#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
EVC	2121	genome.wustl.edu	37	4	5733349	5733349	+	Silent	SNP	G	G	T	rs200101865		TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr4:5733349G>T	ENST00000264956.6	+	4	766	c.582G>T	c.(580-582)cgG>cgT	p.R194R	EVC_ENST00000382674.2_Silent_p.R194R|EVC_ENST00000509451.1_Silent_p.R194R	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	194					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R194R(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CCTTCCTCCGGGTGAACGCCT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	4											60.0	50.0	54.0					4																	5733349		2203	4300	6503	5784250	SO:0001819	synonymous_variant	2121			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.582G>T	4.37:g.5733349G>T			5784250		Silent	SNP	ENST00000264956.6	37	CCDS3383.1	SNP	43	WashU																																																																																				0.627	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1			Silent
TP53	7157	genome.wustl.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	T	C	rs587780073		TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr17:7577580T>C	ENST00000269305.4	-	7	890	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	TP53_ENST00000413465.2_Missense_Mutation_p.Y234C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.Y234C|TP53_ENST00000420246.2_Missense_Mutation_p.Y234C|TP53_ENST00000359597.4_Missense_Mutation_p.Y234C|TP53_ENST00000445888.2_Missense_Mutation_p.Y234C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234C(94)|p.Y234S(9)|p.Y141C(8)|p.0?(8)|p.?(5)|p.Y234del(3)|p.Y141S(2)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234F(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234R(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTAGTTGTAGTGGATGGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	141	Substitution - Missense(115)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)	lung(32)|haematopoietic_and_lymphoid_tissue(17)|breast(17)|ovary(15)|central_nervous_system(10)|urinary_tract(9)|upper_aerodigestive_tract(8)|oesophagus(7)|biliary_tract(6)|large_intestine(5)|kidney(4)|bone(4)|cervix(2)|stomach(2)|adrenal_gland(1)|skin(1)|liver(1)	17	GRCh37	CM035576	TP53	M							119.0	95.0	103.0					17																	7577580		2203	4300	6503	7518305	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.701A>G	17.37:g.7577580T>C	ENSP00000269305:p.Tyr234Cys		7518305	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146603	0.57044	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99826	-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98	4.62	3.49	0.39957	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99778	0.9908	M	0.88105	2.93	0.51012	D	0.999909	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.982;0.998;0.997;0.985;0.994;0.999	D	0.98045	1.0384	10	0.87932	D	0	-10.1131	9.0203	0.36195	0.1783:0.0:0.0:0.8216	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234C;ENSP00000352610:Y234C;ENSP00000269305:Y234C;ENSP00000398846:Y234C;ENSP00000391127:Y234C;ENSP00000391478:Y234C;ENSP00000425104:Y102C;ENSP00000423862:Y141C	ENSP00000269305:Y234C	Y	-	2	0	TP53	7518305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	0.835000	0.34877	0.379000	0.24179	TAC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
SETD5	55209	genome.wustl.edu	37	3	9475570	9475570	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr3:9475570G>A	ENST00000406341.1	+	3	303	c.113G>A	c.(112-114)aGc>aAc	p.S38N	SETD5_ENST00000402198.1_Missense_Mutation_p.S38N|SETD5_ENST00000302463.6_5'UTR|SETD5_ENST00000407969.1_Missense_Mutation_p.S38N|SETD5_ENST00000402466.1_5'UTR			Q9C0A6	SETD5_HUMAN	SET domain containing 5	38								p.S38N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AATGAGAAGAGCGTGTATTCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											183.0	181.0	182.0					3																	9475570		2012	4174	6186	9450570	SO:0001583	missense	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.113G>A	3.37:g.9475570G>A	ENSP00000383939:p.Ser38Asn		9450570	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	7.739	0.700900	0.15172	.	.	ENSG00000168137	ENST00000450326;ENST00000402198;ENST00000406341;ENST00000407969	T;D;D;D	0.91180	1.39;-2.8;-2.8;-2.73	6.07	5.1	0.69264	.	.	.	.	.	T	0.78916	0.4359	N	0.13003	0.285	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.71258	-0.4646	9	0.30854	T	0.27	-9.524	3.6319	0.08135	0.1665:0.2771:0.5563:0.0	.	38	Q9C0A6	SETD5_HUMAN	N	38	ENSP00000413786:S38N;ENSP00000385852:S38N;ENSP00000383939:S38N;ENSP00000384114:S38N	ENSP00000385852:S38N	S	+	2	0	SETD5	9450570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.234000	0.51320	2.890000	0.99128	0.585000	0.79938	AGC		0.453	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		Missense_Mutation
RDH8	50700	genome.wustl.edu	37	19	10127889	10127889	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:10127889T>A	ENST00000171214.1	+	2	509	c.260T>A	c.(259-261)cTg>cAg	p.L87Q	RDH8_ENST00000591589.1_Missense_Mutation_p.L107Q	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	87					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.L87Q(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	GTGGACGTGCTGGGTGAGACT	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											71.0	63.0	66.0					19																	10127889		2203	4300	6503	9988889	SO:0001583	missense	50700			AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.260T>A	19.37:g.10127889T>A	ENSP00000171214:p.Leu87Gln		9988889	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37		SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249234	0.80024	.	.	ENSG00000080511	ENST00000171214	D	0.96856	-4.15	4.77	4.77	0.60923	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000002	D	0.98874	0.9619	H	0.98833	4.345	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.98939	1.0790	10	0.87932	D	0	.	12.2696	0.54697	0.0:0.0:0.0:1.0	.	87	Q9NYR8	RDH8_HUMAN	Q	87	ENSP00000171214:L87Q	ENSP00000171214:L87Q	L	+	2	0	RDH8	9988889	1.000000	0.71417	0.978000	0.43139	0.913000	0.54294	7.509000	0.81698	1.780000	0.52325	0.533000	0.62120	CTG		0.582	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Missense_Mutation
XPC	7508	genome.wustl.edu	37	3	14211987	14211987	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr3:14211987G>T	ENST00000285021.7	-	3	577	c.363C>A	c.(361-363)gaC>gaA	p.D121E	XPC_ENST00000449060.2_Missense_Mutation_p.D121E	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	121	Glu-rich (acidic).				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.D121E(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTCATTGCTGTCTTCATTCA	0.408			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Substitution - Missense(1)	ovary(1)	3											352.0	329.0	336.0					3																	14211987		1903	4127	6030	14186991	SO:0001583	missense	7508	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.363C>A	3.37:g.14211987G>T	ENSP00000285021:p.Asp121Glu		14186991	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	37	CCDS46763.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075085	0.36566	.	.	ENSG00000154767	ENST00000285021;ENST00000449060;ENST00000511155	T;T;T	0.48201	0.82;0.82;0.82	5.65	1.32	0.21799	.	0.956661	0.08755	N	0.898545	T	0.18923	0.0454	N	0.08118	0	0.09310	N	1	B;B	0.34015	0.0;0.435	B;B	0.24541	0.001;0.054	T	0.11567	-1.0582	10	0.02654	T	1	-6.3837	6.6427	0.22919	0.2416:0.1264:0.632:0.0	.	121;121	E9PH69;Q01831	.;XPC_HUMAN	E	121;121;115	ENSP00000285021:D121E;ENSP00000404002:D121E;ENSP00000423867:D115E	ENSP00000285021:D121E	D	-	3	2	XPC	14186991	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	-0.328000	0.07945	0.233000	0.21120	0.650000	0.86243	GAC		0.408	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	NM_004628		Missense_Mutation
MYH11	4629	genome.wustl.edu	37	16	15835615	15835615	+	Splice_Site	SNP	A	A	T			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr16:15835615A>T	ENST00000300036.5	-	21	2762		c.e21+1		MYH11_ENST00000452625.2_Splice_Site|MYH11_ENST00000396324.3_Splice_Site|AF001548.6_ENST00000577048.1_RNA|MYH11_ENST00000576790.2_Splice_Site	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.?(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CCATACAGGTACCTGCGAGTG	0.612			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Unknown(1)	ovary(1)	16											269.0	209.0	229.0					16																	15835615		2197	4300	6497	15743116	SO:0001630	splice_region_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2652+1T>A	16.37:g.15835615A>T			15743116	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Splice_Site_SNP	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100907	0.76983	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0215	0.64558	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH11	15743116	1.000000	0.71417	0.896000	0.35187	0.951000	0.60555	6.861000	0.75478	1.915000	0.55452	0.459000	0.35465	.		0.612	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	Intron	Splice_Site_SNP
EPS15L1	58513	genome.wustl.edu	37	19	16472718	16472718	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:16472718C>G	ENST00000248070.6	-	23	2597	c.2458G>C	c.(2458-2460)Gac>Cac	p.D820H	EPS15L1_ENST00000535753.2_3'UTR|EPS15L1_ENST00000455140.2_Missense_Mutation_p.D820H|EPS15L1_ENST00000594975.1_3'UTR	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	820	15 X 3 AA repeats of D-P-F.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D820H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TCGCCGCTGTCAGCCCCGAGT	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											32.0	40.0	38.0					19																	16472718		2203	4300	6503	16333718	SO:0001583	missense	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.2458G>C	19.37:g.16472718C>G	ENSP00000248070:p.Asp820His		16333718	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	37	CCDS32944.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846938	0.91277	.	.	ENSG00000127527	ENST00000455140;ENST00000248070	T;T	0.55052	0.54;0.54	4.96	4.96	0.65561	.	0.110075	0.64402	D	0.000011	T	0.60534	0.2276	L	0.47716	1.5	0.80722	D	1	D;P	0.54397	0.966;0.911	P;P	0.54401	0.751;0.66	T	0.62812	-0.6775	10	0.52906	T	0.07	.	17.192	0.86882	0.0:1.0:0.0:0.0	.	820;820	Q9UBC2;G3V0H2	EP15R_HUMAN;.	H	820	ENSP00000393313:D820H;ENSP00000248070:D820H	ENSP00000248070:D820H	D	-	1	0	EPS15L1	16333718	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.335000	0.79234	2.318000	0.78349	0.561000	0.74099	GAC		0.527	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235		Missense_Mutation
PDE4C	5143	genome.wustl.edu	37	19	18327666	18327666	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:18327666A>G	ENST00000355502.3	-	16	2241	c.1370T>C	c.(1369-1371)cTg>cCg	p.L457P	PDE4C_ENST00000539010.1_Missense_Mutation_p.L226P|PDE4C_ENST00000597297.1_Missense_Mutation_p.L227P|PDE4C_ENST00000594465.3_Missense_Mutation_p.L457P|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000447275.3_Missense_Mutation_p.L351P|PDE4C_ENST00000598111.2_Missense_Mutation_p.L172P|PDE4C_ENST00000262805.12_Missense_Mutation_p.L425P|PDE4C_ENST00000594617.3_Missense_Mutation_p.L457P			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	457					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.L457P(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	ATGGTTCTCCAGCACCGAGGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											92.0	85.0	87.0					19																	18327666		2203	4300	6503	18188666	SO:0001583	missense	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1370T>C	19.37:g.18327666A>G	ENSP00000347689:p.Leu457Pro		18188666	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	37	CCDS12373.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	a	16.10	3.028077	0.54790	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	4.52	4.52	0.55395	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.64402	D	0.000004	D	0.96599	0.8890	H	0.99058	4.415	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;1.0;1.0;0.989	D	0.97267	0.9908	10	0.87932	D	0	.	11.8181	0.52222	1.0:0.0:0.0:0.0	.	457;425;263;172	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	P	536;457;445;425;351;263;171;226;566	ENSP00000347689:L457P;ENSP00000262805:L425P;ENSP00000402091:L351P;ENSP00000439470:L226P	ENSP00000262805:L425P	L	-	2	0	PDE4C	18188666	1.000000	0.71417	0.996000	0.52242	0.229000	0.25112	8.803000	0.91915	1.682000	0.51000	0.392000	0.25879	CTG		0.592	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			Missense_Mutation
DNAH3	55567	genome.wustl.edu	37	16	21063050	21063050	+	Silent	SNP	A	A	G			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr16:21063050A>G	ENST00000261383.3	-	29	4178	c.4179T>C	c.(4177-4179)taT>taC	p.Y1393Y	DNAH3_ENST00000415178.1_Silent_p.Y1393Y	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1393	AAA 1. {ECO:0000250}.			Y -> F (in Ref. 4; CAA10558). {ECO:0000305}.	cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.Y1393Y(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CCAGGTACTCATAGCCATACA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	16											122.0	121.0	121.0					16																	21063050		2201	4300	6501	20970551	SO:0001819	synonymous_variant	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4179T>C	16.37:g.21063050A>G			20970551	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	8	WashU																																																																																				0.547	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Silent
OR4E2	26686	genome.wustl.edu	37	14	22134199	22134199	+	Silent	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr14:22134199C>G	ENST00000408935.1	+	1	903	c.903C>G	c.(901-903)ctC>ctG	p.L301L		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L301L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TGAAGCAGCTCAGGCAGAGAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	14											45.0	41.0	42.0					14																	22134199		1943	4157	6100	21204039	SO:0001819	synonymous_variant	26686				CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.903C>G	14.37:g.22134199C>G			21204039	Q6IET6|Q96R62	Silent	SNP	ENST00000408935.1	37	CCDS41916.1	SNP	29	WashU																																																																																				0.423	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			Silent
MYO18A	399687	genome.wustl.edu	37	17	27417887	27417887	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr17:27417887C>G	ENST00000527372.1	-	35	5425	c.5245G>C	c.(5245-5247)Gag>Cag	p.E1749Q	MYO18A_ENST00000354329.4_Missense_Mutation_p.E1749Q|MYO18A_ENST00000531253.1_Missense_Mutation_p.E1749Q|MYO18A_ENST00000533112.1_Missense_Mutation_p.E1712Q|MYO18A_ENST00000529578.1_5'UTR|TIAF1_ENST00000408971.2_5'UTR	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1749					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.E1749Q(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGATCTTCCTCCAGCCGGTTC	0.582																																					Esophageal Squamous(182;472 2015 7001 15270 22562)											1	Substitution - Missense(1)	ovary(1)	17											179.0	175.0	176.0					17																	27417887		2068	4215	6283	24442013	SO:0001583	missense	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5245G>C	17.37:g.27417887C>G	ENSP00000437073:p.Glu1749Gln		24442013	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976249	0.53720	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105	T;D;T;T	0.83673	-1.42;-1.75;-1.42;-1.42	4.93	3.95	0.45737	Myosin tail (1);	0.047186	0.85682	D	0.000000	D	0.90324	0.6973	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.76494	0.976;0.999;0.998;0.999	P;D;P;D	0.70487	0.743;0.943;0.898;0.969	D	0.91686	0.5362	10	0.66056	D	0.02	.	15.3615	0.74478	0.0:0.8597:0.1403:0.0	.	1352;1712;1749;1749	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	Q	1749;1712;1712;1749;1749;645;645;1352;30	ENSP00000346291:E1749Q;ENSP00000435932:E1712Q;ENSP00000434228:E1749Q;ENSP00000437073:E1749Q	ENSP00000346291:E1749Q	E	-	1	0	MYO18A	24442013	1.000000	0.71417	0.992000	0.48379	0.052000	0.14988	7.261000	0.78400	1.423000	0.47198	-0.176000	0.13171	GAG		0.582	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		Missense_Mutation
DFNA5	1687	genome.wustl.edu	37	7	24784261	24784261	+	Silent	SNP	G	G	A	rs376703607		TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr7:24784261G>A	ENST00000342947.3	-	3	749	c.324C>T	c.(322-324)cgC>cgT	p.R108R	DFNA5_ENST00000419307.1_5'UTR|DFNA5_ENST00000409775.3_Silent_p.R108R|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000409970.1_5'UTR	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	108					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)		p.R108R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GGCTCTCTACGCGGCTGCTGC	0.552																																					GBM(78;184 1250 20134 20900 23600)											1	Substitution - coding silent(1)	ovary(1)	7						G	,,	0,4406		0,0,2203	94.0	86.0	89.0		324,,324	-11.4	0.0	7		89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,utr-5,coding-synonymous	DFNA5	NM_001127453.1,NM_001127454.1,NM_004403.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	108/497,,108/497	24784261	1,13005	2203	4300	6503	24750786	SO:0001819	synonymous_variant	1687			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.324C>T	7.37:g.24784261G>A			24750786	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Silent	SNP	ENST00000342947.3	37	CCDS5389.1	SNP	38	WashU																																																																																				0.552	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403		Silent
DNMT3A	1788	genome.wustl.edu	37	2	25457159	25457159	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr2:25457159C>T	ENST00000264709.3	-	23	3065	c.2728G>A	c.(2728-2730)Gcg>Acg	p.A910T	DNMT3A_ENST00000380746.4_Missense_Mutation_p.A721T|DNMT3A_ENST00000321117.5_Missense_Mutation_p.A910T|DNMT3A_ENST00000402667.1_Missense_Mutation_p.A687T|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	910	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.A910T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACACACACGCAAAATACTCC	0.502			"""Mis, F, N, S"""		AML																																		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	1	Substitution - Missense(1)	ovary(1)	2											73.0	70.0	71.0					2																	25457159		2203	4300	6503	25310663	SO:0001583	missense	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2728G>A	2.37:g.25457159C>T	ENSP00000264709:p.Ala910Thr		25310663	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987982	0.74589	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.97870	0.9300	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.986	D;B	0.64687	0.928;0.306	D	0.98567	1.0644	10	0.87932	D	0	-4.1862	18.0755	0.89426	0.0:1.0:0.0:0.0	.	910;721	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	T	721;910;910;687	ENSP00000370122:A721T;ENSP00000324375:A910T;ENSP00000264709:A910T;ENSP00000384237:A687T	ENSP00000264709:A910T	A	-	1	0	DNMT3A	25310663	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.916000	0.69981	2.595000	0.87683	0.561000	0.74099	GCG		0.502	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552		Missense_Mutation
ITPR2	3709	genome.wustl.edu	37	12	26572092	26572092	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr12:26572092T>G	ENST00000381340.3	-	50	7416	c.7000A>C	c.(7000-7002)Acc>Ccc	p.T2334P	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2334					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.T2334P(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TACCCACGGGTGAACGTGCCA	0.433																																																1	Substitution - Missense(1)	ovary(1)	12											92.0	92.0	92.0					12																	26572092		1978	4161	6139	26463359	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7000A>C	12.37:g.26572092T>G	ENSP00000370744:p.Thr2334Pro		26463359	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	22.8	4.334787	0.81801	.	.	ENSG00000123104	ENST00000381340	D	0.92199	-2.99	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.94026	0.8086	L	0.49778	1.585	0.80722	D	1	D	0.71674	0.998	D	0.71184	0.972	D	0.92801	0.6256	10	0.30078	T	0.28	.	15.2716	0.73705	0.0:0.0:0.0:1.0	.	2334	Q14571	ITPR2_HUMAN	P	2334	ENSP00000370744:T2334P	ENSP00000370744:T2334P	T	-	1	0	ITPR2	26463359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.104000	0.71498	2.193000	0.70182	0.533000	0.62120	ACC		0.433	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		Missense_Mutation
DEPDC5	9681	genome.wustl.edu	37	22	32206507	32206507	+	Splice_Site	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr22:32206507C>T	ENST00000382112.3	+	19	1395	c.1325C>T	c.(1324-1326)tCt>tTt	p.S442F	DEPDC5_ENST00000536766.1_Splice_Site_p.S414F|DEPDC5_ENST00000400248.2_Splice_Site_p.S442F|DEPDC5_ENST00000400242.3_Splice_Site_p.S442F|DEPDC5_ENST00000382105.2_Splice_Site_p.S442F|DEPDC5_ENST00000535622.1_Splice_Site_p.S442F|DEPDC5_ENST00000266091.3_Splice_Site_p.S442F|DEPDC5_ENST00000400249.2_Splice_Site_p.S442F|DEPDC5_ENST00000382111.2_Splice_Site_p.S442F|DEPDC5_ENST00000400246.1_Splice_Site_p.S442F	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	442					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.S442F(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TGTATTTCAGCTCTCGGGAGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	22											73.0	68.0	70.0					22																	32206507		1824	4094	5918	30536507	SO:0001630	splice_region_variant	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1325-1C>T	22.37:g.32206507C>T			30536507	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827282	0.71143	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.46819	1.45;1.43;0.86;1.85;1.85;1.84;1.43;1.85;1.84;1.85	5.4	5.4	0.78164	.	0.119371	0.64402	D	0.000018	T	0.59514	0.2199	L	0.54323	1.7	0.80722	D	1	B;P;D;B;P;P	0.67145	0.198;0.755;0.996;0.126;0.855;0.733	B;B;P;B;B;B	0.56700	0.113;0.444;0.804;0.073;0.271;0.435	T	0.56733	-0.7930	9	.	.	.	.	18.233	0.89939	0.0:1.0:0.0:0.0	.	442;414;442;442;442;442	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	F	442;414;442;442;442;442;442;442;442;442;442	ENSP00000440210:S442F;ENSP00000441358:S414F;ENSP00000383101:S442F;ENSP00000266091:S442F;ENSP00000383108:S442F;ENSP00000383105:S442F;ENSP00000371539:S442F;ENSP00000371546:S442F;ENSP00000371545:S442F;ENSP00000383107:S442F	.	S	+	2	0	DEPDC5	30536507	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	5.594000	0.67557	2.543000	0.85770	0.555000	0.69702	TCT		0.418	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	Missense_Mutation	Missense_Mutation
BPIFA2	140683	genome.wustl.edu	37	20	31760758	31760758	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr20:31760758G>A	ENST00000253362.2	+	3	324	c.178G>A	c.(178-180)Gtc>Atc	p.V60I	BPIFA2_ENST00000354932.5_Missense_Mutation_p.V60I			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	60						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)	p.V60I(1)									GAAACTGAAGGTCGACCTAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											87.0	81.0	83.0					20																	31760758		2203	4300	6503	31224419	SO:0001583	missense	140683			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.178G>A	20.37:g.31760758G>A	ENSP00000253362:p.Val60Ile		31224419	Q9BQQ0	Missense_Mutation	SNP	ENST00000253362.2	37	CCDS13214.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	9.892	1.204604	0.22205	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.12147	2.71;2.71	3.87	-2.35	0.06684	.	3.678570	0.00769	N	0.001199	T	0.09905	0.0243	L	0.44542	1.39	0.09310	N	1	P	0.34462	0.454	B	0.31191	0.125	T	0.15636	-1.0430	10	0.21540	T	0.41	-25.5462	1.5524	0.02578	0.2066:0.3529:0.2929:0.1476	.	60	Q96DR5	BPIA2_HUMAN	I	60	ENSP00000253362:V60I;ENSP00000347012:V60I	ENSP00000253362:V60I	V	+	1	0	BPIFA2	31224419	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.856000	0.04290	-0.359000	0.08150	0.561000	0.74099	GTC		0.488	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574		Missense_Mutation
TXLNA	200081	genome.wustl.edu	37	1	32660681	32660681	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:32660681G>T	ENST00000373609.1	+	10	1807	c.1526G>T	c.(1525-1527)gGg>gTg	p.G509V	TXLNA_ENST00000373610.3_Missense_Mutation_p.G509V			P40222	TXLNA_HUMAN	taxilin alpha	509					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)	p.G509V(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GAGGGGCCTGGGGCTCAAGCA	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											39.0	40.0	40.0					1																	32660681		2203	4300	6503	32433268	SO:0001583	missense	200081			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.1526G>T	1.37:g.32660681G>T	ENSP00000362711:p.Gly509Val		32433268	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Missense_Mutation	SNP	ENST00000373609.1	37	CCDS353.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	10.04	1.240830	0.22711	.	.	ENSG00000084652	ENST00000373610;ENST00000373609	T;T	0.31247	1.5;1.5	4.61	1.57	0.23409	.	0.711165	0.13467	N	0.385670	T	0.15219	0.0367	N	0.14661	0.345	0.25405	N	0.988402	B	0.12630	0.006	B	0.08055	0.003	T	0.22173	-1.0224	10	0.26408	T	0.33	-5.1795	6.2263	0.20710	0.1341:0.0:0.5844:0.2814	.	509	P40222	TXLNA_HUMAN	V	509	ENSP00000362712:G509V;ENSP00000362711:G509V	ENSP00000362711:G509V	G	+	2	0	TXLNA	32433268	0.043000	0.20138	0.024000	0.17045	0.986000	0.74619	2.309000	0.43699	0.634000	0.30469	0.563000	0.77884	GGG		0.642	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1	NM_175852		Missense_Mutation
CLASP2	23122	genome.wustl.edu	37	3	33543184	33543184	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr3:33543184T>A	ENST00000468888.2	-	38	4464	c.4418A>T	c.(4417-4419)gAt>gTt	p.D1473V	CLASP2_ENST00000359576.5_Missense_Mutation_p.D1464V|CLASP2_ENST00000480013.1_Missense_Mutation_p.D1252V|CLASP2_ENST00000461133.3_Missense_Mutation_p.D1232V|CLASP2_ENST00000539981.1_3'UTR|CLASP2_ENST00000307312.7_Missense_Mutation_p.D954V|CLASP2_ENST00000399362.4_Missense_Mutation_p.D1472V			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1253					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)	p.D1465V(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TTTTAGTTCATCACCAATTAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											136.0	131.0	132.0					3																	33543184		1948	4156	6104	33518188	SO:0001583	missense	23122			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4418A>T	3.37:g.33543184T>A	ENSP00000419974:p.Asp1473Val		33518188	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		SNP	50	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.0|27.0	4.789410|4.789410	0.90367|0.90367	.|.	.|.	ENSG00000163539|ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000480013;ENST00000461133|ENST00000487553	T;T;T;T;T;T|.	0.68624|.	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.102341|.	0.64402|.	D|.	0.000002|.	T|.	0.56514|.	0.1990|.	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P;P|.	0.41910|.	0.741;0.764|.	P;P|.	0.49829|.	0.448;0.623|.	T|.	0.53436|.	-0.8439|.	10|.	0.87932|.	D|.	0|.	-22.3423|-22.3423	14.5456|14.5456	0.68027|0.68027	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1464;1472|.	F5H604;E7ERI8|.	.;.|.	V|C	1473;1472;1464;954;1252;1232|178	ENSP00000419974:D1473V;ENSP00000382297:D1472V;ENSP00000352581:D1464V;ENSP00000304743:D954V;ENSP00000417518:D1252V;ENSP00000419305:D1232V|.	ENSP00000304743:D954V|.	D|X	-|-	2|3	0|0	CLASP2|CLASP2	33518188|33518188	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.717000|7.717000	0.84732|0.84732	2.168000|2.168000	0.68352|0.68352	0.533000|0.533000	0.62120|0.62120	GAT|TGA		0.428	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044		Missense_Mutation
EIF3L	51386	genome.wustl.edu	37	22	38266253	38266253	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr22:38266253C>G	ENST00000412331.2	+	8	1232	c.650C>G	c.(649-651)tCc>tGc	p.S217C	EIF3L_ENST00000476955.1_3'UTR|EIF3L_ENST00000381683.6_Missense_Mutation_p.S169C|EIF3L_ENST00000406934.1_Missense_Mutation_p.S119C	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L									p.S217C(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TTTCTTCGTTCCAATCCCAAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	22											165.0	131.0	143.0					22																	38266253		2203	4300	6503	36596199	SO:0001583	missense	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.650C>G	22.37:g.38266253C>G	ENSP00000416892:p.Ser217Cys		36596199		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607497	0.66558	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.46819	0.86;0.86;0.86	4.93	4.93	0.64822	.	0.152963	0.64402	D	0.000012	T	0.62792	0.2457	L	0.59436	1.845	0.48185	D	0.999609	P;D;P;D	0.55800	0.915;0.973;0.878;0.97	P;P;P;P	0.59288	0.708;0.855;0.708;0.799	T	0.64803	-0.6321	10	0.54805	T	0.06	-30.2824	18.5041	0.90891	0.0:1.0:0.0:0.0	.	169;119;217;260	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	C	217;260;169;184;119	ENSP00000416892:S217C;ENSP00000371099:S169C;ENSP00000384634:S119C	ENSP00000262832:S184C	S	+	2	0	EIF3L	36596199	1.000000	0.71417	0.998000	0.56505	0.789000	0.44602	3.900000	0.56295	2.430000	0.82344	0.462000	0.41574	TCC		0.438	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091		Missense_Mutation
C5orf42	65250	genome.wustl.edu	37	5	37169590	37169590	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr5:37169590G>T	ENST00000508244.1	-	33	6629	c.6536C>A	c.(6535-6537)tCt>tAt	p.S2179Y	C5orf42_ENST00000274258.7_Missense_Mutation_p.S1059Y|C5orf42_ENST00000425232.2_Missense_Mutation_p.S2179Y			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2179						integral component of membrane (GO:0016021)		p.S1059Y(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TAAGTTTTGAGATGATGGAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											75.0	76.0	76.0					5																	37169590		2203	4300	6503	37205347	SO:0001583	missense	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6536C>A	5.37:g.37169590G>T	ENSP00000421690:p.Ser2179Tyr		37205347	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980334	0.74474	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.26223	1.78;1.78;1.75;1.76	5.53	4.63	0.57726	.	0.528900	0.18498	N	0.139460	T	0.39462	0.1079	L	0.52573	1.65	0.09310	N	1	D;D	0.63046	0.986;0.992	P;P	0.62813	0.684;0.907	T	0.14643	-1.0465	10	0.87932	D	0	.	9.2506	0.37554	0.077:0.1459:0.7771:0.0	.	2179;1059	E9PH94;Q9H799	.;CE042_HUMAN	Y	2179;2179;1059;1227;1059	ENSP00000421690:S2179Y;ENSP00000389014:S2179Y;ENSP00000274258:S1059Y;ENSP00000424223:S1227Y	ENSP00000274258:S1059Y	S	-	2	0	C5orf42	37205347	0.034000	0.19679	0.813000	0.32504	0.193000	0.23685	1.220000	0.32491	2.587000	0.87381	0.655000	0.94253	TCT		0.408	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		Missense_Mutation
DNAH8	1769	genome.wustl.edu	37	6	38998056	38998056	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr6:38998056A>T	ENST00000359357.3	+	91	13615	c.13361A>T	c.(13360-13362)aAg>aTg	p.K4454M	DNAH8_ENST00000441566.1_Missense_Mutation_p.K4418M			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4454					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4454M(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCTATTTACAAGAAACCCAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											134.0	127.0	129.0					6																	38998056		2203	4300	6503	39106034	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.13361A>T	6.37:g.38998056A>T	ENSP00000352312:p.Lys4454Met		39106034	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	25.7	4.661555	0.88154	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.10960	2.82;2.82;2.82	5.15	5.15	0.70609	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.34825	-0.9813	10	0.56958	D	0.05	.	14.9933	0.71406	1.0:0.0:0.0:0.0	.	4454	Q96JB1	DYH8_HUMAN	M	4659;4454;4418	ENSP00000333363:K4659M;ENSP00000352312:K4454M;ENSP00000402294:K4418M	ENSP00000333363:K4659M	K	+	2	0	DNAH8	39106034	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.303000	0.78871	1.943000	0.56356	0.528000	0.53228	AAG		0.502	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		Missense_Mutation
PRPH2	5961	genome.wustl.edu	37	6	42690019	42690019	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr6:42690019T>A	ENST00000230381.5	-	1	293	c.54A>T	c.(52-54)caA>caT	p.Q18H		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	18					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.Q18H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			GCCAGAGCCCTTGGGCCAACT	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											80.0	76.0	77.0					6																	42690019		2203	4300	6503	42797997	SO:0001583	missense	5961				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.54A>T	6.37:g.42690019T>A	ENSP00000230381:p.Gln18His		42797997	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811545	0.70797	.	.	ENSG00000112619	ENST00000230381	T	0.03496	3.91	5.61	-4.17	0.03857	.	0.105519	0.64402	N	0.000003	T	0.06371	0.0164	M	0.86953	2.85	0.47584	D	0.999464	D	0.76494	0.999	D	0.71184	0.972	T	0.33085	-0.9882	10	0.19590	T	0.45	.	8.8325	0.35093	0.1094:0.5105:0.0:0.3801	.	18	P23942	PRPH2_HUMAN	H	18	ENSP00000230381:Q18H	ENSP00000230381:Q18H	Q	-	3	2	PRPH2	42797997	0.982000	0.34865	0.971000	0.41717	0.944000	0.59088	0.234000	0.17930	-0.684000	0.05183	-0.274000	0.10170	CAA		0.537	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322		Missense_Mutation
TRAPPC10	7109	genome.wustl.edu	37	21	45451972	45451972	+	Splice_Site	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr21:45451972G>A	ENST00000291574.4	+	2	243	c.68G>A	c.(67-69)tGt>tAt	p.C23Y	TRAPPC10_ENST00000380221.3_Splice_Site_p.C23Y	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	23					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.C23Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CCCTTCATAGGTGCTGGAGAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	21											169.0	168.0	168.0					21																	45451972		2203	4300	6503	44276400	SO:0001630	splice_region_variant	7109			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.68-1G>A	21.37:g.45451972G>A			44276400	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	37	CCDS13704.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	4.917	0.170485	0.09391	.	.	ENSG00000160218	ENST00000380221;ENST00000291574	T;T	0.26223	1.75;1.75	5.51	5.51	0.81932	.	0.206543	0.42682	U	0.000661	T	0.16896	0.0406	N	0.12746	0.255	0.58432	D	0.999996	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09357	-1.0678	9	.	.	.	.	19.0536	0.93054	0.0:0.0:1.0:0.0	.	23;23	P48553;Q86SI7	TPC10_HUMAN;.	Y	23	ENSP00000369570:C23Y;ENSP00000291574:C23Y	.	C	+	2	0	TRAPPC10	44276400	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.298000	0.78815	2.587000	0.87381	0.655000	0.94253	TGT		0.363	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	Missense_Mutation	Missense_Mutation
GNPDA2	132789	genome.wustl.edu	37	4	44719163	44719163	+	Nonsense_Mutation	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr4:44719163T>A	ENST00000295448.3	-	4	532	c.376A>T	c.(376-378)Aaa>Taa	p.K126*	GNPDA2_ENST00000511187.1_Intron|GNPDA2_ENST00000509756.1_Nonsense_Mutation_p.K126*|GNPDA2_ENST00000507534.1_Nonsense_Mutation_p.K56*|GNPDA2_ENST00000507917.1_Nonsense_Mutation_p.K92*	NM_138335.2	NP_612208.1	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	126					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)	p.K126*(1)		endometrium(2)|large_intestine(1)|lung(7)|ovary(1)	11						CCAGCTTCTTTTATTTTGTTT	0.299																																					Colon(54;743 1010 7604 16453 19544)											1	Substitution - Nonsense(1)	ovary(1)	4											81.0	83.0	82.0					4																	44719163		2202	4299	6501	44413920	SO:0001587	stop_gained	132789			AF247786	CCDS3469.1, CCDS59472.1, CCDS59473.1	4p13	2006-04-12			ENSG00000163281	ENSG00000163281	3.5.99.6		21526	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate isomerase"""	613222				12965206	Standard	NM_001270880		Approved	SB52	uc003gwy.4	Q8TDQ7	OTTHUMG00000099415	ENST00000295448.3:c.376A>T	4.37:g.44719163T>A	ENSP00000295448:p.Lys126*		44413920	B4DJF3|Q2VYF1|Q59EA7|Q8NCZ8|Q96BJ4|Q96NC6	Nonsense_Mutation	SNP	ENST00000295448.3	37	CCDS3469.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	16.83	3.230552	0.58777	.	.	ENSG00000163281	ENST00000507917;ENST00000295448;ENST00000507534;ENST00000509756	.	.	.	5.84	0.552	0.17230	.	0.476670	0.24224	N	0.040409	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4887	4.7216	0.12920	0.0:0.3133:0.1629:0.5238	.	.	.	.	X	92;126;56;126	.	ENSP00000295448:K126X	K	-	1	0	GNPDA2	44413920	0.863000	0.29885	0.974000	0.42286	0.195000	0.23768	0.360000	0.20250	0.492000	0.27815	0.482000	0.46254	AAA		0.299	GNPDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216874.3	NM_138335		Nonsense_Mutation
ST18	9705	genome.wustl.edu	37	8	53092685	53092685	+	Missense_Mutation	SNP	C	C	T	rs140681407	byFrequency	TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr8:53092685C>T	ENST00000276480.7	-	9	957	c.274G>A	c.(274-276)Gca>Aca	p.A92T		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	92					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A92T(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTGCTACCTGCGGTAGAGTGA	0.517													C|||	18	0.00359425	0.0121	0.0029	5008	,	,		18446	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	8						C	THR/ALA	34,4372	38.4+/-70.7	0,34,2169	248.0	204.0	219.0		274	-1.9	0.0	8	dbSNP_134	219	0,8600		0,0,4300	yes	missense	ST18	NM_014682.2	58	0,34,6469	TT,TC,CC		0.0,0.7717,0.2614	benign	92/1048	53092685	34,12972	2203	4300	6503	53255238	SO:0001583	missense	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.274G>A	8.37:g.53092685C>T	ENSP00000276480:p.Ala92Thr		53255238	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	SNP	27	WashU	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	7.686	0.690134	0.15039	0.007717	0.0	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.44881	0.93;0.91	5.53	-1.91	0.07641	.	0.466924	0.23686	N	0.045577	T	0.13798	0.0334	L	0.31294	0.92	0.20873	N	0.999831	B	0.09022	0.002	B	0.04013	0.001	T	0.11891	-1.0569	10	0.12430	T	0.62	.	1.6647	0.02799	0.2947:0.3836:0.1378:0.184	.	92	O60284	ST18_HUMAN	T	92	ENSP00000276480:A92T;ENSP00000428521:A92T	ENSP00000276480:A92T	A	-	1	0	ST18	53255238	0.000000	0.05858	0.031000	0.17742	0.031000	0.12232	-0.327000	0.07955	-0.334000	0.08463	-0.137000	0.14449	GCA		0.517	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			Missense_Mutation
NUP93	9688	genome.wustl.edu	37	16	56866216	56866216	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr16:56866216G>T	ENST00000308159.5	+	12	1382	c.1261G>T	c.(1261-1263)Gtg>Ttg	p.V421L	NUP93_ENST00000569842.1_Missense_Mutation_p.V421L|NUP93_ENST00000564887.1_Missense_Mutation_p.V298L|NUP93_ENST00000542526.1_Missense_Mutation_p.V298L	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	421					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.V421L(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GTTGAACCAAGTGTGTTTTGA	0.478																																					Colon(33;610 796 1305 1705 38917)											1	Substitution - Missense(1)	ovary(1)	16											181.0	166.0	171.0					16																	56866216		2198	4300	6498	55423717	SO:0001583	missense	9688			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1261G>T	16.37:g.56866216G>T	ENSP00000310668:p.Val421Leu		55423717	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872889	0.91664	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.43688	0.94;0.94	6.03	5.07	0.68467	.	0.052556	0.85682	D	0.000000	T	0.34513	0.0900	L	0.28556	0.865	0.80722	D	1	B	0.31548	0.328	B	0.33568	0.166	T	0.10706	-1.0618	10	0.34782	T	0.22	-20.3252	15.1765	0.72916	0.0673:0.0:0.9327:0.0	.	421	Q8N1F7	NUP93_HUMAN	L	421;298	ENSP00000310668:V421L;ENSP00000440235:V298L	ENSP00000310668:V421L	V	+	1	0	NUP93	55423717	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	9.687000	0.98667	1.547000	0.49401	0.655000	0.94253	GTG		0.478	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669		Missense_Mutation
OR5AK3P	81228	genome.wustl.edu	37	11	56739298	56739298	+	IGR	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr11:56739298G>A								AP000479.1 (93744 upstream) : OR5AK2 (17048 downstream)														p.M258I(1)									TCTCTTACATGTACTTACAGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	11																																								56495874	SO:0001628	intergenic_variant																																11.37:g.56739298G>A			56495874		Missense_Mutation	SNP		37		SNP	48	WashU																																																																																			0	0.403									Missense_Mutation
Unknown	0	genome.wustl.edu	37	17	0	0	+	IGR	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Invalid:failed_liftOver	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr17:0C>T								None (None upstream) : AC108004.5 (4960 downstream)																							AAGCTTCTCA	0.52																																																0			17																																								59791381	SO:0001628	intergenic_variant	5175																															17.37:g.0C>T			59791381		Missense_Mutation	SNP		37		SNP	20	WashU																																																																																			0	0.520									Missense_Mutation
NLRP13	126204	genome.wustl.edu	37	19	56407362	56407362	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:56407362C>A	ENST00000342929.3	-	11	3080	c.3081G>T	c.(3079-3081)atG>atT	p.M1027I	NLRP13_ENST00000588751.1_Missense_Mutation_p.M1027I	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	1027							ATP binding (GO:0005524)	p.M1027I(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CCTTACATAGCATCTTGACAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	19											197.0	184.0	188.0					19																	56407362		2203	4300	6503	61099174	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.3081G>T	19.37:g.56407362C>A	ENSP00000343891:p.Met1027Ile		61099174	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	0.271	-0.992605	0.02162	.	.	ENSG00000173572	ENST00000342929	T	0.51574	0.7	2.85	-4.85	0.03142	.	.	.	.	.	T	0.18800	0.0451	N	0.04132	-0.27	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.31752	-0.9932	9	0.11182	T	0.66	.	8.0696	0.30680	0.0:0.3343:0.0:0.6657	.	1027	Q86W25	NAL13_HUMAN	I	1027	ENSP00000343891:M1027I	ENSP00000343891:M1027I	M	-	3	0	NLRP13	61099174	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.835000	0.01692	-1.107000	0.03004	-0.469000	0.05056	ATG		0.473	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		Missense_Mutation
ZNF304	57343	genome.wustl.edu	37	19	57867886	57867886	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:57867886T>C	ENST00000282286.5	+	3	822	c.649T>C	c.(649-651)Tat>Cat	p.Y217H	ZNF304_ENST00000391705.3_Missense_Mutation_p.Y217H|ZNF304_ENST00000598744.1_Missense_Mutation_p.Y175H|ZNF304_ENST00000443917.2_Missense_Mutation_p.Y264H			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y217H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CCAAGGAGACTATGATGGACA	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											108.0	87.0	94.0					19																	57867886		2203	4300	6503	62559698	SO:0001583	missense	57343			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.649T>C	19.37:g.57867886T>C	ENSP00000282286:p.Tyr217His		62559698		Missense_Mutation	SNP	ENST00000282286.5	37	CCDS12950.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	t	0.167	-1.075261	0.01903	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.06068	3.35;3.35;3.35	3.45	-0.0844	0.13690	.	.	.	.	.	T	0.00754	0.0025	N	0.00014	-2.92	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46400	-0.9194	9	0.02654	T	1	.	4.5128	0.11919	0.1724:0.6023:0.0:0.2253	.	217;264	Q9HCX3;E7EQD3	ZN304_HUMAN;.	H	217;217;264	ENSP00000282286:Y217H;ENSP00000375586:Y217H;ENSP00000401642:Y264H	ENSP00000282286:Y217H	Y	+	1	0	ZNF304	62559698	0.000000	0.05858	0.005000	0.12908	0.382000	0.30200	-0.052000	0.11865	0.059000	0.16252	0.451000	0.29950	TAT		0.507	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			Missense_Mutation
RIMS1	22999	genome.wustl.edu	37	6	72678727	72678727	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr6:72678727C>G	ENST00000521978.1	+	2	206	c.206C>G	c.(205-207)aCa>aGa	p.T69R	RIMS1_ENST00000348717.5_Missense_Mutation_p.T69R|RIMS1_ENST00000491071.2_Missense_Mutation_p.T69R|RIMS1_ENST00000517960.1_Missense_Mutation_p.T69R|RIMS1_ENST00000518273.1_Missense_Mutation_p.T69R|RIMS1_ENST00000264839.7_Missense_Mutation_p.T69R|RIMS1_ENST00000520567.1_Missense_Mutation_p.T69R|RIMS1_ENST00000522291.1_Missense_Mutation_p.T69R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	69	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.T69R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GCCTGCAAAACACCAAGAAAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											136.0	141.0	140.0					6																	72678727		1934	4135	6069	72735448	SO:0001583	missense	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.206C>G	6.37:g.72678727C>G	ENSP00000428417:p.Thr69Arg		72735448	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747525	0.49257	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34	5.31	4.43	0.53597	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	.	.	.	.	T	0.08980	0.0222	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13202	-1.0518	9	0.19590	T	0.45	.	8.9071	0.35530	0.0:0.9008:0.0:0.0992	.	69	Q86UR5	RIMS1_HUMAN	R	69	ENSP00000430101:T69R;ENSP00000275037:T69R;ENSP00000264839:T69R;ENSP00000429959:T69R;ENSP00000430408:T69R;ENSP00000430502:T69R;ENSP00000430932:T69R;ENSP00000428417:T69R	ENSP00000264839:T69R	T	+	2	0	RIMS1	72735448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.149000	0.42244	2.458000	0.83093	0.655000	0.94253	ACA		0.458	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			Missense_Mutation
PSAP	5660	genome.wustl.edu	37	10	73581662	73581662	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr10:73581662G>A	ENST00000394936.3	-	8	1027	c.880C>T	c.(880-882)Cct>Tct	p.P294S	PSAP_ENST00000394934.1_Missense_Mutation_p.P296S			P07602	SAP_HUMAN	prosaposin	294					blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.P294S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						TCCAGGGCAGGGATGACATTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	10											106.0	96.0	100.0					10																	73581662		2203	4300	6503	73251668	SO:0001583	missense	5660			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.880C>T	10.37:g.73581662G>A	ENSP00000378394:p.Pro294Ser		73251668	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	CCDS7311.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313302	0.60414	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000404083;ENST00000394940	D;D	0.90004	-2.6;-2.6	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.86397	0.5923	L	0.47716	1.5	0.51012	D	0.999905	P	0.50443	0.935	P	0.44696	0.458	D	0.87290	0.2298	10	0.66056	D	0.02	-6.8764	11.8283	0.52280	0.0816:0.0:0.9184:0.0	.	294	P07602	SAP_HUMAN	S	294;294;297;296;300;220	ENSP00000378394:P294S;ENSP00000378392:P296S	ENSP00000350063:P297S	P	-	1	0	PSAP	73251668	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	3.135000	0.50546	2.691000	0.91804	0.655000	0.94253	CCT		0.557	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		Missense_Mutation
ABCB4	5244	genome.wustl.edu	37	7	87032469	87032469	+	Silent	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr7:87032469C>T	ENST00000265723.4	-	27	3747	c.3636G>A	c.(3634-3636)ctG>ctA	p.L1212L	ABCB4_ENST00000358400.3_Silent_p.L1158L|ABCB4_ENST00000359206.3_Silent_p.L1205L|ABCB4_ENST00000545634.1_Silent_p.L1205L|ABCB4_ENST00000453593.1_Silent_p.L1158L	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1212	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.L1205L(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TTTCAGTATCCAGAGCTGATG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	7											165.0	147.0	153.0					7																	87032469		2203	4300	6503	86870405	SO:0001819	synonymous_variant	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3636G>A	7.37:g.87032469C>T			86870405	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	ENST00000265723.4	37	CCDS5606.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	4.549	0.101961	0.08731	.	.	ENSG00000005471	ENST00000440025	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	T	0.56992	0.2023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55648	-0.8108	4	.	.	.	-8.5153	6.7088	0.23266	0.1489:0.7048:0.0:0.1463	.	.	.	.	R	17	.	.	G	-	1	0	ABCB4	86870405	0.993000	0.37304	1.000000	0.80357	0.721000	0.41392	0.367000	0.20382	2.614000	0.88457	0.561000	0.74099	GGA		0.428	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443		Silent
GPR98	84059	genome.wustl.edu	37	5	90052961	90052961	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr5:90052961G>C	ENST00000405460.2	+	57	12019	c.11923G>C	c.(11923-11925)Gaa>Caa	p.E3975Q		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3975	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E3975Q(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGGATTCTTGAATTTGCAGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	5											79.0	80.0	80.0					5																	90052961		1874	4113	5987	90088717	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11923G>C	5.37:g.90052961G>C	ENSP00000384582:p.Glu3975Gln		90088717	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	45	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.462|5.462	0.270266|0.270266	0.10349|0.10349	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|T	0.27557|0.56776	1.66|0.44	5.08|5.08	1.14|1.14	0.20703|0.20703	Na-Ca exchanger/integrin-beta4 (2);|.	0.419851|.	0.28748|.	N|.	0.014271|.	T|T	0.46964|0.46964	0.1420|0.1420	L|L	0.41632|0.41632	1.29|1.29	0.80722|0.80722	D|D	1|1	B;B|.	0.28470|.	0.002;0.213|.	B;B|.	0.24974|.	0.009;0.057|.	T|T	0.42258|0.42258	-0.9462|-0.9462	10|7	0.23302|0.72032	T|D	0.38|0.01	.|.	4.7949|4.7949	0.13267|0.13267	0.4303:0.165:0.4047:0.0|0.4303:0.165:0.4047:0.0	.|.	3975;3975|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	Q|F	3975|1540	ENSP00000384582:E3975Q|ENSP00000422153:L1540F	ENSP00000296619:E3975Q|ENSP00000422153:L1540F	E|L	+|+	1|3	0|2	GPR98|GPR98	90088717|90088717	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.727000|0.727000	0.41649|0.41649	3.124000|3.124000	0.50461|0.50461	0.241000|0.241000	0.21283|0.21283	-0.373000|-0.373000	0.07131|0.07131	GAA|TTG		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Missense_Mutation
OMD	4958	genome.wustl.edu	37	9	95179146	95179146	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr9:95179146G>T	ENST00000375550.4	-	2	970	c.695C>A	c.(694-696)cCt>cAt	p.P232H	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	232					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.P232H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						AAGTGAAGAAGGCAAACCAGG	0.343			T	USP6	aneurysmal bone cysts																																		Dom	yes		9	9q22.31	4958	osteomodulin		M	1	Substitution - Missense(1)	ovary(1)	9											101.0	103.0	103.0					9																	95179146		2203	4300	6503	94218967	SO:0001583	missense	4958			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.695C>A	9.37:g.95179146G>T	ENSP00000364700:p.Pro232His		94218967	Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	37	CCDS6696.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	g	23.6	4.432587	0.83776	.	.	ENSG00000127083	ENST00000375550	T	0.04917	3.53	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000001	T	0.23926	0.0579	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00028	-1.2298	10	0.87932	D	0	-13.6946	20.2148	0.98293	0.0:0.0:1.0:0.0	.	232	Q99983	OMD_HUMAN	H	232	ENSP00000364700:P232H	ENSP00000364700:P232H	P	-	2	0	OMD	94218967	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.636000	0.83301	2.850000	0.98022	0.650000	0.86243	CCT		0.343	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014		Missense_Mutation
IGHV3-48	28424	genome.wustl.edu	37	14	106993922	106993922	+	RNA	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr14:106993922G>T	ENST00000390624.2	-	0	321									immunoglobulin heavy variable 3-48																		CCTTCACAGAGTCTGCGTAGT	0.493																																																0			14											153.0	168.0	163.0					14																	106993922		1889	4111	6000	106064967						M99675		14q32.33	2012-02-08			ENSG00000211964	ENSG00000211964		"""Immunoglobulins / IGH locus"""	5606	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151959		14.37:g.106993922G>T			106064967		Missense_Mutation	SNP	ENST00000390624.2	37		SNP	36	WashU																																																																																				0.493	IGHV3-48-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000324605.1	NG_001019		Missense_Mutation
NPAT	4863	genome.wustl.edu	37	11	108032261	108032261	+	Silent	SNP	T	T	C			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr11:108032261T>C	ENST00000278612.8	-	17	3657	c.3552A>G	c.(3550-3552)tcA>tcG	p.S1184S		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1184					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.S1184S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TAGATAGTTTTGAATTTTCTG	0.363																																																1	Substitution - coding silent(1)	ovary(1)	11											218.0	210.0	213.0					11																	108032261		1810	4082	5892	107537471	SO:0001819	synonymous_variant	4863			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3552A>G	11.37:g.108032261T>C			107537471	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Silent	SNP	ENST00000278612.8	37	CCDS41710.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.664828	0.00765	.	.	ENSG00000149308	ENST00000527296	.	.	.	6.07	-6.58	0.01836	.	.	.	.	.	T	0.19005	0.0456	.	.	.	0.22787	N	0.998734	.	.	.	.	.	.	T	0.30208	-0.9986	4	.	.	.	-0.7448	4.8714	0.13635	0.0706:0.1956:0.1982:0.5356	.	.	.	.	R	183	.	.	Q	-	2	0	NPAT	107537471	0.098000	0.21812	0.234000	0.24042	0.014000	0.08584	-0.539000	0.06113	-1.012000	0.03387	-1.894000	0.00533	CAA		0.363	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519		Silent
SULT1C2	6819	genome.wustl.edu	37	2	108921127	108921127	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr2:108921127A>G	ENST00000437390.2	+	5	692	c.515A>G	c.(514-516)gAg>gGg	p.E172G	SULT1C2_ENST00000326853.5_Missense_Mutation_p.E169G|SULT1C2_ENST00000409880.1_Missense_Mutation_p.E121G|SULT1C2_ENST00000251481.6_Missense_Mutation_p.E158G			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	164					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.E169G(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						ACCTGGGAAGAGTATTTTGAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											143.0	131.0	135.0					2																	108921127		2203	4300	6503	108287559	SO:0001583	missense	6819			U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.515A>G	2.37:g.108921127A>G	ENSP00000399651:p.Glu172Gly		108287559	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000437390.2	37		SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	13.23	2.176463	0.38413	.	.	ENSG00000198203	ENST00000251481;ENST00000326853;ENST00000409880;ENST00000437390	T;T;T;T	0.02236	4.38;4.38;4.38;4.38	4.67	4.67	0.58626	Sulfotransferase domain (1);	0.353337	0.27023	N	0.021309	T	0.05686	0.0149	M	0.81614	2.55	0.36604	D	0.874849	B;B;B;B	0.22983	0.078;0.056;0.078;0.063	B;B;B;B	0.26693	0.072;0.033;0.072;0.043	T	0.04650	-1.0936	10	0.56958	D	0.05	.	13.735	0.62813	1.0:0.0:0.0:0.0	.	172;73;158;169	B4DLP0;B4DPE8;O00338;O00338-2	.;.;ST1C2_HUMAN;.	G	158;169;121;172	ENSP00000251481:E158G;ENSP00000319622:E169G;ENSP00000387054:E121G;ENSP00000399651:E172G	ENSP00000251481:E158G	E	+	2	0	SULT1C2	108287559	0.950000	0.32346	0.848000	0.33437	0.598000	0.36846	4.382000	0.59594	2.082000	0.62665	0.533000	0.62120	GAG		0.468	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	NM_176825		Missense_Mutation
AKNAD1	254268	genome.wustl.edu	37	1	109394765	109394765	+	Silent	SNP	C	C	T	rs537008332		TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:109394765C>T	ENST00000370001.3	-	2	790	c.522G>A	c.(520-522)ccG>ccA	p.P174P	AKNAD1_ENST00000369995.3_Silent_p.P174P|AKNAD1_ENST00000369994.1_Silent_p.P174P|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	174						cytoplasm (GO:0005737)		p.P174P(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						CATCCCTTTTCGGGTTGAGTT	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18922	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											62.0	63.0	63.0					1																	109394765		2202	4295	6497	109196288	SO:0001819	synonymous_variant	254268			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.522G>A	1.37:g.109394765C>T			109196288	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Silent	SNP	ENST00000370001.3	37	CCDS791.2	SNP	31	WashU																																																																																				0.423	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763		Silent
ADORA3	140	genome.wustl.edu	37	1	112045738	112045738	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:112045738A>T	ENST00000241356.4	-	1	644	c.239T>A	c.(238-240)tTc>tAc	p.F80Y	ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Missense_Mutation_p.F80Y	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	80					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.F80Y(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GCAGCTGTAGAAGTGGATTGT	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	69.0	77.0					1																	112045738		2203	4300	6503	111847261	SO:0001583	missense	140			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.239T>A	1.37:g.112045738A>T	ENSP00000241356:p.Phe80Tyr		111847261	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000241356.4	37	CCDS839.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932325	0.52866	.	.	ENSG00000121933	ENST00000369716;ENST00000241356	T;T	0.75589	-0.95;-0.95	5.26	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000241	T	0.61874	0.2382	M	0.72118	2.19	0.38760	D	0.954303	B;B	0.30439	0.279;0.229	B;B	0.37091	0.127;0.241	T	0.60454	-0.7260	10	0.46703	T	0.11	-22.0875	10.107	0.42539	0.6167:0.0:0.0:0.3832	.	80;80	P33765;P33765-2	AA3R_HUMAN;.	Y	80	ENSP00000358730:F80Y;ENSP00000241356:F80Y	ENSP00000241356:F80Y	F	-	2	0	ADORA3	111847261	1.000000	0.71417	0.502000	0.27614	0.908000	0.53690	4.093000	0.57714	0.355000	0.24131	0.459000	0.35465	TTC		0.512	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	NM_000677, NM_020683		Missense_Mutation
CSMD3	114788	genome.wustl.edu	37	8	113323290	113323290	+	Missense_Mutation	SNP	C	C	A	rs564995042		TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr8:113323290C>A	ENST00000297405.5	-	50	8046	c.7802G>T	c.(7801-7803)cGa>cTa	p.R2601L	CSMD3_ENST00000343508.3_Missense_Mutation_p.R2561L|CSMD3_ENST00000455883.2_Missense_Mutation_p.R2497L|CSMD3_ENST00000352409.3_Missense_Mutation_p.R2531L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2601	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2601Q(1)|p.R2561Q(1)|p.R2601L(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCAACAAGTCGGAATCCTCG	0.493										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						3	Substitution - Missense(3)	lung(2)|ovary(1)	8											164.0	134.0	144.0					8																	113323290		2203	4300	6503	113392466	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7802G>T	8.37:g.113323290C>A	ENSP00000297405:p.Arg2601Leu		113392466	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834520	0.91036	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.199696	0.28273	N	0.015950	D	0.83917	0.5358	M	0.82193	2.58	0.49213	D	0.999763	P;P;D	0.89917	0.929;0.942;1.0	P;P;D	0.79784	0.611;0.787;0.993	D	0.84723	0.0741	10	0.54805	T	0.06	.	19.6449	0.95773	0.0:1.0:0.0:0.0	.	2497;2601;2561	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	2561;2601;1871;2497;2531	ENSP00000345799:R2561L;ENSP00000297405:R2601L;ENSP00000341558:R1871L;ENSP00000412263:R2497L;ENSP00000343124:R2531L	ENSP00000297405:R2601L	R	-	2	0	CSMD3	113392466	1.000000	0.71417	0.997000	0.53966	0.780000	0.44128	3.338000	0.52128	2.628000	0.89032	0.655000	0.94253	CGA		0.493	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
VTI1A	143187	genome.wustl.edu	37	10	114575107	114575107	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr10:114575107C>G	ENST00000393077.2	+	8	735	c.619C>G	c.(619-621)Ctg>Gtg	p.L207V		NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	207					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)	p.L207V(1)	VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		CATCACCATCCTGATGGCGAT	0.443			T	TCF7L2	colorectal																																		Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	1	Substitution - Missense(1)	ovary(1)	10											147.0	141.0	143.0					10																	114575107		2037	4191	6228	114565097	SO:0001583	missense	143187			BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.619C>G	10.37:g.114575107C>G	ENSP00000376792:p.Leu207Val		114565097	A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	ENST00000393077.2	37	CCDS7575.2	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	7.309	0.614530	0.14129	.	.	ENSG00000151532	ENST00000393077	.	.	.	5.89	5.89	0.94794	.	1.454920	0.05680	U	0.590273	T	0.43122	0.1233	N	0.16368	0.405	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13710	-1.0499	9	0.16896	T	0.51	-35.6971	9.5598	0.39362	0.2403:0.568:0.1917:0.0	.	207	Q5W0D7	.	V	207	.	ENSP00000376792:L207V	L	+	1	2	VTI1A	114565097	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.956000	0.40382	2.797000	0.96272	0.563000	0.77884	CTG		0.443	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2			Missense_Mutation
LVRN	206338	genome.wustl.edu	37	5	115336129	115336129	+	Splice_Site	SNP	G	G	C			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr5:115336129G>C	ENST00000357872.4	+	8	1639		c.e8-1		AQPEP_ENST00000395528.2_Splice_Site	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN								integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(1)									TTTTGTCCTAGGGAGCGTCTA	0.398																																																1	Unknown(1)	ovary(1)	5											140.0	135.0	136.0					5																	115336129		2202	4300	6502	115364028	SO:0001630	splice_region_variant	206338																														ENST00000357872.4:c.1516-1G>C	5.37:g.115336129G>C			115364028	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Splice_Site_SNP	SNP	ENST00000357872.4	37	CCDS4124.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273176	0.59649	.	.	ENSG00000172901	ENST00000395528;ENST00000357872;ENST00000379578	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0305	0.92955	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC010282.1	115364028	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	7.370000	0.79589	2.861000	0.98227	0.655000	0.94253	.		0.398	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		Intron	Splice_Site_SNP
KIAA1210	57481	genome.wustl.edu	37	X	118239038	118239038	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chrX:118239038A>T	ENST00000402510.2	-	7	984	c.985T>A	c.(985-987)Ttg>Atg	p.L329M		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	329								p.L189M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ATTTCTACCAAGTTCTTAGAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											139.0	138.0	138.0					X																	118239038		1935	4119	6054	118123066	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.985T>A	X.37:g.118239038A>T	ENSP00000384670:p.Leu329Met		118123066	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599631	0.46318	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.19105	2.17	4.48	-1.47	0.08772	.	.	.	.	.	T	0.17831	0.0428	N	0.14661	0.345	0.09310	N	1	D	0.64830	0.994	D	0.64237	0.923	T	0.13926	-1.0491	9	0.30078	T	0.28	.	1.3598	0.02189	0.3497:0.3618:0.1098:0.1787	.	329	Q9ULL0	K1210_HUMAN	M	329;165	ENSP00000384670:L329M	ENSP00000396164:L165M	L	-	1	2	RP13-347D8.5;RP13-347D8.6	118123066	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.425000	0.21346	-0.112000	0.11979	-0.545000	0.04230	TTG		0.438	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		Missense_Mutation
POLQ	10721	genome.wustl.edu	37	3	121207401	121207401	+	Silent	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr3:121207401T>A	ENST00000264233.5	-	16	4505	c.4377A>T	c.(4375-4377)atA>atT	p.I1459I		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1459					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.I1594I(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GAATCAGAAGTATAACTGGTT	0.318								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)											1	Substitution - coding silent(1)	ovary(1)	3											65.0	66.0	66.0					3																	121207401		2203	4299	6502	122690091	SO:0001819	synonymous_variant	10721			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.4377A>T	3.37:g.121207401T>A			122690091	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	CCDS33833.1	SNP	57	WashU																																																																																				0.318	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		Silent
FAM91A1	157769	genome.wustl.edu	37	8	124811838	124811838	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr8:124811838C>G	ENST00000334705.7	+	17	1885	c.1639C>G	c.(1639-1641)Cca>Gca	p.P547A	FAM91A1_ENST00000521166.1_Missense_Mutation_p.P547A	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	547								p.P547A(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			ACAAGGACCACCATCCCTTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											158.0	138.0	144.0					8																	124811838		1863	4096	5959	124881019	SO:0001583	missense	157769			AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.1639C>G	8.37:g.124811838C>G	ENSP00000335082:p.Pro547Ala		124881019	B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	37	CCDS6346.2	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614154	0.87359	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.41065	1.01;1.01	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	M	0.81802	2.56	0.80722	D	1	P;P	0.52061	0.872;0.95	P;P	0.54431	0.495;0.752	T	0.62987	-0.6737	10	0.40728	T	0.16	.	19.138	0.93436	0.0:1.0:0.0:0.0	.	547;547	E7ER68;Q658Y4	.;F91A1_HUMAN	A	547	ENSP00000429491:P547A;ENSP00000335082:P547A	ENSP00000335082:P547A	P	+	1	0	FAM91A1	124881019	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.984000	0.70548	2.595000	0.87683	0.637000	0.83480	CCA		0.408	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963		Missense_Mutation
AIFM1	9131	genome.wustl.edu	37	X	129265759	129265759	+	Silent	SNP	G	G	T	rs146608893		TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chrX:129265759G>T	ENST00000287295.3	-	14	1694	c.1464C>A	c.(1462-1464)ccC>ccA	p.P488P	AIFM1_ENST00000319908.3_Silent_p.P484P|AIFM1_ENST00000440263.1_Silent_p.P136P|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000346424.2_Silent_p.P201P|AIFM1_ENST00000460436.2_Silent_p.P149P	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	488					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.P488P(2)|p.P484P(2)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	AGCCAACATCGGGGCCCAAAT	0.458																																																4	Substitution - coding silent(4)	ovary(2)|kidney(2)	X											124.0	110.0	115.0					X																	129265759		2203	4300	6503	129093440	SO:0001819	synonymous_variant	9131			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1464C>A	X.37:g.129265759G>T			129093440	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Silent	SNP	ENST00000287295.3	37	CCDS14618.1	SNP	39	WashU																																																																																				0.458	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			Silent
PCDHGC5	56097	genome.wustl.edu	37	5	140869726	140869726	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1361-01	TCGA-04-1361-11	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr5:140869726C>A	ENST00000252087.1	+	1	919	c.919C>A	c.(919-921)Ccc>Acc	p.P307T	PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	307	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P307T(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGTTGGGTCCCATAGACTT	0.522																																																2	Substitution - Missense(2)	ovary(2)	5											98.0	96.0	97.0					5																	140869726		2203	4300	6503	140849910	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.919C>A	5.37:g.140869726C>A	ENSP00000252087:p.Pro307Thr		140849910	Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.374920	0.00207	.	.	ENSG00000240764	ENST00000252087	T	0.01629	4.72	5.95	3.23	0.37069	Cadherin (4);Cadherin-like (1);	0.236013	0.30428	N	0.009655	T	0.02267	0.0070	L	0.41710	1.295	0.09310	N	1	P;P	0.45715	0.865;0.814	B;P	0.48425	0.441;0.577	T	0.39522	-0.9610	10	0.11182	T	0.66	.	6.1341	0.20221	0.3695:0.4946:0.0:0.1359	.	307;307	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	T	307	ENSP00000252087:P307T	ENSP00000252087:P307T	P	+	1	0	PCDHGC5	140849910	0.000000	0.05858	0.292000	0.24919	0.000000	0.00434	0.082000	0.14847	0.418000	0.25898	-0.311000	0.09066	CCC		0.522	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		Missense_Mutation
UBE3C	9690	genome.wustl.edu	37	7	157041088	157041088	+	Silent	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr7:157041088G>A	ENST00000348165.5	+	19	2868	c.2508G>A	c.(2506-2508)gaG>gaA	p.E836E		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	836	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.E836E(1)		central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TGCTGGTGGAGCTGCCCTTTG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	7											96.0	96.0	96.0					7																	157041088		2203	4300	6503	156733849	SO:0001819	synonymous_variant	9690			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2508G>A	7.37:g.157041088G>A			156733849	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Silent	SNP	ENST00000348165.5	37	CCDS34789.1	SNP	34	WashU																																																																																				0.473	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671		Silent
SCN1A	6323	genome.wustl.edu	37	2	166852522	166852522	+	Splice_Site	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr2:166852522C>T	ENST00000303395.4	-	24	4581		c.e24+1		AC010127.3_ENST00000597623.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Splice_Site|SCN1A_ENST00000409050.1_Splice_Site|SCN1A_ENST00000423058.2_Splice_Site			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit						adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.?(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATACTTCTTACTCCTGGTCGA	0.328																																																1	Unknown(1)	ovary(1)	2											111.0	107.0	109.0					2																	166852522		2203	4299	6502	166560768	SO:0001630	splice_region_variant	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4581+1G>A	2.37:g.166852522C>T			166560768	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Splice_Site_SNP	SNP	ENST00000303395.4	37	CCDS54413.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918564	0.92249	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1438	0.98071	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN1A	166560768	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.585000	0.82584	2.768000	0.95171	0.650000	0.86243	.		0.328	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	Intron	Splice_Site_SNP
PPIG	9360	genome.wustl.edu	37	2	170493347	170493347	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1361-01	TCGA-04-1361-11	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr2:170493347A>G	ENST00000260970.3	+	14	1799	c.1579A>G	c.(1579-1581)Agt>Ggt	p.S527G	PPIG_ENST00000448752.2_Missense_Mutation_p.S527G|PPIG_ENST00000409714.3_Missense_Mutation_p.S512G	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	527					protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.S527G(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AGAATCAAAGAGTAATGAGCA	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											55.0	54.0	54.0					2																	170493347		2203	4300	6503	170201593	SO:0001583	missense	9360			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1579A>G	2.37:g.170493347A>G	ENSP00000260970:p.Ser527Gly		170201593	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094862	0.36952	.	.	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	T;T;T	0.18338	2.22;2.22;2.22	5.74	5.74	0.90152	.	0.211109	0.49305	D	0.000152	T	0.11110	0.0271	N	0.19112	0.55	0.35355	D	0.787679	B;P;B	0.39782	0.043;0.688;0.043	B;B;B	0.28849	0.027;0.095;0.027	T	0.17228	-1.0376	10	0.49607	T	0.09	-14.9731	16.0351	0.80621	1.0:0.0:0.0:0.0	.	512;512;527	E9PG73;Q2NKQ6;Q13427	.;.;PPIG_HUMAN	G	527;512;527	ENSP00000260970:S527G;ENSP00000386245:S512G;ENSP00000407083:S527G	ENSP00000260970:S527G	S	+	1	0	PPIG	170201593	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.777000	0.55364	2.186000	0.69663	0.533000	0.62120	AGT		0.333	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			Missense_Mutation
FAM20B	9917	genome.wustl.edu	37	1	179033499	179033499	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:179033499G>T	ENST00000263733.4	+	6	1142	c.806G>T	c.(805-807)gGc>gTc	p.G269V		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	269						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.G269V(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TATGACTCTGGCCCGCGCCTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											201.0	168.0	179.0					1																	179033499		2203	4300	6503	177300122	SO:0001583	missense	9917			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.806G>T	1.37:g.179033499G>T	ENSP00000263733:p.Gly269Val		177300122	Q5W0C3|Q5W0C4	Missense_Mutation	SNP	ENST00000263733.4	37	CCDS1328.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	30	5.051738	0.93793	.	.	ENSG00000116199	ENST00000263733	D	0.83075	-1.68	5.91	5.91	0.95273	.	0.048049	0.85682	D	0.000000	D	0.91456	0.7303	M	0.85197	2.74	0.80722	D	1	P	0.42941	0.794	P	0.55577	0.779	D	0.91577	0.5276	10	0.87932	D	0	-63.7364	20.2985	0.98592	0.0:0.0:1.0:0.0	.	269	O75063	XYLK_HUMAN	V	269	ENSP00000263733:G269V	ENSP00000263733:G269V	G	+	2	0	FAM20B	177300122	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	7.615000	0.83006	2.793000	0.96121	0.655000	0.94253	GGC		0.498	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864		Missense_Mutation
PTGS2	5743	genome.wustl.edu	37	1	186645722	186645722	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:186645722C>T	ENST00000367468.5	-	7	983	c.847G>A	c.(847-849)Ggt>Agt	p.G283S	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	283					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.G283S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	ATCATCAGACCAGGCACCAGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	117.0	120.0					1																	186645722		2203	4300	6503	184912345	SO:0001583	missense	5743			D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.847G>A	1.37:g.186645722C>T	ENSP00000356438:p.Gly283Ser		184912345	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.520406	0.96416	.	.	ENSG00000073756	ENST00000367468	T	0.21191	2.02	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.97110	1.0;0.966	T	0.66416	-0.5929	10	0.59425	D	0.04	-16.5579	19.4407	0.94820	0.0:1.0:0.0:0.0	.	283;283	Q8IZA9;P35354	.;PGH2_HUMAN	S	283	ENSP00000356438:G283S	ENSP00000356438:G283S	G	-	1	0	PTGS2	184912345	1.000000	0.71417	0.904000	0.35570	0.987000	0.75469	7.627000	0.83176	2.586000	0.87340	0.650000	0.86243	GGT		0.517	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963		Missense_Mutation
ACSL1	2180	genome.wustl.edu	37	4	185679025	185679025	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr4:185679025C>T	ENST00000515030.1	-	19	2157	c.1832G>A	c.(1831-1833)tGg>tAg	p.W611*	ACSL1_ENST00000513317.1_Nonsense_Mutation_p.W611*|ACSL1_ENST00000454703.2_Nonsense_Mutation_p.W440*|ACSL1_ENST00000281455.2_Nonsense_Mutation_p.W611*|ACSL1_ENST00000504342.1_Nonsense_Mutation_p.W611*|ACSL1_ENST00000507295.1_Nonsense_Mutation_p.W577*|ACSL1_ENST00000437665.3_Nonsense_Mutation_p.W440*			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	611					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.W611*(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CTTTTGGGCCCAGGAACATAA	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	4											178.0	172.0	174.0					4																	185679025		2203	4300	6503	185916019	SO:0001587	stop_gained	2180			BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1832G>A	4.37:g.185679025C>T	ENSP00000422607:p.Trp611*		185916019	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Nonsense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	37	6.240975	0.97403	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2421	19.8273	0.96622	0.0:1.0:0.0:0.0	.	.	.	.	X	440;611;207;611;577;440;611;611	.	ENSP00000281455:W611X	W	-	2	0	ACSL1	185916019	1.000000	0.71417	0.999000	0.59377	0.180000	0.23129	7.741000	0.84997	2.684000	0.91462	0.655000	0.94253	TGG		0.403	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995		Nonsense_Mutation
ARHGEF10L	55160	genome.wustl.edu	37	1	17950939	17950939	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:17950939G>A	ENST00000361221.3	+	13	1417	c.1258G>A	c.(1258-1260)Gcc>Acc	p.A420T	ARHGEF10L_ENST00000167825.4_Intron|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.A381T|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.A178T|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.A420T|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.A381T|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.A198T	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	420	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A420T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTTCACCAGTGCCATGTCCAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											240.0	176.0	198.0					1																	17950939		2203	4300	6503	17823526	SO:0001583	missense	55160			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1258G>A	1.37:g.17950939G>A	ENSP00000355060:p.Ala420Thr		17823526	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924724	0.92319	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829	T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	4.7	4.7	0.59300	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.81786	0.4896	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.976;0.998;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D	0.75484	0.971;0.946;0.964;0.971;0.964;0.977;0.986	D	0.84880	0.0830	10	0.87932	D	0	-31.5189	16.2112	0.82164	0.0:0.0:1.0:0.0	.	198;178;420;186;381;381;420	Q5VXI4;B4DTE2;Q9HCE6-5;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	T	420;381;420;381;178;198;198	ENSP00000355060:A420T;ENSP00000399401:A381T;ENSP00000394621:A420T;ENSP00000364564:A381T;ENSP00000364569:A178T;ENSP00000364557:A198T	ENSP00000355060:A420T	A	+	1	0	ARHGEF10L	17823526	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	9.373000	0.97168	2.166000	0.68216	0.561000	0.74099	GCC		0.562	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		Missense_Mutation
EVI5	7813	genome.wustl.edu	37	1	92979338	92979338	+	Missense_Mutation	SNP	G	G	T	rs373069997		TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr1:92979338G>T	ENST00000370331.1	-	18	2317	c.2308C>A	c.(2308-2310)Ccc>Acc	p.P770T	EVI5_ENST00000543509.1_Missense_Mutation_p.P781T|EVI5_ENST00000540033.1_Missense_Mutation_p.P770T	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	770	Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.P770T(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GCCACTGCGGGGTCCAAAGAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	98.0	97.0					1																	92979338		2203	4300	6503	92751926	SO:0001583	missense	7813			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.2308C>A	1.37:g.92979338G>T	ENSP00000359356:p.Pro770Thr		92751926	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	13.20	2.167506	0.38315	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.06142	3.34;3.34;3.34	5.92	5.92	0.95590	.	0.458193	0.20691	N	0.087441	T	0.03477	0.0100	N	0.22421	0.69	0.45733	D	0.998635	B;B	0.26195	0.144;0.089	B;B	0.29353	0.101;0.047	T	0.44436	-0.9328	10	0.62326	D	0.03	-0.06	18.4921	0.90852	0.0:0.0:1.0:0.0	.	781;770	F5H4R0;O60447	.;EVI5_HUMAN	T	770;770;781	ENSP00000359356:P770T;ENSP00000440826:P770T;ENSP00000445019:P781T	ENSP00000359356:P770T	P	-	1	0	EVI5	92751926	1.000000	0.71417	0.564000	0.28396	0.328000	0.28507	3.180000	0.50895	2.793000	0.96121	0.650000	0.86243	CCC		0.478	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665		Missense_Mutation
MOGAT2	80168	genome.wustl.edu	37	11	75428949	75428949	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr11:75428949C>A	ENST00000198801.5	+	1	86	c.16C>A	c.(16-18)Ccc>Acc	p.P6T	MOGAT2_ENST00000526712.1_5'Flank	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	6					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.P6T(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					AGAGTTCGCGCCCTTGTTTAT	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											110.0	79.0	89.0					11																	75428949		2200	4293	6493	75106597	SO:0001583	missense	80168			AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.16C>A	11.37:g.75428949C>A	ENSP00000198801:p.Pro6Thr		75106597	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	37	CCDS8240.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822896	0.71028	.	.	ENSG00000166391	ENST00000198801	T	0.50548	0.74	4.87	2.85	0.33270	.	0.060631	0.64402	D	0.000002	T	0.70046	0.3179	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72740	-0.4202	10	0.87932	D	0	0.1611	7.3377	0.26619	0.1672:0.7407:0.0:0.0921	.	6;6	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	T	6	ENSP00000198801:P6T	ENSP00000198801:P6T	P	+	1	0	MOGAT2	75106597	0.954000	0.32549	0.021000	0.16686	0.427000	0.31564	2.605000	0.46283	1.166000	0.42689	0.557000	0.71058	CCC		0.582	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098		Missense_Mutation
MOGAT2	80168	genome.wustl.edu	37	11	75439119	75439119	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr11:75439119G>A	ENST00000198801.5	+	4	650	c.580G>A	c.(580-582)Gcc>Acc	p.A194T	MOGAT2_ENST00000526712.1_Missense_Mutation_p.A112T	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	194					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.A194T(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					GGCCCTGGATGCCAGGCCTGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											61.0	54.0	56.0					11																	75439119		2200	4293	6493	75116767	SO:0001583	missense	80168			AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.580G>A	11.37:g.75439119G>A	ENSP00000198801:p.Ala194Thr		75116767	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	37	CCDS8240.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757584	0.69648	.	.	ENSG00000166391	ENST00000198801;ENST00000526712	T;T	0.16457	2.34;2.34	5.93	4.03	0.46877	.	0.049565	0.85682	D	0.000000	T	0.29850	0.0746	L	0.49256	1.55	0.80722	D	1	D;D	0.64830	0.96;0.994	P;P	0.61874	0.764;0.895	T	0.01004	-1.1484	10	0.46703	T	0.11	-3.2987	10.0458	0.42186	0.0717:0.0:0.7906:0.1377	.	194;194	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	T	194;112	ENSP00000198801:A194T;ENSP00000436283:A112T	ENSP00000198801:A194T	A	+	1	0	MOGAT2	75116767	1.000000	0.71417	0.570000	0.28473	0.943000	0.58893	3.633000	0.54295	0.816000	0.34421	0.561000	0.74099	GCC		0.587	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098		Missense_Mutation
MEFV	4210	genome.wustl.edu	37	16	3299648	3299648	+	Missense_Mutation	SNP	C	C	T	rs104895198		TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr16:3299648C>T	ENST00000219596.1	-	3	1082	c.1043G>A	c.(1042-1044)cGc>cAc	p.R348H	MEFV_ENST00000536379.1_Missense_Mutation_p.R137H|MEFV_ENST00000541159.1_Missense_Mutation_p.R137H|MEFV_ENST00000339854.4_Missense_Mutation_p.R168H	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	348					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.R348H(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GCCAGGTGAGCGGCTGCCTGA	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16808	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	16						C	HIS/ARG,HIS/ARG	1,4391	2.1+/-5.4	0,1,2195	25.0	28.0	27.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1043,410	-8.2	0.0	16	dbSNP_132	27	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	MEFV	NM_000243.2,NM_001198536.1	29,29	0,4,6492	TT,TC,CC		0.0349,0.0228,0.0308	possibly-damaging,possibly-damaging	348/782,137/446	3299648	4,12988	2196	4300	6496	3239649	SO:0001583	missense	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1043G>A	16.37:g.3299648C>T	ENSP00000219596:p.Arg348His		3239649	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	5.370	0.253552	0.10185	2.28E-4	3.49E-4	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.64618	-0.11;0.32;0.22;0.33	4.11	-8.23	0.01033	.	2.533260	0.01059	N	0.004617	T	0.41971	0.1182	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.43410	-0.9393	10	0.33141	T	0.24	-27.6587	14.814	0.70017	0.0:0.7071:0.1089:0.184	.	348	O15553	MEFV_HUMAN	H	348;348;168;137;137;137	ENSP00000219596:R348H;ENSP00000339639:R168H;ENSP00000438711:R137H;ENSP00000445079:R137H	ENSP00000219596:R348H	R	-	2	0	MEFV	3239649	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.762000	0.00373	-2.922000	0.00304	-0.251000	0.11542	CGC		0.657	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243		Missense_Mutation
PDIA5	10954	genome.wustl.edu	37	3	122880170	122880170	+	Silent	SNP	T	T	A			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr3:122880170T>A	ENST00000316218.7	+	16	1442	c.1347T>A	c.(1345-1347)atT>atA	p.I449I	PDIA5_ENST00000467157.1_3'UTR	NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	449	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)	p.I449I(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		GCTCCTAGATTGCCTGTGCCG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	3											97.0	87.0	90.0					3																	122880170		2203	4300	6503	124362860	SO:0001819	synonymous_variant	10954			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.1347T>A	3.37:g.122880170T>A			124362860	D3DN95|Q9BV43	Silent	SNP	ENST00000316218.7	37	CCDS3020.1	SNP	63	WashU																																																																																				0.562	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810		Silent
SLC12A2	6558	genome.wustl.edu	37	5	127484533	127484533	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	G	T	T	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr5:127484533T>G	ENST00000262461.2	+	12	2158	c.1969T>G	c.(1969-1971)Tta>Gta	p.L657V	SLC12A2_ENST00000343225.4_Missense_Mutation_p.L657V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	657					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)	p.L657V(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGGCTACATCTTAACATTCTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	5											189.0	188.0	188.0					5																	127484533		2203	4300	6503	127512432	SO:0001583	missense	6558				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1969T>G	5.37:g.127484533T>G	ENSP00000262461:p.Leu657Val		127512432	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417656	0.62622	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98849	-5.18;-5.18	4.2	1.82	0.25136	Amino acid permease domain (1);	0.160682	0.42294	D	0.000729	D	0.98166	0.9394	M	0.70108	2.13	0.80722	D	1	D;D	0.58620	0.979;0.983	P;P	0.58077	0.742;0.832	D	0.96970	0.9708	10	0.87932	D	0	.	6.2846	0.21027	0.0:0.4518:0.0:0.5482	.	657;657	P55011-3;P55011	.;S12A2_HUMAN	V	657	ENSP00000262461:L657V;ENSP00000340878:L657V	ENSP00000262461:L657V	L	+	1	2	SLC12A2	127512432	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.228000	0.51270	0.419000	0.25927	-0.399000	0.06403	TTA		0.333	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046		Missense_Mutation
CHST9	83539	genome.wustl.edu	37	18	24496327	24496327	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr18:24496327C>T	ENST00000284224.8	-	6	1505	c.1228G>A	c.(1228-1230)Gtg>Atg	p.V410M	CHST9_ENST00000581714.1_Missense_Mutation_p.V410M|AQP4-AS1_ENST00000578701.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	410					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.V410M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					TACTGTCTCACGACTTGAGCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	18											143.0	133.0	136.0					18																	24496327		1843	4088	5931	22750325	SO:0001583	missense	83539			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.1228G>A	18.37:g.24496327C>T	ENSP00000284224:p.Val410Met		22750325	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	16.14	3.040034	0.55003	.	.	ENSG00000154080	ENST00000284224	T	0.74632	-0.86	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000009	T	0.78868	0.4351	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.79708	-0.1690	10	0.66056	D	0.02	-17.2963	13.8057	0.63230	0.0:0.9305:0.0:0.0695	.	410	Q7L1S5	CHST9_HUMAN	M	410	ENSP00000284224:V410M	ENSP00000284224:V410M	V	-	1	0	CHST9	22750325	1.000000	0.71417	0.970000	0.41538	0.885000	0.51271	4.492000	0.60334	2.885000	0.99019	0.655000	0.94253	GTG		0.348	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422		Missense_Mutation
TMEM59L	25789	genome.wustl.edu	37	19	18727888	18727888	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:18727888C>A	ENST00000600490.1	+	6	825	c.640C>A	c.(640-642)Cct>Act	p.P214T	TMEM59L_ENST00000262817.3_Missense_Mutation_p.P214T			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	214						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P214T(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						AGGCTCCCACCCTGAAGCCCT	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	59.0	59.0					19																	18727888		2203	4300	6503	18588888	SO:0001583	missense	25789			AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.640C>A	19.37:g.18727888C>A	ENSP00000470879:p.Pro214Thr		18588888		Missense_Mutation	SNP	ENST00000600490.1	37	CCDS12383.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197444	0.58126	.	.	ENSG00000105696	ENST00000262817	T	0.50001	0.76	3.36	3.36	0.38483	.	0.515351	0.21006	N	0.081774	T	0.44540	0.1298	L	0.40543	1.245	0.34792	D	0.735819	D	0.53312	0.959	P	0.49085	0.6	T	0.52961	-0.8505	10	0.24483	T	0.36	-12.4126	13.0226	0.58796	0.0:1.0:0.0:0.0	.	214	Q9UK28	TM59L_HUMAN	T	214	ENSP00000262817:P214T	ENSP00000262817:P214T	P	+	1	0	TMEM59L	18588888	0.888000	0.30383	0.997000	0.53966	0.955000	0.61496	2.471000	0.45127	2.201000	0.70794	0.462000	0.41574	CCT		0.642	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465143.2			Missense_Mutation
ATP13A1	57130	genome.wustl.edu	37	19	19756787	19756787	+	Nonsense_Mutation	SNP	G	G	A	rs144612212	byFrequency	TCGA-04-1361-01	TCGA-04-1361-11	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chr19:19756787G>A	ENST00000357324.6	-	24	3282	c.3256C>T	c.(3256-3258)Cag>Tag	p.Q1086*	GMIP_ENST00000445806.2_5'Flank|ATP13A1_ENST00000291503.5_Nonsense_Mutation_p.Q968*|GMIP_ENST00000587238.1_5'Flank|GMIP_ENST00000203556.4_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1086						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.Q1086*(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TCCACGAACTGCTCCTGCCTG	0.587																																					Esophageal Squamous(142;920 1789 9047 14684 24777)											1	Substitution - Nonsense(1)	ovary(1)	19											215.0	184.0	194.0					19																	19756787		2203	4300	6503	19617787	SO:0001587	stop_gained	57130			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3256C>T	19.37:g.19756787G>A	ENSP00000349877:p.Gln1086*		19617787	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Nonsense_Mutation	SNP	ENST00000357324.6	37	CCDS32970.2	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	37	6.124515	0.97305	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	.	.	.	4.95	2.65	0.31530	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-9.8479	7.0931	0.25295	0.0:0.357:0.4908:0.1522	.	.	.	.	X	968;1086	.	ENSP00000291503:Q968X	Q	-	1	0	ATP13A1	19617787	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	4.525000	0.60559	1.027000	0.39758	0.491000	0.48974	CAG		0.587	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410		Nonsense_Mutation
PFKFB1	5207	genome.wustl.edu	37	X	55020432	55020432	+	Silent	SNP	T	T	G			TCGA-04-1361-01	TCGA-04-1361-11	T	T	T	G	T	T	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chrX:55020432T>G	ENST00000375006.3	-	1	79	c.9A>C	c.(7-9)ccA>ccC	p.P3P	PFKFB1_ENST00000545676.1_Intron|PFKFB1_ENST00000374992.2_Silent_p.P3P	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	3	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)	p.P3P(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						CTCCCATCTCTGGAGACATCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	X											90.0	66.0	74.0					X																	55020432		2203	4300	6503	55037157	SO:0001819	synonymous_variant	5207				CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.9A>C	X.37:g.55020432T>G			55037157	B2RA88|B4DUN5|Q5JXS5|Q99951	Silent	SNP	ENST00000375006.3	37	CCDS14364.1	SNP	55	WashU																																																																																				0.547	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1			Silent
STK26	51765	genome.wustl.edu	37	X	131207038	131207038	+	Silent	SNP	C	C	T	rs34419165		TCGA-04-1361-01	TCGA-04-1361-11	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-04-1361-01	TCGA-04-1361-11	g.chrX:131207038C>T	ENST00000354719.6	+	10	1287	c.1071C>T	c.(1069-1071)ctC>ctT	p.L357L	MST4_ENST00000496850.1_Silent_p.L319L|MST4_ENST00000481105.1_Silent_p.L403L|MST4_ENST00000394334.2_Silent_p.L381L|MST4_ENST00000394335.2_Silent_p.L304L														p.L381L(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					TTGAAGAACTCGAGAAAAGTA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	X											64.0	70.0	68.0					X																	131207038		2199	4295	6494	131034719	SO:0001819	synonymous_variant	51765																														ENST00000354719.6:c.1071C>T	X.37:g.131207038C>T			131034719		Silent	SNP	ENST00000354719.6	37		SNP	31	WashU																																																																																				0.358	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2			Silent
