgsc.bcm.edu	37	6	152639315	152639315	+	Silent	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:152639315G>T	ENST00000367255.5	-	86	17074	c.16473C>A	c.(16471-16473)ggC>ggA	p.G5491G	SYNE1_ENST00000356820.4_Silent_p.G15G|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Silent_p.G5491G|SYNE1_ENST00000448038.1_Silent_p.G5420G|SYNE1_ENST00000423061.1_Silent_p.G5420G	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5491					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.G5491G(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACCCAGTTGGCCATTCTGTT	0.448										HNSCC(10;0.0054)																																						2	Substitution - coding silent(2)	ovary(2)	6											202.0	176.0	185.0					6																	152639315		2203	4300	6503	152681008	SO:0001819	synonymous_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16473C>A	6.37:g.152639315G>T			152681008	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2	SNP	42	Baylor																																																																																				0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Silent
TGFBR3	7049	hgsc.bcm.edu	37	1	92224274	92224274	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:92224274G>T	ENST00000525962.1	-	3	341	c.280C>A	c.(280-282)Cac>Aac	p.H94N	TGFBR3_ENST00000468996.2_5'UTR|TGFBR3_ENST00000370399.2_Missense_Mutation_p.H94N|TGFBR3_ENST00000212355.4_Missense_Mutation_p.H94N			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	94					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.H94N(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TGGTGGATGTGGACTGAGGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											159.0	136.0	144.0					1																	92224274		2203	4300	6503	91996862	SO:0001583	missense	7049			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.280C>A	1.37:g.92224274G>T	ENSP00000436127:p.His94Asn		91996862	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.81	2.346795	0.41599	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.5	4.59	0.56863	.	0.332241	0.36628	N	0.002495	T	0.15349	0.0370	L	0.60455	1.87	0.42057	D	0.991147	P;P	0.37914	0.493;0.611	B;B	0.41813	0.367;0.354	T	0.04551	-1.0943	10	0.08179	T	0.78	-11.6316	10.7234	0.46052	0.1459:0.0:0.8541:0.0	.	94;94	Q03167-2;Q03167	.;TGBR3_HUMAN	N	94	ENSP00000212355:H94N;ENSP00000359426:H94N;ENSP00000436127:H94N;ENSP00000432638:H94N	ENSP00000212355:H94N	H	-	1	0	TGFBR3	91996862	0.857000	0.29778	0.993000	0.49108	0.861000	0.49209	1.083000	0.30815	1.334000	0.45468	0.561000	0.74099	CAC		0.522	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243		Missense_Mutation
TCHHL1	126637	hgsc.bcm.edu	37	1	152059235	152059235	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1338-01	TCGA-04-1338-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:152059235T>A	ENST00000368806.1	-	3	987	c.923A>T	c.(922-924)gAa>gTa	p.E308V		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	308							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			AGCAGCTTGTTCTGGCAGGTC	0.448																																																0			1											224.0	216.0	219.0					1																	152059235		2203	4300	6503	150325859	SO:0001583	missense	126637				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.923A>T	1.37:g.152059235T>A	ENSP00000357796:p.Glu308Val		150325859	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	37	CCDS30857.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	.	4.350	0.064382	0.08388	.	.	ENSG00000182898	ENST00000368806	T	0.22945	1.93	5.95	0.826	0.18829	.	0.471000	0.16174	N	0.226170	T	0.04048	0.0113	L	0.31664	0.95	0.09310	N	1	P	0.44090	0.826	B	0.35114	0.196	T	0.29181	-1.0020	10	0.31617	T	0.26	-1.8667	2.3135	0.04192	0.1436:0.0914:0.3767:0.3882	.	308	Q5QJ38	TCHL1_HUMAN	V	308	ENSP00000357796:E308V	ENSP00000357796:E308V	E	-	2	0	TCHHL1	150325859	0.000000	0.05858	0.002000	0.10522	0.105000	0.19272	0.308000	0.19314	0.119000	0.18210	0.524000	0.50904	GAA		0.448	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104		Missense_Mutation
TMEM33	55161	hgsc.bcm.edu	37	4	41956173	41956173	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:41956173A>C	ENST00000504986.1	+	7	1066	c.701A>C	c.(700-702)cAg>cCg	p.Q234P	TMEM33_ENST00000325094.5_Missense_Mutation_p.Q234P|TMEM33_ENST00000513702.1_Missense_Mutation_p.Q234P	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	234						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)		p.Q234P(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						CTTTGTCTCCAGAGCATTGCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											151.0	143.0	146.0					4																	41956173		2203	4300	6503	41650930	SO:0001583	missense	55161			BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.701A>C	4.37:g.41956173A>C	ENSP00000422473:p.Gln234Pro		41650930	B3KSS8|Q9H953	Missense_Mutation	SNP	ENST00000504986.1	37	CCDS3464.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.836	1.189706	0.21954	.	.	ENSG00000109133	ENST00000504986;ENST00000513702;ENST00000325094	.	.	.	5.43	5.43	0.79202	.	0.360761	0.32328	N	0.006255	T	0.27629	0.0679	N	0.14661	0.345	0.34147	D	0.667096	B	0.14012	0.009	B	0.17979	0.02	T	0.30707	-0.9969	9	0.33940	T	0.23	-9.4065	5.8391	0.18623	0.7913:0.0:0.2087:0.0	.	234	P57088	TMM33_HUMAN	P	234	.	ENSP00000441455:Q234P	Q	+	2	0	TMEM33	41650930	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.351000	0.44071	2.068000	0.61886	0.383000	0.25322	CAG		0.368	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2	NM_018126		Missense_Mutation
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74905203	74905203	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:74905203C>T	ENST00000370899.3	+	22	2248	c.2211C>T	c.(2209-2211)ttC>ttT	p.F737F	TNNI3K_ENST00000370891.2_Silent_p.F737F|TNNI3K_ENST00000326637.3_Silent_p.F636F|FPGT-TNNI3K_ENST00000557284.2_Silent_p.F750F	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.F636F(1)									CTGAGGTGTTCACGCAGTGCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	1											165.0	136.0	146.0					1																	74905203		2203	4300	6503	74677791	SO:0001819	synonymous_variant	51086					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.2211C>T	1.37:g.74905203C>T			74677791		Silent	SNP	ENST00000370899.3	37		SNP	29	Baylor																																																																																				0.483	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3			Silent
CELF3	11189	hgsc.bcm.edu	37	1	151681510	151681510	+	Silent	SNP	C	C	T	rs139969209		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:151681510C>T	ENST00000290583.4	-	5	1243	c.450G>A	c.(448-450)gcG>gcA	p.A150A	RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|RIIAD1_ENST00000326413.3_5'Flank|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000290585.4_Silent_p.A150A	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	150	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A150A(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						TGTTGATGGCCGCCTGGGCCT	0.692																																																1	Substitution - coding silent(1)	ovary(1)	1						C	,,	1,4405		0,1,2202	76.0	81.0	79.0		309,450,450	-8.5	1.0	1	dbSNP_134	79	2,8598		0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CELF3	NM_001172648.1,NM_001172649.1,NM_007185.4	,,	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	,,	103/419,150/416,150/466	151681510	3,13003	2203	4300	6503	149948134	SO:0001819	synonymous_variant	11189			U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.450G>A	1.37:g.151681510C>T			149948134	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	CCDS1002.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	.	10.07	1.249938	0.22880	2.27E-4	2.33E-4	ENSG00000159409	ENST00000420342	.	.	.	4.26	-8.52	0.00920	.	.	.	.	.	T	0.18676	0.0448	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44483	-0.9325	4	.	.	.	-7.3298	2.3118	0.04188	0.1312:0.3832:0.1211:0.3645	.	.	.	.	Q	151	.	.	R	-	2	0	CELF3	149948134	0.000000	0.05858	0.957000	0.39632	0.857000	0.48899	-4.705000	0.00196	-1.098000	0.03038	-1.724000	0.00704	CGG		0.692	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185		Silent
TP53	7157	hgsc.bcm.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser		7518273	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRIM21	6737	hgsc.bcm.edu	37	11	4408208	4408208	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:4408208C>G	ENST00000254436.7	-	5	860	c.748G>C	c.(748-750)Gtc>Ctc	p.V250L	TRIM21_ENST00000543625.1_Intron	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	250					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V250L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		CTTTCCAGGACAATTATCACC	0.448																																																1	Substitution - Missense(1)	ovary(1)	11											77.0	71.0	73.0					11																	4408208		1926	4138	6064	4364784	SO:0001583	missense	6737			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.748G>C	11.37:g.4408208C>G	ENSP00000254436:p.Val250Leu		4364784	Q5XPV5|Q96RF8	Missense_Mutation	SNP	ENST00000254436.7	37	CCDS44525.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701535	0.30142	.	.	ENSG00000132109	ENST00000254436	T	0.05081	3.5	4.04	1.95	0.26073	.	.	.	.	.	T	0.05364	0.0142	L	0.35723	1.085	0.50467	D	0.999879	B	0.02656	0.0	B	0.04013	0.001	T	0.27739	-1.0065	9	0.72032	D	0.01	.	5.1844	0.15176	0.0:0.6791:0.0:0.3209	.	250	P19474	RO52_HUMAN	L	250	ENSP00000254436:V250L	ENSP00000254436:V250L	V	-	1	0	TRIM21	4364784	0.053000	0.20554	0.699000	0.30290	0.985000	0.73830	-0.209000	0.09358	0.528000	0.28580	0.655000	0.94253	GTC		0.448	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141		Missense_Mutation
TRPV3	162514	hgsc.bcm.edu	37	17	3427614	3427614	+	Silent	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr17:3427614A>G	ENST00000576742.1	-	13	1942	c.1621T>C	c.(1621-1623)Ttg>Ctg	p.L541L	TRPV3_ENST00000572519.1_Silent_p.L541L|TRPV3_ENST00000301365.4_Silent_p.L541L	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	541					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.L541L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	TAGGCAAACAAGTACAAGAAG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	17											118.0	107.0	111.0					17																	3427614		2203	4300	6503	3374364	SO:0001819	synonymous_variant	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1621T>C	17.37:g.3427614A>G			3374364	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1	SNP	3	Baylor																																																																																				0.527	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		Silent
TTN	7273	hgsc.bcm.edu	37	2	179435114	179435114	+	Missense_Mutation	SNP	G	G	T	rs397517702	byFrequency	TCGA-04-1338-01	TCGA-04-1338-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:179435114G>T	ENST00000591111.1	-	276	71046	c.70822C>A	c.(70822-70824)Cgc>Agc	p.R23608S	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16309S|TTN_ENST00000460472.2_Missense_Mutation_p.R16184S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16376S|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22681S|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25249S|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23608	Fibronectin type-III 71. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R22679S(1)|p.R16184S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAACTAAGCGGCTGGTTTCT	0.438																																																2	Substitution - Missense(2)	ovary(2)	2											54.0	51.0	52.0					2																	179435114		1922	4130	6052	179143360	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70822C>A	2.37:g.179435114G>T	ENSP00000465570:p.Arg23608Ser		179143360	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477687	0.26511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.57	4.69	0.59074	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65428	0.2690	L	0.41027	1.25	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.69573	-0.5109	9	0.87932	D	0	.	16.3452	0.83126	0.0:0.0:0.8672:0.1328	.	16184;16309;16376;23608	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	22681;16184;16376;16309;16182	ENSP00000343764:R22681S;ENSP00000434586:R16184S;ENSP00000340554:R16376S;ENSP00000352154:R16309S	ENSP00000340554:R16376S	R	-	1	0	TTN	179143360	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	3.307000	0.51888	1.454000	0.47793	0.650000	0.86243	CGC		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TULP2	7288	hgsc.bcm.edu	37	19	49385314	49385314	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr19:49385314G>T	ENST00000221399.3	-	12	1566	c.1422C>A	c.(1420-1422)aaC>aaA	p.N474K		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	474					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.N474K(1)		NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CGATTTGGAAGTTCTTCACCG	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	113.0	122.0					19																	49385314		2203	4300	6503	54077126	SO:0001583	missense	7288			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1422C>A	19.37:g.49385314G>T	ENSP00000221399:p.Asn474Lys		54077126	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583227	0.46006	.	.	ENSG00000104804	ENST00000221399;ENST00000522341	D;D	0.95885	-3.84;-3.84	4.62	3.45	0.39498	Tubby, C-terminal (4);Tubby, C-terminal, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97851	0.9294	H	0.94886	3.595	0.50632	D	0.999886	D	0.89917	1.0	D	0.97110	1.0	D	0.97280	0.9917	10	0.87932	D	0	-38.4452	7.1723	0.25724	0.2184:0.0:0.7816:0.0	.	474	O00295	TULP2_HUMAN	K	474;23	ENSP00000221399:N474K;ENSP00000429131:N23K	ENSP00000221399:N474K	N	-	3	2	TULP2	54077126	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	0.895000	0.28363	1.145000	0.42336	0.650000	0.86243	AAC		0.542	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323		Missense_Mutation
UBAP2	55833	hgsc.bcm.edu	37	9	33927935	33927935	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr9:33927935G>C	ENST00000379238.1	-	20	2348	c.2231C>G	c.(2230-2232)gCa>gGa	p.A744G	UBAP2_ENST00000360802.1_Missense_Mutation_p.A744G|UBAP2_ENST00000379239.4_Missense_Mutation_p.A477G|UBAP2_ENST00000379235.1_5'UTR|UBAP2_ENST00000418786.2_Missense_Mutation_p.Q669E|UBAP2_ENST00000449054.1_Missense_Mutation_p.A744G|UBAP2_ENST00000539807.1_Missense_Mutation_p.A499G					ubiquitin associated protein 2									p.A744G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GGAGGTCGCTGCCGTGGAGAA	0.617																																																1	Substitution - Missense(1)	ovary(1)	9											83.0	73.0	76.0					9																	33927935		2203	4300	6503	33917935	SO:0001583	missense	55833			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.2231C>G	9.37:g.33927935G>C	ENSP00000368540:p.Ala744Gly		33917935		Missense_Mutation	SNP	ENST00000379238.1	37	CCDS6547.1	SNP	46	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.92|12.92	2.082009|2.082009	0.36758|0.36758	.|.	.|.	ENSG00000137073|ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379239;ENST00000539807;ENST00000351580|ENST00000418786	T;T;T;T;T|T	0.37584|0.18502	1.19;1.19;1.19;1.19;1.19|2.21	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.481291|.	0.24249|.	N|.	0.040188|.	T|T	0.19287|0.19287	0.0463|0.0463	M|M	0.67953|0.67953	2.075|2.075	0.20196|0.20196	N|N	0.999924|0.999924	P;B;B;B;P|B	0.38827|0.32467	0.649;0.421;0.421;0.421;0.518|0.372	B;B;B;B;B|B	0.37601|0.27796	0.254;0.254;0.254;0.254;0.129|0.083	T|T	0.48658|0.48658	-0.9016|-0.9016	10|9	0.42905|0.02654	T|T	0.14|1	-7.4298|-7.4298	19.1371|19.1371	0.93431|0.93431	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	669;499;477;653;744|669	F5H4D5;F5H2U4;A6NCA8;F5H2C8;Q5T6F2|E7EWG4	.;.;.;.;UBAP2_HUMAN|.	G|E	744;744;744;653;477;499;180|669	ENSP00000368540:A744G;ENSP00000416932:A744G;ENSP00000354039:A744G;ENSP00000368541:A477G;ENSP00000439329:A499G|ENSP00000404436:Q669E	ENSP00000259602:A180G|ENSP00000404436:Q669E	A|Q	-|-	2|1	0|0	UBAP2|UBAP2	33917935|33917935	0.980000|0.980000	0.34600|0.34600	0.067000|0.067000	0.19924|0.19924	0.026000|0.026000	0.11368|0.11368	5.549000|5.549000	0.67261|0.67261	2.622000|2.622000	0.88805|0.88805	0.655000|0.655000	0.94253|0.94253	GCA|CAG		0.617	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449		Missense_Mutation
UIMC1	51720	hgsc.bcm.edu	37	5	176395727	176395727	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr5:176395727A>C	ENST00000377227.4	-	6	1161	c.1029T>G	c.(1027-1029)agT>agG	p.S343R	UIMC1_ENST00000506128.1_Intron|UIMC1_ENST00000511320.1_Missense_Mutation_p.S343R|UIMC1_ENST00000377219.2_Missense_Mutation_p.S343R|UIMC1_ENST00000503273.1_5'UTR			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	343	AIR.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.S343R(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CATTTTTCTCACTAGCCTGCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	5											145.0	138.0	140.0					5																	176395727		2203	4300	6503	176328333	SO:0001583	missense	51720			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.1029T>G	5.37:g.176395727A>C	ENSP00000366434:p.Ser343Arg		176328333	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	CCDS4408.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.84	2.655234	0.47467	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000377220	T;T;T	0.30981	1.51;1.51;1.51	5.47	4.25	0.50352	.	0.140479	0.51477	D	0.000093	T	0.43678	0.1258	L	0.54323	1.7	0.31433	N	0.672848	D;D	0.69078	0.984;0.997	P;D	0.65773	0.77;0.938	T	0.50874	-0.8776	10	0.66056	D	0.02	.	7.1101	0.25386	0.7735:0.0:0.0824:0.1441	.	343;265	Q96RL1;Q96RL1-3	UIMC1_HUMAN;.	R	343;343;343;265	ENSP00000366434:S343R;ENSP00000366425:S343R;ENSP00000421926:S343R	ENSP00000366425:S343R	S	-	3	2	UIMC1	176328333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.264000	0.33015	2.293000	0.77203	0.528000	0.53228	AGT		0.463	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290		Missense_Mutation
UNC5B	219699	hgsc.bcm.edu	37	10	73047432	73047432	+	Missense_Mutation	SNP	C	C	T	rs149211819		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr10:73047432C>T	ENST00000335350.6	+	6	1227	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	UNC5B_ENST00000373192.4_Missense_Mutation_p.R271W	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	271	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.R271W(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GAAGCGCACCCGGACCTGCAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	10							TRP/ARG	0,4406		0,0,2203	72.0	71.0	72.0		811	3.1	0.6	10	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense	UNC5B	NM_170744.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	271/946	73047432	1,13005	2203	4300	6503	72717438	SO:0001583	missense	219699			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.811C>T	10.37:g.73047432C>T	ENSP00000334329:p.Arg271Trp		72717438	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	c	20.6	4.022727	0.75275	0.0	1.16E-4	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.65732	-0.17;-0.17	5.02	3.09	0.35607	.	0.000000	0.85682	D	0.000000	D	0.87763	0.6259	H	0.99609	4.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90809	0.4700	10	0.87932	D	0	-33.0732	12.9142	0.58197	0.4168:0.5832:0.0:0.0	.	271;271	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	W	271	ENSP00000334329:R271W;ENSP00000362288:R271W	ENSP00000334329:R271W	R	+	1	2	UNC5B	72717438	0.979000	0.34478	0.566000	0.28421	0.998000	0.95712	2.473000	0.45145	0.476000	0.27440	0.537000	0.68136	CGG		0.662	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		Missense_Mutation
USP34	9736	hgsc.bcm.edu	37	2	61438975	61438975	+	Missense_Mutation	SNP	G	G	C	rs200995448		TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:61438975G>C	ENST00000398571.2	-	69	8848	c.8772C>G	c.(8770-8772)ttC>ttG	p.F2924L	USP34_ENST00000472689.1_5'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2924					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.F2924L(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTGTTTTCTTGAACTGTTTAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											102.0	95.0	97.0					2																	61438975		1848	4085	5933	61292479	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8772C>G	2.37:g.61438975G>C	ENSP00000381577:p.Phe2924Leu		61292479	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	SNP	45	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.393590|4.393590	0.83011|0.83011	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571|ENST00000411912	T|.	0.63417|.	-0.04|.	6.06|6.06	4.92|4.92	0.64577|0.64577	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62768|0.62768	0.2455|0.2455	L|L	0.61218|0.61218	1.895|1.895	0.58432|0.58432	D|D	0.999996|0.999996	P|.	0.49447|.	0.924|.	P|.	0.60682|.	0.878|.	T|T	0.60606|0.60606	-0.7230|-0.7230	10|5	0.72032|.	D|.	0.01|.	.|.	9.5156|9.5156	0.39104|0.39104	0.8569:0.0:0.1431:0.0|0.8569:0.0:0.1431:0.0	.|.	2924|.	Q70CQ2|.	UBP34_HUMAN|.	L|E	2772;2772;2924|684	ENSP00000381577:F2924L|.	ENSP00000263989:F2772L|.	F|Q	-|-	3|1	2|0	USP34|USP34	61292479|61292479	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.429000|2.429000	0.44758|0.44758	1.123000|1.123000	0.41961|0.41961	-0.312000|-0.312000	0.09012|0.09012	TTC|CAA		0.358	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			Missense_Mutation
USP34	9736	hgsc.bcm.edu	37	2	61575538	61575538	+	Silent	SNP	C	C	A			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:61575538C>A	ENST00000398571.2	-	15	1828	c.1752G>T	c.(1750-1752)ggG>ggT	p.G584G		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	584					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G584G(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CATCACTATGCCCACTACTGC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	2											130.0	131.0	131.0					2																	61575538		2091	4222	6313	61429042	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.1752G>T	2.37:g.61575538C>A			61429042	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	SNP	26	Baylor																																																																																				0.473	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			Silent
USP47	55031	hgsc.bcm.edu	37	11	11964115	11964115	+	Silent	SNP	G	G	A			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:11964115G>A	ENST00000399455.2	+	21	2727	c.2607G>A	c.(2605-2607)gtG>gtA	p.V869V	USP47_ENST00000527733.1_Silent_p.V849V|USP47_ENST00000339865.5_Silent_p.V781V|USP47_ENST00000539466.1_5'UTR	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	869					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)	p.V781V(1)		breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TAAAGTCTGTGGAAGCTATTC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	11											65.0	63.0	64.0					11																	11964115		1887	4104	5991	11920691	SO:0001819	synonymous_variant	55031			AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.2607G>A	11.37:g.11964115G>A			11920691	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Silent	SNP	ENST00000399455.2	37		SNP	47	Baylor																																																																																				0.443	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944		Silent
VPS52	6293	hgsc.bcm.edu	37	6	33219350	33219350	+	Missense_Mutation	SNP	C	C	T	rs537285931		TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr6:33219350C>T	ENST00000445902.2	-	19	2188	c.1970G>A	c.(1969-1971)aGt>aAt	p.S657N	VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000478934.1_5'UTR|HCG25_ENST00000450514.1_RNA|HCG25_ENST00000422366.1_RNA|HCG25_ENST00000442228.1_RNA|VPS52_ENST00000436044.2_Missense_Mutation_p.S532N|HCG25_ENST00000427196.1_RNA	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	657					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.S657N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TACATCCTGACTCAGAGATTC	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		19072	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	6											154.0	140.0	145.0					6																	33219350		2203	4300	6503	33327328	SO:0001583	missense	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1970G>A	6.37:g.33219350C>T	ENSP00000409952:p.Ser657Asn		33327328	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625703	0.46840	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	4.26	4.26	0.50523	.	0.041393	0.85682	D	0.000000	T	0.17874	0.0429	N	0.03194	-0.395	0.80722	D	1	B;B	0.15719	0.014;0.0	B;B	0.11329	0.006;0.0	T	0.07424	-1.0773	9	0.15952	T	0.53	-11.8324	14.9869	0.71356	0.0:1.0:0.0:0.0	.	468;657	B3KMF7;Q8N1B4	.;VPS52_HUMAN	N	657;635;532	.	ENSP00000414785:S635N	S	-	2	0	VPS52	33327328	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.111000	0.71541	2.669000	0.90835	0.551000	0.68910	AGT		0.498	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553		Missense_Mutation
VWCE	220001	hgsc.bcm.edu	37	11	61053805	61053805	+	Silent	SNP	G	G	T	rs574658486		TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr11:61053805G>T	ENST00000335613.5	-	5	908	c.522C>A	c.(520-522)gcC>gcA	p.A174A		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	174	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.A174A(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGTGGCGGTCGGCAGACAGCT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	100.0	101.0					11																	61053805		2203	4298	6501	60810381	SO:0001819	synonymous_variant	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.522C>A	11.37:g.61053805G>T			60810381	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1	SNP	39	Baylor																																																																																				0.592	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718		Silent
WBP1	23559	hgsc.bcm.edu	37	2	74685792	74685792	+	Silent	SNP	A	A	G			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr2:74685792A>G	ENST00000233615.2	+	1	337	c.63A>G	c.(61-63)caA>caG	p.Q21Q	WBP1_ENST00000494741.1_3'UTR|WBP1_ENST00000409737.1_Silent_p.Q21Q|WBP1_ENST00000393972.3_Silent_p.Q21Q	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	21							WW domain binding (GO:0050699)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						GGGCGCCGCAACAGCAGGTAT	0.622																																																0			2											27.0	28.0	27.0					2																	74685792		2179	4265	6444	74539300	SO:0001819	synonymous_variant	23559			U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	ENST00000233615.2:c.63A>G	2.37:g.74685792A>G			74539300	B2RE02|O95637	Silent	SNP	ENST00000233615.2	37	CCDS1943.1	SNP	2	Baylor																																																																																				0.622	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252221.2	NM_012477		Silent
WDR88	126248	hgsc.bcm.edu	37	19	33628661	33628661	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr19:33628661A>T	ENST00000355868.3	+	2	431	c.355A>T	c.(355-357)Agt>Tgt	p.S119C	WDR88_ENST00000592765.1_Missense_Mutation_p.S119C|WDR88_ENST00000361680.2_Missense_Mutation_p.S119C	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	119								p.S119C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					AAAGCTCCTCAGTGGCTCCTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	19											99.0	86.0	91.0					19																	33628661		2203	4300	6503	38320501	SO:0001583	missense	126248			BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.355A>T	19.37:g.33628661A>T	ENSP00000348129:p.Ser119Cys		38320501	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.68	3.676009	0.67928	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.72394	-0.65;-0.65	5.07	4.02	0.46733	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	38.871000	0.00166	N	0.000000	D	0.87977	0.6314	M	0.92784	3.345	0.26204	N	0.979402	D	0.89917	1.0	D	0.77004	0.989	T	0.60326	-0.7285	10	0.62326	D	0.03	.	6.9823	0.24709	0.6951:0.0:0.0:0.3049	.	119	Q6ZMY6	WDR88_HUMAN	C	119	ENSP00000348129:S119C;ENSP00000355148:S119C	ENSP00000348129:S119C	S	+	1	0	WDR88	38320501	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.395000	0.44459	1.922000	0.55676	0.454000	0.30748	AGT		0.522	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479		Missense_Mutation
WFDC1	58189	hgsc.bcm.edu	37	16	84358028	84358028	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr16:84358028G>T	ENST00000219454.5	+	5	892	c.566G>T	c.(565-567)gGg>gTg	p.G189V	WFDC1_ENST00000568638.1_Missense_Mutation_p.G189V	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	189					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G189V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						TTTCCAGATGGGCGAATCCTA	0.363																																																1	Substitution - Missense(1)	ovary(1)	16											111.0	107.0	109.0					16																	84358028		2200	4300	6500	82915529	SO:0001583	missense	58189			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.566G>T	16.37:g.84358028G>T	ENSP00000219454:p.Gly189Val		82915529	D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	ENST00000219454.5	37	CCDS10946.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411436	0.25465	.	.	ENSG00000103175	ENST00000219454	T	0.40225	1.04	4.55	3.59	0.41128	.	0.062472	0.64402	D	0.000005	T	0.49355	0.1552	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.65773	0.938	T	0.51826	-0.8656	10	0.72032	D	0.01	-24.6957	11.721	0.51683	0.087:0.0:0.913:0.0	.	189	Q9HC57	WFDC1_HUMAN	V	189	ENSP00000219454:G189V	ENSP00000219454:G189V	G	+	2	0	WFDC1	82915529	1.000000	0.71417	0.840000	0.33206	0.306000	0.27790	3.823000	0.55715	1.272000	0.44329	0.650000	0.86243	GGG		0.363	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269083.2			Missense_Mutation
WHSC1	7468	hgsc.bcm.edu	37	4	1962765	1962765	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:1962765G>C	ENST00000382895.3	+	20	3690	c.3259G>C	c.(3259-3261)Gaa>Caa	p.E1087Q	WHSC1_ENST00000508803.1_Missense_Mutation_p.E1087Q|WHSC1_ENST00000382892.2_Missense_Mutation_p.E1087Q|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382891.5_Missense_Mutation_p.E1087Q|WHSC1_ENST00000382888.3_Missense_Mutation_p.E435Q	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1087	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.E1087Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TTTCCAGGGAGAATTTGTTAA	0.517			T	IGH@	MM																																		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	1	Substitution - Missense(1)	ovary(1)	4											261.0	215.0	231.0					4																	1962765		2203	4300	6503	1932563	SO:0001583	missense	7468			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3259G>C	4.37:g.1962765G>C	ENSP00000372351:p.Glu1087Gln		1932563	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844237	0.91197	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.51	5.51	0.81932	SET domain (3);	0.000000	0.53938	D	0.000049	D	0.86802	0.6020	N	0.16656	0.425	0.80722	D	1	B;D	0.89917	0.298;1.0	B;D	0.81914	0.17;0.995	D	0.86178	0.1604	10	0.33141	T	0.24	.	19.4162	0.94700	0.0:0.0:1.0:0.0	.	435;1087	A2A2T2;O96028	.;NSD2_HUMAN	Q	1087;1087;1087;1087;435	ENSP00000423972:E1087Q;ENSP00000372347:E1087Q;ENSP00000372348:E1087Q;ENSP00000372351:E1087Q;ENSP00000372344:E435Q	ENSP00000372344:E435Q	E	+	1	0	WHSC1	1932563	1.000000	0.71417	0.975000	0.42487	0.970000	0.65996	7.789000	0.85783	2.605000	0.88082	0.655000	0.94253	GAA		0.517	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		Missense_Mutation
ZCCHC17	51538	hgsc.bcm.edu	37	1	31811817	31811817	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1338-01	TCGA-04-1338-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr1:31811817G>C	ENST00000373714.1	+	5	500	c.239G>C	c.(238-240)aGa>aCa	p.R80T	ZCCHC17_ENST00000344147.5_Missense_Mutation_p.R80T|RP11-266K22.2_ENST00000430143.1_RNA|ZCCHC17_ENST00000479629.1_3'UTR|ZCCHC17_ENST00000546109.1_Missense_Mutation_p.R72T|ZCCHC17_ENST00000422613.2_Missense_Mutation_p.R56T	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	80	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R80T(1)		breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		AAAAATGATAGAATAAAAGTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	65.0	65.0					1																	31811817		2203	4300	6503	31584404	SO:0001583	missense	51538			AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.239G>C	1.37:g.31811817G>C	ENSP00000362819:p.Arg80Thr		31584404	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	37	CCDS341.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842830	0.71488	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.41	4.43	0.53597	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.042911	0.85682	D	0.000000	T	0.55465	0.1922	M	0.84585	2.705	0.33594	D	0.601468	P;P;P	0.42993	0.682;0.797;0.594	P;P;P	0.48063	0.565;0.495;0.535	T	0.69778	-0.5053	10	0.56958	D	0.05	.	5.4736	0.16684	0.2356:0.0:0.7644:0.0	.	56;72;80	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	T	80;80;72;56	ENSP00000343557:R80T;ENSP00000362819:R80T;ENSP00000444742:R72T;ENSP00000391336:R56T	ENSP00000343557:R80T	R	+	2	0	ZCCHC17	31584404	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.040000	0.70980	2.822000	0.97130	0.557000	0.71058	AGA		0.343	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505		Missense_Mutation
ZNF136	7695	hgsc.bcm.edu	37	19	12296714	12296714	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr19:12296714C>G	ENST00000343979.4	+	2	258	c.118C>G	c.(118-120)Ctg>Gtg	p.L40V	ZNF136_ENST00000398616.2_Intron	NM_003437.3	NP_003428.1	P52737	ZN136_HUMAN	zinc finger protein 136	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.L40V(1)		NS(1)|biliary_tract(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	18						CATGAGGAATCTGGCCTCTAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	76.0	78.0					19																	12296714		2203	4300	6503	12157714	SO:0001583	missense	7695			U09367	CCDS32916.1	19p13.2	2013-01-08	2006-06-13		ENSG00000196646	ENSG00000196646		"""Zinc fingers, C2H2-type"", ""-"""	12920	protein-coding gene	gene with protein product		604078	"""zinc finger protein 136 (clone pHZ-20)"""			7557990	Standard	NM_003437		Approved	pHZ-20	uc002mti.3	P52737	OTTHUMG00000156429	ENST00000343979.4:c.118C>G	19.37:g.12296714C>G	ENSP00000344162:p.Leu40Val		12157714		Missense_Mutation	SNP	ENST00000343979.4	37	CCDS32916.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323994	0.41096	.	.	ENSG00000196646	ENST00000425827;ENST00000343979;ENST00000418338	T;T;T	0.69175	0.27;3.96;-0.38	1.22	0.147	0.14838	Krueppel-associated box (4);	.	.	.	.	T	0.78349	0.4269	M	0.84948	2.725	0.22001	N	0.999423	D	0.69078	0.997	D	0.76071	0.987	T	0.63703	-0.6577	9	0.59425	D	0.04	.	3.5437	0.07820	0.0:0.7313:0.0:0.2687	.	40	P52737	ZN136_HUMAN	V	8;40;8	ENSP00000403707:L8V;ENSP00000344162:L40V;ENSP00000397176:L8V	ENSP00000344162:L40V	L	+	1	2	ZNF136	12157714	0.004000	0.15560	0.632000	0.29296	0.718000	0.41266	0.013000	0.13310	0.090000	0.17273	-0.140000	0.14226	CTG		0.448	ZNF136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344151.2	NM_003437		Missense_Mutation
ZNF185	7739	hgsc.bcm.edu	37	X	152089284	152089284	+	Silent	SNP	C	C	T			TCGA-04-1338-01	TCGA-04-1338-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chrX:152089284C>T	ENST00000370268.4	+	9	682	c.645C>T	c.(643-645)atC>atT	p.I215I	ZNF185_ENST00000318529.8_Silent_p.I53I|ZNF185_ENST00000449285.2_Silent_p.I216I|ZNF185_ENST00000370270.2_Silent_p.I215I|ZNF185_ENST00000535861.1_Silent_p.I215I|ZNF185_ENST00000324823.6_Silent_p.I81I|ZNF185_ENST00000318504.7_Silent_p.I215I|ZNF185_ENST00000539731.1_Silent_p.I215I			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	215						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.I76I(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CACCGTTTATCGCGAAGAGGT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	X											109.0	101.0	104.0					X																	152089284		2057	4170	6227	151839940	SO:0001819	synonymous_variant	7739			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.645C>T	X.37:g.152089284C>T			151839940	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	ENST00000370268.4	37	CCDS48184.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.322	-0.138461	0.06669	.	.	ENSG00000147394	ENST00000426821;ENST00000447088;ENST00000447792	.	.	.	5.38	-5.71	0.02413	.	.	.	.	.	T	0.18467	0.0443	.	.	.	0.27469	N	0.952931	.	.	.	.	.	.	T	0.29971	-0.9994	4	.	.	.	-3.7417	3.2995	0.06978	0.1238:0.4157:0.1248:0.3357	.	.	.	.	C	60;33;12	.	.	R	+	1	0	ZNF185	151839940	0.022000	0.18835	0.028000	0.17463	0.032000	0.12392	-2.083000	0.01364	-0.936000	0.03723	-1.278000	0.01390	CGC		0.577	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150		Silent
ZNF518B	85460	hgsc.bcm.edu	37	4	10445169	10445169	+	Silent	SNP	A	A	C			TCGA-04-1338-01	TCGA-04-1338-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-04-1338-01	TCGA-04-1338-11	g.chr4:10445169A>C	ENST00000326756.3	-	3	3222	c.2784T>G	c.(2782-2784)gcT>gcG	p.A928A		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	928					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A928A(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						GATCTGGCTTAGCTGCTATCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	4											116.0	111.0	113.0					4																	10445169		2203	4300	6503	10054267	SO:0001819	synonymous_variant	85460			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2784T>G	4.37:g.10445169A>C			10054267	Q96LN8	Silent	SNP	ENST00000326756.3	37	CCDS33960.1	SNP	15	Baylor																																																																																				0.458	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		Silent
