#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
AFMID	125061	hgsc.bcm.edu	37	17	76198590	76198590	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr17:76198590G>T	ENST00000327898.5	+	3	174	c.165G>T	c.(163-165)agG>agT	p.R55S	AFMID_ENST00000409257.5_Missense_Mutation_p.R55S|AFMID_ENST00000588800.1_Intron|AFMID_ENST00000591952.1_Intron					arylformamidase											autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)	19			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)			CCACCACAAGGGCCCGGGCCA	0.517																																																0			17											57.0	60.0	59.0					17																	76198590		2203	4300	6503	73710185	SO:0001583	missense	125061			BX648442	CCDS32750.2, CCDS45801.1	17q25.3	2005-11-09			ENSG00000183077	ENSG00000183077	3.5.1.9		20910	protein-coding gene	gene with protein product							Standard	NR_027083		Approved	DKFZp686F03259, KF	uc002juz.3	Q63HM1	OTTHUMG00000153957	ENST00000327898.5:c.165G>T	17.37:g.76198590G>T	ENSP00000328938:p.Arg55Ser		73710185		Missense_Mutation	SNP	ENST00000327898.5	37	CCDS45801.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.280	-0.147315	0.06627	.	.	ENSG00000183077	ENST00000409257;ENST00000327898	.	.	.	4.4	0.931	0.19460	.	0.486350	0.22606	N	0.057894	T	0.43545	0.1252	L	0.54323	1.7	0.58432	D	0.999997	B;B;B	0.24426	0.103;0.063;0.103	B;B;B	0.25140	0.058;0.026;0.058	T	0.20472	-1.0274	9	0.30854	T	0.27	-5.3282	2.1954	0.03909	0.2002:0.1531:0.4905:0.1561	.	55;55;55	A5PLM3;Q63HM1;Q63HM1-2	.;AFMID_HUMAN;.	S	55	.	ENSP00000328938:R55S	R	+	3	2	AFMID	73710185	0.534000	0.26362	0.503000	0.27626	0.694000	0.40290	0.626000	0.24492	0.431000	0.26258	0.407000	0.27541	AGG		0.517	AFMID-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333203.1	XM_058889		Missense_Mutation
AGAP2	116986	hgsc.bcm.edu	37	12	58124297	58124297	+	Silent	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr12:58124297C>T	ENST00000547588.1	-	12	2408	c.2409G>A	c.(2407-2409)ttG>ttA	p.L803L	AGAP2_ENST00000257897.3_Silent_p.L467L	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	803	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GGGCTCGGGCCAAATTCCGGT	0.567																																																0			12											226.0	229.0	228.0					12																	58124297		2203	4300	6503	56410564	SO:0001819	synonymous_variant	116986			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2409G>A	12.37:g.58124297C>T			56410564	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	37	CCDS44932.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.004	0.555434	0.13436	.	.	ENSG00000135439	ENST00000328568	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	T	0.64929	0.2643	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62416	-0.6859	4	.	.	.	.	13.3774	0.60747	0.0:1.0:0.0:0.0	.	.	.	.	S	667	.	.	G	-	1	0	AGAP2	56410564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.291000	0.51764	2.630000	0.89119	0.561000	0.74099	GGC		0.567	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770		Silent
ATP2A1	487	hgsc.bcm.edu	37	16	28913193	28913193	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr16:28913193G>T	ENST00000357084.3	+	16	2377	c.2110G>T	c.(2110-2112)Ggc>Tgc	p.G704C	ATP2A1_ENST00000395503.4_Missense_Mutation_p.G704C|ATP2A1_ENST00000536376.1_Missense_Mutation_p.G579C	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	704					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.G704C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GACAGGTGATGGCGTCAATGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											47.0	40.0	43.0					16																	28913193		2197	4300	6497	28820694	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2110G>T	16.37:g.28913193G>T	ENSP00000349595:p.Gly704Cys		28820694	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994955	0.54041	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.99515	-6.06;-6.06;-6.06	5.27	4.31	0.51392	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.99783	4.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96743	0.9548	10	0.87932	D	0	.	12.9867	0.58596	0.0803:0.0:0.9197:0.0	.	579;704;704	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	C	704;704;741;579	ENSP00000349595:G704C;ENSP00000378879:G704C;ENSP00000443101:G579C	ENSP00000349595:G704C	G	+	1	0	ATP2A1	28820694	1.000000	0.71417	0.709000	0.30452	0.348000	0.29142	9.761000	0.98940	1.216000	0.43427	0.561000	0.74099	GGC		0.537	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320		Missense_Mutation
ATP5B	506	hgsc.bcm.edu	37	12	57033004	57033004	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr12:57033004T>G	ENST00000262030.3	-	9	1425	c.1375A>C	c.(1375-1377)Aaa>Caa	p.K459Q	ATP5B_ENST00000552919.1_Missense_Mutation_p.K448Q|ATP5B_ENST00000550162.1_5'Flank|BAZ2A_ENST00000379441.3_5'Flank|BAZ2A_ENST00000179765.5_5'Flank|BAZ2A_ENST00000551812.1_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	459					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CGCTGTATTTTCCGTGCACGG	0.478																																																0			12											144.0	132.0	136.0					12																	57033004		2203	4300	6503	55319271	SO:0001583	missense	506			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1375A>C	12.37:g.57033004T>G	ENSP00000262030:p.Lys459Gln		55319271	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043560	0.93685	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104;ENST00000551020	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.92	5.92	0.95590	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90021	0.6884	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91921	0.5547	10	0.87932	D	0	-19.0085	15.3986	0.74818	0.0:0.0:0.0:1.0	.	459	P06576	ATPB_HUMAN	Q	459;448;162;274	ENSP00000262030:K459Q;ENSP00000450297:K448Q;ENSP00000450233:K162Q;ENSP00000446677:K274Q	ENSP00000262030:K459Q	K	-	1	0	ATP5B	55319271	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.872000	0.87187	2.278000	0.76064	0.524000	0.50904	AAA		0.478	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		Missense_Mutation
BCAS1	8537	hgsc.bcm.edu	37	20	52644934	52644934	+	Silent	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr20:52644934C>A	ENST00000395961.3	-	4	886	c.720G>T	c.(718-720)ggG>ggT	p.G240G	BCAS1_ENST00000371435.2_Silent_p.G240G|BCAS1_ENST00000411563.1_Silent_p.G143G|BCAS1_ENST00000371440.3_Silent_p.G240G	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	240						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CACTTACCTTCCCTGCAGGGA	0.552																																																0			20											286.0	243.0	258.0					20																	52644934		2203	4300	6503	52078341	SO:0001819	synonymous_variant	8537			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.720G>T	20.37:g.52644934C>A			52078341	A0AVG5|Q68CZ3	Silent	SNP	ENST00000395961.3	37	CCDS13444.1	SNP	30	Baylor																																																																																				0.552	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657		Silent
TIMM21	29090	hgsc.bcm.edu	37	18	71825446	71825446	+	Missense_Mutation	SNP	G	G	A	rs202084098		TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr18:71825446G>A	ENST00000169551.6	+	5	875	c.577G>A	c.(577-579)Gtg>Atg	p.V193M		NM_014177.2	NP_054896.2	Q9BVV7	TIM21_HUMAN	translocase of inner mitochondrial membrane 21 homolog (yeast)	193					cellular protein metabolic process (GO:0044267)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane presequence translocase complex (GO:0005744)											ACACACGTGTGTGAAATTCTA	0.458																																																0			18						G	MET/VAL	0,4406		0,0,2203	101.0	102.0	101.0		577	3.7	0.9	18		101	1,8599	1.2+/-3.3	0,1,4299	yes	missense	C18orf55	NM_014177.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	193/249	71825446	1,13005	2203	4300	6503	69976426	SO:0001583	missense	29090			BC000892	CCDS12003.1	18q22.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000075336	ENSG00000075336			25010	protein-coding gene	gene with protein product		615180	"""chromosome 18 open reading frame 55"""	C18orf55		11042152	Standard	NM_014177		Approved	HSPC154, TIM21	uc010dqr.1	Q9BVV7	OTTHUMG00000132844	ENST00000169551.6:c.577G>A	18.37:g.71825446G>A	ENSP00000169551:p.Val193Met		69976426	Q9P010	Missense_Mutation	SNP	ENST00000169551.6	37	CCDS12003.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.193	1.026448	0.19512	0.0	1.16E-4	ENSG00000075336	ENST00000169551	T	0.37411	1.2	5.55	3.74	0.42951	.	0.279412	0.35378	N	0.003259	T	0.19765	0.0475	L	0.33339	1.005	0.80722	D	1	B	0.30068	0.267	B	0.27380	0.079	T	0.08932	-1.0698	10	0.02654	T	1	-9.1476	6.579	0.22583	0.0:0.3854:0.3237:0.291	.	193	Q9BVV7	TI21L_HUMAN	M	193	ENSP00000169551:V193M	ENSP00000169551:V193M	V	+	1	0	C18orf55	69976426	0.998000	0.40836	0.867000	0.34043	0.370000	0.29829	3.397000	0.52572	0.677000	0.31305	0.551000	0.68910	GTG		0.458	TIMM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256318.1	NM_014177		Missense_Mutation
WDR83OS	51398	hgsc.bcm.edu	37	19	12780179	12780179	+	Silent	SNP	G	G	A	rs62108388	byFrequency	TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr19:12780179G>A	ENST00000596731.1	-	1	1991	c.39C>T	c.(37-39)aaC>aaT	p.N13N	WDR83OS_ENST00000222190.5_Silent_p.N13N|MAN2B1_ENST00000456935.2_5'Flank|WDR83_ENST00000418543.3_Intron|CTD-2192J16.24_ENST00000597961.1_Silent_p.N11N|MAN2B1_ENST00000221363.4_5'Flank|WDR83_ENST00000242796.4_5'Flank|WDR83OS_ENST00000600694.1_5'Flank	NM_016145.3	NP_057229.1	Q9Y284	ASTER_HUMAN	WD repeat domain 83 opposite strand	13						integral component of membrane (GO:0016021)											TCAGCACTTTGTTCGGCCTCC	0.637													G|||	95	0.0189696	0.003	0.0303	5008	,	,		15943	0.0		0.0646	False		,,,				2504	0.0051															0			19						G	,	88,4316		3,82,2117	68.0	55.0	60.0		,39	5.7	1.0	19	dbSNP_129	60	570,8030		13,544,3743	no	intron,coding-synonymous	C19orf56,WDR83	NM_001099737.2,NM_016145.3	,	16,626,5860	AA,AG,GG		6.6279,1.9982,5.06	,	,13/107	12780179	658,12346	2202	4300	6502	12641179	SO:0001819	synonymous_variant	51398			AF151898	CCDS12274.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000105583	ENSG00000105583			30203	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 56"""	C19orf56		10810093	Standard	NM_016145		Approved	PTD008	uc002mud.2	Q9Y284		ENST00000596731.1:c.39C>T	19.37:g.12780179G>A			12641179	B2R4T8|Q9BVI3	Silent	SNP	ENST00000596731.1	37	CCDS12274.1	SNP	48	Baylor																																																																																				0.637	WDR83OS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462702.1	NM_016145		Silent
RRP36	88745	hgsc.bcm.edu	37	6	42993025	42993025	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr6:42993025C>G	ENST00000244496.5	+	3	313	c.303C>G	c.(301-303)atC>atG	p.I101M		NM_033112.2	NP_149103.1	Q96EU6	RRP36_HUMAN	ribosomal RNA processing 36 homolog (S. cerevisiae)	101					ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I101M(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(5)|lung(1)|ovary(1)|prostate(1)	11						CAGCCAAGATCCGAGTACCAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	6											126.0	122.0	123.0					6																	42993025		2203	4300	6503	43101003	SO:0001583	missense	88745			BC011933	CCDS34453.1	6p21.1	2010-07-06	2010-07-06	2010-07-06	ENSG00000124541	ENSG00000124541			21374	protein-coding gene	gene with protein product		613475	"""chromosome 6 open reading frame 153"""	C6orf153		20038530	Standard	NM_033112		Approved	dJ20C7.4	uc003otp.1	Q96EU6	OTTHUMG00000014715	ENST00000244496.5:c.303C>G	6.37:g.42993025C>G	ENSP00000244496:p.Ile101Met		43101003	Q9BRF6|Q9P0C8	Missense_Mutation	SNP	ENST00000244496.5	37	CCDS34453.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821678	0.32237	.	.	ENSG00000124541	ENST00000244496	T	0.42900	0.96	4.95	-1.78	0.07957	.	0.635593	0.15166	N	0.276904	T	0.11580	0.0282	L	0.31926	0.97	0.19300	N	0.999977	P	0.48089	0.905	P	0.45377	0.478	T	0.09818	-1.0657	10	0.35671	T	0.21	.	0.4839	0.00552	0.1993:0.318:0.2294:0.2532	.	101	Q96EU6	RRP36_HUMAN	M	101	ENSP00000244496:I101M	ENSP00000244496:I101M	I	+	3	3	RRP36	43101003	0.911000	0.30947	0.693000	0.30195	0.883000	0.51084	-0.161000	0.10026	-0.140000	0.11394	-0.175000	0.13238	ATC		0.493	RRP36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040572.1	NM_033112		Missense_Mutation
FAM200A	221786	hgsc.bcm.edu	37	7	99145624	99145624	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr7:99145624G>C	ENST00000449309.1	-	2	786	c.407C>G	c.(406-408)tCc>tGc	p.S136C		NM_145111.3	NP_659802.1	Q8TCP9	F200A_HUMAN	family with sequence similarity 200, member A	136						integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.S136C(1)		endometrium(1)|kidney(5)|large_intestine(2)|ovary(2)|skin(1)	11						gtctataccggactgcagccg	0.388																																																1	Substitution - Missense(1)	ovary(1)	7											107.0	91.0	97.0					7																	99145624		1635	2943	4578	98983560	SO:0001583	missense	221786				CCDS5668.1	7q22.1	2010-02-22	2010-02-22	2010-02-22	ENSG00000221909	ENSG00000221909			25401	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 38"""	C7orf38		10607616	Standard	NM_145111		Approved	FLJ36794, DKFZp727G131	uc003ura.3	Q8TCP9	OTTHUMG00000156723	ENST00000449309.1:c.407C>G	7.37:g.99145624G>C	ENSP00000411372:p.Ser136Cys		98983560	A4D293|A8K3V9|B2RD92|C9J6A8|D6W5T2|Q8N9P3	Missense_Mutation	SNP	ENST00000449309.1	37	CCDS5668.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717745	0.30413	.	.	ENSG00000221909	ENST00000449309;ENST00000408938	T;T	0.46451	0.87;0.87	2.58	1.69	0.24217	Ribonuclease H-like (1);	0.259817	0.25408	N	0.030896	T	0.29882	0.0747	L	0.31926	0.97	0.22185	N	0.999301	B	0.25441	0.126	B	0.32724	0.151	T	0.20940	-1.0260	10	0.49607	T	0.09	.	5.4215	0.16403	0.1609:0.0:0.8391:0.0	.	136	Q8TCP9	F200A_HUMAN	C	136	ENSP00000411372:S136C;ENSP00000386191:S136C	ENSP00000386191:S136C	S	-	2	0	FAM200A	98983560	0.571000	0.26659	0.856000	0.33681	0.985000	0.73830	1.064000	0.30579	0.644000	0.30656	0.655000	0.94253	TCC		0.388	FAM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345467.1	NM_145111		Missense_Mutation
CARD6	84674	hgsc.bcm.edu	37	5	40853323	40853323	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr5:40853323A>T	ENST00000254691.5	+	3	2088	c.1889A>T	c.(1888-1890)cAg>cTg	p.Q630L	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	630					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GCTGCCCTCCAGGAAGTGATG	0.527																																																0			5											130.0	131.0	131.0					5																	40853323		2203	4300	6503	40889080	SO:0001583	missense	84674			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.1889A>T	5.37:g.40853323A>T	ENSP00000254691:p.Gln630Leu		40889080	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.450	1.090423	0.20471	.	.	ENSG00000132357	ENST00000254691	T	0.12672	2.66	5.0	-0.0585	0.13796	.	0.411550	0.20850	N	0.084556	T	0.11410	0.0278	L	0.60455	1.87	0.24909	N	0.992052	B	0.31318	0.319	B	0.26517	0.07	T	0.16100	-1.0414	10	0.36615	T	0.2	-3.0328	7.5146	0.27593	0.6349:0.0:0.3651:0.0	.	630	Q9BX69	CARD6_HUMAN	L	630	ENSP00000254691:Q630L	ENSP00000254691:Q630L	Q	+	2	0	CARD6	40889080	0.003000	0.15002	0.631000	0.29282	0.512000	0.34134	0.035000	0.13797	-0.143000	0.11334	-1.144000	0.01866	CAG		0.527	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3			Missense_Mutation
CD44	960	hgsc.bcm.edu	37	11	35218311	35218311	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr11:35218311C>A	ENST00000428726.2	+	6	809	c.686C>A	c.(685-687)gCt>gAt	p.A229D	CD44_ENST00000433354.2_Missense_Mutation_p.A229D|CD44_ENST00000434472.2_Intron|CD44_ENST00000415148.2_Intron|CD44_ENST00000263398.6_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Missense_Mutation_p.A229D|CD44_ENST00000352818.4_Intron|CD44_ENST00000437706.2_Missense_Mutation_p.A229D|CD44_ENST00000433892.2_Intron|CD44_ENST00000526669.2_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	229	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	AGCACTAGTGCTACAGCAACT	0.373																																																0			11											109.0	94.0	99.0					11																	35218311		2202	4298	6500	35174887	SO:0001583	missense	960			M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.686C>A	11.37:g.35218311C>A	ENSP00000398632:p.Ala229Asp		35174887	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	ENST00000428726.2	37	CCDS7897.1	SNP	28	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.149|5.149	0.213117|0.213117	0.09757|0.09757	.|.	.|.	ENSG00000026508|ENSG00000026508	ENST00000433354;ENST00000449691;ENST00000437706;ENST00000428726|ENST00000525685	T;T;T;T|.	0.26067|.	1.76;1.76;1.76;1.76|.	4.53|4.53	0.44|0.44	0.16572|0.16572	.|.	0.978844|.	0.08328|.	N|.	0.962739|.	T|T	0.15522|0.15522	0.0374|0.0374	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999998|0.999998	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.27839|0.27839	-1.0062|-1.0062	10|5	0.33940|.	T|.	0.23|.	-16.2576|-16.2576	4.9438|4.9438	0.13978|0.13978	0.2157:0.4035:0.3809:0.0|0.2157:0.4035:0.3809:0.0	.|.	229|.	P16070|.	CD44_HUMAN|.	D|I	229|97	ENSP00000414567:A229D;ENSP00000391008:A229D;ENSP00000403990:A229D;ENSP00000398632:A229D|.	ENSP00000398632:A229D|.	A|L	+|+	2|1	0|2	CD44|CD44	35174887|35174887	0.144000|0.144000	0.22641|0.22641	0.034000|0.034000	0.17996|0.17996	0.111000|0.111000	0.19643|0.19643	0.201000|0.201000	0.17276|0.17276	0.024000|0.024000	0.15214|0.15214	0.561000|0.561000	0.74099|0.74099	GCT|CTA		0.373	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610		Missense_Mutation
CATSPER1	117144	hgsc.bcm.edu	37	11	65793480	65793480	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr11:65793480C>A	ENST00000312106.5	-	1	508	c.371G>T	c.(370-372)aGg>aTg	p.R124M		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	124	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATGATGCCTCCTGCCATCACG	0.587																																																0			11											90.0	78.0	82.0					11																	65793480		2201	4296	6497	65550056	SO:0001583	missense	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.371G>T	11.37:g.65793480C>A	ENSP00000309052:p.Arg124Met		65550056	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499885	0.26861	.	.	ENSG00000175294	ENST00000312106	D	0.97752	-4.52	2.68	0.317	0.15861	.	5.783990	0.00424	N	0.000078	D	0.96691	0.8920	L	0.51422	1.61	0.09310	N	1	D	0.56521	0.976	P	0.47528	0.549	D	0.90636	0.4571	10	0.39692	T	0.17	0.5487	9.5072	0.39053	0.0:0.3831:0.6169:0.0	.	124	Q8NEC5	CTSR1_HUMAN	M	124	ENSP00000309052:R124M	ENSP00000309052:R124M	R	-	2	0	CATSPER1	65550056	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.759000	0.04761	0.395000	0.25257	0.313000	0.20887	AGG		0.587	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		Missense_Mutation
CREBBP	1387	hgsc.bcm.edu	37	16	3819257	3819257	+	Frame_Shift_Del	DEL	G	G	-			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr16:3819257delG	ENST00000262367.5	-	15	3787	c.2978delC	c.(2977-2979)cctfs	p.P993fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.P955fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	993					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P993fs*5(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTCCAGCACAGGTACGTCAGG	0.602			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Deletion - Frameshift(1)	ovary(1)	16											116.0	101.0	106.0					16																	3819257		2197	4300	6497	3759258	SO:0001589	frameshift_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2978delC	16.37:g.3819257delG	ENSP00000262367:p.Pro993fs		3759258	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	ENST00000262367.5	37	CCDS10509.1	DEL	35	Baylor																																																																																				0.602	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		Frame_Shift_Del
CSNK2B	1460	hgsc.bcm.edu	37	6	31637165	31637165	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr6:31637165C>A	ENST00000375882.2	+	6	593	c.437C>A	c.(436-438)cCc>cAc	p.P146H	CSNK2B-LY6G5B-1181_ENST00000375880.2_Missense_Mutation_p.P146H|CSNK2B_ENST00000375865.2_Missense_Mutation_p.P146H|LY6G5B_ENST00000375864.4_5'Flank|LY6G5B_ENST00000409525.1_5'Flank|CSNK2B_ENST00000375885.4_Missense_Mutation_p.P165H|CSNK2B_ENST00000375866.2_Missense_Mutation_p.P146H	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	146					adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)			central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						GTGTACACACCCAAGTCATCA	0.567																																																0			6											102.0	82.0	89.0					6																	31637165		2203	4300	6503	31745144	SO:0001583	missense	1460			M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.437C>A	6.37:g.31637165C>A	ENSP00000365042:p.Pro146His		31745144	B0UXA9|P07312|P13862|Q4VX47	Missense_Mutation	SNP	ENST00000375882.2	37	CCDS4712.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970386	0.92919	.	.	ENSG00000204435	ENST00000375885;ENST00000375882;ENST00000375880;ENST00000375865;ENST00000375866	.	.	.	6.17	6.17	0.99709	Casein kinase II, regulatory subunit, beta-sheet (1);	0.059884	0.64402	D	0.000002	D	0.88463	0.6443	H	0.95679	3.705	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90554	0.4511	8	0.87932	D	0	-22.119	18.3732	0.90420	0.0:1.0:0.0:0.0	.	146;146	Q5SRQ3;P67870	.;CSK2B_HUMAN	H	165;146;146;146;146	.	ENSP00000365025:P146H	P	+	2	0	CSNK2B	31745144	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.445000	0.66594	2.941000	0.99782	0.655000	0.94253	CCC		0.567	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076063.8	NM_001320		Missense_Mutation
ECH1	1891	hgsc.bcm.edu	37	19	39322015	39322015	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr19:39322015T>A	ENST00000221418.4	-	2	426	c.194A>T	c.(193-195)aAa>aTa	p.K65I	ECH1_ENST00000597805.1_Intron|AC104534.3_ENST00000594769.1_Missense_Mutation_p.N235Y	NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	65					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CAGAACATGTTTCTGCGCAGA	0.592																																																0			19											112.0	108.0	109.0					19																	39322015		2203	4300	6503	44013855	SO:0001583	missense	1891			U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.194A>T	19.37:g.39322015T>A	ENSP00000221418:p.Lys65Ile		44013855	A8K745|Q8WVX0|Q96EZ9	Missense_Mutation	SNP	ENST00000221418.4	37	CCDS33014.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.28	2.787245	0.49997	.	.	ENSG00000104823	ENST00000221418	T	0.44482	0.92	5.73	-1.04	0.10068	.	0.437100	0.25777	N	0.028379	T	0.41558	0.1164	M	0.64997	1.995	0.09310	N	1	B;B	0.31640	0.333;0.314	B;B	0.42282	0.382;0.183	T	0.42361	-0.9456	10	0.46703	T	0.11	.	6.9317	0.24445	0.0:0.2383:0.1104:0.6513	.	65;65	B4DVS4;Q13011	.;ECH1_HUMAN	I	65	ENSP00000221418:K65I	ENSP00000221418:K65I	K	-	2	0	ECH1	44013855	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.359000	0.20233	-0.184000	0.10567	0.533000	0.62120	AAA		0.592	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1			Missense_Mutation
ERBB2	2064	hgsc.bcm.edu	37	17	37881132	37881132	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr17:37881132G>T	ENST00000269571.5	+	20	2620	c.2461G>T	c.(2461-2463)Gac>Tac	p.D821Y	ERBB2_ENST00000584601.1_Missense_Mutation_p.D791Y|ERBB2_ENST00000540147.1_Missense_Mutation_p.D791Y|ERBB2_ENST00000406381.2_Missense_Mutation_p.D791Y|ERBB2_ENST00000541774.1_Missense_Mutation_p.D806Y|ERBB2_ENST00000445658.2_Missense_Mutation_p.D545Y|ERBB2_ENST00000584450.1_Missense_Mutation_p.D821Y|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	821	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.D821Y(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GGGCTCCCAGGACCTGCTGAA	0.587		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	1	Substitution - Missense(1)	ovary(1)	17											50.0	50.0	50.0					17																	37881132		2203	4300	6503	35134658	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2461G>T	17.37:g.37881132G>T	ENSP00000269571:p.Asp821Tyr		35134658	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996996	0.35226	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78	5.15	5.15	0.70609	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.71921	0.3397	L	0.42008	1.315	0.80722	D	1	B;P;B	0.41624	0.18;0.757;0.273	B;B;B	0.30646	0.04;0.118;0.04	T	0.74118	-0.3768	9	0.02654	T	1	.	18.2461	0.89986	0.0:0.0:1.0:0.0	.	545;806;821	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	Y	791;806;545;821;791	ENSP00000385185:D791Y;ENSP00000446466:D806Y;ENSP00000404047:D545Y;ENSP00000269571:D821Y;ENSP00000443562:D791Y	ENSP00000269571:D821Y	D	+	1	0	ERBB2	35134658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.754000	0.38369	2.397000	0.81536	0.563000	0.77884	GAC		0.587	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			Missense_Mutation
EXPH5	23086	hgsc.bcm.edu	37	11	108380925	108380925	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr11:108380925A>T	ENST00000265843.4	-	6	5419	c.5309T>A	c.(5308-5310)cTg>cAg	p.L1770Q	EXPH5_ENST00000428840.1_Missense_Mutation_p.L1694Q|EXPH5_ENST00000525344.1_Missense_Mutation_p.L1763Q|EXPH5_ENST00000443411.1_Missense_Mutation_p.L1582Q	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1770					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		AAAACTGGCCAGTGGACTGCT	0.478																																																0			11											72.0	79.0	77.0					11																	108380925		2201	4298	6499	107886135	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5309T>A	11.37:g.108380925A>T	ENSP00000265843:p.Leu1770Gln		107886135	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.29	2.193746	0.38707	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312	T;T;T;T;T	0.03468	4.14;4.07;3.92;4.14;3.98	5.8	-5.67	0.02444	.	1.586180	0.03722	N	0.252007	T	0.04363	0.0120	M	0.65975	2.015	0.09310	N	1	B	0.28128	0.201	B	0.20955	0.032	T	0.39143	-0.9628	10	0.27082	T	0.32	7.6359	4.5427	0.12066	0.4033:0.0:0.2306:0.3661	.	1770	Q8NEV8	EXPH5_HUMAN	Q	1770;1694;1582;1763;600;1694	ENSP00000265843:L1770Q;ENSP00000391966:L1694Q;ENSP00000411390:L1582Q;ENSP00000432546:L1763Q;ENSP00000432683:L1694Q	ENSP00000265843:L1770Q	L	-	2	0	EXPH5	107886135	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.198000	0.17217	-0.923000	0.03785	-0.327000	0.08410	CTG		0.478	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		Missense_Mutation
FGF6	2251	hgsc.bcm.edu	37	12	4553398	4553398	+	Silent	SNP	C	C	G			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr12:4553398C>G	ENST00000228837.2	-	2	394	c.351G>C	c.(349-351)ctG>ctC	p.L117L		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	117					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			AAATTTCCAGCAGGCCTGACA	0.532																																																0			12											60.0	53.0	55.0					12																	4553398		2203	4300	6503	4423659	SO:0001819	synonymous_variant	2251			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.351G>C	12.37:g.4553398C>G			4423659	Q0VAE1	Silent	SNP	ENST00000228837.2	37	CCDS8527.1	SNP	25	Baylor																																																																																				0.532	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996		Silent
FRMPD4	9758	hgsc.bcm.edu	37	X	12736568	12736568	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chrX:12736568T>C	ENST00000380682.1	+	16	4129	c.3623T>C	c.(3622-3624)tTt>tCt	p.F1208S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1208					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GAGGGCCATTTTTCTCTGCAG	0.602																																																0			X											106.0	106.0	106.0					X																	12736568		2203	4300	6503	12646489	SO:0001583	missense	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3623T>C	X.37:g.12736568T>C	ENSP00000370057:p.Phe1208Ser		12646489	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.29	1.595267	0.28445	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05382	3.45	5.67	5.67	0.87782	.	0.104908	0.64402	D	0.000002	T	0.10423	0.0255	M	0.68317	2.08	0.35021	D	0.757836	B;B	0.27971	0.196;0.196	B;B	0.20955	0.032;0.032	T	0.04029	-1.0983	10	0.72032	D	0.01	-13.8131	14.8911	0.70609	0.0:0.0:0.0:1.0	.	1200;1208	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	S	1208;1199;1197	ENSP00000370057:F1208S	ENSP00000304583:F1197S	F	+	2	0	FRMPD4	12646489	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.048000	0.71046	1.899000	0.54978	0.486000	0.48141	TTT		0.602	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		Missense_Mutation
GPATCH3	63906	hgsc.bcm.edu	37	1	27217658	27217658	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:27217658A>T	ENST00000361720.5	-	7	1444	c.1421T>A	c.(1420-1422)tTg>tAg	p.L474*	GPN2_ENST00000374135.4_5'Flank|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	474							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GATGAGCCCCAAGCCATTTCT	0.552																																																0			1											43.0	41.0	42.0					1																	27217658		2203	4300	6503	27090245	SO:0001587	stop_gained	63906			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.1421T>A	1.37:g.27217658A>T	ENSP00000354645:p.Leu474*		27090245	Q5JYH2|Q8NDJ2|Q9H9Z3	Nonsense_Mutation	SNP	ENST00000361720.5	37	CCDS290.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.57	2.873366	0.51695	.	.	ENSG00000198746	ENST00000361720;ENST00000536641;ENST00000450844	.	.	.	5.18	4.04	0.47022	.	0.659704	0.13067	N	0.416383	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-3.0956	1.8351	0.03138	0.5662:0.1755:0.0908:0.1676	.	.	.	.	X	474;456;92	.	ENSP00000354645:L474X	L	-	2	0	GPATCH3	27090245	0.006000	0.16342	0.944000	0.38274	0.225000	0.24961	2.172000	0.42463	0.970000	0.38263	-0.327000	0.08410	TTG		0.552	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1	NM_022078		Nonsense_Mutation
INO80	54617	hgsc.bcm.edu	37	15	41379856	41379856	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr15:41379856C>T	ENST00000361937.3	-	6	986	c.562G>A	c.(562-564)Gca>Aca	p.A188T	INO80_ENST00000401393.3_Missense_Mutation_p.A188T			Q9ULG1	INO80_HUMAN	INO80 complex subunit	188	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AGCAGGCCTGCACTGTAGTAC	0.408																																																0			15											156.0	139.0	145.0					15																	41379856		2203	4300	6503	39167148	SO:0001583	missense	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.562G>A	15.37:g.41379856C>T	ENSP00000355205:p.Ala188Thr		39167148	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666250	0.47677	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.91295	-2.82;-2.82	4.8	4.8	0.61643	.	0.108684	0.64402	D	0.000005	D	0.83571	0.5283	N	0.17594	0.5	0.47341	D	0.999395	B	0.14012	0.009	B	0.06405	0.002	T	0.78046	-0.2357	10	0.26408	T	0.33	.	18.0504	0.89345	0.0:1.0:0.0:0.0	.	188	Q9ULG1	INO80_HUMAN	T	188	ENSP00000355205:A188T;ENSP00000384686:A188T	ENSP00000355205:A188T	A	-	1	0	INO80	39167148	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.717000	0.54911	2.496000	0.84212	0.557000	0.71058	GCA		0.408	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553		Missense_Mutation
KIAA1429	25962	hgsc.bcm.edu	37	8	95508084	95508084	+	Silent	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr8:95508084C>T	ENST00000297591.5	-	19	4494	c.4419G>A	c.(4417-4419)ttG>ttA	p.L1473L	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1473					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L1473L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CACTGTCCAACAAAGAATCCA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	8											107.0	93.0	97.0					8																	95508084		2203	4300	6503	95577260	SO:0001819	synonymous_variant	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4419G>A	8.37:g.95508084C>T			95577260	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	CCDS34923.1	SNP	17	Baylor																																																																																				0.408	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		Silent
KRTAP19-4	337971	hgsc.bcm.edu	37	21	31869270	31869270	+	Silent	SNP	G	G	A			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr21:31869270G>A	ENST00000334058.2	-	1	181	c.159C>T	c.(157-159)tgC>tgT	p.C53C		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	53						intermediate filament (GO:0005882)		p.C53C(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ATCCTCCATAGCATGATGGGC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	21											130.0	133.0	132.0					21																	31869270		2203	4300	6503	30791141	SO:0001819	synonymous_variant	337971			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.159C>T	21.37:g.31869270G>A			30791141	Q17RT4|Q17RT6	Silent	SNP	ENST00000334058.2	37	CCDS33534.1	SNP	34	Baylor																																																																																				0.473	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128219.2			Silent
MAP3K6	9064	hgsc.bcm.edu	37	1	27686383	27686383	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:27686383A>T	ENST00000493901.1	-	18	2524	c.2285T>A	c.(2284-2286)tTg>tAg	p.L762*	MAP3K6_ENST00000357582.2_Nonsense_Mutation_p.L762*|MAP3K6_ENST00000374040.3_Nonsense_Mutation_p.L754*	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	762	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GTTGTCGTGCAAGTAGCCAAG	0.602																																																0			1											117.0	107.0	110.0					1																	27686383		2203	4300	6503	27558970	SO:0001587	stop_gained	9064			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2285T>A	1.37:g.27686383A>T	ENSP00000419591:p.Leu762*		27558970	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Nonsense_Mutation	SNP	ENST00000493901.1	37	CCDS299.1	SNP	5	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	39|39	7.810718|7.810718	0.98501|0.98501	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000472410|ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	.|.	.|.	.|.	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|.	.|.	.|.	.|.	T|.	0.34716|.	0.0907|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32771|.	-0.9894|.	3|.	.|0.02654	.|T	.|1	.|.	13.8658|13.8658	0.63588|0.63588	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	S|X	486|754;762;485;762	.|.	.|ENSP00000350195:L762X	C|L	-|-	1|2	0|0	MAP3K6|MAP3K6	27558970|27558970	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.328000|0.328000	0.28507|0.28507	8.712000|8.712000	0.91403|0.91403	2.109000|2.109000	0.64355|0.64355	0.459000|0.459000	0.35465|0.35465	TGC|TTG		0.602	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672		Nonsense_Mutation
MOCOS	55034	hgsc.bcm.edu	37	18	33831144	33831144	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr18:33831144G>C	ENST00000261326.5	+	11	2083	c.2062G>C	c.(2062-2064)Gaa>Caa	p.E688Q		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGATTGTGGAGAAAAAATTTC	0.323																																																0			18											87.0	81.0	83.0					18																	33831144		2203	4300	6503	32085142	SO:0001583	missense	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2062G>C	18.37:g.33831144G>C	ENSP00000261326:p.Glu688Gln		32085142		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527641	0.64860	.	.	ENSG00000075643	ENST00000261326	T	0.36699	1.24	5.52	5.52	0.82312	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);	0.155772	0.56097	D	0.000021	T	0.56615	0.1997	M	0.65498	2.005	0.29143	N	0.878895	D	0.63880	0.993	D	0.68765	0.96	T	0.54470	-0.8289	10	0.40728	T	0.16	-14.484	14.9506	0.71071	0.0:0.0:1.0:0.0	.	688	Q96EN8	MOCOS_HUMAN	Q	688	ENSP00000261326:E688Q	ENSP00000261326:E688Q	E	+	1	0	MOCOS	32085142	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.612000	0.54142	2.597000	0.87782	0.655000	0.94253	GAA		0.323	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			Missense_Mutation
MOCOS	55034	hgsc.bcm.edu	37	18	33848514	33848514	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr18:33848514C>G	ENST00000261326.5	+	15	2554	c.2533C>G	c.(2533-2535)Ctg>Gtg	p.L845V		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGGCATGTACCTGATGCATGC	0.368																																																0			18											269.0	232.0	245.0					18																	33848514		2203	4300	6503	32102512	SO:0001583	missense	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2533C>G	18.37:g.33848514C>G	ENSP00000261326:p.Leu845Val		32102512		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206017	0.58234	.	.	ENSG00000075643	ENST00000261326	T	0.36878	1.23	5.74	3.78	0.43462	Molybdenum cofactor sulfurase, C-terminal (2);	0.070225	0.64402	D	0.000015	T	0.51601	0.1684	M	0.64630	1.985	0.26532	N	0.974242	D	0.76494	0.999	D	0.71656	0.974	T	0.41324	-0.9515	10	0.48119	T	0.1	-19.8111	8.7446	0.34578	0.0:0.8112:0.0:0.1888	.	845	Q96EN8	MOCOS_HUMAN	V	845	ENSP00000261326:L845V	ENSP00000261326:L845V	L	+	1	2	MOCOS	32102512	0.999000	0.42202	1.000000	0.80357	0.904000	0.53231	0.482000	0.22276	0.765000	0.33221	0.650000	0.86243	CTG		0.368	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			Missense_Mutation
MTOR	2475	hgsc.bcm.edu	37	1	11272943	11272943	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:11272943A>T	ENST00000361445.4	-	22	3384	c.3308T>A	c.(3307-3309)tTt>tAt	p.F1103Y		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1103					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.F1103Y(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GTTGGCGCCAAACAGCTGGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	82.0	87.0					1																	11272943		2203	4300	6503	11195530	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3308T>A	1.37:g.11272943A>T	ENSP00000354558:p.Phe1103Tyr		11195530	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.3	4.907797	0.92107	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.67345	-0.26	5.48	5.48	0.80851	Armadillo-like helical (1);Armadillo-type fold (1);	0.133205	0.53938	D	0.000049	T	0.79862	0.4519	H	0.94808	3.585	0.80722	D	1	D	0.57571	0.98	P	0.46885	0.53	D	0.86264	0.1657	10	0.66056	D	0.02	-15.3771	15.5783	0.76410	1.0:0.0:0.0:0.0	.	1103	P42345	MTOR_HUMAN	Y	1103	ENSP00000354558:F1103Y	ENSP00000354558:F1103Y	F	-	2	0	MTOR	11195530	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	8.739000	0.91574	2.081000	0.62600	0.533000	0.62120	TTT		0.507	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		Missense_Mutation
NIN	51199	hgsc.bcm.edu	37	14	51224167	51224167	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr14:51224167C>T	ENST00000382041.3	-	18	3771	c.3581G>A	c.(3580-3582)tGg>tAg	p.W1194*	NIN_ENST00000389868.3_Intron|NIN_ENST00000530997.2_Nonsense_Mutation_p.W1194*|NIN_ENST00000453196.1_Nonsense_Mutation_p.W1194*|NIN_ENST00000324330.9_Nonsense_Mutation_p.W1194*|NIN_ENST00000245441.5_Nonsense_Mutation_p.W1194*|NIN_ENST00000382043.4_Intron	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1194					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTTCAGCTCCCAGGATTCAGT	0.433			T	PDGFRB	MPD																																		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0			14											100.0	102.0	102.0					14																	51224167		2203	4300	6503	50293917	SO:0001587	stop_gained	51199			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.3581G>A	14.37:g.51224167C>T	ENSP00000371472:p.Trp1194*		50293917	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Nonsense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	42	9.657221	0.99231	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	.	.	.	5.93	5.01	0.66863	.	0.507248	0.21940	N	0.066897	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-7.0508	10.8723	0.46891	0.1308:0.7996:0.0:0.0696	.	.	.	.	X	1194;1177;1200;1194;1194;1194	.	ENSP00000245441:W1194X	W	-	2	0	NIN	50293917	0.196000	0.23350	0.998000	0.56505	0.727000	0.41649	1.100000	0.31025	2.814000	0.96858	0.563000	0.77884	TGG		0.433	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		Nonsense_Mutation
NXT2	55916	hgsc.bcm.edu	37	X	108780235	108780235	+	5'UTR	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chrX:108780235G>T	ENST00000372106.1	+	0	131				NXT2_ENST00000372107.1_5'UTR|NXT2_ENST00000372103.1_5'Flank|NXT2_ENST00000218004.1_Missense_Mutation_p.Q55H	NM_001242617.1	NP_001229546.1	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2						mRNA transport (GO:0051028)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q55H(1)		endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	6						CAAGGTCCCAGATGGCCACGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	X											61.0	41.0	48.0					X																	108780235		2203	4300	6503	108666891	SO:0001623	5_prime_UTR_variant	55916			AF246127	CCDS14546.1, CCDS56605.1, CCDS56606.1	Xq22.3	2008-02-05			ENSG00000101888	ENSG00000101888			18151	protein-coding gene	gene with protein product		300320				11073998	Standard	NM_018698		Approved	P15-2	uc004eoe.2	Q9NPJ8	OTTHUMG00000022185	ENST00000372106.1:c.-1G>T	X.37:g.108780235G>T			108666891	D3DUY1|Q0VAN8|Q5JYV5|Q5JYV6|Q5JYV7|Q9H8U0|Q9NQ64|Q9NRL7|Q9Y3M4|Q9Y3M5	Missense_Mutation	SNP	ENST00000372106.1	37	CCDS56605.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838708	0.32513	.	.	ENSG00000101888	ENST00000218004	.	.	.	4.79	-1.34	0.09143	.	0.954001	0.08669	N	0.911198	T	0.21718	0.0523	.	.	.	0.09310	N	0.999994	P	0.39696	0.683	B	0.36418	0.224	T	0.13124	-1.0521	8	0.45353	T	0.12	.	2.7845	0.05370	0.0869:0.2641:0.2396:0.4094	.	55	Q9NPJ8-3	.	H	55	.	ENSP00000218004:Q55H	Q	+	3	2	NXT2	108666891	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	-0.169000	0.09911	-0.455000	0.07054	-0.192000	0.12808	CAG		0.632	NXT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057886.1	NM_018698		Missense_Mutation
OR2T34	127068	hgsc.bcm.edu	37	1	248737595	248737595	+	Missense_Mutation	SNP	A	A	G	rs150601708	byFrequency	TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:248737595A>G	ENST00000328782.2	-	1	485	c.464T>C	c.(463-465)gTt>gCt	p.V155A		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V155A(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATTCCCAAAACCCAGCAGGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											17.0	23.0	21.0					1																	248737595		2143	4273	6416	246804218	SO:0001583	missense	127068			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.464T>C	1.37:g.248737595A>G	ENSP00000330904:p.Val155Ala		246804218	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	SNP	2	Baylor	602	0.27564102564102566	196	0.3983739837398374	85	0.23480662983425415	151	0.263986013986014	170	0.22427440633245382	.	5.973	0.363525	0.11296	.	.	ENSG00000183310	ENST00000328782	T	0.38722	1.12	2.34	0.992	0.19819	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.10685	0.025	0.80722	P	0.0	B	0.15930	0.015	B	0.19666	0.026	T	0.47522	-0.9111	8	0.28530	T	0.3	.	6.4829	0.22073	0.7538:0.2461:0.0:0.0	.	155	Q8NGX1	O2T34_HUMAN	A	155	ENSP00000330904:V155A	ENSP00000330904:V155A	V	-	2	0	OR2T34	246804218	0.000000	0.05858	0.011000	0.14972	0.090000	0.18270	-0.276000	0.08514	0.953000	0.37825	0.319000	0.21371	GTT		0.522	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		Missense_Mutation
OR56A4	120793	hgsc.bcm.edu	37	11	6023870	6023870	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr11:6023870A>T	ENST00000330728.4	-	1	554	c.509T>A	c.(508-510)tTc>tAc	p.F170Y		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F170Y(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATGACCATGAACGTGCAGGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											79.0	70.0	73.0					11																	6023870		2201	4296	6497	5980446	SO:0001583	missense	120793			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.509T>A	11.37:g.6023870A>T	ENSP00000328215:p.Phe170Tyr		5980446	B9EH17	Missense_Mutation	SNP	ENST00000330728.4	37	CCDS31404.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645156	0.67358	.	.	ENSG00000183389	ENST00000330728	T	0.03065	4.06	3.58	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001756	T	0.12944	0.0314	M	0.63208	1.945	0.30398	N	0.780325	D	0.69078	0.997	D	0.67900	0.954	T	0.00613	-1.1644	10	0.87932	D	0	.	11.4057	0.49896	1.0:0.0:0.0:0.0	.	118	Q8NGH8	O56A4_HUMAN	Y	170	ENSP00000328215:F170Y	ENSP00000328215:F170Y	F	-	2	0	OR56A4	5980446	0.983000	0.35010	0.880000	0.34516	0.623000	0.37688	8.899000	0.92544	1.609000	0.50190	0.454000	0.30748	TTC		0.507	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179		Missense_Mutation
PGK1	5230	hgsc.bcm.edu	37	X	77369313	77369313	+	Frame_Shift_Del	DEL	C	C	-			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chrX:77369313delC	ENST00000373316.4	+	3	356	c.189delC	c.(187-189)cacfs	p.H63fs	PGK1_ENST00000537456.1_Frame_Shift_Del_p.H35fs|PGK1_ENST00000442431.1_Frame_Shift_Del_p.H63fs	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	63	Substrate binding.				carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TTATGAGCCACCTAGGCCGGC	0.512																																																0			X											83.0	69.0	74.0					X																	77369313		2203	4300	6503	77255969	SO:0001589	frameshift_variant	5230			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.189delC	X.37:g.77369313delC	ENSP00000362413:p.His63fs		77255969	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Frame_Shift_Del	DEL	ENST00000373316.4	37	CCDS14438.1	DEL	18	Baylor																																																																																				0.512	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1			Frame_Shift_Del
PIGX	54965	hgsc.bcm.edu	37	3	196454941	196454941	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr3:196454941C>T	ENST00000421265.1	+	4	396	c.343C>T	c.(343-345)Cac>Tac	p.H115Y	PIGX_ENST00000541663.1_Missense_Mutation_p.H48Y|PIGX_ENST00000314118.4_Missense_Mutation_p.H115Y			Q8TBF5	PIGX_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class X	156					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(5)|lung(4)|stomach(1)	11	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;1.08e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00322)		TCATCGGCCGCACAGTGAAGA	0.468																																																0			3											140.0	128.0	132.0					3																	196454941		2203	4300	6503	197939338	SO:0001583	missense	54965			AK000529	CCDS3320.1, CCDS3320.2, CCDS54701.1	3q29	2013-02-26	2006-06-28		ENSG00000163964	ENSG00000163964		"""Phosphatidylinositol glycan anchor biosynthesis"""	26046	protein-coding gene	gene with protein product		610276	"""phosphatidylinositol glycan, class X"""			15635094	Standard	NM_017861		Approved	FLJ20522	uc010iaj.3	Q8TBF5	OTTHUMG00000155535	ENST00000421265.1:c.343C>T	3.37:g.196454941C>T	ENSP00000416446:p.His115Tyr		197939338	Q9NWZ2	Missense_Mutation	SNP	ENST00000421265.1	37		SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527982	0.44969	.	.	ENSG00000163964	ENST00000426755;ENST00000392391;ENST00000314118;ENST00000296333;ENST00000421265;ENST00000541663;ENST00000451319	T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.45	3.48	0.39840	.	0.655165	0.15098	N	0.280689	T	0.33265	0.0857	L	0.44542	1.39	0.09310	N	1	D;D	0.59767	0.986;0.976	P;P	0.54140	0.743;0.61	T	0.10917	-1.0609	10	0.46703	T	0.11	-4.3019	4.6346	0.12518	0.1409:0.6078:0.1543:0.097	.	156;156	Q8TBF5-2;Q8TBF5	.;PIGX_HUMAN	Y	115;156;115;156;115;48;115	ENSP00000409073:H115Y;ENSP00000376192:H156Y;ENSP00000317301:H115Y;ENSP00000296333:H156Y;ENSP00000416446:H115Y;ENSP00000443269:H48Y;ENSP00000390804:H115Y	ENSP00000296333:H156Y	H	+	1	0	PIGX	197939338	0.035000	0.19736	0.827000	0.32855	0.598000	0.36846	0.207000	0.17395	1.225000	0.43566	0.655000	0.94253	CAC		0.468	PIGX-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000340684.1	NM_017861		Missense_Mutation
PIK3C2B	5287	hgsc.bcm.edu	37	1	204397328	204397328	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:204397328G>C	ENST00000367187.3	-	31	4975	c.4419C>G	c.(4417-4419)ttC>ttG	p.F1473L	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.F1445L	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1473	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GTGGGTGGAAGAAGGTGTACA	0.498																																																0			1											72.0	63.0	66.0					1																	204397328		2203	4300	6503	202663951	SO:0001583	missense	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4419C>G	1.37:g.204397328G>C	ENSP00000356155:p.Phe1473Leu		202663951	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916637	0.73098	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.79554	-1.28;-1.28	5.24	1.17	0.20885	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	D	0.88991	0.6588	M	0.88512	2.96	0.40370	D	0.979334	D;D	0.76494	0.994;0.999	D;D	0.79108	0.976;0.992	D	0.87556	0.2468	10	0.87932	D	0	.	9.1659	0.37052	0.4717:0.0:0.5283:0.0	.	1445;1473	F5GWN5;O00750	.;P3C2B_HUMAN	L	1473;1445	ENSP00000356155:F1473L;ENSP00000400561:F1445L	ENSP00000356155:F1473L	F	-	3	2	PIK3C2B	202663951	1.000000	0.71417	0.997000	0.53966	0.898000	0.52572	0.817000	0.27281	-0.038000	0.13624	0.591000	0.81541	TTC		0.498	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		Missense_Mutation
POLR1C	9533	hgsc.bcm.edu	37	6	43488991	43488991	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr6:43488991A>C	ENST00000372389.3	+	9	1082	c.994A>C	c.(994-996)Aag>Cag	p.K332Q	POLR1C_ENST00000304004.3_Intron|POLR1C_ENST00000372344.2_Missense_Mutation_p.K282Q|RP3-337H4.9_ENST00000607571.1_RNA	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	332					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			ACTGATGGGGAAGTGCCGGCG	0.527																																																0			6											112.0	109.0	110.0					6																	43488991		2203	4300	6503	43596969	SO:0001583	missense	9533			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.994A>C	6.37:g.43488991A>C	ENSP00000361465:p.Lys332Gln		43596969	O75395|Q5JTE3	Missense_Mutation	SNP	ENST00000372389.3	37	CCDS4901.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688307	0.88639	.	.	ENSG00000171453	ENST00000372389;ENST00000372373;ENST00000372344	D;D	0.85629	-2.01;-2.01	5.09	5.09	0.68999	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.048704	0.85682	D	0.000000	D	0.94295	0.8167	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96158	0.9113	10	0.87932	D	0	-18.1446	14.8517	0.70300	1.0:0.0:0.0:0.0	.	332	O15160	RPAC1_HUMAN	Q	332;196;282	ENSP00000361465:K332Q;ENSP00000361419:K282Q	ENSP00000361419:K282Q	K	+	1	0	POLR1C	43596969	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.799000	0.91895	1.912000	0.55364	0.477000	0.44152	AAG		0.527	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3	NM_004875		Missense_Mutation
POLR3A	11128	hgsc.bcm.edu	37	10	79777462	79777462	+	Silent	SNP	G	G	A			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr10:79777462G>A	ENST00000372371.3	-	10	1439	c.1302C>T	c.(1300-1302)taC>taT	p.Y434Y	POLR3A_ENST00000484760.1_5'UTR	NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	434					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.Y434Y(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			CTCGATTTCCGTATTTCAAAA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	10											151.0	139.0	143.0					10																	79777462		2203	4300	6503	79447468	SO:0001819	synonymous_variant	11128			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.1302C>T	10.37:g.79777462G>A			79447468	Q8IW34|Q8TCW5	Silent	SNP	ENST00000372371.3	37	CCDS7354.1	SNP	40	Baylor																																																																																				0.428	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		Silent
PPOX	5498	hgsc.bcm.edu	37	1	161137880	161137880	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:161137880C>T	ENST00000367999.4	+	5	700	c.434C>T	c.(433-435)aCt>aTt	p.T145I	PPOX_ENST00000352210.5_Missense_Mutation_p.T145I|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	145					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCTGATGAGACTGTGCACAGT	0.617																																																0			1											54.0	57.0	56.0					1																	161137880		2203	4300	6503	159404504	SO:0001583	missense	5498			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.434C>T	1.37:g.161137880C>T	ENSP00000356978:p.Thr145Ile		159404504	D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	CCDS1221.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.75	3.886219	0.72410	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.96685	-4.09;-4.09	5.69	4.77	0.60923	Amine oxidase (1);	0.167021	0.52532	D	0.000069	D	0.95056	0.8399	M	0.75085	2.285	0.80722	D	1	P	0.47034	0.889	P	0.46479	0.518	D	0.95069	0.8202	10	0.87932	D	0	-23.8471	13.137	0.59415	0.0:0.6935:0.3065:0.0	.	145	P50336	PPOX_HUMAN	I	145	ENSP00000343943:T145I;ENSP00000356978:T145I	ENSP00000343943:T145I	T	+	2	0	PPOX	159404504	0.979000	0.34478	0.966000	0.40874	0.972000	0.66771	1.475000	0.35409	1.395000	0.46643	0.650000	0.86243	ACT		0.617	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		Missense_Mutation
TMPRSS15	5651	hgsc.bcm.edu	37	21	19698878	19698878	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr21:19698878C>A	ENST00000284885.3	-	16	1825	c.1792G>T	c.(1792-1794)Ggg>Tgg	p.G598W		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	598	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.G598W(2)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GGGCCAGGCCCTGTGTACACA	0.463																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	21											156.0	129.0	138.0					21																	19698878		2203	4300	6503	18620749	SO:0001583	missense	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1792G>T	21.37:g.19698878C>A	ENSP00000284885:p.Gly598Trp		18620749	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064511	0.76187	.	.	ENSG00000154646	ENST00000284885	T	0.65364	-0.15	5.27	5.27	0.74061	CUB (5);	0.000000	0.85682	D	0.000000	D	0.87466	0.6184	H	0.98525	4.255	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.92136	0.5716	9	.	.	.	.	16.7401	0.85457	0.0:1.0:0.0:0.0	.	598	P98073	ENTK_HUMAN	W	598	ENSP00000284885:G598W	.	G	-	1	0	TMPRSS15	18620749	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	5.518000	0.67068	2.612000	0.88384	0.650000	0.86243	GGG		0.463	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		Missense_Mutation
PTPN3	5774	hgsc.bcm.edu	37	9	112151594	112151594	+	Silent	SNP	G	G	C			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr9:112151594G>C	ENST00000374541.2	-	22	2276	c.2172C>G	c.(2170-2172)acC>acG	p.T724T	PTPN3_ENST00000394827.3_Silent_p.T192T|PTPN3_ENST00000446349.1_Silent_p.T548T|PTPN3_ENST00000497739.1_5'UTR|PTPN3_ENST00000412145.1_Silent_p.T593T|PTPN3_ENST00000262539.3_Silent_p.T570T	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	724	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ACTGTGCACAGGTATGCGGCA	0.468																																																0			9											86.0	77.0	80.0					9																	112151594		2203	4300	6503	111191415	SO:0001819	synonymous_variant	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2172C>G	9.37:g.112151594G>C			111191415	A0AUW9|E7EN99|E9PGU7	Silent	SNP	ENST00000374541.2	37	CCDS6776.1	SNP	35	Baylor																																																																																				0.468	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4			Silent
QRICH1	54870	hgsc.bcm.edu	37	3	49095139	49095139	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr3:49095139T>A	ENST00000395443.2	-	3	966	c.494A>T	c.(493-495)cAa>cTa	p.Q165L	QRICH1_ENST00000424300.1_Missense_Mutation_p.Q165L|QRICH1_ENST00000357496.2_Missense_Mutation_p.Q165L|QRICH1_ENST00000479449.1_Intron	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	165	Gln-rich.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTGAGCTGCTTGCAGCTGCGA	0.617																																																0			3											117.0	112.0	114.0					3																	49095139		2203	4300	6503	49070143	SO:0001583	missense	54870				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.494A>T	3.37:g.49095139T>A	ENSP00000378830:p.Gln165Leu		49070143	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274015	0.40194	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000001	T	0.44393	0.1291	N	0.14661	0.345	0.58432	D	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.36016	-0.9765	9	0.87932	D	0	-2.5864	16.5259	0.84331	0.0:0.0:0.0:1.0	.	165	Q2TAL8	QRIC1_HUMAN	L	165	.	ENSP00000350094:Q165L	Q	-	2	0	QRICH1	49070143	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.139000	0.50577	2.301000	0.77427	0.524000	0.50904	CAA		0.617	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730		Missense_Mutation
SCN2A	6326	hgsc.bcm.edu	37	2	166170618	166170618	+	Splice_Site	SNP	G	G	A			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr2:166170618G>A	ENST00000375437.2	+	10	1673	c.1383G>A	c.(1381-1383)caG>caA	p.Q461Q	SCN2A_ENST00000357398.3_Splice_Site_p.Q461Q|SCN2A_ENST00000375427.2_Splice_Site_p.Q461Q|SCN2A_ENST00000283256.6_Splice_Site_p.Q461Q	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	461					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Q461Q(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGAAGCTCAGGTATAGTGAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	2											50.0	48.0	49.0					2																	166170618		2202	4299	6501	165878864	SO:0001630	splice_region_variant	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1383+1G>A	2.37:g.166170618G>A			165878864	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1	SNP	35	Baylor																																																																																				0.398	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	Silent	Silent
SERPINH1	871	hgsc.bcm.edu	37	11	75282994	75282994	+	Nonsense_Mutation	SNP	G	G	T	rs577035420		TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr11:75282994G>T	ENST00000524558.1	+	5	2558	c.1123G>T	c.(1123-1125)Gag>Tag	p.E375*	SERPINH1_ENST00000358171.3_Nonsense_Mutation_p.E375*|SERPINH1_ENST00000533603.1_Nonsense_Mutation_p.E375*|SERPINH1_ENST00000525876.1_Nonsense_Mutation_p.E158*			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	375					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CGGGCGCGAGGAGCTGCGCAG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		17772	0.0		0.0	False		,,,				2504	0.001															0			11											50.0	42.0	45.0					11																	75282994		2200	4293	6493	74960642	SO:0001587	stop_gained	871			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.1123G>T	11.37:g.75282994G>T	ENSP00000434412:p.Glu375*		74960642	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Nonsense_Mutation	SNP	ENST00000524558.1	37	CCDS8239.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	46	12.183267	0.99644	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000421448;ENST00000524558;ENST00000525876	.	.	.	5.13	5.13	0.70059	.	0.098253	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	16.4265	0.83816	0.0:0.0:1.0:0.0	.	.	.	.	X	375;375;354;375;158	.	ENSP00000350894:E375X	E	+	1	0	SERPINH1	74960642	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.880000	0.69698	2.532000	0.85374	0.561000	0.74099	GAG		0.617	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353		Nonsense_Mutation
SETDB1	9869	hgsc.bcm.edu	37	1	150916431	150916431	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr1:150916431A>G	ENST00000271640.5	+	8	1101	c.911A>G	c.(910-912)tAt>tGt	p.Y304C	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368962.2_Missense_Mutation_p.Y304C|SETDB1_ENST00000368969.4_Missense_Mutation_p.Y304C|SETDB1_ENST00000368963.1_Missense_Mutation_p.M237V	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	304	Tudor 1.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.Y304C(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TATGCTTCCTATGTCACACAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											204.0	181.0	189.0					1																	150916431		2203	4300	6503	149183055	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.911A>G	1.37:g.150916431A>G	ENSP00000271640:p.Tyr304Cys		149183055	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	SNP	16	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.504929|4.504929	0.85282|0.85282	.|.	.|.	ENSG00000143379|ENSG00000143379	ENST00000368963|ENST00000271640;ENST00000368962;ENST00000534805;ENST00000368969;ENST00000498193;ENST00000413562	.|T;T;T;T;T	.|0.43688	.|0.94;0.94;0.94;0.94;0.94	5.17|5.17	5.17|5.17	0.71159|0.71159	.|Tudor domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57272|0.57272	0.2042|0.2042	M|M	0.78456|0.78456	2.415|2.415	0.32013|0.32013	N|N	0.601802|0.601802	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;0.999;0.999	T|T	0.63804|0.63804	-0.6554|-0.6554	6|10	0.87932|0.87932	D|D	0|0	.|.	15.187|15.187	0.73009|0.73009	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|304;304;304;304;304	.|E9PRF4;E9PQM8;Q15047-2;Q15047-3;Q15047	.|.;.;.;.;SETB1_HUMAN	V|C	237|304;304;304;304;304;147	.|ENSP00000271640:Y304C;ENSP00000357958:Y304C;ENSP00000436148:Y304C;ENSP00000357965:Y304C;ENSP00000432348:Y304C	ENSP00000357959:M237V|ENSP00000271640:Y304C	M|Y	+|+	1|2	0|0	SETDB1|SETDB1	149183055|149183055	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.222000|8.222000	0.89777|0.89777	2.177000|2.177000	0.69029|0.69029	0.377000|0.377000	0.23210|0.23210	ATG|TAT		0.408	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			Missense_Mutation
SIPA1L1	26037	hgsc.bcm.edu	37	14	72055760	72055760	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr14:72055760G>A	ENST00000555818.1	+	2	1519	c.1171G>A	c.(1171-1173)Gac>Aac	p.D391N	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.D391N|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.D391N	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	391					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.D391N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CAGCACAGAGGACCTGAATTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	14											64.0	66.0	65.0					14																	72055760		2203	4300	6503	71125513	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1171G>A	14.37:g.72055760G>A	ENSP00000450832:p.Asp391Asn		71125513	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797780	0.90538	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	D;D;D	0.83335	-1.71;-1.7;-1.71	6.07	6.07	0.98685	.	0.041576	0.85682	D	0.000000	D	0.90448	0.7009	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.97	D;D;P	0.85130	0.997;0.979;0.749	D	0.90082	0.4171	10	0.87932	D	0	-35.2389	20.6593	0.99626	0.0:0.0:1.0:0.0	.	391;391;391	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	N	391	ENSP00000370630:D391N;ENSP00000450832:D391N;ENSP00000351352:D391N	ENSP00000351352:D391N	D	+	1	0	SIPA1L1	71125513	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GAC		0.507	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		Missense_Mutation
SLC16A7	9194	hgsc.bcm.edu	37	12	60165110	60165110	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr12:60165110G>A	ENST00000261187.4	+	3	492	c.328G>A	c.(328-330)Gta>Ata	p.V110I	SLC16A7_ENST00000552432.1_Missense_Mutation_p.V110I|SLC16A7_ENST00000547379.1_Missense_Mutation_p.V110I|SLC16A7_ENST00000543448.1_Missense_Mutation_p.V11I|SLC16A7_ENST00000552024.1_Missense_Mutation_p.V110I	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	110					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	TAGCAGCGTGGTACAGCTGTA	0.433																																																0			12											241.0	210.0	221.0					12																	60165110		2203	4300	6503	58451377	SO:0001583	missense	9194			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.328G>A	12.37:g.60165110G>A	ENSP00000261187:p.Val110Ile		58451377	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.483713	0.01027	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.94	-11.9	0.00025	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.907582	0.09690	N	0.768580	T	0.09291	0.0229	N	0.02334	-0.595	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.30937	-0.9961	9	.	.	.	.	5.9012	0.18967	0.1709:0.2829:0.4277:0.1185	.	110	O60669	MOT2_HUMAN	I	110;110;110;110;110;11	ENSP00000449547:V110I;ENSP00000448071:V110I;ENSP00000448742:V110I;ENSP00000446722:V110I;ENSP00000261187:V110I;ENSP00000443731:V11I	.	V	+	1	0	SLC16A7	58451377	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.072000	0.00618	-5.594000	0.00012	-2.675000	0.00143	GTA		0.433	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731		Missense_Mutation
SLIT3	6586	hgsc.bcm.edu	37	5	168138034	168138034	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr5:168138034T>A	ENST00000519560.1	-	25	3004	c.2585A>T	c.(2584-2586)gAc>gTc	p.D862V	SLIT3_ENST00000404867.3_Missense_Mutation_p.D862V|CTC-558O2.1_ENST00000521870.1_RNA|SLIT3_ENST00000332966.8_Missense_Mutation_p.D862V|CTC-558O2.1_ENST00000522615.1_RNA	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	862	LRRCT 4.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGACTGCAGTCACAGTGGAG	0.632																																					Ovarian(29;311 847 10864 17279 24903)											0			5											24.0	21.0	22.0					5																	168138034		2202	4294	6496	168070612	SO:0001583	missense	6586			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2585A>T	5.37:g.168138034T>A	ENSP00000430333:p.Asp862Val		168070612	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	28.5	4.921431	0.92249	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.81163	-1.46;-1.46;-1.46	4.7	4.7	0.59300	Cysteine-rich flanking region, C-terminal (1);	0.084898	0.85682	D	0.000000	D	0.89694	0.6789	M	0.94101	3.495	0.80722	D	1	P	0.48589	0.912	P	0.53313	0.723	D	0.92476	0.5989	10	0.87932	D	0	.	14.616	0.68549	0.0:0.0:0.0:1.0	.	862	O75094	SLIT3_HUMAN	V	862	ENSP00000430333:D862V;ENSP00000332164:D862V;ENSP00000384890:D862V	ENSP00000332164:D862V	D	-	2	0	SLIT3	168070612	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.719000	0.84751	2.098000	0.63641	0.528000	0.53228	GAC		0.632	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		Missense_Mutation
SRC	6714	hgsc.bcm.edu	37	20	36030940	36030940	+	Missense_Mutation	SNP	G	G	C	rs186207963		TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr20:36030940G>C	ENST00000373578.2	+	12	1568	c.1219G>C	c.(1219-1221)Gac>Cac	p.D407H	SRC_ENST00000445403.1_Missense_Mutation_p.D407H|SRC_ENST00000373567.2_Missense_Mutation_p.D407H|SRC_ENST00000373558.2_Missense_Mutation_p.D413H|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000360723.4_Missense_Mutation_p.D413H|SRC_ENST00000358208.4_Missense_Mutation_p.D407H	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	407	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.D407H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CAAAGTGGCGGACTTTGGGCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											64.0	57.0	59.0					20																	36030940		2203	4300	6503	35464354	SO:0001583	missense	6714			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1219G>C	20.37:g.36030940G>C	ENSP00000362680:p.Asp407His		35464354	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	SNP	41	Baylor	263	0.12042124542124542	85	0.17276422764227642	28	0.07734806629834254	48	0.08391608391608392	102	0.1345646437994723	G	24.8	4.567860	0.86439	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.99	4.99	0.66335	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.00695	0.0023	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56080	-0.8038	10	0.87932	D	0	.	15.8235	0.78678	0.0:0.0:1.0:0.0	.	407	P12931	SRC_HUMAN	H	407;407;413;407;407;413	ENSP00000408503:D407H;ENSP00000362680:D407H;ENSP00000353950:D413H;ENSP00000350941:D407H;ENSP00000362668:D407H;ENSP00000362659:D413H	ENSP00000350941:D407H	D	+	1	0	SRC	35464354	1.000000	0.71417	0.984000	0.44739	0.788000	0.44548	9.657000	0.98554	2.586000	0.87340	0.561000	0.74099	GAC		0.622	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417		Missense_Mutation
TBX4	9496	hgsc.bcm.edu	37	17	59560462	59560462	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr17:59560462A>G	ENST00000240335.1	+	8	1268	c.1223A>G	c.(1222-1224)gAc>gGc	p.D408G	TBX4_ENST00000589449.1_Intron|TBX4_ENST00000393853.4_Missense_Mutation_p.D409G	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	408					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D408G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TCTGGGGTGGACGACCTGCCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											88.0	77.0	81.0					17																	59560462		2203	4300	6503	56915244	SO:0001583	missense	9496			AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1223A>G	17.37:g.59560462A>G	ENSP00000240335:p.Asp408Gly		56915244	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757903	0.49468	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	T;T	0.44083	0.93;0.93	5.51	5.51	0.81932	.	0.166678	0.51477	D	0.000086	T	0.40015	0.1100	L	0.47716	1.5	0.53688	D	0.999976	P;P	0.47762	0.9;0.608	B;B	0.42771	0.397;0.188	T	0.21177	-1.0253	9	.	.	.	.	14.8123	0.70006	1.0:0.0:0.0:0.0	.	409;408	A5PKU7;P57082	.;TBX4_HUMAN	G	409;408	ENSP00000377435:D409G;ENSP00000240335:D408G	.	D	+	2	0	TBX4	56915244	1.000000	0.71417	0.998000	0.56505	0.749000	0.42624	5.892000	0.69790	2.094000	0.63399	0.533000	0.62120	GAC		0.602	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488		Missense_Mutation
TMEM44	93109	hgsc.bcm.edu	37	3	194309318	194309318	+	Silent	SNP	T	T	A			TCGA-04-1525-01	TCGA-04-1525-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr3:194309318T>A	ENST00000392432.2	-	11	1573	c.1368A>T	c.(1366-1368)ctA>ctT	p.L456L	TMEM44-AS1_ENST00000447982.1_RNA|TMEM44-AS1_ENST00000419571.1_RNA|TMEM44-AS1_ENST00000453671.1_RNA|TMEM44_ENST00000473092.1_Silent_p.L419L|TMEM44_ENST00000381975.3_3'UTR|TMEM44_ENST00000273580.7_Silent_p.L420L|TMEM44_ENST00000476750.1_5'UTR|TMEM44_ENST00000347147.4_Silent_p.L409L	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	456						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		GGGATCCCAGTAGCTCCACAT	0.527																																																0			3											188.0	177.0	181.0					3																	194309318		2203	4300	6503	195790607	SO:0001819	synonymous_variant	93109			AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.1368A>T	3.37:g.194309318T>A			195790607	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Silent	SNP	ENST00000392432.2	37	CCDS54699.1	SNP	57	Baylor																																																																																				0.527	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399		Silent
Unknown	0	hgsc.bcm.edu	37	17	0	0	+	IGR	DEL	C-	C-	G			TCGA-04-1525-01	TCGA-04-1525-10	-	-	.	.	.	.	Unknown	Invalid:failed_liftOver	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr17:0delC-								None (None upstream) : AC108004.5 (4960 downstream)																							AAGCTTCTCA	0.52																																																0			17																																								7517819	SO:0001628	intergenic_variant	7157																															17.37:g.0delC-			7517818		Indel	Indel		37		Indel	23	Baylor																																																																																			0	0.520									Indel
TRIM35	23087	hgsc.bcm.edu	37	8	27156041	27156041	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1525-01	TCGA-04-1525-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr8:27156041C>A	ENST00000305364.4	-	2	554	c.471G>T	c.(469-471)gaG>gaT	p.E157D	TRIM35_ENST00000521253.1_Intron	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	157					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		CCTTGGCCTTCTCCCGCAGTG	0.607																																																0			8											96.0	85.0	89.0					8																	27156041		2203	4300	6503	27211958	SO:0001583	missense	23087			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.471G>T	8.37:g.27156041C>A	ENSP00000301924:p.Glu157Asp		27211958	Q86XQ0|Q8WVA4	Missense_Mutation	SNP	ENST00000305364.4	37	CCDS6056.2	SNP	32	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.36|12.36	1.915767|1.915767	0.33815|0.33815	.|.	.|.	ENSG00000104228|ENSG00000104228	ENST00000305364|ENST00000380544	T|.	0.65178|.	-0.14|.	5.35|5.35	3.57|3.57	0.40892|0.40892	.|.	0.000000|0.000000	0.52532|0.52532	D|D	0.000077|0.000077	T|.	0.58148|.	0.2102|.	L|L	0.52823|0.52823	1.66|1.66	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|.	0.52741|.	-0.8535|.	10|.	0.38643|0.35671	T|T	0.18|0.21	.|.	8.2871|8.2871	0.31935|0.31935	0.0:0.8217:0.0:0.1783|0.0:0.8217:0.0:0.1783	.|.	157|.	Q9UPQ4|.	TRI35_HUMAN|.	D|X	157|195	ENSP00000301924:E157D|.	ENSP00000301924:E157D|ENSP00000369917:E195X	E|E	-|-	3|1	2|0	TRIM35|TRIM35	27211958|27211958	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	0.100000|0.100000	0.15231|0.15231	0.651000|0.651000	0.30788|0.30788	-0.768000|-0.768000	0.03414|0.03414	GAG|GAA		0.607	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219848.2	NM_171982		Missense_Mutation
TRIM42	287015	hgsc.bcm.edu	37	3	140409814	140409814	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1525-01	TCGA-04-1525-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr3:140409814A>C	ENST00000286349.3	+	4	2056	c.1865A>C	c.(1864-1866)tAc>tCc	p.Y622S		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	622	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Y622S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCATAGGTTTACTGGACATGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											108.0	97.0	101.0					3																	140409814		2203	4300	6503	141892504	SO:0001583	missense	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1865A>C	3.37:g.140409814A>C	ENSP00000286349:p.Tyr622Ser		141892504	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839434	0.71488	.	.	ENSG00000155890	ENST00000286349	T	0.48836	0.8	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000025	T	0.54532	0.1864	N	0.24115	0.695	0.38974	D	0.958811	D	0.76494	0.999	D	0.87578	0.998	T	0.61826	-0.6983	10	0.87932	D	0	-31.4688	12.5738	0.56352	1.0:0.0:0.0:0.0	.	622	Q8IWZ5	TRI42_HUMAN	S	622	ENSP00000286349:Y622S	ENSP00000286349:Y622S	Y	+	2	0	TRIM42	141892504	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.999000	0.57031	2.222000	0.72286	0.528000	0.53228	TAC		0.408	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		Missense_Mutation
VPS4B	9525	hgsc.bcm.edu	37	18	61067845	61067845	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr18:61067845G>C	ENST00000238497.5	-	6	779	c.576C>G	c.(574-576)aaC>aaG	p.N192K	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	192					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)	p.N192K(1)		breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						ATGTTGAGTTGTTGGCTTCTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	18											125.0	125.0	125.0					18																	61067845		2203	4300	6503	59218825	SO:0001583	missense	9525			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.576C>G	18.37:g.61067845G>C	ENSP00000238497:p.Asn192Lys		59218825	Q69HW4|Q9GZS7	Missense_Mutation	SNP	ENST00000238497.5	37	CCDS11983.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677221	0.68042	.	.	ENSG00000119541	ENST00000238497	D	0.92348	-3.02	6.11	4.34	0.51931	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.89139	0.6630	N	0.11892	0.195	0.80722	D	1	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.61722	0.893;0.893;0.893	D	0.85965	0.1473	10	0.25751	T	0.34	-28.0479	10.0169	0.42020	0.2036:0.0:0.7964:0.0	.	192;192;192	A8K5D8;A8K4G7;O75351	.;.;VPS4B_HUMAN	K	192	ENSP00000238497:N192K	ENSP00000238497:N192K	N	-	3	2	VPS4B	59218825	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.733000	0.74796	0.921000	0.36994	0.655000	0.94253	AAC		0.368	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869		Missense_Mutation
WDR62	284403	hgsc.bcm.edu	37	19	36575625	36575625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr19:36575625G>T	ENST00000270301.7	+	12	1621	c.1621G>T	c.(1621-1623)Gag>Tag	p.E541*	WDR62_ENST00000401500.2_Nonsense_Mutation_p.E541*			O43379	WDR62_HUMAN	WD repeat domain 62	541					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTGTGCCTGGAGTACTCCAA	0.652																																																0			19											97.0	78.0	85.0					19																	36575625		2203	4300	6503	41267465	SO:0001587	stop_gained	284403			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1621G>T	19.37:g.36575625G>T	ENSP00000270301:p.Glu541*		41267465	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Nonsense_Mutation	SNP	ENST00000270301.7	37	CCDS33001.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	38	6.947420	0.97956	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	.	.	.	5.15	5.15	0.70609	.	0.061187	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-29.0202	16.4688	0.84094	0.0:0.0:1.0:0.0	.	.	.	.	X	541	.	ENSP00000270301:E541X	E	+	1	0	WDR62	41267465	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.156000	0.94705	2.558000	0.86282	0.561000	0.74099	GAG		0.652	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		Nonsense_Mutation
ZNF565	147929	hgsc.bcm.edu	37	19	36674259	36674259	+	Silent	SNP	G	G	T			TCGA-04-1525-01	TCGA-04-1525-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-04-1525-01	TCGA-04-1525-10	g.chr19:36674259G>T	ENST00000355114.5	-	5	1455	c.729C>A	c.(727-729)gcC>gcA	p.A243A	ZNF565_ENST00000392173.2_Silent_p.A203A|ZNF565_ENST00000304116.5_Silent_p.A203A			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			CACGGCTGAAGGCCTTCCCAC	0.468																																																0			19											89.0	80.0	83.0					19																	36674259		2203	4300	6503	41366099	SO:0001819	synonymous_variant	147929			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.729C>A	19.37:g.36674259G>T			41366099	B3KQ35|Q6NUS2	Silent	SNP	ENST00000355114.5	37		SNP	35	Baylor																																																																																				0.468	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000451697.1	NM_152477		Silent
