#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ARHGEF10L	55160	broad.mit.edu	37	1	17942686	17942686	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:17942686A>T	ENST00000361221.3	+	9	983	c.824A>T	c.(823-825)aAg>aTg	p.K275M	ARHGEF10L_ENST00000167825.4_5'Flank|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.K236M|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.K236M|ARHGEF10L_ENST00000375408.3_5'Flank|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.K33M|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.K275M	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	275						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K275M(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTGCACAGGAAGGACGTCCTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											89.0	75.0	80.0					1																	17942686		2203	4300	6503	17815273	SO:0001583	missense	55160			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.824A>T	1.37:g.17942686A>T	ENSP00000355060:p.Lys275Met		17815273	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	23.9	4.476157	0.84640	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420	T;T;T;T;T	0.65549	0.14;0.24;-0.01;0.24;-0.16	5.19	5.19	0.71726	.	0.062950	0.64402	D	0.000020	T	0.74884	0.3775	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D	0.64830	0.965;0.989;0.973;0.994;0.989;0.989	P;D;P;D;D;P	0.67548	0.779;0.93;0.759;0.952;0.91;0.815	T	0.76517	-0.2930	10	0.52906	T	0.07	-16.5115	12.411	0.55468	1.0:0.0:0.0:0.0	.	33;275;41;236;236;275	B4DTE2;Q9HCE6-5;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;ARGAL_HUMAN	M	275;236;275;236;33	ENSP00000355060:K275M;ENSP00000399401:K236M;ENSP00000394621:K275M;ENSP00000364564:K236M;ENSP00000364569:K33M	ENSP00000355060:K275M	K	+	2	0	ARHGEF10L	17815273	1.000000	0.71417	0.979000	0.43373	0.985000	0.73830	6.552000	0.73914	1.951000	0.56629	0.460000	0.39030	AAG		0.632	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		Missense_Mutation
ASH1L	55870	broad.mit.edu	37	1	155452077	155452077	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:155452077G>A	ENST00000368346.3	-	3	1223	c.584C>T	c.(583-585)aCt>aTt	p.T195I	ASH1L_ENST00000548830.1_3'UTR|ASH1L_ENST00000392403.3_Missense_Mutation_p.T195I			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	195					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.T195I(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ACCAAGAAGAGTAGATGGCGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											147.0	147.0	147.0					1																	155452077		2203	4300	6503	153718701	SO:0001583	missense	55870			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.584C>T	1.37:g.155452077G>A	ENSP00000357330:p.Thr195Ile		153718701	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842374	0.51057	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90197	-2.63;-2.63	3.9	3.9	0.45041	.	0.487586	0.18571	N	0.137357	T	0.76407	0.3983	N	0.14661	0.345	0.80722	D	1	P;P	0.41131	0.622;0.739	B;B	0.38194	0.137;0.267	T	0.82216	-0.0567	10	0.66056	D	0.02	.	13.8348	0.63402	0.0:0.0:1.0:0.0	.	195;195	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	I	195	ENSP00000357330:T195I;ENSP00000376204:T195I	ENSP00000357330:T195I	T	-	2	0	ASH1L	153718701	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	5.133000	0.64764	2.021000	0.59480	0.563000	0.77884	ACT		0.428	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		Missense_Mutation
SEC16B	89866	broad.mit.edu	37	1	177901866	177901866	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:177901866G>C	ENST00000308284.6	-	23	2988	c.2899C>G	c.(2899-2901)Ctg>Gtg	p.L967V	SEC16B_ENST00000495165.1_5'UTR|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	967					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.L968V(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						ACATCCGGCAGAGGTGGGGAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											39.0	46.0	44.0					1																	177901866		2005	4162	6167	176168489	SO:0001583	missense	89866			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2899C>G	1.37:g.177901866G>C	ENSP00000308339:p.Leu967Val		176168489	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	CCDS44281.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121449	0.37436	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.14516	2.5	4.47	3.53	0.40419	.	0.826655	0.10545	N	0.662199	T	0.29652	0.0740	L	0.57536	1.79	0.29487	N	0.855928	D;B;D	0.63880	0.993;0.192;0.993	D;B;D	0.76071	0.987;0.044;0.967	T	0.07770	-1.0755	10	0.15066	T	0.55	-6.0109	10.4518	0.44526	0.0:0.1977:0.8023:0.0	.	968;967;664	B1AM08;Q96JE7;Q96PW0	.;SC16B_HUMAN;.	V	967;652;683	ENSP00000308339:L967V	ENSP00000239472:L683V	L	-	1	2	AL359075.1	176168489	0.082000	0.21442	0.338000	0.25549	0.014000	0.08584	1.599000	0.36751	1.193000	0.43086	0.467000	0.42956	CTG		0.627	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		Missense_Mutation
PPP1R12B	4660	broad.mit.edu	37	1	202406995	202406995	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:202406995C>G	ENST00000608999.1	+	10	1454	c.1301C>G	c.(1300-1302)tCt>tGt	p.S434C	RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000356764.2_3'UTR|PPP1R12B_ENST00000480184.1_Missense_Mutation_p.S434C|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.S434C	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	434					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.S434C(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			AAAGATGAATCTCCTTCTTCA	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											69.0	69.0	69.0					1																	202406995		2203	4300	6503	200673618	SO:0001583	missense	4660			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1301C>G	1.37:g.202406995C>G	ENSP00000476755:p.Ser434Cys		200673618	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638615	0.87760	.	.	ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000480184	T;T;T	0.71103	0.91;0.92;-0.54	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000020	D	0.85877	0.5799	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.995	D	0.86912	0.2061	10	0.87932	D	0	.	19.8773	0.96884	0.0:1.0:0.0:0.0	.	434;434;434	O60237;F8W8M3;Q2TAI8	MYPT2_HUMAN;.;.	C	434	ENSP00000384496:S434C;ENSP00000337897:S434C;ENSP00000417159:S434C	ENSP00000337897:S434C	S	+	2	0	PPP1R12B	200673618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.204000	0.72143	2.686000	0.91538	0.650000	0.86243	TCT		0.438	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		Missense_Mutation
PTPN14	5784	broad.mit.edu	37	1	214638126	214638126	+	Silent	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:214638126G>A	ENST00000366956.5	-	2	215	c.21C>T	c.(19-21)ctC>ctT	p.L7L	PTPN14_ENST00000543945.1_Silent_p.L7L	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	7					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.L7L(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GTGTCCGGCGGAGCTTCAGAC	0.587																																					Colon(92;557 1424 24372 34121 40073)											1	Substitution - coding silent(1)	ovary(1)	1											102.0	85.0	90.0					1																	214638126		2203	4300	6503	212704749	SO:0001819	synonymous_variant	5784			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.21C>T	1.37:g.214638126G>A			212704749	Q5VSI0	Silent	SNP	ENST00000366956.5	37	CCDS1514.1	SNP	41	Broad																																																																																				0.587	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401		Silent
VN1R5	317705	broad.mit.edu	37	1	247420260	247420260	+	IGR	SNP	T	T	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:247420260T>C								RP11-488L18.8 (15135 upstream) : Y_RNA (37876 downstream)																							GTGACATGGATAAATGATTCT	0.428																																																0			1											182.0	175.0	177.0					1																	247420260		1953	4146	6099	245486883	SO:0001628	intergenic_variant	317705																															1.37:g.247420260T>C			245486883		Missense_Mutation	SNP		37		SNP	49	Broad																																																																																			0	0.428									Missense_Mutation
ARMC4	55130	broad.mit.edu	37	10	28149706	28149706	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr10:28149706C>G	ENST00000305242.5	-	19	2961	c.2869G>C	c.(2869-2871)Gtg>Ctg	p.V957L	ARMC4_ENST00000537576.1_Missense_Mutation_p.V649L|ARMC4_ENST00000545014.1_Missense_Mutation_p.V482L	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	957					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.V957L(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CCGAAGGCCACTCTATTCCTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											180.0	146.0	157.0					10																	28149706		2203	4300	6503	28189712	SO:0001583	missense	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2869G>C	10.37:g.28149706C>G	ENSP00000306410:p.Val957Leu		28189712	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030220	0.35797	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	D;D;T	0.93763	-3.28;-3.28;-0.14	5.45	4.31	0.51392	Armadillo-like helical (1);Armadillo-type fold (1);	0.195809	0.43747	D	0.000525	D	0.91791	0.7403	M	0.68952	2.095	0.80722	D	1	B;P	0.37276	0.257;0.589	B;B	0.38921	0.14;0.285	D	0.90921	0.4783	10	0.41790	T	0.15	-25.6472	12.916	0.58207	0.0:0.8888:0.0:0.1112	.	482;957	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	L	649;957;482	ENSP00000443208:V649L;ENSP00000306410:V957L;ENSP00000441076:V482L	ENSP00000306410:V957L	V	-	1	0	ARMC4	28189712	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.982000	0.49337	2.711000	0.92665	0.655000	0.94253	GTG		0.468	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		Missense_Mutation
ANK3	288	broad.mit.edu	37	10	61833325	61833325	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr10:61833325C>G	ENST00000280772.2	-	37	7505	c.7314G>C	c.(7312-7314)ttG>ttC	p.L2438F	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2438					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L2438F(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCAAAAGCTTCAATGTTTTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	10											88.0	89.0	89.0					10																	61833325		2203	4300	6503	61503331	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7314G>C	10.37:g.61833325C>G	ENSP00000280772:p.Leu2438Phe		61503331	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522498	0.44866	.	.	ENSG00000151150	ENST00000280772	T	0.74526	-0.85	5.69	5.69	0.88448	.	0.000000	0.33572	N	0.004765	D	0.82995	0.5158	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.79936	-0.1593	10	0.29301	T	0.29	.	15.302	0.73958	0.0:0.8605:0.1395:0.0	.	2438	Q12955	ANK3_HUMAN	F	2438	ENSP00000280772:L2438F	ENSP00000280772:L2438F	L	-	3	2	ANK3	61503331	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.170000	0.31883	2.687000	0.91594	0.462000	0.41574	TTG		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		Missense_Mutation
C10orf91	170393	broad.mit.edu	37	10	134261465	134261465	+	Missense_Mutation	SNP	A	A	G	rs141082990		TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr10:134261465A>G	ENST00000392630.3	+	3	399	c.338A>G	c.(337-339)gAt>gGt	p.D113G	C10orf91_ENST00000321248.2_Missense_Mutation_p.D113G	NM_173541.2	NP_775812.1	Q5T1B1	CJ091_HUMAN	chromosome 10 open reading frame 91	113								p.D113G(1)		endometrium(1)|kidney(1)|lung(1)|ovary(2)	5		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		CCCGTGGTAGATCAAGCCTCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	10						A	GLY/ASP	1,4401	2.1+/-5.4	0,1,2200	48.0	60.0	56.0		338	-0.5	0.0	10	dbSNP_134	56	0,8596		0,0,4298	no	missense	C10orf91	NM_173541.2	94	0,1,6498	GG,GA,AA		0.0,0.0227,0.0077	benign	113/146	134261465	1,12997	2201	4298	6499	134111455	SO:0001583	missense	170393			BC030794	CCDS7668.1	10q26.3	2004-03-16			ENSG00000180066	ENSG00000180066			27275	protein-coding gene	gene with protein product						12477932	Standard	NM_173541		Approved	bA432J24.4	uc001llm.3	Q5T1B1	OTTHUMG00000019289	ENST00000392630.3:c.338A>G	10.37:g.134261465A>G	ENSP00000376407:p.Asp113Gly		134111455	Q8N0T7	Missense_Mutation	SNP	ENST00000392630.3	37	CCDS7668.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	3.275	-0.148348	0.06627	2.27E-4	0.0	ENSG00000180066	ENST00000392630;ENST00000321248	T;T	0.07908	3.15;3.15	0.235	-0.47	0.12131	.	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44205	-0.9343	7	.	.	.	.	.	.	.	.	113	Q5T1B1	CJ091_HUMAN	G	113	ENSP00000376407:D113G;ENSP00000323241:D113G	.	D	+	2	0	C10orf91	134111455	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.345000	0.02637	-1.858000	0.01158	-1.843000	0.00578	GAT		0.672	C10orf91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051078.2	NM_173541		Missense_Mutation
OR52N4	390072	broad.mit.edu	37	11	5776083	5776083	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr11:5776083T>A	ENST00000317254.3	+	1	161	c.113T>A	c.(112-114)gTt>gAt	p.V38D	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V38A(1)|p.V38D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TCTATGTATGTTGTGGCTATG	0.438																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	11											151.0	148.0	149.0					11																	5776083		2008	4203	6211	5732659	SO:0001583	missense	390072			AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.113T>A	11.37:g.5776083T>A	ENSP00000323224:p.Val38Asp		5732659	B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	CCDS44528.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	14.67	2.604375	0.46423	.	.	ENSG00000181074	ENST00000317254	T	0.03152	4.03	5.74	2.03	0.26663	.	0.539113	0.15409	N	0.263872	T	0.09642	0.0237	M	0.87682	2.9	0.23510	N	0.997526	B	0.28378	0.209	B	0.34652	0.187	T	0.09552	-1.0669	10	0.87932	D	0	.	9.3013	0.37847	0.0:0.2126:0.0:0.7874	.	38	Q8NGI2	O52N4_HUMAN	D	38	ENSP00000323224:V38D	ENSP00000323224:V38D	V	+	2	0	OR52N4	5732659	0.000000	0.05858	0.994000	0.49952	0.988000	0.76386	0.160000	0.16462	0.090000	0.17273	0.451000	0.29950	GTT		0.438	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		Missense_Mutation
OR5W2	390148	broad.mit.edu	37	11	55681278	55681278	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr11:55681278G>A	ENST00000344514.1	-	1	780	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R261W(2)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GAACTTGGCCGGAAATACATA	0.443																																					Melanoma(48;171 1190 15239 43886 49348)											2	Substitution - Missense(2)	ovary(1)|prostate(1)	11											80.0	92.0	88.0					11																	55681278		2201	4296	6497	55437854	SO:0001583	missense	390148			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.781C>T	11.37:g.55681278G>A	ENSP00000342448:p.Arg261Trp		55437854		Missense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104592	0.56291	.	.	ENSG00000187612	ENST00000344514	T	0.37915	1.17	5.01	-7.18	0.01505	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36167	N	0.002753	T	0.34337	0.0894	M	0.83852	2.665	0.09310	N	1	P	0.43024	0.798	P	0.44990	0.466	T	0.17745	-1.0359	10	0.72032	D	0.01	.	3.6052	0.08039	0.1349:0.0833:0.2308:0.5509	.	261	Q8NH69	OR5W2_HUMAN	W	261	ENSP00000342448:R261W	ENSP00000342448:R261W	R	-	1	2	OR5W2	55437854	0.000000	0.05858	0.028000	0.17463	0.903000	0.53119	-1.242000	0.02908	-1.391000	0.02085	0.549000	0.68633	CGG		0.443	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960		Missense_Mutation
SLC22A12	116085	broad.mit.edu	37	11	64359399	64359399	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr11:64359399G>A	ENST00000377574.1	+	1	1118	c.371G>A	c.(370-372)cGc>cAc	p.R124H	SLC22A12_ENST00000377567.2_Missense_Mutation_p.R124H|SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000377572.1_Missense_Mutation_p.R124H|SLC22A12_ENST00000336464.7_Missense_Mutation_p.R124H	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	124					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)	p.R124H(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GTCTATGACCGCAGCATCTTC	0.637																																																1	Substitution - Missense(1)	ovary(1)	11											31.0	33.0	32.0					11																	64359399		2201	4297	6498	64115975	SO:0001583	missense	116085			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.371G>A	11.37:g.64359399G>A	ENSP00000366797:p.Arg124His		64115975	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	ENST00000377574.1	37	CCDS8075.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	10.93	1.488699	0.26686	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000336464	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	4.4	-6.58	0.01836	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.588348	0.16865	N	0.196362	T	0.50171	0.1600	N	0.24115	0.695	0.09310	N	0.999999	B;B;P;B	0.35307	0.011;0.056;0.494;0.056	B;B;B;B	0.26864	0.016;0.016;0.074;0.016	T	0.44802	-0.9304	10	0.30854	T	0.27	.	5.7996	0.18406	0.5469:0.0:0.2254:0.2277	.	124;124;124;124	B5ME56;B3KV05;Q96S37-2;Q96S37	.;.;.;S22AC_HUMAN	H	124	ENSP00000366790:R124H;ENSP00000366797:R124H;ENSP00000366795:R124H;ENSP00000336836:R124H	ENSP00000336836:R124H	R	+	2	0	SLC22A12	64115975	0.000000	0.05858	0.234000	0.24042	0.860000	0.49131	-2.776000	0.00776	-1.583000	0.01638	-0.678000	0.03780	CGC		0.637	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585		Missense_Mutation
FOLR2	2350	broad.mit.edu	37	11	71932638	71932638	+	Missense_Mutation	SNP	C	C	A	rs138209906		TCGA-04-1357-01	TCGA-04-1357-11			C	A	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr11:71932638C>A	ENST00000298223.6	+	5	787	c.600C>A	c.(598-600)agC>agA	p.S200R	FOLR2_ENST00000454954.2_Missense_Mutation_p.S159R|FOLR2_ENST00000449475.2_Missense_Mutation_p.S196R	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	200					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)	p.S200R(1)|p.S200S(1)		breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	GCCGAGGGAGCGGCCGCTGCA	0.572																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|breast(1)	11											93.0	94.0	94.0					11																	71932638		2200	4293	6493	71610286	SO:0001583	missense	2350			AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.600C>A	11.37:g.71932638C>A	ENSP00000298223:p.Ser200Arg		71610286	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	SNP	27	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	16.77|16.77	3.214088|3.214088	0.58452|0.58452	.|.	.|.	ENSG00000165457|ENSG00000165457	ENST00000413873|ENST00000449475;ENST00000298223;ENST00000454954	.|T;T;T	.|0.78816	.|-1.21;-1.21;-1.21	4.58|4.58	-9.13|-9.13	0.00704|0.00704	.|Folate receptor-like (1);	.|0.141225	.|0.48286	.|U	.|0.000183	D|D	0.84800|0.84800	0.5552|0.5552	M|M	0.92649|0.92649	3.33|3.33	0.25978|0.25978	N|N	0.982413|0.982413	.|D	.|0.76494	.|0.999	.|D	.|0.81914	.|0.995	T|T	0.78181|0.78181	-0.2304|-0.2304	6|10	0.87932|0.72032	D|D	0|0.01	.|.	6.7188|6.7188	0.23318|0.23318	0.1092:0.5845:0.1106:0.1957|0.1092:0.5845:0.1106:0.1957	.|.	.|200	.|P14207	.|FOLR2_HUMAN	E|R	214|196;200;159	.|ENSP00000405638:S196R;ENSP00000298223:S200R;ENSP00000414094:S159R	ENSP00000412980:A214E|ENSP00000298223:S200R	A|S	+|+	2|3	0|2	FOLR2|FOLR2	71610286|71610286	0.000000|0.000000	0.05858|0.05858	0.182000|0.182000	0.23118|0.23118	0.945000|0.945000	0.59286|0.59286	-4.433000|-4.433000	0.00235|0.00235	-2.021000|-2.021000	0.00939|0.00939	0.462000|0.462000	0.41574|0.41574	GCG|AGC		0.572	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803		Missense_Mutation
ANKRD52	283373	broad.mit.edu	37	12	56647988	56647988	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr12:56647988C>G	ENST00000267116.7	-	8	890	c.769G>C	c.(769-771)Gag>Cag	p.E257Q		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	257								p.E257Q(1)		endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						TTCACCAGCTCAATAGCCACA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											151.0	170.0	164.0					12																	56647988		2118	4248	6366	54934255	SO:0001583	missense	283373			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.769G>C	12.37:g.56647988C>G	ENSP00000267116:p.Glu257Gln		54934255	A6NE79|B1Q2K2	Missense_Mutation	SNP	ENST00000267116.7	37	CCDS44920.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.332882	0.95758	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	D	0.83419	-1.72	4.59	4.59	0.56863	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	N	0.17278	0.47	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.84303	0.0506	10	0.38643	T	0.18	.	16.7094	0.85381	0.0:1.0:0.0:0.0	.	257	Q8NB46	ANR52_HUMAN	Q	257	ENSP00000267116:E257Q	ENSP00000267116:E257Q	E	-	1	0	ANKRD52	54934255	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.548000	0.85928	0.591000	0.81541	GAG		0.542	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595		Missense_Mutation
GCN1L1	10985	broad.mit.edu	37	12	120600702	120600702	+	Silent	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr12:120600702C>T	ENST00000300648.6	-	20	2124	c.2112G>A	c.(2110-2112)agG>agA	p.R704R		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	704					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.R704R(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GATCCAGGTGCCTGGTGATAA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	12											92.0	90.0	91.0					12																	120600702		1991	4155	6146	119085085	SO:0001819	synonymous_variant	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.2112G>A	12.37:g.120600702C>T			119085085	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1	SNP	26	Broad																																																																																				0.582	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			Silent
SLC7A7	9056	broad.mit.edu	37	14	23248049	23248049	+	Silent	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr14:23248049G>C	ENST00000397532.3	-	4	1248	c.723C>G	c.(721-723)ggC>ggG	p.G241G	SLC7A7_ENST00000554517.1_5'UTR|SLC7A7_ENST00000397528.4_Silent_p.G241G|SLC7A7_ENST00000397529.2_Silent_p.G241G|SLC7A7_ENST00000555702.1_Silent_p.G241G|SLC7A7_ENST00000285850.7_Silent_p.G241G|SLC7A7_ENST00000554061.1_5'UTR			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	241					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)	p.G241G(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		GGGTGTCCCAGCCTGAGTAGG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	14											157.0	123.0	135.0					14																	23248049		2203	4300	6503	22317889	SO:0001819	synonymous_variant	9056			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.723C>G	14.37:g.23248049G>C			22317889	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Silent	SNP	ENST00000397532.3	37	CCDS9574.1	SNP	34	Broad																																																																																				0.473	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3			Silent
MYH7	4625	broad.mit.edu	37	14	23888732	23888732	+	Silent	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr14:23888732G>A	ENST00000355349.3	-	28	3975	c.3813C>T	c.(3811-3813)aaC>aaT	p.N1271N	MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1271					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.N1271N(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGGTGAGGTCGTTGACAGAAC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	14											113.0	100.0	104.0					14																	23888732		2203	4300	6503	22958572	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3813C>T	14.37:g.23888732G>A			22958572	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1	SNP	40	Broad																																																																																				0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		Silent
ANPEP	290	broad.mit.edu	37	15	90335747	90335747	+	Missense_Mutation	SNP	G	G	A	rs148410109		TCGA-04-1357-01	TCGA-04-1357-11			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr15:90335747G>A	ENST00000300060.6	-	17	2609	c.2296C>T	c.(2296-2298)Cca>Tca	p.P766S		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	766	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.P766S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCACACTCTGGAACTCCGTTG	0.577																																					NSCLC(30;827 977 2459 19669 26125)											1	Substitution - Missense(1)	ovary(1)	15						G	SER/PRO	0,4400		0,0,2200	137.0	117.0	123.0		2296	-8.4	0.0	15	dbSNP_134	123	1,8597	1.2+/-3.3	0,1,4298	no	missense	ANPEP	NM_001150.2	74	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	766/968	90335747	1,12997	2200	4299	6499	88136751	SO:0001583	missense	290			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2296C>T	15.37:g.90335747G>A	ENSP00000300060:p.Pro766Ser		88136751	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016554	0.19355	0.0	1.16E-4	ENSG00000166825	ENST00000300060	T	0.05580	3.42	4.58	-8.41	0.00961	.	1.984930	0.02249	N	0.066466	T	0.03739	0.0106	N	0.21583	0.68	0.09310	N	1	B	0.12630	0.006	B	0.19148	0.024	T	0.38950	-0.9637	10	0.15952	T	0.53	.	5.8666	0.18779	0.0745:0.4786:0.1568:0.2901	.	766	P15144	AMPN_HUMAN	S	766	ENSP00000300060:P766S	ENSP00000300060:P766S	P	-	1	0	ANPEP	88136751	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-8.105000	0.00025	-1.060000	0.03189	-0.314000	0.08810	CCA		0.577	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1			Missense_Mutation
BLM	641	broad.mit.edu	37	15	91292753	91292753	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1357-01	TCGA-04-1357-11			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr15:91292753G>T	ENST00000355112.3	+	3	373	c.255G>T	c.(253-255)agG>agT	p.R85S	BLM_ENST00000560509.1_Missense_Mutation_p.R85S	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	85					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.R85S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATCAGCAAAGGGTCAAGGACT	0.403			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	ovary(1)	15											71.0	70.0	70.0					15																	91292753		2198	4298	6496	89093757	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.255G>T	15.37:g.91292753G>T	ENSP00000347232:p.Arg85Ser		89093757	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	9.472	1.095917	0.20552	.	.	ENSG00000197299	ENST00000355112	T	0.44083	0.93	5.91	-2.08	0.07254	.	1.363960	0.04220	N	0.333455	T	0.32315	0.0825	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.42749	-0.9433	10	0.72032	D	0.01	-10.0147	9.3697	0.38246	0.0:0.3082:0.3509:0.3408	.	85;85	B2RAN0;P54132	.;BLM_HUMAN	S	85	ENSP00000347232:R85S	ENSP00000347232:R85S	R	+	3	2	BLM	89093757	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.018000	0.13422	-0.152000	0.11156	0.655000	0.94253	AGG		0.403	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			Missense_Mutation
SMG1	23049	broad.mit.edu	37	16	18882779	18882779	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr16:18882779C>T	ENST00000446231.2	-	16	2621	c.2209G>A	c.(2209-2211)Gaa>Aaa	p.E737K	SMG1_ENST00000389467.3_Missense_Mutation_p.E737K|snoU13_ENST00000459248.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	737	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E733K(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ACAGCTGCTTCCAAAGCCCAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	16											56.0	51.0	52.0					16																	18882779		1813	4081	5894	18790280	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2209G>A	16.37:g.18882779C>T	ENSP00000402515:p.Glu737Lys		18790280	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.440783	0.96168	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.15017	2.46;2.46	5.21	5.21	0.72293	Armadillo-type fold (1);	0.000000	0.64402	U	0.000004	T	0.38825	0.1055	L	0.59436	1.845	0.51767	D	0.999939	D	0.63880	0.993	D	0.68192	0.956	T	0.02214	-1.1194	10	0.34782	T	0.22	.	19.116	0.93340	0.0:1.0:0.0:0.0	.	737	Q96Q15	SMG1_HUMAN	K	737	ENSP00000402515:E737K;ENSP00000374118:E737K	ENSP00000374118:E737K	E	-	1	0	SMG1	18790280	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.569000	0.82380	2.589000	0.87451	0.555000	0.69702	GAA		0.343	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		Missense_Mutation
GFOD2	81577	broad.mit.edu	37	16	67709567	67709567	+	Missense_Mutation	SNP	C	C	T	rs566819045		TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr16:67709567C>T	ENST00000268797.7	-	3	994	c.649G>A	c.(649-651)Gtc>Atc	p.V217I	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	217					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)	p.V217I(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TCGCTAGTGACGTGCCGGATG	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											81.0	70.0	73.0					16																	67709567		2198	4300	6498	66267068	SO:0001583	missense	81577			AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.649G>A	16.37:g.67709567C>T	ENSP00000268797:p.Val217Ile		66267068	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Missense_Mutation	SNP	ENST00000268797.7	37	CCDS10845.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	6.019	0.371833	0.11409	.	.	ENSG00000141098	ENST00000268797	T	0.41400	1.0	5.28	5.28	0.74379	.	0.114776	0.64402	D	0.000014	T	0.30293	0.0760	N	0.16266	0.395	0.58432	D	0.99999	B	0.19331	0.035	B	0.15484	0.013	T	0.05354	-1.0890	10	0.23891	T	0.37	-44.168	18.8749	0.92331	0.0:1.0:0.0:0.0	.	217	Q3B7J2	GFOD2_HUMAN	I	217	ENSP00000268797:V217I	ENSP00000268797:V217I	V	-	1	0	GFOD2	66267068	0.981000	0.34729	0.989000	0.46669	0.897000	0.52465	2.571000	0.45990	2.625000	0.88918	0.557000	0.71058	GTC		0.587	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268868.2	NM_030819		Missense_Mutation
RANBP10	57610	broad.mit.edu	37	16	67765391	67765391	+	Silent	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr16:67765391G>A	ENST00000317506.3	-	7	988	c.873C>T	c.(871-873)tcC>tcT	p.S291S	RANBP10_ENST00000536251.1_Silent_p.S62S|RANBP10_ENST00000602677.1_Silent_p.S291S|RANBP10_ENST00000448631.2_Silent_p.S235S|RANBP10_ENST00000425512.2_Silent_p.S159S|RANBP10_ENST00000411657.2_Silent_p.S174S	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	291	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.S291S(1)		endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		TGTTCTTTATGGACGCCTGTT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	16											172.0	157.0	162.0					16																	67765391		2198	4300	6498	66322892	SO:0001819	synonymous_variant	57610			AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.873C>T	16.37:g.67765391G>A			66322892	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Silent	SNP	ENST00000317506.3	37	CCDS32469.1	SNP	47	Broad																																																																																				0.483	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850		Silent
CHST5	23563	broad.mit.edu	37	16	75563653	75563653	+	Silent	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr16:75563653G>C	ENST00000336257.3	-	3	2024	c.630C>G	c.(628-630)ctC>ctG	p.L210L	CHST5_ENST00000541075.1_Silent_p.L216L|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	210					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.L210L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CGGGGTCGCTGAGCAGCGGGT	0.711																																																1	Substitution - coding silent(1)	ovary(1)	16											63.0	67.0	66.0					16																	75563653		2198	4298	6496	74121154	SO:0001819	synonymous_variant	23563			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.630C>G	16.37:g.75563653G>C			74121154	B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	ENST00000336257.3	37	CCDS10919.1	SNP	45	Broad																																																																																				0.711	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126		Silent
MYH1	4619	broad.mit.edu	37	17	10404659	10404659	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1357-01	TCGA-04-1357-11			T	G	T	T	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:10404659T>G	ENST00000226207.5	-	27	3600	c.3506A>C	c.(3505-3507)aAg>aCg	p.K1169T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1169					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K1169T(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTCCCGCTTCTTGTTCATCTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											90.0	100.0	96.0					17																	10404659		2203	4300	6503	10345384	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3506A>C	17.37:g.10404659T>G	ENSP00000226207:p.Lys1169Thr		10345384	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890724	0.91889	.	.	ENSG00000109061	ENST00000226207	D	0.85629	-2.01	5.51	5.51	0.81932	Myosin tail (1);	0.000000	0.45361	U	0.000378	D	0.93713	0.7991	M	0.91920	3.255	0.58432	D	0.999998	D	0.63880	0.993	D	0.70487	0.969	D	0.95003	0.8145	10	0.87932	D	0	.	15.9255	0.79611	0.0:0.0:0.0:1.0	.	1169	P12882	MYH1_HUMAN	T	1169	ENSP00000226207:K1169T	ENSP00000226207:K1169T	K	-	2	0	MYH1	10345384	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.889000	0.87307	2.221000	0.72209	0.528000	0.53228	AAG		0.607	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		Missense_Mutation
TOP2A	7153	broad.mit.edu	37	17	38554849	38554849	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1357-01	TCGA-04-1357-11			C	A	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:38554849C>A	ENST00000423485.1	-	27	3656	c.3498G>T	c.(3496-3498)ttG>ttT	p.L1166F		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1166					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)	p.L1166F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CTTCTTTCCACAAATCTGATG	0.294																																																1	Substitution - Missense(1)	ovary(1)	17											52.0	46.0	48.0					17																	38554849		1800	4066	5866	35808375	SO:0001583	missense	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3498G>T	17.37:g.38554849C>A	ENSP00000411532:p.Leu1166Phe		35808375	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	CCDS45672.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689175	0.68271	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.48522	0.81	5.65	2.57	0.30868	DNA topoisomerase, type IIA, subunit A/C-terminal (2);DNA topoisomerase, type IIA, central (1);	0.000000	0.85682	D	0.000000	T	0.70491	0.3230	M	0.90198	3.095	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.74754	-0.3558	10	0.66056	D	0.02	.	10.671	0.45757	0.0:0.7315:0.0:0.2685	.	1166	P11388	TOP2A_HUMAN	F	1166;1246;1189;1202	ENSP00000411532:L1166F	ENSP00000269577:L1246F	L	-	3	2	TOP2A	35808375	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.061000	0.30542	0.865000	0.35603	-0.142000	0.14014	TTG		0.294	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			Missense_Mutation
STAT5B	6777	broad.mit.edu	37	17	40362268	40362268	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:40362268G>C	ENST00000293328.3	-	15	1995	c.1827C>G	c.(1825-1827)aaC>aaG	p.N609K		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	609	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.N609K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CATCTGGCTTGTTAATGAGTA	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											140.0	122.0	128.0					17																	40362268		2203	4300	6503	37615794	SO:0001583	missense	6777			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1827C>G	17.37:g.40362268G>C	ENSP00000293328:p.Asn609Lys		37615794	Q8WWS8	Missense_Mutation	SNP	ENST00000293328.3	37	CCDS11423.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875407	0.33162	.	.	ENSG00000173757	ENST00000293328	T	0.54279	0.58	5.19	4.23	0.50019	SH2 motif (4);	0.137571	0.64402	D	0.000003	T	0.34454	0.0898	N	0.13168	0.305	0.45490	D	0.998455	B	0.20887	0.049	B	0.22152	0.038	T	0.10567	-1.0624	10	0.16420	T	0.52	-3.0911	13.8315	0.63384	0.0732:0.0:0.9268:0.0	.	609	P51692	STA5B_HUMAN	K	609	ENSP00000293328:N609K	ENSP00000293328:N609K	N	-	3	2	STAT5B	37615794	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.223000	0.65283	1.433000	0.47394	-0.136000	0.14681	AAC		0.493	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448		Missense_Mutation
BRCA1	672	broad.mit.edu	37	17	41226411	41226411	+	Nonsense_Mutation	SNP	G	G	A	rs80356992|rs80357915		TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:41226411G>A	ENST00000357654.3	-	14	4730	c.4612C>T	c.(4612-4614)Cag>Tag	p.Q1538*	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Nonsense_Mutation_p.Q1242*|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Nonsense_Mutation_p.Q1491*|BRCA1_ENST00000352993.3_Nonsense_Mutation_p.Q396*|BRCA1_ENST00000491747.2_Nonsense_Mutation_p.Q434*|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591534.1_Nonsense_Mutation_p.Q29*|BRCA1_ENST00000471181.2_Nonsense_Mutation_p.Q1559*|BRCA1_ENST00000468300.1_Nonsense_Mutation_p.Q434*|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000351666.3_Nonsense_Mutation_p.Q355*	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1538					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q1538*(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCTTCCAGCTGTTGCTCCTCC	0.443			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Substitution - Nonsense(1)	ovary(1)	17	GRCh37	CM980230	BRCA1	M	rs80356992						149.0	157.0	154.0					17																	41226411		2203	4300	6503	38479937	SO:0001587	stop_gained	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4612C>T	17.37:g.41226411G>A	ENSP00000350283:p.Gln1538*		38479937	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437249	0.83885	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919	.	.	.	5.54	2.44	0.29823	.	0.434165	0.19728	N	0.107439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	7.1345	0.25521	0.0:0.2106:0.5014:0.288	.	.	.	.	X	1538;1559;396;355;1242;434;387;1560;1491;433;434;309;388	.	ENSP00000310938:Q1242X	Q	-	1	0	BRCA1	38479937	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.393000	0.20817	0.435000	0.26365	-1.036000	0.02392	CAG		0.443	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		Nonsense_Mutation
MRPL10	124995	broad.mit.edu	37	17	45904417	45904417	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:45904417A>G	ENST00000351111.2	-	3	381	c.376T>C	c.(376-378)Ttc>Ctc	p.F126L	MRPL10_ENST00000414011.1_Missense_Mutation_p.F136L|MRPL10_ENST00000290208.7_Missense_Mutation_p.F136L	NM_145255.3	NP_660298.2	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10	126					ribosome biogenesis (GO:0042254)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.F126L(1)		endometrium(3)|large_intestine(1)|lung(3)|ovary(1)	8						TGGTTGGGGAAGACCTTCATC	0.567																																																1	Substitution - Missense(1)	ovary(1)	17											81.0	70.0	74.0					17																	45904417		2203	4300	6503	43259416	SO:0001583	missense	124995			AB051618	CCDS11516.1, CCDS11517.1	17q21.3	2012-09-13			ENSG00000159111	ENSG00000159111		"""Mitochondrial ribosomal proteins / large subunits"""	14055	protein-coding gene	gene with protein product	"""39S ribosomal protein L10, mitochondrial"""	611825				11551941	Standard	NM_148887		Approved	RPML8, MRP-L8, L10MT, MRP-L10, MRPL8, MGC17973	uc002ily.3	Q7Z7H8	OTTHUMG00000156302	ENST00000351111.2:c.376T>C	17.37:g.45904417A>G	ENSP00000324100:p.Phe126Leu		43259416	A6NGJ4|Q96B80|Q96Q55	Missense_Mutation	SNP	ENST00000351111.2	37	CCDS11516.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761608	0.89932	.	.	ENSG00000159111	ENST00000351111;ENST00000290208;ENST00000414011	T;T;T	0.39997	1.05;1.05;1.05	5.62	5.62	0.85841	.	0.141232	0.64402	D	0.000004	T	0.50188	0.1601	M	0.66939	2.045	0.58432	D	0.999997	B;P	0.37207	0.411;0.587	B;B	0.43754	0.43;0.249	T	0.51371	-0.8714	10	0.48119	T	0.1	-7.1627	14.8043	0.69942	1.0:0.0:0.0:0.0	.	126;136	Q7Z7H8;A6NGJ4	RM10_HUMAN;.	L	126;136;136	ENSP00000324100:F126L;ENSP00000290208:F136L;ENSP00000395870:F136L	ENSP00000290208:F136L	F	-	1	0	MRPL10	43259416	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	6.491000	0.73649	2.146000	0.66826	0.459000	0.35465	TTC		0.567	MRPL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343764.1	NM_145255		Missense_Mutation
SPAG9	9043	broad.mit.edu	37	17	49197872	49197872	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:49197872T>G	ENST00000262013.7	-	1	354	c.146A>C	c.(145-147)gAg>gCg	p.E49A	SPAG9_ENST00000505279.1_Missense_Mutation_p.E49A|SPAG9_ENST00000357122.4_Missense_Mutation_p.E49A	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	49					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.E49A(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CGGCATCAGCTCTTTGACCAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	17											65.0	55.0	58.0					17																	49197872		2203	4300	6503	46552871	SO:0001583	missense	9043			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.146A>C	17.37:g.49197872T>G	ENSP00000262013:p.Glu49Ala		46552871	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	CCDS45740.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	29.2	4.988943	0.93106	.	.	ENSG00000008294	ENST00000262013;ENST00000505279;ENST00000357122;ENST00000546269	T;T;T	0.45668	0.89;0.89;0.89	3.84	3.84	0.44239	JNK/Rab-associated protein-1, N-terminal (1);	0.081414	0.48286	U	0.000192	T	0.58524	0.2128	M	0.70595	2.14	0.49687	D	0.999819	B;D;D	0.59357	0.308;0.985;0.977	B;P;P	0.61328	0.414;0.887;0.846	T	0.62077	-0.6930	10	0.51188	T	0.08	-9.7077	12.9612	0.58460	0.0:0.0:0.0:1.0	.	49;49;49	O60271-2;O60271;O60271-4	.;JIP4_HUMAN;.	A	49	ENSP00000262013:E49A;ENSP00000426900:E49A;ENSP00000349636:E49A	ENSP00000262013:E49A	E	-	2	0	SPAG9	46552871	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.205000	0.77881	1.518000	0.48934	0.248000	0.18094	GAG		0.662	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971		Missense_Mutation
ZNF236	7776	broad.mit.edu	37	18	74622099	74622099	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr18:74622099C>G	ENST00000253159.8	+	15	2819	c.2621C>G	c.(2620-2622)tCc>tGc	p.S874C	ZNF236_ENST00000320610.9_Missense_Mutation_p.S876C	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	874					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S874C(1)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCGCAACAGTCCTTCGAACCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	18											88.0	87.0	87.0					18																	74622099		1871	4099	5970	72751087	SO:0001583	missense	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2621C>G	18.37:g.74622099C>G	ENSP00000253159:p.Ser874Cys		72751087	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773923	0.31411	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.12879	2.64;2.8	5.2	5.2	0.72013	.	0.510883	0.21736	N	0.069895	T	0.16514	0.0397	L	0.60455	1.87	0.48762	D	0.999701	P	0.45348	0.856	B	0.36186	0.219	T	0.03695	-1.1012	10	0.44086	T	0.13	.	18.7386	0.91765	0.0:1.0:0.0:0.0	.	874	Q9UL36	ZN236_HUMAN	C	874	ENSP00000253159:S874C;ENSP00000444524:S874C	ENSP00000253159:S874C	S	+	2	0	ZNF236	72751087	0.553000	0.26513	0.706000	0.30403	0.030000	0.12068	4.904000	0.63279	2.584000	0.87258	0.563000	0.77884	TCC		0.488	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			Missense_Mutation
AP1M1	8907	broad.mit.edu	37	19	16314404	16314404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr19:16314404G>A	ENST00000291439.3	+	2	626	c.177G>A	c.(175-177)tgG>tgA	p.W59*	AP1M1_ENST00000429941.2_Nonsense_Mutation_p.W59*|AP1M1_ENST00000444449.2_Nonsense_Mutation_p.W59*|AP1M1_ENST00000590756.1_Intron|AP1M1_ENST00000541844.1_Intron	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	59					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.W59*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						GTTTCATGTGGATCAAACACA	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	19											105.0	95.0	98.0					19																	16314404		2203	4300	6503	16175404	SO:0001587	stop_gained	8907				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.177G>A	19.37:g.16314404G>A	ENSP00000291439:p.Trp59*		16175404	Q4TTY5	Nonsense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	38	6.812363	0.97857	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000429941	.	.	.	4.73	4.73	0.59995	.	0.063541	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-21.3479	16.709	0.85380	0.0:0.0:1.0:0.0	.	.	.	.	X	59	.	ENSP00000291439:W59X	W	+	3	0	AP1M1	16175404	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.520000	0.98027	2.194000	0.70268	0.655000	0.94253	TGG		0.582	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493		Nonsense_Mutation
NCAN	1463	broad.mit.edu	37	19	19329823	19329823	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr19:19329823C>T	ENST00000252575.6	+	3	272	c.173C>T	c.(172-174)cCc>cTc	p.P58L		NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	58	Ig-like V-type.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.P58L(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GTGGCCCTGCCCTGTCTCTTT	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											33.0	33.0	33.0					19																	19329823		2202	4299	6501	19190823	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.173C>T	19.37:g.19329823C>T	ENSP00000252575:p.Pro58Leu		19190823	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691798	0.88735	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.67698	-0.28	4.55	4.55	0.56014	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37669	N	0.001987	D	0.82935	0.5145	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86342	0.1705	10	0.87932	D	0	-19.3405	14.8061	0.69956	0.0:1.0:0.0:0.0	.	58	O14594	NCAN_HUMAN	L	72;58	ENSP00000252575:P58L	ENSP00000252575:P58L	P	+	2	0	NCAN	19190823	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.192000	0.77771	2.060000	0.61445	0.491000	0.48974	CCC		0.652	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		Missense_Mutation
HPN	3249	broad.mit.edu	37	19	35551301	35551301	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr19:35551301A>C	ENST00000262626.2	+	8	1330	c.505A>C	c.(505-507)Acc>Ccc	p.T169P	HPN_ENST00000597419.1_Intron|HPN_ENST00000392226.1_Missense_Mutation_p.T169P|HPN-AS1_ENST00000392227.2_RNA	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	169	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.T169P(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	AGGCCGGGACACCAGCTTGGG	0.692																																																1	Substitution - Missense(1)	ovary(1)	19											52.0	60.0	57.0					19																	35551301		2203	4300	6503	40243141	SO:0001583	missense	3249				CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.505A>C	19.37:g.35551301A>C	ENSP00000262626:p.Thr169Pro		40243141	B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	CCDS32993.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	16.38	3.107070	0.56291	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.88975	-2.45;-2.45	4.74	1.33	0.21861	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.285322	0.38605	N	0.001629	D	0.85440	0.5697	L	0.60067	1.865	0.80722	D	1	P;P;P	0.40476	0.718;0.529;0.637	P;B;P	0.45119	0.47;0.369;0.455	T	0.80495	-0.1357	10	0.72032	D	0.01	.	2.4264	0.04460	0.4846:0.0:0.3049:0.2104	.	141;169;169	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	P	169;169;141	ENSP00000262626:T169P;ENSP00000376060:T169P	ENSP00000262626:T169P	T	+	1	0	HPN	40243141	0.996000	0.38824	1.000000	0.80357	0.957000	0.61999	2.303000	0.43646	0.319000	0.23209	-0.531000	0.04308	ACC		0.692	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151		Missense_Mutation
CD22	933	broad.mit.edu	37	19	35837099	35837099	+	Missense_Mutation	SNP	T	T	A	rs376085852		TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr19:35837099T>A	ENST00000085219.5	+	13	2439	c.2373T>A	c.(2371-2373)gaT>gaA	p.D791E	CD22_ENST00000341773.6_Missense_Mutation_p.D614E|CD22_ENST00000544992.2_Nonstop_Mutation_p.*752R|CD22_ENST00000270311.6_Missense_Mutation_p.D606E|MIR5196_ENST00000578146.1_RNA|CD22_ENST00000536635.2_Missense_Mutation_p.D703E|CD22_ENST00000419549.2_Missense_Mutation_p.D619E|CD22_ENST00000594250.1_Missense_Mutation_p.D614E	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	791					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.D791E(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CGGACTGCGATGACACGGTCA	0.597																																					Ovarian(42;1009 1133 23674 26041)											1	Substitution - Missense(1)	ovary(1)	19											115.0	99.0	105.0					19																	35837099		2203	4300	6503	40528939	SO:0001583	missense	933			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.2373T>A	19.37:g.35837099T>A	ENSP00000085219:p.Asp791Glu		40528939	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	SNP	51	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.531|0.531	-0.857841|-0.857841	0.02610|0.02610	.|.	.|.	ENSG00000012124|ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000270311;ENST00000419549|ENST00000544992	T;T;T;T;T|.	0.57752|.	0.92;0.47;0.38;0.76;0.98|.	3.67|3.67	-5.6|-5.6	0.02497|0.02497	.|.	0.839834|.	0.10147|.	N|.	0.710088|.	T|.	0.16171|.	0.0389|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B;B;P;P|.	0.38535|.	0.149;0.404;0.635;0.547|.	B;B;B;B|.	0.37989|.	0.081;0.159;0.081;0.262|.	T|.	0.25984|.	-1.0116|.	9|.	0.22109|.	T|.	0.4|.	.|.	1.2828|1.2828	0.02044|0.02044	0.1493:0.2907:0.3295:0.2305|0.1493:0.2907:0.3295:0.2305	.|.	619;703;791;614|.	Q32M46;F5H7U3;P20273;P20273-2|.	.;.;CD22_HUMAN;.|.	E|R	791;703;614;606;619|752	ENSP00000085219:D791E;ENSP00000442279:D703E;ENSP00000339349:D614E;ENSP00000270311:D606E;ENSP00000403822:D619E|.	ENSP00000085219:D791E|.	D|X	+|+	3|1	2|0	CD22|CD22	40528939|40528939	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.042000|0.042000	0.13812|0.13812	-3.175000|-3.175000	0.00571|0.00571	-0.951000|-0.951000	0.03654|0.03654	0.260000|0.260000	0.18958|0.18958	GAT|TGA		0.597	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771		Missense_Mutation
PIKFYVE	200576	broad.mit.edu	37	2	209195353	209195353	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr2:209195353G>A	ENST00000264380.4	+	23	4056	c.3898G>A	c.(3898-3900)Gat>Aat	p.D1300N		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1300					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.D1300N(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GAAGGAGTTGGATTCTCCAGT	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											217.0	214.0	215.0					2																	209195353		2203	4300	6503	208903598	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3898G>A	2.37:g.209195353G>A	ENSP00000264380:p.Asp1300Asn		208903598	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693118	0.88735	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.67345	-0.26;-0.26	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.73753	0.3627	L	0.40543	1.245	0.80722	D	1	D;P	0.67145	0.996;0.953	P;P	0.60609	0.877;0.551	T	0.68823	-0.5307	10	0.29301	T	0.29	-21.3143	19.861	0.96785	0.0:0.0:1.0:0.0	.	1300;1244	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	N	1300;876;1244	ENSP00000264380:D1300N;ENSP00000405736:D1244N	ENSP00000264380:D1300N	D	+	1	0	PIKFYVE	208903598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.691000	0.84191	2.767000	0.95098	0.655000	0.94253	GAT		0.413	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		Missense_Mutation
SLC16A14	151473	broad.mit.edu	37	2	230923815	230923815	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr2:230923815A>C	ENST00000295190.4	-	2	712	c.254T>G	c.(253-255)aTa>aGa	p.I85R	RNY4P19_ENST00000362530.1_RNA	NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.I85R(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CATACCCACTATCAAGGTGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	2											78.0	81.0	80.0					2																	230923815		2203	4300	6503	230632059	SO:0001583	missense	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.254T>G	2.37:g.230923815A>C	ENSP00000295190:p.Ile85Arg		230632059	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	37	CCDS2473.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445202	0.83993	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	T;T;T	0.61392	0.11;0.11;0.11	5.39	5.39	0.77823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.097786	0.44688	D	0.000428	T	0.76176	0.3951	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.83275	0.986;0.996	T	0.77672	-0.2500	10	0.48119	T	0.1	.	15.5825	0.76455	1.0:0.0:0.0:0.0	.	85;85	E7EMG7;Q7RTX9	.;MOT14_HUMAN	R	85	ENSP00000295190:I85R;ENSP00000400352:I85R;ENSP00000395775:I85R	ENSP00000295190:I85R	I	-	2	0	SLC16A14	230632059	1.000000	0.71417	0.986000	0.45419	0.901000	0.52897	7.565000	0.82337	2.263000	0.75096	0.533000	0.62120	ATA		0.483	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527		Missense_Mutation
ARMC9	80210	broad.mit.edu	37	2	232209764	232209764	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr2:232209764G>C	ENST00000349938.4	+	21	2150	c.1956G>C	c.(1954-1956)agG>agC	p.R652S	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	652						extracellular vesicular exosome (GO:0070062)		p.R652S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CCCTGCAAAGGCCCGTCACCC	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											51.0	55.0	54.0					2																	232209764		2203	4300	6503	231918008	SO:0001583	missense	80210			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1956G>C	2.37:g.232209764G>C	ENSP00000258417:p.Arg652Ser		231918008	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419966	0.42918	.	.	ENSG00000135931	ENST00000349938;ENST00000359743	T	0.29397	1.57	5.01	2.16	0.27623	.	0.000000	0.85682	D	0.000000	T	0.35128	0.0921	L	0.29908	0.895	0.44323	D	0.997201	D	0.76494	0.999	D	0.76071	0.987	T	0.18967	-1.0320	10	0.87932	D	0	-23.5124	3.8893	0.09111	0.1977:0.0:0.6095:0.1928	.	652	Q7Z3E5	ARMC9_HUMAN	S	652	ENSP00000258417:R652S	ENSP00000258417:R652S	R	+	3	2	ARMC9	231918008	1.000000	0.71417	0.973000	0.42090	0.164000	0.22412	0.816000	0.27267	0.612000	0.30071	-0.311000	0.09066	AGG		0.532	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139		Missense_Mutation
SOGA1	140710	broad.mit.edu	37	20	35443807	35443807	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr20:35443807C>A	ENST00000357779.3	-	5	1650	c.1324G>T	c.(1324-1326)Ggc>Tgc	p.G442C	SOGA1_ENST00000279034.6_Missense_Mutation_p.G442C|SOGA1_ENST00000456801.2_Missense_Mutation_p.G283C|SOGA1_ENST00000237536.4_Missense_Mutation_p.G680C			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	442					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G680C(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						AGCCGGAGGCCAGCCGTGAAG	0.647																																																1	Substitution - Missense(1)	ovary(1)	20											24.0	26.0	26.0					20																	35443807		2203	4300	6503	34877221	SO:0001583	missense	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1324G>T	20.37:g.35443807C>A	ENSP00000350424:p.Gly442Cys		34877221	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	9.882	1.201816	0.22121	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.18657	2.2;2.21;2.21;2.21	4.86	2.77	0.32553	.	0.493070	0.22605	N	0.057917	T	0.34483	0.0899	L	0.44542	1.39	0.30988	N	0.721743	D	0.76494	0.999	D	0.76071	0.987	T	0.24693	-1.0153	10	0.56958	D	0.05	-33.9079	10.2468	0.43345	0.0:0.7651:0.0:0.2349	.	442	O94964-4	.	C	680;442;283;442	ENSP00000237536:G680C;ENSP00000279034:G442C;ENSP00000413886:G283C;ENSP00000350424:G442C	ENSP00000237536:G680C	G	-	1	0	KIAA0889	34877221	0.713000	0.27926	0.981000	0.43875	0.227000	0.25037	1.163000	0.31798	0.662000	0.31006	-1.134000	0.01955	GGC		0.647	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181		Missense_Mutation
TTI1	9675	broad.mit.edu	37	20	36640434	36640434	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr20:36640434G>C	ENST00000373448.2	-	3	2023	c.1785C>G	c.(1783-1785)atC>atG	p.I595M	TTI1_ENST00000487362.1_5'UTR|TTI1_ENST00000373447.3_Missense_Mutation_p.I595M|TTI1_ENST00000449821.1_Missense_Mutation_p.I595M	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	595					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.I595M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CACCAGACGTGATGGCTTGGA	0.448																																																1	Substitution - Missense(1)	ovary(1)	20											141.0	144.0	143.0					20																	36640434		2203	4300	6503	36073848	SO:0001583	missense	9675			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.1785C>G	20.37:g.36640434G>C	ENSP00000362547:p.Ile595Met		36073848	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	5.033	0.191823	0.09547	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.15139	2.45;2.45;2.45	5.23	5.23	0.72850	Armadillo-type fold (1);	0.410465	0.25741	N	0.028602	T	0.16342	0.0393	L	0.47716	1.5	0.27115	N	0.962276	P	0.37636	0.603	B	0.36666	0.23	T	0.12553	-1.0543	10	0.39692	T	0.17	-18.8485	11.4776	0.50308	0.0844:0.0:0.9156:0.0	.	595	O43156	TTI1_HUMAN	M	595	ENSP00000362547:I595M;ENSP00000362546:I595M;ENSP00000407270:I595M	ENSP00000362546:I595M	I	-	3	3	TTI1	36073848	1.000000	0.71417	0.966000	0.40874	0.032000	0.12392	0.917000	0.28665	2.719000	0.93026	0.655000	0.94253	ATC		0.448	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		Missense_Mutation
EMID1	129080	broad.mit.edu	37	22	29627097	29627097	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr22:29627097C>T	ENST00000404820.3	+	6	681	c.554C>T	c.(553-555)gCc>gTc	p.A185V	EMID1_ENST00000404755.3_Missense_Mutation_p.A185V|EMID1_ENST00000334018.6_Missense_Mutation_p.A185V|EMID1_ENST00000484039.1_3'UTR			Q96A84	EMID1_HUMAN	EMI domain containing 1	183	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)		p.A185V(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						CCCCCTCCTGCCCAGGGCAGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	22											51.0	53.0	52.0					22																	29627097		2203	4300	6503	27957097	SO:0001583	missense	129080			AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.554C>T	22.37:g.29627097C>T	ENSP00000384452:p.Ala185Val		27957097	B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	ENST00000404820.3	37		SNP	26	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.645|9.645	1.139924|1.139924	0.21205|0.21205	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127|ENST00000433143	D;T;D;D;T|.	0.90324|.	-2.65;0.59;-2.51;-2.65;0.69|.	4.95|4.95	1.69|1.69	0.24217|0.24217	.|.	0.682217|.	0.12677|.	N|.	0.448313|.	T|T	0.35770|0.35770	0.0943|0.0943	N|N	0.17564|0.17564	0.495|0.495	0.37107|0.37107	D|D	0.900188|0.900188	B;B;B;B|.	0.10296|.	0.002;0.002;0.002;0.003|.	B;B;B;B|.	0.09377|.	0.002;0.002;0.002;0.004|.	T|T	0.19844|0.19844	-1.0293|-1.0293	10|5	0.27785|.	T|.	0.31|.	-4.8813|-4.8813	7.0351|7.0351	0.24989|0.24989	0.0:0.7298:0.0:0.2702|0.0:0.7298:0.0:0.2702	.|.	185;185;183;185|.	B0QYK4;B0QYK5;Q96A84;Q96A84-3|.	.;.;EMID1_HUMAN;.|.	V|S	185;185;185;185;157|31	ENSP00000335481:A185V;ENSP00000403816:A185V;ENSP00000385414:A185V;ENSP00000384452:A185V;ENSP00000399760:A157V|.	ENSP00000335481:A185V|.	A|P	+|+	2|1	0|0	EMID1|EMID1	27957097|27957097	0.948000|0.948000	0.32251|0.32251	0.999000|0.999000	0.59377|0.59377	0.026000|0.026000	0.11368|0.11368	2.095000|2.095000	0.41729|0.41729	0.622000|0.622000	0.30249|0.30249	0.585000|0.585000	0.79938|0.79938	GCC|CCC		0.617	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455		Missense_Mutation
CACNA1I	8911	broad.mit.edu	37	22	40054966	40054966	+	Silent	SNP	T	T	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr22:40054966T>G	ENST00000402142.3	+	12	2175	c.2175T>G	c.(2173-2175)ggT>ggG	p.G725G	CACNA1I_ENST00000401624.1_Silent_p.G725G|CACNA1I_ENST00000400164.3_Silent_p.G690G|CACNA1I_ENST00000404898.1_Silent_p.G690G|CACNA1I_ENST00000336649.4_Silent_p.G731G|CACNA1I_ENST00000407673.1_Silent_p.G690G	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	725					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.G690G(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	AGGCGGACGGTGGGCTGTCGG	0.672																																																1	Substitution - coding silent(1)	ovary(1)	22											23.0	30.0	28.0					22																	40054966		2169	4258	6427	38384912	SO:0001819	synonymous_variant	8911			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.2175T>G	22.37:g.40054966T>G			38384912	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	CCDS46710.1	SNP	59	Broad																																																																																				0.672	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		Silent
TTLL12	23170	broad.mit.edu	37	22	43572347	43572347	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr22:43572347T>G	ENST00000216129.6	-	6	959	c.896A>C	c.(895-897)cAc>cCc	p.H299P	TTLL12_ENST00000484118.1_5'Flank	NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	299					cellular protein modification process (GO:0006464)			p.H299P(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GCCGTGGGGGTGCACCACGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	22																																								41902291	SO:0001583	missense	23170			D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.896A>C	22.37:g.43572347T>G	ENSP00000216129:p.His299Pro		41902291	Q20WK5|Q9UGU3	Missense_Mutation	SNP	ENST00000216129.6	37	CCDS14047.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	8.888	0.953217	0.18431	.	.	ENSG00000100304	ENST00000216129;ENST00000423379	T	0.44482	0.92	5.22	-0.974	0.10293	.	0.707111	0.14305	N	0.328074	T	0.15435	0.0372	N	0.02202	-0.64	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16571	-1.0398	10	0.35671	T	0.21	-25.5798	6.7354	0.23407	0.0:0.4128:0.1346:0.4526	.	299;299	B1AH89;Q14166	.;TTL12_HUMAN	P	299	ENSP00000216129:H299P	ENSP00000216129:H299P	H	-	2	0	TTLL12	41902291	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.687000	0.25407	-0.572000	0.06006	-0.290000	0.09829	CAC		0.592	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140		Missense_Mutation
TAMM41	132001	broad.mit.edu	37	3	11851157	11851157	+	Splice_Site	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr3:11851157C>G	ENST00000444133.2	-	6	851		c.e6-1		TAMM41_ENST00000273037.5_Splice_Site|TAMM41_ENST00000455809.1_Splice_Site			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)						cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										TTTTATCTATCTGAAGGGAGG	0.378																																																0			3											109.0	108.0	108.0					3																	11851157		2203	4300	6503	11826157	SO:0001630	splice_region_variant	132001				CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.709-1G>C	3.37:g.11851157C>G			11826157	B4DIY7|C9J2U4	Splice_Site_SNP	SNP	ENST00000444133.2	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028938	0.75504	.	.	ENSG00000144559	ENST00000455809;ENST00000273037;ENST00000444133	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0696	0.89402	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TAMM41	11826157	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	7.556000	0.82233	2.495000	0.84180	0.557000	0.71058	.		0.378	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000339258.2	NM_138807	Intron	Splice_Site_SNP
CACNA1D	776	broad.mit.edu	37	3	53531457	53531457	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr3:53531457C>T	ENST00000350061.5	+	2	857	c.346C>T	c.(346-348)Cga>Tga	p.R116*	CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.R116*|CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.R116*	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	116					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.R116*(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TAACCCCATCCGAAGAGCCTG	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	3											92.0	105.0	100.0					3																	53531457		2203	4300	6503	53506497	SO:0001587	stop_gained	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.346C>T	3.37:g.53531457C>T	ENSP00000288133:p.Arg116*		53506497	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Nonsense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	39	7.911234	0.98557	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	.	.	.	5.83	5.83	0.93111	.	0.000000	0.50627	D	0.000117	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1166	0.97939	0.0:1.0:0.0:0.0	.	.	.	.	X	116	.	ENSP00000288139:R116X	R	+	1	2	CACNA1D	53506497	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.743000	0.62110	2.758000	0.94735	0.655000	0.94253	CGA		0.423	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		Nonsense_Mutation
GFM1	85476	broad.mit.edu	37	3	158376728	158376728	+	Silent	SNP	A	A	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr3:158376728A>G	ENST00000486715.1	+	9	1458	c.1101A>G	c.(1099-1101)caA>caG	p.Q367Q	GFM1_ENST00000478576.1_Silent_p.Q367Q|GFM1_ENST00000264263.5_Silent_p.Q386Q	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1									p.Q367Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GATTTGGACAATTAACTTATG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	3											114.0	103.0	107.0					3																	158376728		2203	4300	6503	159859422	SO:0001819	synonymous_variant	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.1101A>G	3.37:g.158376728A>G			159859422		Silent	SNP	ENST00000486715.1	37	CCDS33885.1	SNP	4	Broad																																																																																				0.408	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996		Silent
YEATS2	55689	broad.mit.edu	37	3	183442221	183442221	+	Silent	SNP	T	T	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr3:183442221T>A	ENST00000305135.5	+	6	747	c.552T>A	c.(550-552)atT>atA	p.I184I		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	184			I -> V (in dbSNP:rs16858033).		chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.I184I(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CTTCTAGAATTACTGGCTCCC	0.343																																																1	Substitution - coding silent(1)	ovary(1)	3											85.0	79.0	81.0					3																	183442221		1823	4087	5910	184924915	SO:0001819	synonymous_variant	55689			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.552T>A	3.37:g.183442221T>A			184924915	A7E2B9|D3DNS9|Q641P6|Q9NW96	Silent	SNP	ENST00000305135.5	37	CCDS43175.1	SNP	61	Broad																																																																																				0.343	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023		Silent
BMP3	651	broad.mit.edu	37	4	81967253	81967253	+	Silent	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr4:81967253C>T	ENST00000282701.2	+	2	998	c.678C>T	c.(676-678)cgC>cgT	p.R226R		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	226					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.R226R(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						CCAAGGGACGCCAGCTGCCAA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	4											117.0	123.0	121.0					4																	81967253		2203	4300	6503	82186277	SO:0001819	synonymous_variant	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.678C>T	4.37:g.81967253C>T			82186277	Q4VAS5	Silent	SNP	ENST00000282701.2	37	CCDS3588.1	SNP	26	Broad																																																																																				0.433	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			Silent
ANK2	287	broad.mit.edu	37	4	114275419	114275419	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1357-01	TCGA-04-1357-11			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr4:114275419C>T	ENST00000357077.4	+	38	5698	c.5645C>T	c.(5644-5646)tCa>tTa	p.S1882L	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S1849L	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1882	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S1882L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCACCTGTATCACCCTCGACA	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											191.0	173.0	179.0					4																	114275419		2203	4300	6503	114494868	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5645C>T	4.37:g.114275419C>T	ENSP00000349588:p.Ser1882Leu		114494868	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862835	0.91511	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.68624	-0.34;-0.34	5.44	5.44	0.79542	.	0.000000	0.44902	D	0.000417	T	0.79405	0.4440	L	0.59436	1.845	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.77557	0.977;0.99	T	0.77099	-0.2713	9	.	.	.	.	18.1971	0.89826	0.0:1.0:0.0:0.0	.	1849;1882	Q01484;Q01484-4	ANK2_HUMAN;.	L	1882;1849	ENSP00000349588:S1882L;ENSP00000264366:S1849L	.	S	+	2	0	ANK2	114494868	0.990000	0.36364	0.799000	0.32177	0.983000	0.72400	1.653000	0.37323	2.832000	0.97577	0.655000	0.94253	TCA		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		Missense_Mutation
APC	324	broad.mit.edu	37	5	112170682	112170682	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1357-01	TCGA-04-1357-11			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr5:112170682G>T	ENST00000457016.1	+	15	2158	c.1778G>T	c.(1777-1779)tGg>tTg	p.W593L	APC_ENST00000508376.2_Missense_Mutation_p.W593L|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.W593L			P25054	APC_HUMAN	adenomatous polyposis coli	593	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.W593L(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTGCCTTATGGAATTTGTCA	0.393		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|skin(1)	5	GRCh37	CM970084	APC	M							183.0	152.0	162.0					5																	112170682		2202	4300	6502	112198581	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1778G>T	5.37:g.112170682G>T	ENSP00000413133:p.Trp593Leu		112198581	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.419527	0.96111	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83298	0.5224	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84959	0.0876	10	0.87932	D	0	-5.4199	20.3409	0.98764	0.0:0.0:1.0:0.0	.	595;593	Q4LE70;P25054	.;APC_HUMAN	L	593;575;593;593;593	ENSP00000413133:W593L;ENSP00000423224:W575L;ENSP00000257430:W593L;ENSP00000427089:W593L;ENSP00000423828:W593L	ENSP00000257430:W593L	W	+	2	0	APC	112198581	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.814000	0.96858	0.655000	0.94253	TGG		0.393	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
HARS	3035	broad.mit.edu	37	5	140054614	140054614	+	Silent	SNP	A	A	G			TCGA-04-1357-01	TCGA-04-1357-11			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr5:140054614A>G	ENST00000504156.1	-	11	2018	c.1299T>C	c.(1297-1299)gaT>gaC	p.D433D	DND1_ENST00000542735.1_5'Flank|HARS_ENST00000457527.2_Silent_p.D413D|HARS_ENST00000438307.2_Silent_p.D393D|HARS_ENST00000415192.2_Silent_p.D359D|HARS_ENST00000504366.1_Silent_p.D364D|HARS_ENST00000431330.2_Silent_p.D319D|HARS_ENST00000448240.1_Silent_p.D238D|HARS_ENST00000307633.3_Silent_p.D373D	NM_002109.4	NP_002100.2	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	433					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)	p.D433D(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	TGATCCCAGCATCCCACAGTT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	5											149.0	135.0	139.0					5																	140054614		2203	4300	6503	140034798	SO:0001819	synonymous_variant	3035			AK000498	CCDS4237.1, CCDS58976.1, CCDS58977.1, CCDS58978.1, CCDS75323.1, CCDS75324.1	5q31.3	2012-10-02			ENSG00000170445	ENSG00000170445	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4816	protein-coding gene	gene with protein product	"""histidine tRNA ligase 1, cytoplasmic"""	142810					Standard	XM_005268428		Approved		uc003lgv.4	P12081	OTTHUMG00000129502	ENST00000504156.1:c.1299T>C	5.37:g.140054614A>G			140034798	B4DHQ1|B4DY73|D6REN6|J3KNE5	Silent	SNP	ENST00000504156.1	37	CCDS4237.1	SNP	8	Broad																																																																																				0.512	HARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251673.2	NM_002109		Silent
FLT4	2324	broad.mit.edu	37	5	180058743	180058743	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr5:180058743A>T	ENST00000261937.6	-	2	172	c.94T>A	c.(94-96)Ttg>Atg	p.L32M	FLT4_ENST00000393347.3_Missense_Mutation_p.L32M|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.L32M	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	32	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.L32M(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTGATGTTCAAGGTCGGGGGG	0.632																																					Colon(97;1075 1466 27033 27547 35871)											2	Substitution - Missense(2)	ovary(2)	5											79.0	67.0	71.0					5																	180058743		2203	4300	6503	179991349	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.94T>A	5.37:g.180058743A>T	ENSP00000261937:p.Leu32Met		179991349	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.69	3.678467	0.68042	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	T;T;T	0.36157	1.27;1.27;1.27	4.28	3.4	0.38934	Immunoglobulin-like (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor 3 (VEGFR3), N-terminal (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58807	0.2148	M	0.83774	2.66	0.52099	D	0.999943	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.989;0.998;0.996;0.997;0.997	T	0.59231	-0.7493	9	0.42905	T	0.14	.	9.9215	0.41468	0.0985:0.0:0.9015:0.0	.	32;32;32;32;32	B5A928;B5A927;P35916-3;E9PD35;P35916	.;.;.;.;VGFR3_HUMAN	M	32	ENSP00000261937:L32M;ENSP00000377016:L32M;ENSP00000426057:L32M	ENSP00000261937:L32M	L	-	1	2	FLT4	179991349	1.000000	0.71417	0.876000	0.34364	0.651000	0.38670	2.144000	0.42197	0.920000	0.36970	-0.375000	0.07067	TTG		0.632	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			Missense_Mutation
SLC26A8	116369	broad.mit.edu	37	6	35919049	35919050	+	Missense_Mutation	DNP	AC	AC	TG			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:35919049_35919050AC>TG	ENST00000490799.1	-	19	2715_2716	c.2362_2363GT>CA	c.(2362-2364)GTt>CAt	p.V788H	SLC26A8_ENST00000355574.2_Missense_Mutation_p.V788H|SLC26A8_ENST00000394602.2_Missense_Mutation_p.V683H	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.V788H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						GGCGTCGTGAACGCTGAGGAAC	0.49																																																1	Substitution - Missense(1)	ovary(1)	6																																								36027028	SO:0001583	missense	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.2362_2363delinsTG	6.37:g.35919049_35919050delinsTG	ENSP00000417638:p.Val788His		36027027		Missense_Mutation	DNP	ENST00000490799.1	37	CCDS4813.1	DNP	2	Broad																																																																																				0.490	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2			Missense_Mutation
KCTD20	222658	broad.mit.edu	37	6	36449518	36449518	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:36449518G>C	ENST00000373731.2	+	6	1229	c.838G>C	c.(838-840)Ggg>Cgg	p.G280R	KCTD20_ENST00000536244.1_Missense_Mutation_p.G135R|KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000544295.1_Missense_Mutation_p.G34R|KCTD20_ENST00000449081.2_Missense_Mutation_p.G114R	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	280					protein homooligomerization (GO:0051260)			p.G280R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						TCCACCAATGGGGGAGGAATA	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											92.0	84.0	87.0					6																	36449518		2203	4300	6503	36557496	SO:0001583	missense	222658			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.838G>C	6.37:g.36449518G>C	ENSP00000362836:p.Gly280Arg		36557496	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.375369	0.95923	.	.	ENSG00000112078	ENST00000373731;ENST00000544295;ENST00000449081;ENST00000536244	D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.88444	0.6438	M	0.66297	2.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87888	0.2682	10	0.87932	D	0	-22.7238	20.5827	0.99408	0.0:0.0:1.0:0.0	.	114;280	Q7Z5Y7-2;Q7Z5Y7	.;KCD20_HUMAN	R	280;34;114;135	ENSP00000362836:G280R;ENSP00000440150:G34R;ENSP00000412205:G114R;ENSP00000439118:G135R	ENSP00000362836:G280R	G	+	1	0	KCTD20	36557496	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	GGG		0.507	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562		Missense_Mutation
SYNCRIP	10492	broad.mit.edu	37	6	86324940	86324940	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:86324940T>C	ENST00000369622.3	-	11	1906	c.1406A>G	c.(1405-1407)tAt>tGt	p.Y469C	RP11-321N4.5_ENST00000503906.1_Missense_Mutation_p.I5V|SYNCRIP_ENST00000355238.6_Missense_Mutation_p.Y469C	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	469	3 X 4 AA repeats of Y-Y-G-Y.|8 X 3 AA repeats of R-G-G.|Interaction with APOBEC1.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Y469C(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		ATAACCATAATAATCATAATA	0.418																																																1	Substitution - Missense(1)	ovary(1)	6											28.0	28.0	28.0					6																	86324940		2202	4292	6494	86381659	SO:0001583	missense	10492			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1406A>G	6.37:g.86324940T>C	ENSP00000358635:p.Tyr469Cys		86381659	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	CCDS5005.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	9.796	1.179219	0.21787	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	T;T	0.32023	1.48;1.47	5.4	5.4	0.78164	.	0.056031	0.64402	D	0.000001	T	0.33990	0.0882	M	0.81942	2.565	0.58432	D	0.999991	P;D;P;P;D;D;P	0.54964	0.947;0.969;0.859;0.949;0.969;0.969;0.947	B;P;B;P;P;P;B	0.47162	0.237;0.54;0.339;0.54;0.54;0.54;0.339	T	0.39583	-0.9607	10	0.59425	D	0.04	.	15.4275	0.75065	0.0:0.0:0.0:1.0	.	469;434;371;317;434;469;469	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	C	469	ENSP00000347380:Y469C;ENSP00000358635:Y469C	ENSP00000347380:Y469C	Y	-	2	0	SYNCRIP	86381659	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.217000	0.72218	2.045000	0.60652	0.460000	0.39030	TAT		0.418	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372		Missense_Mutation
SCML4	256380	broad.mit.edu	37	6	108066282	108066282	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:108066282C>A	ENST00000369020.3	-	5	798	c.553G>T	c.(553-555)Gtc>Ttc	p.V185F	SCML4_ENST00000479803.1_5'Flank|SCML4_ENST00000369021.3_Missense_Mutation_p.V156F|SCML4_ENST00000369022.2_Missense_Mutation_p.V127F	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V156F(1)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		AAGCGGAGGACATAGCCGATG	0.597																																																1	Substitution - Missense(1)	ovary(1)	6											43.0	38.0	39.0					6																	108066282		2203	4300	6503	108172975	SO:0001583	missense	256380				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.553G>T	6.37:g.108066282C>A	ENSP00000358016:p.Val185Phe		108172975	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227450	0.58668	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.38	3.56	0.40772	.	0.056845	0.64402	D	0.000001	T	0.64800	0.2631	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	0.993;0.994;1.0	P;D;D	0.73380	0.875;0.939;0.98	T	0.69599	-0.5102	10	0.51188	T	0.08	.	12.254	0.54613	0.0:0.8601:0.0:0.1399	.	185;185;156	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	F	127;185;156;156	ENSP00000358018:V127F;ENSP00000358016:V185F;ENSP00000358017:V156F;ENSP00000404688:V156F	ENSP00000358016:V185F	V	-	1	0	SCML4	108172975	1.000000	0.71417	0.874000	0.34290	0.204000	0.24138	4.530000	0.60595	1.494000	0.48533	0.655000	0.94253	GTC		0.597	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128		Missense_Mutation
SAMD3	154075	broad.mit.edu	37	6	130476009	130476009	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:130476009G>C	ENST00000368134.2	-	11	1592	c.984C>G	c.(982-984)gaC>gaG	p.D328E	SAMD3_ENST00000457563.2_Missense_Mutation_p.D352E|SAMD3_ENST00000439090.2_Missense_Mutation_p.D328E|SAMD3_ENST00000437477.2_Missense_Mutation_p.D328E	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	328								p.D328E(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		GTTTAAGAATGTCCTTCAGAG	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											106.0	96.0	99.0					6																	130476009		2203	4300	6503	130517702	SO:0001583	missense	154075			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.984C>G	6.37:g.130476009G>C	ENSP00000357116:p.Asp328Glu		130517702	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	CCDS34539.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	5.697	0.313100	0.10789	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477	T;T;T;T	0.45276	0.92;0.9;0.92;0.92	5.74	-4.31	0.03698	.	0.232981	0.38272	N	0.001753	T	0.07413	0.0187	N	0.21448	0.665	0.53688	D	0.999976	B	0.09022	0.002	B	0.10450	0.005	T	0.14755	-1.0461	10	0.31617	T	0.26	.	0.7567	0.01000	0.3714:0.1649:0.2561:0.2076	.	328	Q8N6K7	SAMD3_HUMAN	E	328;352;328;328	ENSP00000357116:D328E;ENSP00000402092:D352E;ENSP00000403565:D328E;ENSP00000391163:D328E	ENSP00000357116:D328E	D	-	3	2	SAMD3	130517702	0.010000	0.17322	0.476000	0.27291	0.962000	0.63368	-0.350000	0.07721	-0.549000	0.06191	-0.244000	0.11960	GAC		0.348	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552		Missense_Mutation
ALDH8A1	64577	broad.mit.edu	37	6	135253943	135253943	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:135253943C>G	ENST00000265605.2	-	5	888	c.820G>C	c.(820-822)Gca>Cca	p.A274P	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.A224P|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.A274P	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	274					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.A274P(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CTGACGGTTGCCGGAATGCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											89.0	88.0	88.0					6																	135253943		2203	4300	6503	135295636	SO:0001583	missense	64577			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.820G>C	6.37:g.135253943C>G	ENSP00000265605:p.Ala274Pro		135295636	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	8.726	0.915504	0.17907	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.78246	-1.16;-1.16;-1.16	5.3	-1.1	0.09872	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.244890	0.47455	D	0.000233	T	0.57666	0.2069	M	0.62088	1.915	0.25616	N	0.986444	B;B;B	0.30634	0.288;0.244;0.288	B;B;B	0.37480	0.251;0.162;0.251	T	0.58457	-0.7633	10	0.59425	D	0.04	.	6.7228	0.23340	0.0:0.2307:0.1324:0.6369	.	224;274;274	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	P	274;274;224	ENSP00000265605:A274P;ENSP00000356819:A274P;ENSP00000356821:A224P	ENSP00000265605:A274P	A	-	1	0	ALDH8A1	135295636	0.946000	0.32159	0.000000	0.03702	0.003000	0.03518	1.673000	0.37534	-0.100000	0.12241	-1.109000	0.02080	GCA		0.582	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			Missense_Mutation
AKAP12	9590	broad.mit.edu	37	6	151673288	151673288	+	Silent	SNP	T	T	G	rs142243463	byFrequency	TCGA-04-1357-01	TCGA-04-1357-11			T	G	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr6:151673288T>G	ENST00000253332.1	+	3	3951	c.3762T>G	c.(3760-3762)acT>acG	p.T1254T	AKAP12_ENST00000402676.2_Silent_p.T1254T|AKAP12_ENST00000359755.5_Silent_p.T1149T|AKAP12_ENST00000354675.6_Silent_p.T1156T			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1254					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.T1254T(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CAGTGGAAACTGTATCCATTC	0.438																																					Melanoma(141;1616 1805 10049 24534 51979)											1	Substitution - coding silent(1)	ovary(1)	6											73.0	68.0	69.0					6																	151673288		2203	4300	6503	151714981	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.3762T>G	6.37:g.151673288T>G			151714981	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1	SNP	55	Broad																																																																																				0.438	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			Silent
ADCY1	107	broad.mit.edu	37	7	45697379	45697379	+	Missense_Mutation	SNP	C	C	T	rs566259707		TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr7:45697379C>T	ENST00000297323.7	+	6	1224	c.1202C>T	c.(1201-1203)aCg>aTg	p.T401M	ADCY1_ENST00000432715.1_Missense_Mutation_p.T176M	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	401					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.T401M(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGTCTGCACACGGGCAGGGTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		18993	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7											121.0	90.0	100.0					7																	45697379		2203	4300	6503	45663904	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1202C>T	7.37:g.45697379C>T	ENSP00000297323:p.Thr401Met		45663904	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516560	0.85495	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.86497	-2.13;-2.13	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.93200	0.7834	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.71870	0.881;0.975	D	0.94018	0.7290	10	0.72032	D	0.01	.	14.9371	0.70964	0.0:1.0:0.0:0.0	.	401;176	Q08828;C9J1J0	ADCY1_HUMAN;.	M	176;401;401	ENSP00000392721:T176M;ENSP00000297323:T401M	ENSP00000297323:T401M	T	+	2	0	ADCY1	45663904	0.999000	0.42202	0.998000	0.56505	0.999000	0.98932	4.269000	0.58890	2.446000	0.82766	0.655000	0.94253	ACG		0.597	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		Missense_Mutation
HEPACAM2	253012	broad.mit.edu	37	7	92844969	92844969	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr7:92844969G>C	ENST00000394468.2	-	3	537	c.460C>G	c.(460-462)Cat>Gat	p.H154D	HEPACAM2_ENST00000453812.2_Missense_Mutation_p.H177D|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.H142D|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.H142D	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	154	Ig-like C2-type 1.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.H142D(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						GAGGGAGGATGAATCTGCACC	0.443																																																1	Substitution - Missense(1)	ovary(1)	7											87.0	80.0	82.0					7																	92844969		2203	4300	6503	92682905	SO:0001583	missense	253012			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.460C>G	7.37:g.92844969G>C	ENSP00000377980:p.His154Asp		92682905	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	CCDS43616.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479469	0.26511	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.09445	2.98;2.98;2.98;2.98	5.59	4.69	0.59074	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.448650	0.28772	N	0.014183	T	0.09335	0.0230	L	0.35414	1.06	0.19775	N	0.999951	B;B;B;B	0.23490	0.014;0.086;0.007;0.005	B;B;B;B	0.24848	0.034;0.056;0.013;0.014	T	0.22312	-1.0220	10	0.38643	T	0.18	-0.3468	10.1214	0.42623	0.0825:0.1728:0.7448:0.0	.	177;142;154;142	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	D	154;142;142;177	ENSP00000377980:H154D;ENSP00000340532:H142D;ENSP00000389592:H142D;ENSP00000390204:H177D	ENSP00000340532:H142D	H	-	1	0	HEPACAM2	92682905	0.686000	0.27661	0.555000	0.28281	0.848000	0.48234	1.788000	0.38714	1.442000	0.47568	0.591000	0.81541	CAT		0.443	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151		Missense_Mutation
PMPCB	9512	broad.mit.edu	37	7	102949405	102949405	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr7:102949405G>C	ENST00000249269.4	+	8	894	c.856G>C	c.(856-858)Gtg>Ctg	p.V286L	PMPCB_ENST00000428154.1_Missense_Mutation_p.V286L|PMPCB_ENST00000420236.2_Missense_Mutation_p.V181L	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	286					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.V286L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTAGATTCGTGTGAGGGATGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											143.0	124.0	131.0					7																	102949405		2203	4300	6503	102736641	SO:0001583	missense	9512			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.856G>C	7.37:g.102949405G>C	ENSP00000249269:p.Val286Leu		102736641	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	37	CCDS5730.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	6.596	0.478379	0.12521	.	.	ENSG00000105819	ENST00000249269;ENST00000428154;ENST00000420236	T;T;T	0.29917	1.55;1.55;1.55	5.35	3.55	0.40652	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.113396	0.64402	D	0.000014	T	0.24431	0.0592	L	0.35644	1.08	0.58432	D	0.999999	B;B;B;B;B;P	0.39717	0.023;0.02;0.372;0.099;0.099;0.684	B;B;B;B;B;B	0.42188	0.033;0.042;0.213;0.213;0.213;0.379	T	0.02371	-1.1169	10	0.14656	T	0.56	.	10.0496	0.42208	0.2349:0.0:0.7651:0.0	.	181;181;286;277;286;286	E7ERZ4;B4DM90;A8K1E9;Q96CP5;O75439;G3V0E4	.;.;.;.;MPPB_HUMAN;.	L	286;286;181	ENSP00000249269:V286L;ENSP00000390035:V286L;ENSP00000410393:V181L	ENSP00000249269:V286L	V	+	1	0	PMPCB	102736641	0.994000	0.37717	0.978000	0.43139	0.824000	0.46624	2.206000	0.42779	0.750000	0.32877	-0.143000	0.13931	GTG		0.413	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279		Missense_Mutation
XKR6	286046	broad.mit.edu	37	8	10782160	10782160	+	Silent	SNP	G	G	A			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr8:10782160G>A	ENST00000416569.2	-	2	971	c.945C>T	c.(943-945)agC>agT	p.S315S	XKR6_ENST00000304437.2_Silent_p.S36S	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	315						integral component of membrane (GO:0016021)		p.S315S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		GGGTCTCGGCGCTGTTCTTCT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	8											71.0	70.0	70.0					8																	10782160		2203	4300	6503	10819570	SO:0001819	synonymous_variant	286046			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.945C>T	8.37:g.10782160G>A			10819570	Q8TBA0	Silent	SNP	ENST00000416569.2	37	CCDS5978.2	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	10.50	1.366755	0.24771	.	.	ENSG00000171044	ENST00000382461	.	.	.	4.84	0.474	0.16768	.	.	.	.	.	T	0.56499	0.1989	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47058	-0.9146	4	.	.	.	-2.8682	8.9704	0.35903	0.4883:0.0:0.5117:0.0	.	.	.	.	V	92	.	.	A	-	2	0	XKR6	10819570	0.987000	0.35691	0.979000	0.43373	0.986000	0.74619	0.217000	0.17603	-0.240000	0.09696	0.457000	0.33378	GCG		0.667	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683		Silent
WRN	7486	broad.mit.edu	37	8	30942737	30942737	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chr8:30942737A>G	ENST00000298139.5	+	11	1655	c.1406A>G	c.(1405-1407)gAa>gGa	p.E469G		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	469	2 X 27 AA tandem repeats of H-L-S-P-N-D- N-E-N-D-T-S-Y-V-I-E-S-D-E-D-L-E-M-E-M-L- K.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.E469G(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GAGAGTGATGAAGATTTAGAA	0.249			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	1	Substitution - Missense(1)	ovary(1)	8											92.0	109.0	103.0					8																	30942737		2201	4286	6487	31062279	SO:0001583	missense	7486	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1406A>G	8.37:g.30942737A>G	ENSP00000298139:p.Glu469Gly		31062279	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	16.99	3.275267	0.59649	.	.	ENSG00000165392	ENST00000298139	T	0.50813	0.73	3.17	3.17	0.36434	.	0.702782	0.10134	U	0.711717	T	0.46698	0.1406	N	0.08118	0	0.31609	N	0.651701	D	0.89917	1.0	D	0.69142	0.962	T	0.53085	-0.8488	10	0.72032	D	0.01	-20.1157	10.0203	0.42039	1.0:0.0:0.0:0.0	.	469	Q14191	WRN_HUMAN	G	469	ENSP00000298139:E469G	ENSP00000298139:E469G	E	+	2	0	WRN	31062279	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.773000	0.62331	1.676000	0.50930	0.477000	0.44152	GAA		0.249	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			Missense_Mutation
PNMA3	29944	broad.mit.edu	37	X	152225867	152225867	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-04-1357-01	TCGA-04-1357-11	g.chrX:152225867T>C	ENST00000370264.4	+	1	481	c.455T>C	c.(454-456)gTg>gCg	p.V152A	PNMA3_ENST00000370265.4_Missense_Mutation_p.V152A|PNMA3_ENST00000447306.1_Missense_Mutation_p.V152A			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	152					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V152A(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					ggggcagcagtgcagcctctg	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											49.0	48.0	48.0					X																	152225867		2203	4299	6502	151976523	SO:0001583	missense	29944			AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.455T>C	X.37:g.152225867T>C	ENSP00000359286:p.Val152Ala		151976523	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	CCDS35435.2	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	t	9.560	1.118212	0.20877	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.11385	2.78;2.78;2.78	1.95	0.705	0.18127	.	.	.	.	.	T	0.06600	0.0169	L	0.34521	1.04	0.09310	N	1	B	0.30634	0.288	B	0.29785	0.107	T	0.41502	-0.9505	9	0.18276	T	0.48	.	3.2639	0.06858	0.0:0.2724:0.0:0.7276	.	152	Q9UL41	PNMA3_HUMAN	A	152	ENSP00000359288:V152A;ENSP00000407642:V152A;ENSP00000359286:V152A	ENSP00000359286:V152A	V	+	2	0	PNMA3	151976523	0.001000	0.12720	0.071000	0.20095	0.199000	0.23934	0.813000	0.27225	0.111000	0.17947	0.341000	0.21757	GTG		0.532	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578179	7578180	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-04-1357-01	TCGA-04-1357-11	g.chr17:7578179_7578180delCA	ENST00000269305.4	-	6	858_859	c.669_670delTG	c.(667-672)cctgagfs	p.E224fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.E224fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.E224fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.E224fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.E224fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Frame_Shift_Del_p.E224fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	224	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(13)|p.0?(8)|p.E224*(5)|p.E224K(5)|p.P223P(4)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACCAGACCTCAGGCGGCTCAT	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	39	Unknown(13)|Whole gene deletion(8)|Substitution - Nonsense(5)|Substitution - Missense(5)|Substitution - coding silent(4)|Deletion - Frameshift(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	biliary_tract(5)|endometrium(5)|stomach(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|urinary_tract(3)|central_nervous_system(2)|oesophagus(2)|skin(2)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|large_intestine(1)|breast(1)	17																																								7518905	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.669_670delTG	17.37:g.7578179_7578180delCA	ENSP00000269305:p.Glu224fs		7518904	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	29	Broad																																																																																				0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
NBPF15	284565	broad.mit.edu	37	1	148753330	148753336	+	Frame_Shift_Del	DEL	TTATCTT	TTATCTT	-			TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:148753330_148753336delTTATCTT	ENST00000417839.1	+	12	1537_1543	c.1347_1353delTTATCTT	c.(1345-1353)gattatcttfs	p.DYL449fs		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		449	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CTCCTTCAGATTATCTTGAACTGCCTG	0.488																																																0			1								52,918		24,4,457						0.1	0.0			1	124,1206		55,14,596	no	frameshift	NBPF16	NM_001102663.1		79,18,1053	A1A1,A1R,RR		9.3233,5.3608,7.6522				176,2124				147019960	SO:0001589	frameshift_variant	728936																														ENST00000417839.1:c.1347_1353delTTATCTT	1.37:g.148753330_148753336delTTATCTT	ENSP00000395369:p.Asp449fs		147019954	A8MPT6	Frame_Shift_Del	DEL	ENST00000417839.1	37	CCDS41384.1	DEL	52	Broad																																																																																				0.488	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			Frame_Shift_Del
SLC45A3	85414	broad.mit.edu	37	1	205632218	205632253	+	In_Frame_Del	DEL	GCCGACAGCCCTTCTGCTGGCTCGGTGGGGCCCAGC	GCCGACAGCCCTTCTGCTGGCTCGGTGGGGCCCAGC	-	rs72434280|rs548999847|rs71152447|rs528961181|rs370721708	byFrequency	TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-04-1357-01	TCGA-04-1357-11	g.chr1:205632218_205632253delGCCGACAGCCCTTCTGCTGGCTCGGTGGGGCCCAGC	ENST00000367145.3	-	3	961_996	c.666_701delGCTGGGCCCCACCGAGCCAGCAGAAGGGCTGTCGGC	c.(664-702)gcgctgggccccaccgagccagcagaagggctgtcggcc>gcc	p.222_234ALGPTEPAEGLSA>A	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	222					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.L223_A234delLGPTEPAEGLSA(1)	SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			CAAGGAGGGGGCCGACAGCCCTTCTGCTGGCTCGGTGGGGCCCAGCGCTGCCTCCT	0.691			T	"""ETV1, ETV5, ELK4, ERG"""	prostate									172	0.034345	0.0023	0.0937	5008	,	,		21924	0.0903		0.008	False		,,,				2504	0.0051						Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	1	Deletion - In frame(1)	ovary(1)	1																																								203898876	SO:0001651	inframe_deletion	85414			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.666_701delGCTGGGCCCCACCGAGCCAGCAGAAGGGCTGTCGGC	1.37:g.205632218_205632253delGCCGACAGCCCTTCTGCTGGCTCGGTGGGGCCCAGC	ENSP00000356113:p.Ala222_Ser233del		203898841	A8K2U9	In_Frame_Del	DEL	ENST00000367145.3	37	CCDS1458.1	DEL	42	Broad																																																																																				0.691	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090619.1	NM_033102		In_Frame_Del
WIZ	58525	broad.mit.edu	37	19	15537868	15537884	+	Frame_Shift_Del	DEL	CCCCCGGCAGCATCTCC	CCCCCGGCAGCATCTCC	-	rs200893760|rs374089802	byFrequency	TCGA-04-1357-01	TCGA-04-1357-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-04-1357-01	TCGA-04-1357-11	g.chr19:15537868_15537884delCCCCCGGCAGCATCTCC	ENST00000389282.4	-	6	3774_3790	c.3561_3577delGGAGATGCTGCCGGGGG	c.(3559-3579)cgggagatgctgccgggggccfs	p.EMLPGA1188fs	WIZ_ENST00000599910.2_Frame_Shift_Del_p.EMLPGA505fs|WIZ_ENST00000263381.7_Frame_Shift_Del_p.EMLPGA331fs|WIZ_ENST00000599686.3_Frame_Shift_Del_p.EMLPGA372fs|WIZ_ENST00000545156.1_Frame_Shift_Del_p.EMLPGA502fs			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1188					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.E331fs*9(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CCATGAAGGGCCCCCGGCAGCATCTCCCGCTTGATCT	0.613																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								15398884	SO:0001589	frameshift_variant	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3561_3577delGGAGATGCTGCCGGGGG	19.37:g.15537868_15537884delCCCCCGGCAGCATCTCC	ENSP00000373933:p.Glu1188fs		15398868	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Frame_Shift_Del	DEL	ENST00000389282.4	37		DEL	26	Broad																																																																																				0.613	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241		Frame_Shift_Del
