#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SPEN	23013	broad.mit.edu	37	1	16261097	16261097	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:16261097G>C	ENST00000375759.3	+	11	8566	c.8362G>C	c.(8362-8364)Ggg>Cgg	p.G2788R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2788	Interaction with RBPSUH. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.G2788R(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GTTCCACCCAGGGTCCATGCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	57.0	58.0					1																	16261097		2203	4300	6503	16133684	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8362G>C	1.37:g.16261097G>C	ENSP00000364912:p.Gly2788Arg		16133684	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541190	0.27563	.	.	ENSG00000065526	ENST00000375759	T	0.11169	2.8	5.08	5.08	0.68730	.	.	.	.	.	T	0.09468	0.0233	N	0.08118	0	0.48395	D	0.999645	P	0.37636	0.603	B	0.44163	0.443	T	0.44922	-0.9296	9	0.32370	T	0.25	-22.0124	16.6435	0.85138	0.0:0.0:1.0:0.0	.	2788	Q96T58	MINT_HUMAN	R	2788	ENSP00000364912:G2788R	ENSP00000364912:G2788R	G	+	1	0	SPEN	16133684	1.000000	0.71417	0.962000	0.40283	0.097000	0.18754	6.332000	0.72934	2.362000	0.80069	0.561000	0.74099	GGG		0.592	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		Missense_Mutation
USP48	84196	broad.mit.edu	37	1	22048168	22048168	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:22048168T>A	ENST00000308271.9	-	13	2386	c.1738A>T	c.(1738-1740)Aat>Tat	p.N580Y	USP48_ENST00000400301.1_Missense_Mutation_p.N580Y|USP48_ENST00000529637.1_Missense_Mutation_p.N579Y|USP48_ENST00000374732.3_Missense_Mutation_p.N119Y	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	580	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.N580Y(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TTCAGCAGATTATTAACAGTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	76.0	76.0					1																	22048168		2203	4300	6503	21920755	SO:0001583	missense	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1738A>T	1.37:g.22048168T>A	ENSP00000309262:p.Asn580Tyr		21920755	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	23.8	4.455137	0.84209	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.47	5.47	0.80525	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.000000	0.85682	D	0.000000	T	0.63965	0.2556	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.994;0.999;0.999;0.996;0.999	D;D;D;D;P;D	0.85130	0.997;0.929;0.952;0.952;0.804;0.994	T	0.67722	-0.5597	10	0.72032	D	0.01	.	14.7425	0.69467	0.0:0.0:0.0:1.0	.	579;580;580;580;580;119	B7ZKS7;B7ZKS3;Q86UV5-3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;.;UBP48_HUMAN;.	Y	580;580;119;579	ENSP00000383157:N580Y;ENSP00000309262:N580Y;ENSP00000363864:N119Y;ENSP00000431949:N579Y	ENSP00000309262:N580Y	N	-	1	0	USP48	21920755	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.092000	0.76930	2.090000	0.63153	0.528000	0.53228	AAT		0.373	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		Missense_Mutation
OPRD1	4985	broad.mit.edu	37	1	29189708	29189708	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:29189708C>G	ENST00000234961.2	+	3	1274	c.1032C>G	c.(1030-1032)agC>agG	p.S344R		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	344					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)	p.S344R(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ACCCCAGCAGCTTCAGCCGCG	0.721																																																1	Substitution - Missense(1)	ovary(1)	1											8.0	8.0	8.0					1																	29189708		2179	4269	6448	29062295	SO:0001583	missense	4985			U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.1032C>G	1.37:g.29189708C>G	ENSP00000234961:p.Ser344Arg		29062295	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550192	0.27652	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.38401	1.14	4.06	2.14	0.27477	.	0.477395	0.22876	N	0.054565	T	0.22360	0.0539	L	0.33245	0.995	0.43924	D	0.996571	B	0.23442	0.085	B	0.15052	0.012	T	0.05733	-1.0867	10	0.17369	T	0.5	.	8.3398	0.32237	0.0:0.799:0.0:0.201	.	344	P41143	OPRD_HUMAN	R	344;296	ENSP00000234961:S344R	ENSP00000234961:S344R	S	+	3	2	OPRD1	29062295	1.000000	0.71417	0.912000	0.35992	0.897000	0.52465	3.802000	0.55553	0.359000	0.24239	-0.379000	0.06801	AGC		0.721	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911		Missense_Mutation
CSMD2	114784	broad.mit.edu	37	1	34498193	34498193	+	Splice_Site	SNP	A	A	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:34498193A>C	ENST00000373381.4	-	3	694		c.e3+1			NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGAGGCACTTACCTTCATAGG	0.562																																																1	Unknown(1)	ovary(1)	1											92.0	69.0	77.0					1																	34498193		2203	4299	6502	34270780	SO:0001630	splice_region_variant	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.517+1T>G	1.37:g.34498193A>C			34270780	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Splice_Site_SNP	SNP	ENST00000373381.4	37		SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471609	0.84533	.	.	ENSG00000121904	ENST00000373381	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6594	0.56806	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSMD2	34270780	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.580000	0.74040	2.243000	0.73865	0.533000	0.62120	.		0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	Intron	Splice_Site_SNP
MFSD2A	84879	broad.mit.edu	37	1	40434419	40434419	+	Splice_Site	SNP	T	T	G	rs112704028		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:40434419T>G	ENST00000372809.5	+	13	1711		c.e13+2		MFSD2A_ENST00000372811.5_Splice_Site|MFSD2A_ENST00000480630.1_Splice_Site|MFSD2A_ENST00000420632.2_Splice_Site	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A						establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)	p.?(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GGCACTGAGGTGAGTGGGGAG	0.567																																																1	Unknown(1)	ovary(1)	1											52.0	52.0	52.0					1																	40434419		2203	4300	6503	40207006	SO:0001630	splice_region_variant	84879			AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.1568+2T>G	1.37:g.40434419T>G			40207006	A8K675|Q6UWU5|Q96F59|Q9BRC8	Splice_Site_SNP	SNP	ENST00000372809.5	37	CCDS44118.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	20.9	4.058951	0.76074	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000372809	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9325	0.70926	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD2A	40207006	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.331000	0.79192	2.311000	0.77944	0.533000	0.62120	.		0.567	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793	Intron	Splice_Site_SNP
GSTM5	2949	broad.mit.edu	37	1	110257751	110257751	+	Splice_Site	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:110257751G>A	ENST00000256593.3	+	7	514		c.e7-1		GSTM5_ENST00000492718.1_Splice_Site|GSTM5_ENST00000369812.5_Splice_Site|GSTM5_ENST00000369813.1_Splice_Site	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)	p.?(1)		NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GCCTTCTTCAGATCACCTTTG	0.448																																																1	Unknown(1)	ovary(1)	1											247.0	225.0	232.0					1																	110257751		2203	4300	6503	110059274	SO:0001630	splice_region_variant	2949			L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.457-1G>A	1.37:g.110257751G>A			110059274	A8K0V8|Q6PD78	Splice_Site_SNP	SNP	ENST00000256593.3	37	CCDS811.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878624	0.72294	.	.	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6947	0.77488	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GSTM5	110059274	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.472000	0.73567	2.468000	0.83385	0.597000	0.82753	.		0.448	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851	Intron	Splice_Site_SNP
SELP	6403	broad.mit.edu	37	1	169562907	169562907	+	Silent	SNP	A	A	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:169562907A>G	ENST00000263686.6	-	14	2380	c.2343T>C	c.(2341-2343)tcT>tcC	p.S781S	SELP_ENST00000367792.2_Silent_p.S597S|SELP_ENST00000367786.2_Silent_p.S719S|SELP_ENST00000367793.2_Silent_p.S719S|SELP_ENST00000367788.2_Silent_p.S719S|SELP_ENST00000458599.2_Silent_p.S597S|SELP_ENST00000367791.2_Silent_p.S595S|SELP_ENST00000367794.2_Silent_p.S719S	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	781					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.S781S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GACCTATCGTAGAAGCCACCG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	1											72.0	69.0	70.0					1																	169562907		2203	4300	6503	167829531	SO:0001819	synonymous_variant	6403			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.2343T>C	1.37:g.169562907A>G			167829531	Q5R344|Q8IVD1	Silent	SNP	ENST00000263686.6	37	CCDS1282.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	0.168	-1.074376	0.01903	.	.	ENSG00000174175	ENST00000446728	.	.	.	5.62	0.516	0.17019	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.35847	-0.9772	4	.	.	.	-17.0207	3.0629	0.06205	0.5294:0.0:0.1677:0.3029	.	.	.	.	H	597	.	.	Y	-	1	0	SELP	167829531	0.009000	0.17119	0.044000	0.18714	0.013000	0.08279	-0.069000	0.11542	-0.160000	0.11002	-0.341000	0.08007	TAC		0.438	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		Silent
ZBTB37	84614	broad.mit.edu	37	1	173839617	173839617	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:173839617C>A	ENST00000367701.5	+	2	445	c.254C>A	c.(253-255)tCt>tAt	p.S85Y	ZBTB37_ENST00000427304.1_Missense_Mutation_p.S85Y|ZBTB37_ENST00000367704.1_Missense_Mutation_p.S85Y|GAS5_ENST00000364084.1_RNA|ZBTB37_ENST00000432989.1_Missense_Mutation_p.S85Y|ZBTB37_ENST00000367702.1_Missense_Mutation_p.S85Y			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	85	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S85Y(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						CAGCTCCTTTCTTTCTGTTAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											79.0	80.0	80.0					1																	173839617		2203	4300	6503	172106240	SO:0001583	missense	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.254C>A	1.37:g.173839617C>A	ENSP00000356674:p.Ser85Tyr		172106240	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	ENST00000367701.5	37	CCDS44278.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591100	0.66219	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367701	T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58	5.85	5.85	0.93711	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.206689	0.52532	D	0.000071	T	0.75280	0.3828	L	0.33485	1.01	0.58432	D	0.999994	D;D	0.71674	0.998;0.994	D;D	0.80764	0.994;0.964	T	0.77130	-0.2701	10	0.72032	D	0.01	.	20.1542	0.98100	0.0:1.0:0.0:0.0	.	85;85	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	Y	85	ENSP00000356677:S85Y;ENSP00000415293:S85Y;ENSP00000409408:S85Y;ENSP00000356675:S85Y;ENSP00000356674:S85Y	ENSP00000356674:S85Y	S	+	2	0	ZBTB37	172106240	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.733000	0.68571	2.767000	0.95098	0.563000	0.77884	TCT		0.448	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090729.2	NM_032522		Missense_Mutation
CACNA1E	777	broad.mit.edu	37	1	181702679	181702679	+	Missense_Mutation	SNP	G	G	A	rs547399351		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:181702679G>A	ENST00000367573.2	+	21	3055	c.3055G>A	c.(3055-3057)Gtg>Atg	p.V1019M	CACNA1E_ENST00000358338.5_Missense_Mutation_p.V951M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1019M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V626M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1000M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1000M|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V970M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1019					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1019M(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGGGAAGCACGTGGTGCTGAC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20352	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											46.0	54.0	52.0					1																	181702679		2179	4271	6450	179969302	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3055G>A	1.37:g.181702679G>A	ENSP00000356545:p.Val1019Met		179969302	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	6.503	0.461044	0.12342	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96200	-3.88;-3.87;-3.88;-3.87;-3.94;-3.88;-3.88	4.72	-1.64	0.08318	.	1.749810	0.02299	N	0.070996	D	0.87916	0.6298	N	0.08118	0	0.09310	N	1	P;B;B	0.36733	0.567;0.431;0.001	B;B;B	0.26310	0.068;0.032;0.001	T	0.80491	-0.1359	10	0.33141	T	0.24	.	12.1674	0.54138	0.4047:0.0:0.5953:0.0	.	1000;1019;1019	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	M	1019;1000;970;951;626;1000;1019	ENSP00000356542:V1019M;ENSP00000434814:V1000M;ENSP00000350183:V970M;ENSP00000351101:V951M;ENSP00000356539:V626M;ENSP00000353222:V1000M;ENSP00000356545:V1019M	ENSP00000350183:V970M	V	+	1	0	CACNA1E	179969302	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.171000	0.16685	-0.490000	0.06707	-1.598000	0.00824	GTG		0.642	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		Missense_Mutation
EDEM3	80267	broad.mit.edu	37	1	184663448	184663448	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:184663448C>T	ENST00000318130.8	-	20	2814	c.2548G>A	c.(2548-2550)Gca>Aca	p.A850T	EDEM3_ENST00000367512.3_Missense_Mutation_p.A823T|EDEM3_ENST00000466392.1_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	850					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.A807T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCCATATCTGCTAGAGATAAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											91.0	87.0	88.0					1																	184663448		2203	4299	6502	182930071	SO:0001583	missense	80267			AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.2548G>A	1.37:g.184663448C>T	ENSP00000318147:p.Ala850Thr		182930071	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	ENST00000318130.8	37	CCDS1363.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	11.46	1.644060	0.29246	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.73363	-0.69;-0.74	5.63	0.338	0.15974	.	0.593220	0.17938	N	0.156947	T	0.46502	0.1396	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.30650	-0.9971	10	0.02654	T	1	.	1.8631	0.03193	0.2374:0.453:0.1152:0.1943	.	850	Q9BZQ6	EDEM3_HUMAN	T	850;823	ENSP00000318147:A850T;ENSP00000356482:A823T	ENSP00000318147:A850T	A	-	1	0	EDEM3	182930071	0.402000	0.25311	0.002000	0.10522	0.855000	0.48748	0.159000	0.16442	-0.185000	0.10550	0.655000	0.94253	GCA		0.383	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191		Missense_Mutation
HMCN1	83872	broad.mit.edu	37	1	185956618	185956618	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:185956618C>T	ENST00000271588.4	+	20	3219	c.2990C>T	c.(2989-2991)cCa>cTa	p.P997L	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Missense_Mutation_p.P997L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	997	Ig-like C2-type 7.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.P997L(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAAGGCATTCCAGTAACTTTA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											178.0	175.0	176.0					1																	185956618		2203	4300	6503	184223241	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2990C>T	1.37:g.185956618C>T	ENSP00000271588:p.Pro997Leu		184223241	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.101231	0.94245	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66460	-0.21;-0.21	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.114453	0.64402	D	0.000011	T	0.81607	0.4858	M	0.71036	2.16	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.87578	0.956;0.998	T	0.81093	-0.1089	10	0.44086	T	0.13	.	19.0253	0.92930	0.0:1.0:0.0:0.0	.	381;997	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	L	997	ENSP00000271588:P997L;ENSP00000356462:P997L	ENSP00000271588:P997L	P	+	2	0	HMCN1	184223241	0.998000	0.40836	0.958000	0.39756	0.985000	0.73830	5.417000	0.66423	2.501000	0.84356	0.655000	0.94253	CCA		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Missense_Mutation
CRB1	23418	broad.mit.edu	37	1	197316487	197316487	+	Missense_Mutation	SNP	C	C	T	rs62636263		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:197316487C>T	ENST00000367400.3	+	4	1001	c.866C>T	c.(865-867)aCg>aTg	p.T289M	CRB1_ENST00000538660.1_Missense_Mutation_p.T289M|CRB1_ENST00000535699.1_Missense_Mutation_p.T220M|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000543483.1_5'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	289	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		T -> M (rare variant found in patients with retinal dystrophy; does not segregate with the disease in a family; unlikely to be pathogenic). {ECO:0000269|PubMed:11231775, ECO:0000269|PubMed:11389483, ECO:0000269|PubMed:12843338, ECO:0000269|PubMed:17724218, ECO:0000269|PubMed:21602930}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T289M(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGTAACTGCACGGGTAGTGGA	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		18280	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1	GRCh37	CM010798	CRB1	M	rs62636263	C	,MET/THR	1,4405	2.1+/-5.4	0,1,2202	205.0	184.0	191.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,866	-5.3	0.0	1	dbSNP_129	191	2,8598	2.2+/-6.3	0,2,4298	no	intron,missense	CRB1	NM_001193640.1,NM_201253.2	,81	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	,benign	,289/1407	197316487	3,13003	2203	4300	6503	195583110	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.866C>T	1.37:g.197316487C>T	ENSP00000356370:p.Thr289Met		195583110	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490443	0.26686	2.27E-4	2.33E-4	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	D;D;D	0.91792	-2.91;-2.91;-2.91	5.4	-5.28	0.02755	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.81870	0.4914	L	0.43701	1.375	0.09310	N	1	B;P;B;B	0.40360	0.154;0.714;0.14;0.282	B;B;B;B	0.27170	0.004;0.077;0.016;0.023	T	0.71906	-0.4451	9	0.46703	T	0.11	.	4.6492	0.12587	0.2342:0.3197:0.0:0.4461	rs62636263	289;220;289;314	B7Z5T2;F5H0L2;P82279;Q59H36	.;.;CRUM1_HUMAN;.	M	220;289;289	ENSP00000438786:T220M;ENSP00000438091:T289M;ENSP00000356370:T289M	ENSP00000356370:T289M	T	+	2	0	CRB1	195583110	0.000000	0.05858	0.016000	0.15963	0.997000	0.91878	-0.039000	0.12124	-0.962000	0.03604	0.585000	0.79938	ACG		0.383	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		Missense_Mutation
RRP15	51018	broad.mit.edu	37	1	218478382	218478382	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:218478382C>A	ENST00000366932.3	+	3	448	c.418C>A	c.(418-420)Ctg>Atg	p.L140M		NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)	140						mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.L140M(1)	ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		TGATAAGAGGCTGGAGTGGGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											153.0	165.0	161.0					1																	218478382		2203	4300	6503	216545005	SO:0001583	missense	51018				CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.418C>A	1.37:g.218478382C>A	ENSP00000355899:p.Leu140Met		216545005		Missense_Mutation	SNP	ENST00000366932.3	37	CCDS1520.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865686	0.32977	.	.	ENSG00000067533	ENST00000366932	T	0.45276	0.9	5.79	4.87	0.63330	.	0.056714	0.64402	D	0.000003	T	0.32041	0.0816	N	0.24115	0.695	0.26743	N	0.970349	B	0.09022	0.002	B	0.13407	0.009	T	0.20840	-1.0263	10	0.45353	T	0.12	.	15.3643	0.74507	0.2532:0.7468:0.0:0.0	.	140	Q9Y3B9	RRP15_HUMAN	M	140	ENSP00000355899:L140M	ENSP00000355899:L140M	L	+	1	2	RRP15	216545005	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.178000	0.31981	1.457000	0.47850	-0.152000	0.13540	CTG		0.378	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095284.1	NM_016052		Missense_Mutation
HLX	3142	broad.mit.edu	37	1	221055541	221055541	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:221055541C>G	ENST00000366903.6	+	3	2309	c.808C>G	c.(808-810)Cag>Gag	p.Q270E	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_Missense_Mutation_p.Q56E	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	270					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.Q270E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CACCATGCCGCAGACGTACAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	51.0	55.0					1																	221055541		2203	4300	6503	219122164	SO:0001583	missense	3142			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.808C>G	1.37:g.221055541C>G	ENSP00000355870:p.Gln270Glu		219122164	B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.259447	0.95368	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	T;D;T	0.95205	1.26;-3.64;3.36	5.84	5.84	0.93424	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.56097	D	0.000028	D	0.93880	0.8042	L	0.34521	1.04	0.58432	D	0.999999	P	0.48640	0.913	P	0.51918	0.684	D	0.92156	0.5732	10	0.28530	T	0.3	-31.9252	20.1278	0.97990	0.0:1.0:0.0:0.0	.	270	Q14774	HLX_HUMAN	E	270;3;56	ENSP00000355870:Q270E;ENSP00000408248:Q3E;ENSP00000449882:Q56E	ENSP00000355870:Q270E	Q	+	1	0	HLX	219122164	1.000000	0.71417	0.969000	0.41365	0.852000	0.48524	7.788000	0.85771	2.768000	0.95171	0.561000	0.74099	CAG		0.552	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958		Missense_Mutation
OR2T2	401992	broad.mit.edu	37	1	248617013	248617013	+	Silent	SNP	A	A	C	rs150092963	byFrequency	TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr1:248617013A>C	ENST00000342927.3	+	1	937	c.915A>C	c.(913-915)gtA>gtC	p.V305V		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V305V(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGAGGAAAGTACTAGGGAGAT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	1											26.0	28.0	28.0					1																	248617013		2188	4286	6474	246683636	SO:0001819	synonymous_variant	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.915A>C	1.37:g.248617013A>C			246683636	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1	SNP	14	Broad																																																																																				0.537	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		Silent
CALML5	51806	broad.mit.edu	37	10	5541328	5541328	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr10:5541328T>C	ENST00000380332.3	-	1	205	c.74A>G	c.(73-75)aAc>aGc	p.N25S		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	25	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.N25S(1)		biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						GATGGTGCCGTTTCCATCCGT	0.627																																					GBM(149;1055 3356 43077)											1	Substitution - Missense(1)	ovary(1)	10											109.0	107.0	108.0					10																	5541328		2203	4300	6503	5531328	SO:0001583	missense	51806			AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.74A>G	10.37:g.5541328T>C	ENSP00000369689:p.Asn25Ser		5531328	Q5SQI3|Q8IXU8	Missense_Mutation	SNP	ENST00000380332.3	37	CCDS7068.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	12.21	1.868713	0.32977	.	.	ENSG00000178372	ENST00000380332	T	0.71698	-0.59	4.49	3.34	0.38264	EF-hand-like domain (1);	0.201201	0.34200	N	0.004171	T	0.57548	0.2061	L	0.31065	0.9	0.22880	N	0.99862	B	0.02656	0.0	B	0.04013	0.001	T	0.52351	-0.8587	10	0.87932	D	0	-42.6139	10.5031	0.44817	0.0:0.0868:0.0:0.9132	.	25	Q9NZT1	CALL5_HUMAN	S	25	ENSP00000369689:N25S	ENSP00000369689:N25S	N	-	2	0	CALML5	5531328	1.000000	0.71417	0.001000	0.08648	0.000000	0.00434	4.805000	0.62561	0.298000	0.22638	-1.139000	0.01908	AAC		0.627	CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046556.1	NM_017422		Missense_Mutation
PRKCQ	5588	broad.mit.edu	37	10	6470302	6470302	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr10:6470302T>C	ENST00000263125.5	-	18	2087	c.1988A>G	c.(1987-1989)aAt>aGt	p.N663S	PRKCQ_ENST00000397176.2_Missense_Mutation_p.N600S|PRKCQ_ENST00000539722.1_Missense_Mutation_p.N538S	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	663	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.N663S(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TTTGTCGAAATTGCTGCAGTC	0.393																																					Ovarian(50;572 1126 10530 25349 30594)											1	Substitution - Missense(1)	ovary(1)	10											180.0	188.0	185.0					10																	6470302		2203	4300	6503	6510308	SO:0001583	missense	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1988A>G	10.37:g.6470302T>C	ENSP00000263125:p.Asn663Ser		6510308	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	SNP	52	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.9|21.9	4.215815|4.215815	0.79352|0.79352	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.76186	.|-1.0;-1.0;-1.0	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91878|0.91878	0.7429|0.7429	H|H	0.98866|0.98866	4.355|4.355	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999	.|D;D;D;D	.|0.91635	.|0.997;0.997;0.999;0.995	D|D	0.95021|0.95021	0.8160|0.8160	5|10	.|0.87932	.|D	.|0	.|.	15.1244|15.1244	0.72472|0.72472	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|538;435;600;663	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	V|S	436|663;600;538	.|ENSP00000263125:N663S;ENSP00000380361:N600S;ENSP00000441752:N538S	.|ENSP00000263125:N663S	I|N	-|-	1|2	0|0	PRKCQ|PRKCQ	6510308|6510308	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.674000|0.674000	0.39518|0.39518	7.486000|7.486000	0.81215|0.81215	2.053000|2.053000	0.61076|0.61076	0.459000|0.459000	0.35465|0.35465	ATT|AAT		0.393	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		Missense_Mutation
OGDHL	55753	broad.mit.edu	37	10	50953874	50953874	+	Silent	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr10:50953874G>A	ENST00000374103.4	-	11	1531	c.1446C>T	c.(1444-1446)aaC>aaT	p.N482N	OGDHL_ENST00000419399.1_Silent_p.N425N|OGDHL_ENST00000432695.1_Silent_p.N273N	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	482					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.N482N(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TGTTGAAAGTGTTTCTCCATT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	10											121.0	95.0	104.0					10																	50953874		2203	4300	6503	50623880	SO:0001819	synonymous_variant	55753			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1446C>T	10.37:g.50953874G>A			50623880	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	ENST00000374103.4	37	CCDS7234.1	SNP	48	Broad																																																																																				0.577	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245		Silent
JMJD1C	221037	broad.mit.edu	37	10	64975081	64975081	+	Silent	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr10:64975081G>A	ENST00000399262.2	-	7	1175	c.957C>T	c.(955-957)agC>agT	p.S319S	JMJD1C_ENST00000542921.1_Silent_p.S137S|JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000399251.1_Silent_p.S100S|JMJD1C_ENST00000402544.1_Silent_p.S100S	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	319					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.S100S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTGGTATACTGCTATCTGAGC	0.393																																																1	Substitution - coding silent(1)	ovary(1)	10											256.0	223.0	234.0					10																	64975081		1884	4112	5996	64645087	SO:0001819	synonymous_variant	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.957C>T	10.37:g.64975081G>A			64645087	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	37	CCDS41532.1	SNP	46	Broad																																																																																				0.393	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		Silent
TNKS1BP1	85456	broad.mit.edu	37	11	57077421	57077421	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr11:57077421C>A	ENST00000532437.1	-	5	3075	c.2764G>T	c.(2764-2766)Gat>Tat	p.D922Y	TNKS1BP1_ENST00000530920.1_5'UTR|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.D922Y			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	922	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.D922Y(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TCATCGGCATCCTGGCTGCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											187.0	182.0	184.0					11																	57077421		2201	4296	6497	56833997	SO:0001583	missense	85456			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2764G>T	11.37:g.57077421C>A	ENSP00000437271:p.Asp922Tyr		56833997	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317079	0.40996	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.42900	0.96;0.96	5.37	5.37	0.77165	.	0.118358	0.37219	N	0.002184	T	0.60843	0.2300	M	0.63843	1.955	0.09310	N	1	D	0.76494	0.999	D	0.66351	0.943	T	0.56774	-0.7923	10	0.87932	D	0	-7.1958	16.0144	0.80425	0.0:1.0:0.0:0.0	.	922	Q9C0C2	TB182_HUMAN	Y	922	ENSP00000350990:D922Y;ENSP00000437271:D922Y	ENSP00000350990:D922Y	D	-	1	0	TNKS1BP1	56833997	0.012000	0.17670	0.140000	0.22221	0.113000	0.19764	2.423000	0.44705	2.527000	0.85204	0.462000	0.41574	GAT		0.572	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		Missense_Mutation
NXF1	10482	broad.mit.edu	37	11	62571034	62571034	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr11:62571034T>C	ENST00000532297.1	-	4	855	c.226A>G	c.(226-228)Acc>Gcc	p.T76A	NXF1_ENST00000531131.1_Intron|NXF1_ENST00000531709.2_Missense_Mutation_p.T76A|NXF1_ENST00000439713.2_Missense_Mutation_p.T76A|NXF1_ENST00000294172.2_Missense_Mutation_p.T76A			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	76	Interaction with ALYREF/THOC4.|Major non-specific RNA-binding.|RNA-binding (RBD).				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T76A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTCGGGTGGTATAGGGGTTG	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											95.0	87.0	89.0					11																	62571034		2201	4299	6500	62327610	SO:0001583	missense	10482			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.226A>G	11.37:g.62571034T>C	ENSP00000436679:p.Thr76Ala		62327610	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	8.791	0.930488	0.18131	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713;ENST00000533671;ENST00000531474	T;T;T;T	0.42513	1.0;1.0;0.98;0.97	4.66	-5.34	0.02705	.	1.200360	0.05872	N	0.624770	T	0.18593	0.0446	N	0.12746	0.255	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.35748	-0.9776	10	0.05833	T	0.94	-0.1036	8.2956	0.31984	0.0:0.1995:0.1311:0.6695	.	119;89;76	E9PIN3;Q59E96;Q9UBU9	.;.;NXF1_HUMAN	A	76;76;119;76;16;16	ENSP00000294172:T76A;ENSP00000436679:T76A;ENSP00000435742:T119A;ENSP00000408864:T76A	ENSP00000294172:T76A	T	-	1	0	NXF1	62327610	0.000000	0.05858	0.001000	0.08648	0.911000	0.54048	-1.276000	0.02815	-1.020000	0.03354	-0.899000	0.02877	ACC		0.507	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362		Missense_Mutation
LRP5	4041	broad.mit.edu	37	11	68177498	68177498	+	Silent	SNP	C	C	T	rs35298380		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr11:68177498C>T	ENST00000294304.7	+	10	2314	c.2208C>T	c.(2206-2208)gaC>gaT	p.D736D		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	736	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.D736D(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACTGGGCCGACACTGGGACCA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		16822	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11						C		1,4399	2.1+/-5.4	0,1,2199	109.0	90.0	97.0		2208	4.5	1.0	11	dbSNP_126	97	0,8588		0,0,4294	no	coding-synonymous	LRP5	NM_002335.2		0,1,6493	TT,TC,CC		0.0,0.0227,0.0077		736/1616	68177498	1,12987	2200	4294	6494	67934074	SO:0001819	synonymous_variant	4041			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2208C>T	11.37:g.68177498C>T			67934074	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1	SNP	17	Broad																																																																																				0.627	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		Silent
MGST1	4257	broad.mit.edu	37	12	16516792	16516792	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:16516792G>T	ENST00000396209.1	+	4	428	c.285G>T	c.(283-285)ttG>ttT	p.L95F	MGST1_ENST00000396210.3_Missense_Mutation_p.L95F|MGST1_ENST00000540056.1_3'UTR|MGST1_ENST00000396207.1_Missense_Mutation_p.L95F|MGST1_ENST00000010404.2_Missense_Mutation_p.L95F|MGST1_ENST00000535309.1_Intron	NM_145791.2	NP_665734.1	P10620	MGST1_HUMAN	microsomal glutathione S-transferase 1	95					cellular response to lipid hydroperoxide (GO:0071449)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|Leydig cell differentiation (GO:0033327)|oxidation-reduction process (GO:0055114)|protein homotrimerization (GO:0070207)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	apical part of cell (GO:0045177)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	glutathione binding (GO:0043295)|glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)	p.L95F(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9		Hepatocellular(102;0.121)			Glutathione(DB00143)	TGTATTCCTTGAGTGGTCCCG	0.448																																																1	Substitution - Missense(1)	ovary(1)	12											160.0	149.0	152.0					12																	16516792		2203	4300	6503	16408059	SO:0001583	missense	4257			U46494	CCDS8677.1, CCDS58209.1	12p12.3-p12.1	2012-06-21			ENSG00000008394	ENSG00000008394	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7061	protein-coding gene	gene with protein product		138330		GST12			Standard	NM_145792		Approved	MGST-I	uc031qgl.1	P10620	OTTHUMG00000168816	ENST00000396209.1:c.285G>T	12.37:g.16516792G>T	ENSP00000379512:p.Leu95Phe		16408059	A8K533|G5EA53	Missense_Mutation	SNP	ENST00000396209.1	37	CCDS8677.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453828	0.43531	.	.	ENSG00000008394	ENST00000010404;ENST00000543076;ENST00000396210;ENST00000396209;ENST00000396207	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	5.27	3.41	0.39046	Membrane associated eicosanoid/glutathione metabolism-like domain (1);	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	M	0.64170	1.965	0.53688	D	0.999977	B	0.33413	0.411	B	0.37650	0.255	T	0.52548	-0.8561	10	0.24483	T	0.36	-9.6709	8.4856	0.33069	0.1516:0.2248:0.6236:0.0	.	95	P10620	MGST1_HUMAN	F	95;59;95;95;95	ENSP00000010404:L95F;ENSP00000442767:L59F;ENSP00000379513:L95F;ENSP00000379512:L95F;ENSP00000379510:L95F	ENSP00000010404:L95F	L	+	3	2	MGST1	16408059	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	1.094000	0.30951	1.454000	0.47793	0.655000	0.94253	TTG		0.448	MGST1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401189.1	NM_145791		Missense_Mutation
ST8SIA1	6489	broad.mit.edu	37	12	22440105	22440105	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:22440105G>A	ENST00000396037.4	-	2	840	c.359C>T	c.(358-360)tCa>tTa	p.S120L	ST8SIA1_ENST00000539510.1_Nonsense_Mutation_p.Q14*	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	120					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.S120L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						AGAGTAAGTTGAATTGTCAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	12											106.0	98.0	101.0					12																	22440105		2203	4300	6503	22331372	SO:0001583	missense	6489			L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.359C>T	12.37:g.22440105G>A	ENSP00000379353:p.Ser120Leu		22331372	A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	ENST00000396037.4	37	CCDS8697.1	SNP	45	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.909595|7.909595	0.98557|0.98557	.|.	.|.	ENSG00000111728|ENSG00000111728	ENST00000539510|ENST00000396037;ENST00000540824;ENST00000541868	.|T;T;T	.|0.64618	.|-0.11;1.58;-0.11	5.35|5.35	3.37|3.37	0.38596|0.38596	.|.	.|0.285303	.|0.34268	.|N	.|0.004101	.|T	.|0.53674	.|0.1811	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	A|A	1|1	.|B	.|0.21821	.|0.061	.|B	.|0.26614	.|0.071	.|T	.|0.63470	.|-0.6630	.|9	0.66056|0.62326	D|D	0.02|0.03	-2.9179|-2.9179	9.1551|9.1551	0.36988|0.36988	0.0:0.14:0.5834:0.2765|0.0:0.14:0.5834:0.2765	.|.	.|120	.|Q92185	.|SIA8A_HUMAN	X|L	14|120;71;97	.|ENSP00000379353:S120L;ENSP00000441707:S71L;ENSP00000440292:S97L	ENSP00000446363:Q14X|ENSP00000261197:S120L	Q|S	-|-	1|2	0|0	ST8SIA1|ST8SIA1	22331372|22331372	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.980000|0.980000	0.70556|0.70556	4.381000|4.381000	0.59587|0.59587	1.227000|1.227000	0.43598|0.43598	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.408	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402245.2	NM_003034		Missense_Mutation
KIAA1551	55196	broad.mit.edu	37	12	32135055	32135055	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:32135055C>G	ENST00000312561.4	+	4	1580	c.1166C>G	c.(1165-1167)gCa>gGa	p.A389G	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	389								p.A389G(1)									ACAAGTGTTGCAAAAGAAAAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	12											77.0	88.0	84.0					12																	32135055		2203	4300	6503	32026322	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1166C>G	12.37:g.32135055C>G	ENSP00000310338:p.Ala389Gly		32026322	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305707	0.60305	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.06068	3.98;3.35	5.86	4.97	0.65823	.	0.454672	0.20634	N	0.088538	T	0.04543	0.0124	N	0.14661	0.345	0.09310	N	1	B	0.16802	0.019	B	0.18561	0.022	T	0.41233	-0.9520	9	.	.	.	.	13.2874	0.60251	0.0:0.925:0.0:0.075	.	389	Q9HCM1	CL035_HUMAN	G	389	ENSP00000310338:A389G;ENSP00000370442:A389G	.	A	+	2	0	C12orf35	32026322	0.006000	0.16342	0.144000	0.22314	0.494000	0.33585	0.512000	0.22755	2.776000	0.95493	0.655000	0.94253	GCA		0.323	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169		Missense_Mutation
RND1	27289	broad.mit.edu	37	12	49254783	49254783	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:49254783C>A	ENST00000309739.5	-	4	580	c.450G>T	c.(448-450)gaG>gaT	p.E150D		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	150					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)	p.E150D(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						CACACACCTGCTCATAGGAGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	12											101.0	93.0	96.0					12																	49254783		2203	4300	6503	47541050	SO:0001583	missense	27289			Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.450G>T	12.37:g.49254783C>A	ENSP00000308461:p.Glu150Asp		47541050	A8K9P7	Missense_Mutation	SNP	ENST00000309739.5	37	CCDS8771.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302621	0.40795	.	.	ENSG00000172602	ENST00000550607;ENST00000309739	T;T	0.78707	-1.2;-1.2	5.85	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.80287	0.4595	L	0.43923	1.385	0.58432	D	0.999996	P	0.46859	0.885	D	0.63597	0.916	T	0.75909	-0.3151	10	0.30854	T	0.27	-1.6016	9.8672	0.41152	0.0:0.7131:0.0:0.2869	.	150	Q92730	RND1_HUMAN	D	44;150	ENSP00000447059:E44D;ENSP00000308461:E150D	ENSP00000308461:E150D	E	-	3	2	RND1	47541050	0.970000	0.33590	1.000000	0.80357	0.961000	0.63080	0.166000	0.16583	0.933000	0.37291	0.655000	0.94253	GAG		0.557	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408915.1	NM_014470		Missense_Mutation
GALNT6	11226	broad.mit.edu	37	12	51753081	51753081	+	Silent	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:51753081G>C	ENST00000543196.2	-	7	1408	c.1203C>G	c.(1201-1203)ccC>ccG	p.P401P	GALNT6_ENST00000356317.3_Silent_p.P401P			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	401	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P401P(1)		endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGACAGAGCAGGGGATGATCT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	12											111.0	106.0	108.0					12																	51753081		2203	4300	6503	50039348	SO:0001819	synonymous_variant	11226			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1203C>G	12.37:g.51753081G>C			50039348	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	37	CCDS8813.1	SNP	35	Broad																																																																																				0.587	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		Silent
ESPL1	9700	broad.mit.edu	37	12	53684720	53684720	+	Silent	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:53684720C>G	ENST00000257934.4	+	25	5551	c.5460C>G	c.(5458-5460)tcC>tcG	p.S1820S	ESPL1_ENST00000552462.1_Silent_p.S1820S	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1820					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.S1820S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						AGGAGGCCTCCCGCCTACAGG	0.627																																					Colon(53;1069 1201 2587 5382)											1	Substitution - coding silent(1)	ovary(1)	12											21.0	20.0	20.0					12																	53684720		2203	4298	6501	51970987	SO:0001819	synonymous_variant	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5460C>G	12.37:g.53684720C>G			51970987		Silent	SNP	ENST00000257934.4	37	CCDS8852.1	SNP	22	Broad																																																																																				0.627	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		Silent
FGD6	55785	broad.mit.edu	37	12	95604293	95604293	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:95604293C>A	ENST00000343958.4	-	2	990	c.767G>T	c.(766-768)tGc>tTc	p.C256F	FGD6_ENST00000546711.1_Missense_Mutation_p.C256F|FGD6_ENST00000549499.1_Missense_Mutation_p.C256F|FGD6_ENST00000550368.1_5'Flank	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	256					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.C256F(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						GTCATCCTGGCAAGTTTCAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	74.0	74.0					12																	95604293		2203	4300	6503	94128424	SO:0001583	missense	55785			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.767G>T	12.37:g.95604293C>A	ENSP00000344446:p.Cys256Phe		94128424	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	1.827	-0.470884	0.04445	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.68903	-0.25;-0.36;-0.29	5.99	-0.595	0.11660	.	0.701496	0.13123	N	0.412021	T	0.56062	0.1960	L	0.53249	1.67	0.09310	N	1	B	0.24823	0.112	B	0.23852	0.049	T	0.50466	-0.8825	10	0.56958	D	0.05	0.2646	6.1317	0.20209	0.0:0.5242:0.1167:0.3591	.	256	Q6ZV73	FGD6_HUMAN	F	256	ENSP00000344446:C256F;ENSP00000450342:C256F;ENSP00000449005:C256F	ENSP00000344446:C256F	C	-	2	0	FGD6	94128424	0.279000	0.24239	0.087000	0.20705	0.066000	0.16364	-0.035000	0.12205	-0.136000	0.11475	-0.150000	0.13652	TGC		0.403	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351		Missense_Mutation
HECTD4	283450	broad.mit.edu	37	12	112743937	112743937	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr12:112743937C>T	ENST00000430131.2	-	7	1229	c.84G>A	c.(82-84)tgG>tgA	p.W28*	HECTD4_ENST00000550722.1_Nonsense_Mutation_p.W278*|HECTD4_ENST00000377560.5_Nonsense_Mutation_p.W278*			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	28					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.W278*(1)									TGGCAGGAGACCAGATCCAAT	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	12											76.0	77.0	77.0					12																	112743937		1994	4163	6157	111228320	SO:0001587	stop_gained	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.84G>A	12.37:g.112743937C>T	ENSP00000404379:p.Trp28*		111228320	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Nonsense_Mutation	SNP	ENST00000430131.2	37		SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	46	12.666444	0.99687	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6952	0.88279	0.0:1.0:0.0:0.0	.	.	.	.	X	278;28;278	.	ENSP00000366783:W278X	W	-	3	0	C12orf51	111228320	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.369000	0.79578	2.694000	0.91930	0.460000	0.39030	TGG		0.483	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		Nonsense_Mutation
ZC3H13	23091	broad.mit.edu	37	13	46563022	46563022	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr13:46563022C>G	ENST00000242848.4	-	9	1503	c.1155G>C	c.(1153-1155)aaG>aaC	p.K385N	ZC3H13_ENST00000282007.3_Missense_Mutation_p.K385N			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	385	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.K385N(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		GAGGACTCTGCTTTCTCTGGG	0.488																																					Esophageal Squamous(187;747 2077 11056 31291 44172)											1	Substitution - Missense(1)	ovary(1)	13											143.0	125.0	131.0					13																	46563022		2203	4300	6503	45461023	SO:0001583	missense	23091			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1155G>C	13.37:g.46563022C>G	ENSP00000242848:p.Lys385Asn		45461023	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243236	0.39697	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.33654	2.43;1.4	6.03	4.3	0.51218	.	0.000000	0.64402	D	0.000003	T	0.44767	0.1309	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.64776	0.852;0.929	T	0.34900	-0.9810	10	0.45353	T	0.12	.	12.1719	0.54163	0.0:0.811:0.0:0.189	.	385;385	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	N	385;385;201	ENSP00000242848:K385N;ENSP00000282007:K385N	ENSP00000242848:K385N	K	-	3	2	ZC3H13	45461023	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.603000	0.36794	1.558000	0.49541	0.655000	0.94253	AAG		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070		Missense_Mutation
ALDH6A1	4329	broad.mit.edu	37	14	74527349	74527349	+	Missense_Mutation	SNP	C	C	T	rs183066442	byFrequency	TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr14:74527349C>T	ENST00000553458.1	-	12	1702	c.1604G>A	c.(1603-1605)cGt>cAt	p.R535H	CCDC176_ENST00000394009.3_Intron|CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_Missense_Mutation_p.R252H|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.R522H|AC005484.5_ENST00000492026.1_RNA	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	535					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)	p.R535H(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		TTGTTTCTAACGGCCCATGGT	0.428													C|||	7	0.00139776	0.0	0.0101	5008	,	,		18344	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14						C	HIS/ARG,	0,4406		0,0,2203	134.0	119.0	124.0		1604,	0.5	1.0	14		124	1,8599	1.2+/-3.3	0,1,4299	yes	missense,intron	ALDH6A1,C14orf45	NM_005589.2,NM_025057.2	29,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,	535/536,	74527349	1,13005	2203	4300	6503	73597102	SO:0001583	missense	4329			M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.1604G>A	14.37:g.74527349C>T	ENSP00000450436:p.Arg535His		73597102	B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	37	CCDS9826.1	SNP	19	Broad	5	0.0022893772893772895	0	0.0	5	0.013812154696132596	0	0.0	0	0.0	C	15.90	2.968220	0.53614	0.0	1.16E-4	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	T;T;T	0.76709	-1.01;-1.0;-1.04	5.99	0.462	0.16695	.	0.269765	0.43416	N	0.000565	T	0.54983	0.1892	L	0.27053	0.805	0.43156	D	0.994937	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.54009	-0.8357	10	0.56958	D	0.05	.	10.6201	0.45474	0.0:0.543:0.0:0.457	.	522;535	B4DFS8;Q02252	.;MMSA_HUMAN	H	535;522;252	ENSP00000450436:R535H;ENSP00000342564:R522H;ENSP00000452081:R252H	ENSP00000342564:R535H	R	-	2	0	ALDH6A1	73597102	0.999000	0.42202	0.995000	0.50966	0.930000	0.56654	1.744000	0.38268	0.137000	0.18759	0.655000	0.94253	CGT		0.428	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1			Missense_Mutation
HERC2	8924	broad.mit.edu	37	15	28474440	28474440	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr15:28474440G>A	ENST00000261609.7	-	34	5281	c.5173C>T	c.(5173-5175)Cgg>Tgg	p.R1725W		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R1725W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGCAGCATCCGATTAAAAGGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	15											80.0	89.0	86.0					15																	28474440		2201	4295	6496	26148035	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5173C>T	15.37:g.28474440G>A	ENSP00000261609:p.Arg1725Trp		26148035		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954142	0.73902	.	.	ENSG00000128731	ENST00000261609	T	0.43688	0.94	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.53077	0.1774	L	0.48642	1.525	0.80722	D	1	D	0.76494	0.999	P	0.62014	0.897	T	0.56896	-0.7903	10	0.87932	D	0	.	12.9789	0.58552	0.0:0.0:0.8275:0.1725	.	1725	O95714	HERC2_HUMAN	W	1725	ENSP00000261609:R1725W	ENSP00000261609:R1725W	R	-	1	2	HERC2	26148035	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.056000	0.76662	2.194000	0.70268	0.555000	0.69702	CGG		0.418	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Missense_Mutation
SPTBN5	51332	broad.mit.edu	37	15	42145528	42145528	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr15:42145528G>T	ENST00000320955.6	-	59	10325	c.10098C>A	c.(10096-10098)tgC>tgA	p.C3366*	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3366					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)	p.C3366*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTTGAAGGCGGCACTCCCTGA	0.647																																																1	Substitution - Nonsense(1)	ovary(1)	15											44.0	50.0	48.0					15																	42145528		2063	4198	6261	39932820	SO:0001587	stop_gained	51332			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10098C>A	15.37:g.42145528G>T	ENSP00000317790:p.Cys3366*		39932820		Nonsense_Mutation	SNP	ENST00000320955.6	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	.	50	16.965947	0.99876	.	.	ENSG00000137877	ENST00000320955	.	.	.	4.77	1.64	0.23874	.	1.133620	0.06618	N	0.756922	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	7.4908	0.27460	0.1773:0.22:0.6027:0.0	.	.	.	.	X	3366	.	ENSP00000317790:C3366X	C	-	3	2	SPTBN5	39932820	0.849000	0.29639	0.013000	0.15412	0.037000	0.13140	0.220000	0.17660	0.431000	0.26258	0.491000	0.48974	TGC		0.647	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642		Nonsense_Mutation
FES	2242	broad.mit.edu	37	15	91436889	91436890	+	Missense_Mutation	DNP	TG	TG	CC			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr15:91436889_91436890TG>CC	ENST00000328850.3	+	17	2193_2194	c.2051_2052TG>CC	c.(2050-2052)cTG>cCC	p.L684P	FES_ENST00000394302.1_Missense_Mutation_p.L543P|FES_ENST00000394300.3_Missense_Mutation_p.L626P|FES_ENST00000450438.2_Missense_Mutation_p.L556P|FES_ENST00000444422.2_Missense_Mutation_p.L614P|FES_ENST00000414248.2_Missense_Mutation_p.L556P	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	684	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)	p.L684P(1)		lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CCCAGGGACCTGGCTGCTCGGA	0.594																																																1	Substitution - Missense(1)	ovary(1)	15																																								89237894	SO:0001583	missense	2242			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	Exception_encountered	15.37:g.91436889_91436890delinsCC	ENSP00000331504:p.Leu684Pro		89237893	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	DNP	ENST00000328850.3	37	CCDS10365.1	DNP	55	Broad																																																																																				0.594	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005		Missense_Mutation
TMEM204	79652	broad.mit.edu	37	16	1584302	1584302	+	Missense_Mutation	SNP	C	C	T	rs551545490		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:1584302C>T	ENST00000566264.1	+	1	729	c.26C>T	c.(25-27)gCg>gTg	p.A9V	IFT140_ENST00000426508.2_Intron|TMEM204_ENST00000253934.5_Missense_Mutation_p.A9V|IFT140_ENST00000361339.5_5'Flank	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	9					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A9V(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				CTCGTGGCCGCGGCCGTGCTG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		14774	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	16											33.0	40.0	38.0					16																	1584302		2137	4251	6388	1524303	SO:0001583	missense	79652				CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.26C>T	16.37:g.1584302C>T	ENSP00000454945:p.Ala9Val		1524303	D3DU76|Q3KRC1|Q9H7G5	Missense_Mutation	SNP	ENST00000566264.1	37	CCDS42098.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	5.978	0.364481	0.11296	.	.	ENSG00000131634	ENST00000253934	T	0.44482	0.92	5.29	0.981	0.19756	.	0.581667	0.19928	N	0.102921	T	0.18923	0.0454	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24154	-1.0168	10	0.15499	T	0.54	-23.8303	9.0341	0.36277	0.0:0.6503:0.0:0.3497	.	9	Q9BSN7	TM204_HUMAN	V	9	ENSP00000253934:A9V	ENSP00000253934:A9V	A	+	2	0	TMEM204	1524303	0.907000	0.30839	0.005000	0.12908	0.035000	0.12851	1.838000	0.39211	-0.046000	0.13446	-0.302000	0.09304	GCG		0.682	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432610.1	NM_024600		Missense_Mutation
CHD9	80205	broad.mit.edu	37	16	53190689	53190689	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:53190689C>T	ENST00000398510.3	+	1	775	c.688C>T	c.(688-690)Caa>Taa	p.Q230*	CHD9_ENST00000447540.1_Nonsense_Mutation_p.Q230*|CHD9_ENST00000564845.1_Nonsense_Mutation_p.Q230*|CHD9_ENST00000566029.1_Nonsense_Mutation_p.Q230*			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	230	Ser-rich.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q230*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TTCAATGCAGCAATTTTCTCA	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	16											121.0	114.0	116.0					16																	53190689		1896	4122	6018	51748190	SO:0001587	stop_gained	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.688C>T	16.37:g.53190689C>T	ENSP00000381522:p.Gln230*		51748190	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Nonsense_Mutation	SNP	ENST00000398510.3	37		SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896098	0.91962	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	.	.	.	4.8	3.85	0.44370	.	0.104471	0.42294	D	0.000736	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-5.2999	12.8145	0.57657	0.0:0.9206:0.0:0.0794	.	.	.	.	X	230	.	ENSP00000381522:Q230X	Q	+	1	0	CHD9	51748190	0.995000	0.38212	0.996000	0.52242	0.880000	0.50808	3.749000	0.55150	1.028000	0.39785	0.650000	0.86243	CAA		0.368	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		Nonsense_Mutation
SLC38A7	55238	broad.mit.edu	37	16	58711319	58711319	+	Silent	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:58711319G>A	ENST00000570101.1	-	5	1504	c.621C>T	c.(619-621)agC>agT	p.S207S	SLC38A7_ENST00000219320.4_Silent_p.S207S|SLC38A7_ENST00000564100.1_Silent_p.S207S|SLC38A7_ENST00000566953.1_Intron|SLC38A7_ENST00000564010.1_Silent_p.S118S			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	207					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)	p.S207S(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						TACCCACGACGCTCAGGAAGC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	16											144.0	107.0	119.0					16																	58711319		2198	4300	6498	57268820	SO:0001819	synonymous_variant	55238			BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.621C>T	16.37:g.58711319G>A			57268820	Q53GJ9|Q9H9I5	Silent	SNP	ENST00000570101.1	37	CCDS10800.1	SNP	38	Broad																																																																																				0.552	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231		Silent
LRRC36	55282	broad.mit.edu	37	16	67401138	67401138	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:67401138C>T	ENST00000329956.6	+	8	992	c.973C>T	c.(973-975)Cct>Tct	p.P325S	LRRC36_ENST00000563189.1_Missense_Mutation_p.P204S|LRRC36_ENST00000290940.7_Missense_Mutation_p.P57S|LRRC36_ENST00000541146.1_Intron|LRRC36_ENST00000435835.3_Missense_Mutation_p.P204S	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	325								p.P325S(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		CTATCAGTTACCTTCAGATGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	16											138.0	135.0	136.0					16																	67401138		2198	4300	6498	65958639	SO:0001583	missense	55282			BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.973C>T	16.37:g.67401138C>T	ENSP00000329943:p.Pro325Ser		65958639	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	37	CCDS32467.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522117	0.44866	.	.	ENSG00000159708	ENST00000329956;ENST00000290940;ENST00000435835	T;T;T	0.51325	3.04;0.71;1.3	6.17	4.11	0.48088	.	0.188003	0.46145	N	0.000303	T	0.40862	0.1134	L	0.56769	1.78	0.80722	D	1	B;B;B	0.27166	0.17;0.103;0.103	B;B;B	0.23419	0.046;0.046;0.029	T	0.41052	-0.9530	10	0.54805	T	0.06	-6.9386	7.5361	0.27710	0.1629:0.7548:0.0:0.0823	.	204;204;325	B7Z7B3;Q1X8D7-2;Q1X8D7	.;.;LRC36_HUMAN	S	325;57;204	ENSP00000329943:P325S;ENSP00000290940:P57S;ENSP00000411122:P204S	ENSP00000290940:P57S	P	+	1	0	LRRC36	65958639	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.968000	0.29357	1.602000	0.50124	0.655000	0.94253	CCT		0.408	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	NM_018296		Missense_Mutation
EDC4	23644	broad.mit.edu	37	16	67915025	67915025	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:67915025C>T	ENST00000358933.5	+	19	2817	c.2578C>T	c.(2578-2580)Cga>Tga	p.R860*	CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	860					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R860*(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GGCCTTCCACCGACCACCATA	0.587																																																1	Substitution - Nonsense(1)	ovary(1)	16											86.0	85.0	85.0					16																	67915025		2198	4300	6498	66472526	SO:0001587	stop_gained	23644			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.2578C>T	16.37:g.67915025C>T	ENSP00000351811:p.Arg860*		66472526	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Nonsense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.261315	0.98732	.	.	ENSG00000038358	ENST00000358933	.	.	.	4.95	2.84	0.33178	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0362	13.038	0.58882	0.514:0.486:0.0:0.0	.	.	.	.	X	860	.	ENSP00000351811:R860X	R	+	1	2	EDC4	66472526	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.014000	0.29950	1.259000	0.44117	0.591000	0.81541	CGA		0.587	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329		Nonsense_Mutation
ZZEF1	23140	broad.mit.edu	37	17	3954080	3954080	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:3954080C>G	ENST00000381638.2	-	36	5982	c.5858G>C	c.(5857-5859)gGa>gCa	p.G1953A		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1953							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.G1953A(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GTCACCTTTTCCCTGATGAGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	17											65.0	59.0	61.0					17																	3954080		2203	4300	6503	3900829	SO:0001583	missense	23140			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5858G>C	17.37:g.3954080C>G	ENSP00000371051:p.Gly1953Ala		3900829	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098415	0.76870	.	.	ENSG00000074755	ENST00000381638	T	0.26373	1.74	5.66	4.63	0.57726	.	0.057732	0.64402	D	0.000002	T	0.27663	0.0680	L	0.32530	0.975	0.58432	D	0.999999	P;P	0.49862	0.793;0.929	P;B	0.45881	0.496;0.296	T	0.03651	-1.1016	10	0.54805	T	0.06	-5.5719	18.2335	0.89942	0.0:0.8709:0.1291:0.0	.	1953;1953	O43149-2;O43149	.;ZZEF1_HUMAN	A	1953	ENSP00000371051:G1953A	ENSP00000371051:G1953A	G	-	2	0	ZZEF1	3900829	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	3.557000	0.53741	2.652000	0.90054	0.655000	0.94253	GGA		0.532	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113		Missense_Mutation
DNAH9	1770	broad.mit.edu	37	17	11522913	11522913	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:11522913G>A	ENST00000262442.4	+	6	1233	c.1165G>A	c.(1165-1167)Gaa>Aaa	p.E389K	DNAH9_ENST00000454412.2_Missense_Mutation_p.E389K	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	389	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E389K(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGAGGTAGAAGAAAGTCAGAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											135.0	135.0	135.0					17																	11522913		2203	4300	6503	11463638	SO:0001583	missense	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1165G>A	17.37:g.11522913G>A	ENSP00000262442:p.Glu389Lys		11463638	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.223210	0.95139	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.60171	0.21;0.21	6.07	6.07	0.98685	Dynein heavy chain, domain-1 (1);	0.224065	0.39475	N	0.001360	T	0.79003	0.4373	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.79617	-0.1729	10	0.72032	D	0.01	.	20.239	0.98366	0.0:0.0:1.0:0.0	.	389	Q9NYC9	DYH9_HUMAN	K	389	ENSP00000262442:E389K;ENSP00000414874:E389K	ENSP00000262442:E389K	E	+	1	0	DNAH9	11463638	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	8.901000	0.92560	2.884000	0.98904	0.655000	0.94253	GAA		0.438	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		Missense_Mutation
MYO19	80179	broad.mit.edu	37	17	34859787	34859788	+	Splice_Site	DNP	CA	CA	GT			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:34859787_34859788CA>GT	ENST00000431794.3	-	20	2499		c.e20+1		MYO19_ENST00000268852.9_Splice_Site	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX							cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CGAGCCCACTCACCGGATGGGG	0.619																																																0			17																																								31933901	SO:0001630	splice_region_variant	80179			BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.1977_1977delinsGT	17.37:g.34859787_34859788delinsGT			31933900	Q59GS4|Q9H5X2	Splice_Site_SNP	DNP	ENST00000431794.3	37	CCDS54112.1	DNP	29	Broad																																																																																				0.619	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109	Intron	Splice_Site_SNP
MYO19	80179	broad.mit.edu	37	17	34859790	34859790	+	Splice_Site	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:34859790C>A	ENST00000431794.3	-	20	2498	c.1976G>T	c.(1975-1977)cGg>cTg	p.R659L	MYO19_ENST00000268852.9_Splice_Site_p.R459L	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	659	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R659L(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GCCCACTCACCGGATGGGGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	17																																								31933903	SO:0001630	splice_region_variant	80179			BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.1976+1G>T	17.37:g.34859790C>A			31933903	Q59GS4|Q9H5X2	Missense_Mutation	SNP	ENST00000431794.3	37	CCDS54112.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.407009	0.96051	.	.	ENSG00000141140	ENST00000431794;ENST00000268852	D;D	0.97831	-4.56;-4.56	5.48	5.48	0.80851	Myosin head, motor domain (2);	.	.	.	.	D	0.99083	0.9685	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.99501	1.0953	8	.	.	.	.	17.8969	0.88891	0.0:1.0:0.0:0.0	.	659;459	Q96H55;Q96H55-4	MYO19_HUMAN;.	L	659;459	ENSP00000409936:R659L;ENSP00000268852:R459L	.	R	-	2	0	MYO19	31933903	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.012000	0.76366	2.576000	0.86940	0.563000	0.77884	CGG		0.627	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109	Missense_Mutation	Missense_Mutation
MYL4	4635	broad.mit.edu	37	17	45297309	45297309	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:45297309C>A	ENST00000354968.1	+	4	331	c.203C>A	c.(202-204)aCt>aAt	p.T68N	MYL4_ENST00000572316.1_Missense_Mutation_p.T68N|snoU13_ENST00000516279.1_RNA|MYL4_ENST00000393450.1_Missense_Mutation_p.T68N	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	68	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)	p.T68N(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						CGGACCCCGACTGGAGAGATG	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											66.0	66.0	66.0					17																	45297309		2203	4300	6503	42652308	SO:0001583	missense	4635				CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.203C>A	17.37:g.45297309C>A	ENSP00000347055:p.Thr68Asn		42652308	D3DXJ7|P11783	Missense_Mutation	SNP	ENST00000354968.1	37	CCDS11510.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243235	0.39697	.	.	ENSG00000198336	ENST00000354968;ENST00000393450	T;T	0.66995	-0.24;-0.24	5.65	2.46	0.29980	EF-hand-like domain (1);	0.692542	0.14274	N	0.329989	T	0.55401	0.1918	L	0.36672	1.1	0.32661	N	0.518085	B	0.12013	0.005	B	0.21151	0.033	T	0.58457	-0.7633	10	0.59425	D	0.04	-0.3004	9.2497	0.37547	0.0:0.6472:0.2761:0.0767	.	68	P12829	MYL4_HUMAN	N	68	ENSP00000347055:T68N;ENSP00000377096:T68N	ENSP00000347055:T68N	T	+	2	0	MYL4	42652308	0.000000	0.05858	0.133000	0.22050	0.846000	0.48090	1.167000	0.31847	0.370000	0.24538	0.561000	0.74099	ACT		0.592	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841		Missense_Mutation
SRSF1	6426	broad.mit.edu	37	17	56083294	56083294	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:56083294G>T	ENST00000258962.4	-	3	628	c.420C>A	c.(418-420)caC>caA	p.H140Q	SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000585096.1_Intron|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000584773.1_Missense_Mutation_p.H140Q|SRSF1_ENST00000582730.2_Missense_Mutation_p.H140Q	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	140	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.H140Q(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTTCACGCATGTGATCCTTTA	0.403																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	82.0	90.0					17																	56083294		2203	4300	6503	53438293	SO:0001583	missense	6426				CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.420C>A	17.37:g.56083294G>T	ENSP00000258962:p.His140Gln		53438293	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	ENST00000258962.4	37	CCDS11600.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661799	0.47572	.	.	ENSG00000136450	ENST00000258962	T	0.16324	2.35	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60667	-0.7218	10	0.87932	D	0	.	20.1057	0.97893	0.0:0.0:1.0:0.0	.	172;140	Q59FA2;Q07955	.;SRSF1_HUMAN	Q	140	ENSP00000258962:H140Q	ENSP00000258962:H140Q	H	-	3	2	SRSF1	53438293	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.338000	0.96553	2.827000	0.97445	0.650000	0.86243	CAC		0.403	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924		Missense_Mutation
CBX4	8535	broad.mit.edu	37	17	77808484	77808485	+	Missense_Mutation	DNP	CT	CT	GA			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:77808484_77808485CT>GA	ENST00000269397.4	-	5	1133_1134	c.956_957AG>TC	c.(955-957)aAG>aTC	p.K319I		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	319	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.K319I(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CCTCCACCTTCTTCTCCTCTGC	0.688											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17																																								75423080	SO:0001583	missense	8535			AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.956_957delinsGA	17.37:g.77808484_77808485delinsGA	ENSP00000269397:p.Lys319Ile	1178	75423079	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	DNP	ENST00000269397.4	37	CCDS32758.1	DNP	32	Broad																																																																																				0.688	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655		Missense_Mutation
MC4R	4160	broad.mit.edu	37	18	58039574	58039574	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr18:58039574G>T	ENST00000299766.3	-	1	427	c.9C>A	c.(7-9)aaC>aaA	p.N3K		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	3					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)	p.N3K(1)		endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GGTGGGTGGAGTTCACCATGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	18											36.0	36.0	36.0					18																	58039574		2199	4284	6483	56190554	SO:0001583	missense	4160			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.9C>A	18.37:g.58039574G>T	ENSP00000299766:p.Asn3Lys		56190554	B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	ENST00000299766.3	37	CCDS11976.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639039	0.29157	.	.	ENSG00000166603	ENST00000299766	T	0.56941	0.43	5.56	2.83	0.33086	.	0.096519	0.64402	D	0.000002	T	0.29355	0.0731	N	0.08118	0	0.35039	D	0.75951	B	0.06786	0.001	B	0.06405	0.002	T	0.17592	-1.0364	10	0.59425	D	0.04	.	7.6523	0.28354	0.3306:0.0:0.6694:0.0	.	3	P32245	MC4R_HUMAN	K	3	ENSP00000299766:N3K	ENSP00000299766:N3K	N	-	3	2	MC4R	56190554	1.000000	0.71417	0.675000	0.29917	0.674000	0.39518	1.644000	0.37228	0.406000	0.25560	0.655000	0.94253	AAC		0.522	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912		Missense_Mutation
SLC1A6	6511	broad.mit.edu	37	19	15079253	15079253	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr19:15079253A>C	ENST00000221742.3	-	3	417	c.410T>G	c.(409-411)gTg>gGg	p.V137G	SLC1A6_ENST00000600144.1_Missense_Mutation_p.V137G|SLC1A6_ENST00000430939.2_Intron|SLC1A6_ENST00000544886.2_Missense_Mutation_p.V137G|SLC1A6_ENST00000598504.1_Missense_Mutation_p.V137G	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	137					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GATGGTGGTCACCATGTAGTA	0.627																																																0			19											117.0	81.0	93.0					19																	15079253		2203	4300	6503	14940253	SO:0001583	missense	6511				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.410T>G	19.37:g.15079253A>C	ENSP00000221742:p.Val137Gly		14940253	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	a	10.18	1.280266	0.23392	.	.	ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610	T;T	0.60672	0.17;0.17	4.3	4.3	0.51218	.	0.445726	0.22748	N	0.056108	T	0.52108	0.1714	L	0.41124	1.26	0.58432	D	0.999993	P;P;B	0.47191	0.866;0.891;0.03	P;P;B	0.50537	0.593;0.643;0.014	T	0.46442	-0.9191	10	0.25751	T	0.34	-13.8076	6.3511	0.21377	0.8901:0.0:0.1099:0.0	.	137;138;137	Q8N753;Q59GB0;P48664	.;.;EAA4_HUMAN	G	137;137;138	ENSP00000221742:V137G;ENSP00000446175:V137G	ENSP00000221742:V137G	V	-	2	0	SLC1A6	14940253	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.309000	0.43699	1.804000	0.52760	0.375000	0.23000	GTG		0.627	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		Missense_Mutation
POLR2I	5438	broad.mit.edu	37	19	36605738	36605738	+	Nonsense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr19:36605738G>C	ENST00000221859.4	-	1	510	c.21C>G	c.(19-21)taC>taG	p.Y7*	TBCB_ENST00000589996.1_5'Flank|TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000585746.1_5'Flank|TBCB_ENST00000221855.3_5'Flank	NM_006233.4	NP_006224.1	P36954	RPB9_HUMAN	polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa	7					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|maintenance of transcriptional fidelity during DNA-templated transcription elongation from RNA polymerase II promoter (GO:0001193)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.Y7*(1)		kidney(1)|large_intestine(1)|ovary(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGCCCGGCTCGTAAGTCCCGT	0.687																																																1	Substitution - Nonsense(1)	ovary(1)	19											72.0	75.0	74.0					19																	36605738		2203	4300	6503	41297578	SO:0001587	stop_gained	5438				CCDS12487.1	19q13.12	2013-10-17	2002-08-29		ENSG00000105258	ENSG00000105258	2.7.7.6	"""RNA polymerase subunits"""	9196	protein-coding gene	gene with protein product		180662	"""polymerase (RNA) II (DNA directed) polypeptide I (14.5kD)"""			8034326	Standard	NM_006233		Approved	RPB9, hRPB14.5	uc002ode.3	P36954	OTTHUMG00000181749	ENST00000221859.4:c.21C>G	19.37:g.36605738G>C	ENSP00000221859:p.Tyr7*		41297578	B2R5J2|Q6NW05	Nonsense_Mutation	SNP	ENST00000221859.4	37	CCDS12487.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	38	6.718327	0.97788	.	.	ENSG00000105258	ENST00000221859	.	.	.	5.54	-0.521	0.11931	.	0.114843	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-4.9646	4.5084	0.11899	0.434:0.0:0.4187:0.1473	.	.	.	.	X	7	.	ENSP00000221859:Y7X	Y	-	3	2	POLR2I	41297578	1.000000	0.71417	0.998000	0.56505	0.454000	0.32378	0.773000	0.26661	0.109000	0.17891	-0.142000	0.14014	TAC		0.687	POLR2I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457442.1	NM_006233		Nonsense_Mutation
ZNF549	256051	broad.mit.edu	37	19	58046513	58046513	+	Splice_Site	SNP	G	G	T	rs367783563		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr19:58046513G>T	ENST00000376233.3	+	3	255	c.74G>T	c.(73-75)gGc>gTc	p.G25V	ZNF549_ENST00000240719.3_Splice_Site_p.G12V|ZNF549_ENST00000602149.1_Splice_Site_p.G25V|ZNF549_ENST00000594943.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G12V(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCATGCAGGGCCATGTGACC	0.517																																																1	Substitution - Missense(1)	ovary(1)	19						G	VAL/GLY,VAL/GLY	1,4405	2.1+/-5.4	0,1,2202	142.0	114.0	123.0		74,35	0.2	0.0	19		123	0,8600		0,0,4300	no	missense-near-splice,missense-near-splice	ZNF549	NM_001199295.1,NM_153263.2	109,109	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	benign,benign	25/641,12/628	58046513	1,13005	2203	4300	6503	62738325	SO:0001630	splice_region_variant	256051			AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.73-1G>T	19.37:g.58046513G>T			62738325	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	37	CCDS56106.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033014	0.54896	2.27E-4	0.0	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.00873	5.59;5.59	2.58	0.248	0.15526	Krueppel-associated box (1);	.	.	.	.	T	0.01387	0.0045	L	0.46614	1.455	0.09310	N	0.999999	B;P	0.44380	0.349;0.834	B;P	0.47430	0.092;0.547	T	0.48917	-0.8992	9	0.54805	T	0.06	.	2.507	0.04647	0.1736:0.0:0.5325:0.2939	.	25;12	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	V	12;25	ENSP00000240719:G12V;ENSP00000365407:G25V	ENSP00000240719:G12V	G	+	2	0	ZNF549	62738325	0.081000	0.21417	0.048000	0.18961	0.942000	0.58702	-0.272000	0.08560	0.367000	0.24454	0.655000	0.94253	GGC		0.517	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	Missense_Mutation	Missense_Mutation
TRAPPC12	51112	broad.mit.edu	37	2	3425739	3425739	+	Missense_Mutation	SNP	A	A	C	rs199781718		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:3425739A>C	ENST00000324266.5	+	4	1447	c.1252A>C	c.(1252-1254)Acc>Ccc	p.T418P	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.T418P	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	418					vesicle-mediated transport (GO:0016192)			p.T418P(2)									CGGGCTGCTCACCAGCCACAC	0.597																																																2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	2											31.0	29.0	30.0					2																	3425739		2203	4300	6503	3404746	SO:0001583	missense	51112			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1252A>C	2.37:g.3425739A>C	ENSP00000324318:p.Thr418Pro		3404746	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	37	CCDS1652.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918701	0.52546	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	T;T	0.51071	0.72;0.72	4.72	4.72	0.59763	.	0.115270	0.64402	D	0.000020	T	0.44603	0.1301	L	0.56769	1.78	0.58432	D	0.999998	P;B	0.37663	0.604;0.43	B;B	0.38803	0.282;0.076	T	0.47923	-0.9079	10	0.54805	T	0.06	.	9.7173	0.40283	0.9157:0.0:0.0843:0.0	.	401;418	E7ENL7;Q8WVT3	.;TPC12_HUMAN	P	418;401;418	ENSP00000371544:T418P;ENSP00000324318:T418P	ENSP00000303612:T401P	T	+	1	0	TTC15	3404746	1.000000	0.71417	0.968000	0.41197	0.968000	0.65278	4.643000	0.61390	1.975000	0.57531	0.460000	0.39030	ACC		0.597	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030		Missense_Mutation
NCOA1	8648	broad.mit.edu	37	2	24905856	24905856	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:24905856G>T	ENST00000406961.1	+	8	1043	c.391G>T	c.(391-393)Ggg>Tgg	p.G131W	NCOA1_ENST00000348332.3_Missense_Mutation_p.G131W|NCOA1_ENST00000288599.5_Missense_Mutation_p.G131W|NCOA1_ENST00000407230.1_5'UTR|NCOA1_ENST00000395856.3_Missense_Mutation_p.G131W|NCOA1_ENST00000538539.1_Missense_Mutation_p.G131W|NCOA1_ENST00000405141.1_Missense_Mutation_p.G131W			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	131	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.G131W(1)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAACTGTGAAGGGAGAATTGT	0.368			T	PAX3	alveolar rhadomyosarcoma																																		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	1	Substitution - Missense(1)	ovary(1)	2											100.0	98.0	99.0					2																	24905856		2203	4300	6503	24759360	SO:0001583	missense	8648			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.391G>T	2.37:g.24905856G>T	ENSP00000385216:p.Gly131Trp		24759360	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799202	0.90538	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35	5.55	5.55	0.83447	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.76118	0.3943	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85450	0.1160	10	0.87932	D	0	.	19.0969	0.93255	0.0:0.0:1.0:0.0	.	131;131;131	Q15788-3;Q15788;Q15788-2	.;NCOA1_HUMAN;.	W	131	ENSP00000385216:G131W;ENSP00000385097:G131W;ENSP00000444039:G131W;ENSP00000320940:G131W;ENSP00000288599:G131W;ENSP00000379197:G131W	ENSP00000288599:G131W	G	+	1	0	NCOA1	24759360	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.616000	0.88540	0.655000	0.94253	GGG		0.368	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		Missense_Mutation
ZNF513	130557	broad.mit.edu	37	2	27601003	27601003	+	Silent	SNP	T	T	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:27601003T>C	ENST00000323703.6	-	4	1233	c.1035A>G	c.(1033-1035)ggA>ggG	p.G345G	ZNF513_ENST00000407879.1_Silent_p.G283G|ZNF513_ENST00000491924.1_Intron	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	345					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.G345G(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCACCCCCTCCAGCCTCTC	0.667																																																1	Substitution - coding silent(1)	ovary(1)	2																																								27454507	SO:0001819	synonymous_variant	130557			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1035A>G	2.37:g.27601003T>C			27454507	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Silent	SNP	ENST00000323703.6	37	CCDS1751.1	SNP	54	Broad																																																																																				0.667	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631		Silent
APLF	200558	broad.mit.edu	37	2	68765169	68765169	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:68765169T>G	ENST00000303795.4	+	7	1141	c.970T>G	c.(970-972)Tgt>Ggt	p.C324G	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	324					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.C324G(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GGCAATGAGCTGTTCTGAAAA	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	87.0	89.0					2																	68765169		2203	4300	6503	68618673	SO:0001583	missense	200558			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.970T>G	2.37:g.68765169T>G	ENSP00000307004:p.Cys324Gly		68618673	A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	CCDS1888.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	.	5.485	0.274579	0.10403	.	.	ENSG00000169621	ENST00000303795	T	0.21932	1.98	5.19	-1.46	0.08800	.	0.905060	0.09655	N	0.773241	T	0.17704	0.0425	L	0.60455	1.87	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33701	-0.9858	10	0.25751	T	0.34	.	6.1184	0.20139	0.0:0.2574:0.4637:0.2789	.	324	Q8IW19	APLF_HUMAN	G	324	ENSP00000307004:C324G	ENSP00000307004:C324G	C	+	1	0	APLF	68618673	0.000000	0.05858	0.000000	0.03702	0.155000	0.21991	-0.158000	0.10070	-0.257000	0.09459	0.455000	0.32223	TGT		0.418	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545		Missense_Mutation
INPP4A	3631	broad.mit.edu	37	2	99170737	99170737	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:99170737C>G	ENST00000523221.1	+	14	1366	c.1366C>G	c.(1366-1368)Cgg>Ggg	p.R456G	INPP4A_ENST00000409540.3_Missense_Mutation_p.R456G|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000074304.5_Missense_Mutation_p.R456G|INPP4A_ENST00000409016.4_Missense_Mutation_p.R456G|INPP4A_ENST00000409851.3_Missense_Mutation_p.R451G|INPP4A_ENST00000545415.1_Missense_Mutation_p.R456G			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	456					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.R456G(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						CCTGCAGACACGGCAGCTGGT	0.617																																																1	Substitution - Missense(1)	ovary(1)	2											16.0	19.0	18.0					2																	99170737		2135	4246	6381	98537169	SO:0001583	missense	3631			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1366C>G	2.37:g.99170737C>G	ENSP00000427722:p.Arg456Gly		98537169	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	37	CCDS46369.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	19.22	3.785742	0.70337	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33	5.28	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	M	0.62723	1.935	0.58432	D	0.999998	D;D;D;D	0.89917	0.998;0.999;1.0;1.0	D;D;D;D	0.91635	0.994;0.996;0.999;0.999	T	0.54820	-0.8236	10	0.54805	T	0.06	-27.1116	13.4244	0.61018	0.2304:0.7696:0.0:0.0	.	456;456;456;451	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	G	456;451;456;456;456;456	ENSP00000386704:R456G;ENSP00000386777:R451G;ENSP00000074304:R456G;ENSP00000442149:R456G;ENSP00000387294:R456G;ENSP00000427722:R456G	ENSP00000074304:R456G	R	+	1	2	INPP4A	98537169	0.651000	0.27340	1.000000	0.80357	0.982000	0.71751	1.147000	0.31602	2.755000	0.94549	0.655000	0.94253	CGG		0.617	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566		Missense_Mutation
GCC2	9648	broad.mit.edu	37	2	109116045	109116045	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:109116045C>G	ENST00000309863.6	+	22	5533	c.4819C>G	c.(4819-4821)Caa>Gaa	p.Q1607E		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1607	Mediates interaction with RAB6A.|Mediates interaction with RAB9A.				Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.Q1607E(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GGAAAGGAATCAAGAGCGAGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											11.0	17.0	15.0					2																	109116045		1632	3359	4991	108482477	SO:0001583	missense	9648			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.4819C>G	2.37:g.109116045C>G	ENSP00000307939:p.Gln1607Glu		108482477	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	37	CCDS33268.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	20.0	3.929750	0.73327	.	.	ENSG00000135968	ENST00000309863	T	0.36699	1.24	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	M	0.70595	2.14	0.43399	D	0.995521	P	0.48911	0.917	P	0.48952	0.596	T	0.40590	-0.9555	10	0.17832	T	0.49	.	18.66	0.91469	0.0:1.0:0.0:0.0	.	1607	Q8IWJ2	GCC2_HUMAN	E	1607	ENSP00000307939:Q1607E	ENSP00000307939:Q1607E	Q	+	1	0	GCC2	108482477	1.000000	0.71417	0.974000	0.42286	0.988000	0.76386	7.156000	0.77453	2.399000	0.81585	0.550000	0.68814	CAA		0.398	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635		Missense_Mutation
GCA	25801	broad.mit.edu	37	2	163204169	163204169	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:163204169G>T	ENST00000437150.2	+	2	270	c.109G>T	c.(109-111)Gga>Tga	p.G37*	GCA_ENST00000473240.1_3'UTR|GCA_ENST00000233612.4_Nonsense_Mutation_p.G18*|GCA_ENST00000429691.2_Nonsense_Mutation_p.G18*	NM_012198.3	NP_036330.1	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	37					membrane fusion (GO:0061025)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G37*(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	9						ACTCCTCGATGGATACTCTGG	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	2											93.0	85.0	87.0					2																	163204169		2203	4300	6503	162912415	SO:0001587	stop_gained	25801			M81637	CCDS2218.1	2q24.2	2013-01-10	2001-11-28		ENSG00000115271	ENSG00000115271		"""EF-hand domain containing"""	15990	protein-coding gene	gene with protein product		607030	"""grancalcin, EF-hand calcium-binding protein"""			1737748, 1530588, 12804766	Standard	NM_012198		Approved	GCL	uc002ucg.3	P28676	OTTHUMG00000132057	ENST00000437150.2:c.109G>T	2.37:g.163204169G>T	ENSP00000394842:p.Gly37*		162912415	B2R5X3|Q53TB5|Q59EP3	Nonsense_Mutation	SNP	ENST00000437150.2	37	CCDS2218.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514592	0.85389	.	.	ENSG00000115271	ENST00000446271;ENST00000429691;ENST00000437150;ENST00000453113;ENST00000233612	.	.	.	4.99	4.12	0.48240	.	10.390100	0.05093	U	0.485609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	12.874	0.57980	0.0807:0.0:0.9193:0.0	.	.	.	.	X	63;18;37;18;18	.	ENSP00000233612:G18X	G	+	1	0	GCA	162912415	1.000000	0.71417	0.043000	0.18650	0.002000	0.02628	3.760000	0.55235	1.250000	0.43966	-0.186000	0.12905	GGA		0.463	GCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255080.3	NM_012198		Nonsense_Mutation
PTPRN	5798	broad.mit.edu	37	2	220166422	220166422	+	Silent	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr2:220166422C>A	ENST00000295718.2	-	7	1254	c.1014G>T	c.(1012-1014)ctG>ctT	p.L338L	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.L248L|PTPRN_ENST00000409251.3_Silent_p.L338L	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	338					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.L338L(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCACAGCGGCCAGCCTCTGCA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	2											20.0	24.0	23.0					2																	220166422		2203	4299	6502	219874666	SO:0001819	synonymous_variant	5798				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1014G>T	2.37:g.220166422C>A			219874666	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	CCDS2440.1	SNP	21	Broad																																																																																				0.622	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			Silent
SOGA1	140710	broad.mit.edu	37	20	35467706	35467706	+	Missense_Mutation	SNP	G	G	C	rs564729213		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr20:35467706G>C	ENST00000357779.3	-	2	438	c.112C>G	c.(112-114)Cgc>Ggc	p.R38G	SOGA1_ENST00000279034.6_Missense_Mutation_p.R38G|SOGA1_ENST00000237536.4_Missense_Mutation_p.R276G			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	38					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R276G(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TCGGCTTTGCGCAGCCGGTAC	0.657																																																1	Substitution - Missense(1)	ovary(1)	20																																								34901120	SO:0001583	missense	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.112C>G	20.37:g.35467706G>C	ENSP00000350424:p.Arg38Gly		34901120	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227608	0.58668	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000357779	T;T;T	0.36699	1.33;1.24;1.31	4.86	4.86	0.63082	.	0.069021	0.50627	D	0.000102	T	0.58366	0.2117	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61327	-0.7085	10	0.66056	D	0.02	-22.0903	12.063	0.53572	0.0:0.0:0.8276:0.1724	.	38	O94964-4	.	G	276;38;38	ENSP00000237536:R276G;ENSP00000279034:R38G;ENSP00000350424:R38G	ENSP00000237536:R276G	R	-	1	0	KIAA0889	34901120	0.986000	0.35501	1.000000	0.80357	0.663000	0.39108	1.814000	0.38972	2.517000	0.84864	0.491000	0.48974	CGC		0.657	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181		Missense_Mutation
CSE1L	1434	broad.mit.edu	37	20	47705871	47705871	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr20:47705871G>T	ENST00000262982.2	+	18	2032	c.1909G>T	c.(1909-1911)Gtt>Ttt	p.V637F	CSE1L_ENST00000542325.1_Missense_Mutation_p.V420F|CSE1L_ENST00000396192.3_Missense_Mutation_p.V581F	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	637					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)	p.V637F(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CCCTGCTGCTGTTGTAAATTT	0.318																																																1	Substitution - Missense(1)	ovary(1)	20											134.0	127.0	129.0					20																	47705871		2202	4299	6501	47139278	SO:0001583	missense	1434			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1909G>T	20.37:g.47705871G>T	ENSP00000262982:p.Val637Phe		47139278	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512572	0.85389	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.55930	0.49;0.49;0.49	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);CAS/CSE, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68668	0.3026	M	0.73962	2.25	0.80722	D	1	P;P;B;B;D	0.71674	0.553;0.83;0.022;0.403;0.998	P;P;B;B;D	0.71414	0.503;0.724;0.032;0.356;0.973	T	0.63765	-0.6563	10	0.15952	T	0.53	-20.7495	14.1985	0.65686	0.0713:0.0:0.9287:0.0	.	326;420;581;581;637	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	F	235;637;420;581	ENSP00000262982:V637F;ENSP00000446477:V420F;ENSP00000379495:V581F	ENSP00000262982:V637F	V	+	1	0	CSE1L	47139278	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.658000	0.83755	2.722000	0.93159	0.655000	0.94253	GTT		0.318	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316		Missense_Mutation
SALL4	57167	broad.mit.edu	37	20	50406711	50406711	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr20:50406711C>T	ENST00000217086.4	-	2	2422	c.2311G>A	c.(2311-2313)Gag>Aag	p.E771K	SALL4_ENST00000395997.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	771					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E771K(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTCTGATACTCCTGGTCTCCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											86.0	69.0	75.0					20																	50406711		2203	4300	6503	49840118	SO:0001583	missense	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2311G>A	20.37:g.50406711C>T	ENSP00000217086:p.Glu771Lys		49840118	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327386	0.81690	.	.	ENSG00000101115	ENST00000217086	T	0.09911	2.93	5.61	5.61	0.85477	.	0.000000	0.44483	D	0.000456	T	0.30885	0.0779	M	0.80616	2.505	0.80722	D	1	D	0.59767	0.986	P	0.53954	0.738	T	0.03684	-1.1013	10	0.59425	D	0.04	-40.3799	19.6259	0.95678	0.0:1.0:0.0:0.0	.	771	Q9UJQ4	SALL4_HUMAN	K	771	ENSP00000217086:E771K	ENSP00000217086:E771K	E	-	1	0	SALL4	49840118	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.047000	0.71038	2.619000	0.88677	0.655000	0.94253	GAG		0.562	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			Missense_Mutation
LIPI	149998	broad.mit.edu	37	21	15538721	15538721	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr21:15538721C>T	ENST00000536861.1	-	5	694	c.695G>A	c.(694-696)gGa>gAa	p.G232E	LIPI_ENST00000344577.2_Missense_Mutation_p.G253E			Q6XZB0	LIPI_HUMAN	lipase, member I	232					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.G253E(2)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TTGTTTATTTCCTCCATTTGG	0.343																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	21											130.0	127.0	128.0					21																	15538721		2203	4300	6503	14460592	SO:0001583	missense	149998			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.695G>A	21.37:g.15538721C>T	ENSP00000440381:p.Gly232Glu		14460592	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753898	0.69648	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.92858	-3.12;-3.12	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.97306	0.9119	H	0.95437	3.67	0.47245	D	0.999367	D	0.89917	1.0	D	0.97110	1.0	D	0.98190	1.0462	10	0.87932	D	0	.	16.4355	0.83873	0.0:1.0:0.0:0.0	.	253	Q6XZB0-2	.	E	253;232	ENSP00000343331:G253E;ENSP00000440381:G232E	ENSP00000343331:G253E	G	-	2	0	LIPI	14460592	0.999000	0.42202	0.971000	0.41717	0.688000	0.40055	5.203000	0.65174	2.686000	0.91538	0.585000	0.79938	GGA		0.343	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		Missense_Mutation
TRIOBP	11078	broad.mit.edu	37	22	38151168	38151168	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr22:38151168G>C	ENST00000406386.3	+	14	5803	c.5548G>C	c.(5548-5550)Gtg>Ctg	p.V1850L	TRIOBP_ENST00000403663.2_Missense_Mutation_p.V137L|TRIOBP_ENST00000407319.2_Missense_Mutation_p.V137L	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1850	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.V137L(1)|p.V1850L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TGAGTACGCGGTGCAGCGCAA	0.627																																																2	Substitution - Missense(2)	ovary(2)	22											65.0	49.0	54.0					22																	38151168		2203	4300	6503	36481114	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5548G>C	22.37:g.38151168G>C	ENSP00000384312:p.Val1850Leu		36481114	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.202762|5.202762	0.94997|0.94997	.|.	.|.	ENSG00000100106|ENSG00000100106	ENST00000428075|ENST00000406386;ENST00000407319;ENST00000403663;ENST00000418339;ENST00000452519;ENST00000417857	.|D;D;D;D;D;D	.|0.92647	.|-3.08;-3.08;-3.08;-3.08;-3.08;-3.08	4.77|4.77	4.77|4.77	0.60923|0.60923	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|.	.|.	.|.	.|.	D|D	0.95294|0.95294	0.8473|0.8473	M|M	0.62723|0.62723	1.935|1.935	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.71674	.|0.997;0.998;0.997	.|D;D;D	.|0.81914	.|0.991;0.995;0.992	D|D	0.95847|0.95847	0.8871|0.8871	5|9	.|0.72032	.|D	.|0.01	.|.	17.8134|17.8134	0.88623|0.88623	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|137;137;1850	.|F8W6V6;F2Z2W0;Q9H2D6	.|.;.;TARA_HUMAN	A|L	90|1850;137;137;96;66;66	.|ENSP00000384312:V1850L;ENSP00000383913:V137L;ENSP00000386026:V137L;ENSP00000396946:V96L;ENSP00000407542:V66L;ENSP00000387881:V66L	.|ENSP00000386026:V137L	G|V	+|+	2|1	0|0	TRIOBP|TRIOBP	36481114|36481114	1.000000|1.000000	0.71417|0.71417	0.918000|0.918000	0.36340|0.36340	0.959000|0.959000	0.62525|0.62525	9.363000|9.363000	0.97131|0.97131	2.182000|2.182000	0.69389|0.69389	0.655000|0.655000	0.94253|0.94253	GGT|GTG		0.627	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			Missense_Mutation
GOLGA4	2803	broad.mit.edu	37	3	37365320	37365320	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:37365320A>C	ENST00000361924.2	+	14	2317	c.1943A>C	c.(1942-1944)aAg>aCg	p.K648T	GOLGA4_ENST00000356847.4_Missense_Mutation_p.K670T|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	648	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.K648T(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CTTAGGGAAAAGTGTGAACAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											56.0	57.0	57.0					3																	37365320		2202	4300	6502	37340324	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1943A>C	3.37:g.37365320A>C	ENSP00000354486:p.Lys648Thr		37340324	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	12.64	1.998131	0.35226	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000429018;ENST00000437131	T;T;T	0.29142	1.59;1.58;1.58	4.96	3.8	0.43715	.	0.199937	0.24876	N	0.034887	T	0.42607	0.1210	M	0.79475	2.455	0.28587	N	0.909853	P;P;P;P	0.50369	0.934;0.934;0.934;0.679	P;P;P;B	0.50490	0.642;0.642;0.642;0.311	T	0.40701	-0.9549	10	0.52906	T	0.07	.	8.7297	0.34491	0.8135:0.0:0.0699:0.1167	.	648;648;670;648	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	T	648;670;209;519	ENSP00000354486:K648T;ENSP00000349305:K670T;ENSP00000405842:K519T	ENSP00000349305:K670T	K	+	2	0	GOLGA4	37340324	0.993000	0.37304	0.063000	0.19743	0.325000	0.28411	2.269000	0.43346	0.326000	0.23384	-1.139000	0.01908	AAG		0.363	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078		Missense_Mutation
DNAH1	25981	broad.mit.edu	37	3	52386009	52386009	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:52386009C>A	ENST00000420323.2	+	17	3022	c.2761C>A	c.(2761-2763)Ctt>Att	p.L921I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	921	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L921I(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTCTAAGATCCTTGGGCAGAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											35.0	36.0	35.0					3																	52386009		2000	4178	6178	52361049	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.2761C>A	3.37:g.52386009C>A	ENSP00000401514:p.Leu921Ile		52361049	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719019	0.30503	.	.	ENSG00000114841	ENST00000420323	T	0.24350	1.86	5.67	3.79	0.43588	.	0.320487	0.22755	N	0.056029	T	0.15046	0.0363	L	0.29908	0.895	0.19945	N	0.999942	B;B	0.26120	0.04;0.142	B;B	0.28638	0.022;0.092	T	0.08146	-1.0736	10	0.37606	T	0.19	.	2.0376	0.03543	0.2499:0.3754:0.2427:0.132	.	921;921	C9JXH6;Q9P2D7-3	.;.	I	921	ENSP00000401514:L921I	ENSP00000401514:L921I	L	+	1	0	DNAH1	52361049	0.138000	0.22547	0.997000	0.53966	0.982000	0.71751	0.028000	0.13644	2.678000	0.91216	0.655000	0.94253	CTT		0.542	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		Missense_Mutation
STAB1	23166	broad.mit.edu	37	3	52538804	52538804	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:52538804A>G	ENST00000321725.6	+	12	1365	c.1289A>G	c.(1288-1290)cAc>cGc	p.H430R		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	430	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.H430R(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCAGGGCAGCACATCCTGGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	88.0	89.0					3																	52538804		2203	4300	6503	52513844	SO:0001583	missense	23166			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1289A>G	3.37:g.52538804A>G	ENSP00000312946:p.His430Arg		52513844	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230785	0.58777	.	.	ENSG00000010327	ENST00000321725	D	0.90504	-2.68	4.6	4.6	0.57074	FAS1 domain (4);	0.000000	0.85682	D	0.000000	D	0.93851	0.8033	M	0.73598	2.24	0.38125	D	0.93798	D;D	0.89917	0.997;1.0	D;D	0.85130	0.943;0.997	D	0.93169	0.6564	10	0.28530	T	0.3	.	10.9442	0.47292	1.0:0.0:0.0:0.0	.	430;430	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	R	430	ENSP00000312946:H430R	ENSP00000312946:H430R	H	+	2	0	STAB1	52513844	0.963000	0.33076	0.988000	0.46212	0.963000	0.63663	2.031000	0.41117	2.035000	0.60131	0.459000	0.35465	CAC		0.607	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136		Missense_Mutation
CMSS1	84319	broad.mit.edu	37	3	99881221	99881221	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:99881221G>C	ENST00000421999.2	+	4	446	c.300G>C	c.(298-300)aaG>aaC	p.K100N	CMSS1_ENST00000489081.1_Missense_Mutation_p.K82N	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	100							poly(A) RNA binding (GO:0044822)	p.K100N(1)									AGCTGATGAAGGACTATTATA	0.378																																																1	Substitution - Missense(1)	ovary(1)	3											89.0	94.0	92.0					3																	99881221		2203	4300	6503	101363911	SO:0001583	missense	84319				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.300G>C	3.37:g.99881221G>C	ENSP00000410396:p.Lys100Asn		101363911	A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	ENST00000421999.2	37	CCDS2935.1	SNP	35	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.458|6.458	0.452646|0.452646	0.12283|0.12283	.|.	.|.	ENSG00000184220|ENSG00000184220	ENST00000497345|ENST00000421999;ENST00000489081;ENST00000478909	.|T;T;T	.|0.29397	.|1.57;1.57;1.57	5.83|5.83	-1.57|-1.57	0.08506|0.08506	.|.	.|0.746562	.|0.13895	.|N	.|0.355306	T|T	0.12220|0.12220	0.0297|0.0297	N|N	0.11560|0.11560	0.145|0.145	0.09310|0.09310	N|N	0.999993|0.999993	.|B	.|0.11235	.|0.004	.|B	.|0.12156	.|0.007	T|T	0.28808|0.28808	-1.0032|-1.0032	5|9	.|.	.|.	.|.	.|.	5.0759|5.0759	0.14630|0.14630	0.4829:0.0:0.2805:0.2366|0.4829:0.0:0.2805:0.2366	.|.	.|100	.|Q9BQ75	.|CC026_HUMAN	R|N	9|100;82;56	.|ENSP00000410396:K100N;ENSP00000419161:K82N;ENSP00000417293:K56N	.|.	G|K	+|+	1|3	0|2	C3orf26|C3orf26	101363911|101363911	0.550000|0.550000	0.26489|0.26489	0.940000|0.940000	0.37924|0.37924	0.786000|0.786000	0.44442|0.44442	0.099000|0.099000	0.15210|0.15210	-0.372000|-0.372000	0.07992|0.07992	-0.136000|-0.136000	0.14681|0.14681	GGA|AAG		0.378	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359		Missense_Mutation
RARRES1	5918	broad.mit.edu	37	3	158428697	158428697	+	Missense_Mutation	SNP	C	C	T	rs375257995		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:158428697C>T	ENST00000237696.5	-	3	645	c.365G>A	c.(364-366)cGt>cAt	p.R122H	RARRES1_ENST00000479756.1_Missense_Mutation_p.R122H|RARRES1_ENST00000498640.1_Intron	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	122					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R122H(1)		NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	TTTCCCCAAACGTCCCTCACC	0.438																																																1	Substitution - Missense(1)	ovary(1)	3						C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	179.0	164.0	169.0		365,365	-5.7	0.0	3		169	0,8600		0,0,4300	no	missense,missense	RARRES1	NM_002888.2,NM_206963.1	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	122/229,122/295	158428697	1,13005	2203	4300	6503	159911391	SO:0001583	missense	5918			U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.365G>A	3.37:g.158428697C>T	ENSP00000237696:p.Arg122His		159911391	Q8N1D7	Missense_Mutation	SNP	ENST00000237696.5	37	CCDS3184.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	8.767	0.924990	0.18056	2.27E-4	0.0	ENSG00000118849	ENST00000237696;ENST00000479756	T;T	0.24908	1.83;1.83	5.7	-5.71	0.02413	.	0.798454	0.10730	N	0.640701	T	0.12561	0.0305	N	0.11560	0.145	0.09310	N	1	B;B	0.18461	0.007;0.028	B;B	0.10450	0.003;0.005	T	0.18304	-1.0341	10	0.31617	T	0.26	7.7519	14.6652	0.68901	0.0:0.1925:0.0:0.8075	.	122;122	P49788-2;P49788	.;TIG1_HUMAN	H	122	ENSP00000237696:R122H;ENSP00000418556:R122H	ENSP00000237696:R122H	R	-	2	0	RARRES1	159911391	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.900000	0.00339	-1.368000	0.02149	-0.137000	0.14449	CGT		0.438	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352358.1			Missense_Mutation
SI	6476	broad.mit.edu	37	3	164735578	164735578	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:164735578G>T	ENST00000264382.3	-	30	3666	c.3604C>A	c.(3604-3606)Cca>Aca	p.P1202T		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1202	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.P1202T(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GCAACTTCTGGAGTTGGGCCC	0.328										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											59.0	57.0	57.0					3																	164735578		2203	4300	6503	166218272	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3604C>A	3.37:g.164735578G>T	ENSP00000264382:p.Pro1202Thr		166218272	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142279	0.77775	.	.	ENSG00000090402	ENST00000264382	D	0.95272	-3.66	4.91	4.91	0.64330	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.97942	0.9323	M	0.92459	3.31	0.58432	D	0.99999	D	0.89917	1.0	D	0.87578	0.998	D	0.98965	1.0799	10	0.87932	D	0	.	18.2831	0.90104	0.0:0.0:1.0:0.0	.	1202	P14410	SUIS_HUMAN	T	1202	ENSP00000264382:P1202T	ENSP00000264382:P1202T	P	-	1	0	SI	166218272	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	8.171000	0.89675	2.540000	0.85666	0.491000	0.48974	CCA		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
SAMD7	344658	broad.mit.edu	37	3	169639085	169639085	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:169639085A>G	ENST00000428432.2	+	4	559	c.170A>G	c.(169-171)aAc>aGc	p.N57S	SAMD7_ENST00000335556.3_Missense_Mutation_p.N57S	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	57								p.N57S(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GTTCTACCAAACACAAATATG	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											151.0	130.0	137.0					3																	169639085		2203	4300	6503	171121779	SO:0001583	missense	344658			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.170A>G	3.37:g.169639085A>G	ENSP00000391299:p.Asn57Ser		171121779		Missense_Mutation	SNP	ENST00000428432.2	37	CCDS3209.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	5.703	0.314302	0.10789	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.43688	0.94;0.94	5.85	1.79	0.24919	.	0.052050	0.85682	D	0.000000	T	0.26340	0.0643	L	0.33485	1.01	0.09310	N	1	B	0.29909	0.261	B	0.28553	0.091	T	0.12116	-1.0560	10	0.25751	T	0.34	-18.5889	7.0493	0.25063	0.6477:0.2794:0.073:0.0	.	57	Q7Z3H4	SAMD7_HUMAN	S	57	ENSP00000391299:N57S;ENSP00000334668:N57S	ENSP00000334668:N57S	N	+	2	0	SAMD7	171121779	0.276000	0.24211	0.629000	0.29254	0.065000	0.16274	1.364000	0.34171	0.517000	0.28361	-0.313000	0.08912	AAC		0.438	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610		Missense_Mutation
TNIK	23043	broad.mit.edu	37	3	170802090	170802090	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr3:170802090C>T	ENST00000436636.2	-	26	3367	c.3023G>A	c.(3022-3024)aGg>aAg	p.R1008K	TNIK_ENST00000341852.6_Missense_Mutation_p.R924K|TNIK_ENST00000460047.1_Missense_Mutation_p.R945K|TNIK_ENST00000538048.1_Missense_Mutation_p.R960K|TNIK_ENST00000470834.1_Missense_Mutation_p.R971K|TNIK_ENST00000357327.5_Missense_Mutation_p.R979K|TNIK_ENST00000369326.5_Missense_Mutation_p.R986K|TNIK_ENST00000488470.1_Missense_Mutation_p.R953K|TNIK_ENST00000284483.8_Missense_Mutation_p.R1000K|TNIK_ENST00000475336.1_Missense_Mutation_p.R916K	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	1008	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R1008K(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CTGTTCTTGCCTAAGAAGTTC	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											140.0	136.0	137.0					3																	170802090		1851	4101	5952	172284784	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.3023G>A	3.37:g.170802090C>T	ENSP00000399511:p.Arg1008Lys		172284784	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375498	0.61735	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.73363	-0.74;-0.71;-0.73;-0.74;-0.74;-0.74;-0.72;-0.74;-0.74;-0.72	5.95	5.08	0.68730	.	0.134058	0.64402	N	0.000003	T	0.71160	0.3307	L	0.56769	1.78	0.53005	D	0.999967	B;B;B;B;B;B;B;B	0.27679	0.0;0.002;0.0;0.0;0.148;0.002;0.0;0.185	B;B;B;B;B;B;B;B	0.26864	0.001;0.008;0.001;0.001;0.062;0.008;0.001;0.074	T	0.68580	-0.5371	10	0.39692	T	0.17	.	15.0248	0.71659	0.0:0.9321:0.0:0.0679	.	916;971;945;924;1000;979;953;1008	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	K	1008;986;960;924;1000;916;979;945;953;971	ENSP00000399511:R1008K;ENSP00000358332:R986K;ENSP00000443278:R960K;ENSP00000345352:R924K;ENSP00000284483:R1000K;ENSP00000418156:R916K;ENSP00000349880:R979K;ENSP00000418916:R945K;ENSP00000418378:R953K;ENSP00000419990:R971K	ENSP00000284483:R1000K	R	-	2	0	TNIK	172284784	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.641000	0.54360	1.518000	0.48934	0.650000	0.86243	AGG		0.398	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796		Missense_Mutation
TMEM156	80008	broad.mit.edu	37	4	38995464	38995464	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr4:38995464C>A	ENST00000381938.3	-	3	620	c.513G>T	c.(511-513)atG>atT	p.M171I		NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	171						integral component of membrane (GO:0016021)		p.M171I(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						GCTCATCCTCCATGATTGTTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											247.0	216.0	227.0					4																	38995464		2203	4300	6503	38671859	SO:0001583	missense	80008			AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.513G>T	4.37:g.38995464C>A	ENSP00000371364:p.Met171Ile		38671859	Q9H5N9	Missense_Mutation	SNP	ENST00000381938.3	37	CCDS3448.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333501	0.24167	.	.	ENSG00000121895	ENST00000381938;ENST00000344606	T;T	0.22134	1.97;1.97	5.41	-5.81	0.02340	.	1.918220	0.02105	N	0.054264	T	0.12860	0.0312	L	0.38175	1.15	0.09310	N	1	B	0.18610	0.029	B	0.15870	0.014	T	0.14090	-1.0485	10	0.29301	T	0.29	6.0746	0.8399	0.01148	0.3167:0.2658:0.0978:0.3198	.	171	Q8N614	TM156_HUMAN	I	171;143	ENSP00000371364:M171I;ENSP00000343758:M143I	ENSP00000343758:M143I	M	-	3	0	TMEM156	38671859	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-3.613000	0.00414	-1.124000	0.02936	0.655000	0.94253	ATG		0.403	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250435.3	NM_024943		Missense_Mutation
NKX6-1	4825	broad.mit.edu	37	4	85414555	85414555	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr4:85414555C>A	ENST00000295886.4	-	3	1212	c.991G>T	c.(991-993)Gat>Tat	p.D331Y	NKX6-1_ENST00000515820.2_Missense_Mutation_p.D57Y	NM_006168.2	NP_006159.2	P78426	NKX61_HUMAN	NK6 homeobox 1	331	Involved in DNA-binding. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|cellular response to peptide hormone stimulus (GO:0071375)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|negative regulation of glial cell differentiation (GO:0045686)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|organ morphogenesis (GO:0009887)|pancreas development (GO:0031016)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of insulin secretion (GO:0032024)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of axon extension (GO:0030516)|regulation of neuron migration (GO:2001222)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to drug (GO:0042493)|response to nicotine (GO:0035094)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D331Y(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	15		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.0013)		GAGTTGGGATCCAGAGGCTTA	0.622																																																1	Substitution - Missense(1)	ovary(1)	4											148.0	140.0	143.0					4																	85414555		2203	4300	6503	85633579	SO:0001583	missense	4825			AH007313	CCDS3607.1	4q21.33	2012-03-09	2007-07-09	2002-10-04	ENSG00000163623	ENSG00000163623		"""Homeoboxes / ANTP class : NKL subclass"""	7839	protein-coding gene	gene with protein product		602563	"""NK homeobox (Drosophila), family 6, A"", ""NK6 transcription factor related, locus 1 (Drosophila)"""	NKX6A		9119408	Standard	NM_006168		Approved	Nkx6.1	uc003hpa.1	P78426	OTTHUMG00000130426	ENST00000295886.4:c.991G>T	4.37:g.85414555C>A	ENSP00000295886:p.Asp331Tyr		85633579		Missense_Mutation	SNP	ENST00000295886.4	37	CCDS3607.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708231	0.30322	.	.	ENSG00000163623	ENST00000295886;ENST00000515820	T	0.58210	0.35	4.51	2.75	0.32379	.	0.111909	0.64402	D	0.000018	T	0.49898	0.1584	M	0.77313	2.365	0.80722	D	1	B	0.25235	0.121	B	0.15484	0.013	T	0.50890	-0.8774	10	0.87932	D	0	-14.6218	8.5077	0.33197	0.1534:0.7653:0.0:0.0813	.	331	P78426	NKX61_HUMAN	Y	331;57	ENSP00000295886:D331Y	ENSP00000295886:D331Y	D	-	1	0	NKX6-1	85633579	1.000000	0.71417	0.997000	0.53966	0.057000	0.15508	7.466000	0.80914	0.514000	0.28300	-0.518000	0.04402	GAT		0.622	NKX6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252814.2	NM_006168		Missense_Mutation
PALLD	23022	broad.mit.edu	37	4	169819673	169819673	+	Silent	SNP	A	A	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr4:169819673A>G	ENST00000505667.1	+	14	2453	c.2280A>G	c.(2278-2280)agA>agG	p.R760R	PALLD_ENST00000507735.1_Silent_p.R256R|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000261509.6_Silent_p.R743R|PALLD_ENST00000512127.1_Silent_p.R361R|PALLD_ENST00000335742.7_Silent_p.R585R			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	967	Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.R743R(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GTGAACAGAGACTCATCAGTG	0.458									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)											1	Substitution - coding silent(1)	ovary(1)	4											83.0	80.0	81.0					4																	169819673		2203	4300	6503	170056248	SO:0001819	synonymous_variant	23022	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2280A>G	4.37:g.169819673A>G			170056248	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	CCDS54818.1	SNP	10	Broad																																																																																				0.458	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		Silent
IRX4	50805	broad.mit.edu	37	5	1879925	1879925	+	Silent	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr5:1879925G>C	ENST00000505790.1	-	5	885	c.429C>G	c.(427-429)ggC>ggG	p.G143G	IRX4_ENST00000231357.2_Silent_p.G143G|IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000513692.1_Silent_p.G143G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	143					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G143G(1)		endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		TGCGCCGCGTGCCGCTGTCCA	0.667																																																1	Substitution - coding silent(1)	ovary(1)	5											99.0	78.0	85.0					5																	1879925		2203	4300	6503	1932925	SO:0001819	synonymous_variant	50805			AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.429C>G	5.37:g.1879925G>C			1932925	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1	SNP	46	Broad																																																																																				0.667	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358		Silent
NNT	23530	broad.mit.edu	37	5	43675734	43675734	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr5:43675734A>T	ENST00000264663.5	+	18	2977	c.2756A>T	c.(2755-2757)gAc>gTc	p.D919V	NNT_ENST00000344920.4_Missense_Mutation_p.D919V|NNT_ENST00000512996.2_Missense_Mutation_p.D788V	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	919					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.D919V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					AATGCAATTGACATGATTCGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	5											83.0	78.0	80.0					5																	43675734		2203	4300	6503	43711491	SO:0001583	missense	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2756A>T	5.37:g.43675734A>T	ENSP00000264663:p.Asp919Val		43711491	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	25.8	4.670232	0.88348	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.91686	-2.89;-2.89;-2.89	5.74	5.74	0.90152	.	0.189899	0.64402	D	0.000019	D	0.92522	0.7625	L	0.48174	1.505	0.80722	D	1	B	0.29988	0.264	B	0.43331	0.416	D	0.91903	0.5533	10	0.72032	D	0.01	-13.6024	16.3426	0.83092	1.0:0.0:0.0:0.0	.	919	Q13423	NNTM_HUMAN	V	434;919;919;788	ENSP00000264663:D919V;ENSP00000343873:D919V;ENSP00000426343:D788V	ENSP00000264663:D919V	D	+	2	0	NNT	43711491	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	8.858000	0.92256	2.317000	0.78254	0.460000	0.39030	GAC		0.353	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		Missense_Mutation
NDST1	3340	broad.mit.edu	37	5	149907644	149907644	+	Silent	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr5:149907644C>G	ENST00000261797.6	+	3	1294	c.792C>G	c.(790-792)gcC>gcG	p.A264A	NDST1_ENST00000523767.1_Silent_p.A264A	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	264	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A264A(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTGCACGCCACTGTGGTCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	5											64.0	50.0	55.0					5																	149907644		2203	4300	6503	149887837	SO:0001819	synonymous_variant	3340			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.792C>G	5.37:g.149907644C>G			149887837	Q96E57	Silent	SNP	ENST00000261797.6	37	CCDS34277.1	SNP	21	Broad																																																																																				0.627	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543		Silent
ZKSCAN8	7745	broad.mit.edu	37	6	28116415	28116415	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:28116415A>G	ENST00000330236.6	+	2	414	c.230A>G	c.(229-231)cAt>cGt	p.H77R	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.H77R	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	77	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCCCTTTGCCATCAGTGGCTG	0.567																																																0			6											82.0	76.0	78.0					6																	28116415		2203	4300	6503	28224394	SO:0001583	missense	7745				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.230A>G	6.37:g.28116415A>G	ENSP00000332750:p.His77Arg		28224394	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	37	CCDS4645.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	10.23	1.293933	0.23564	.	.	ENSG00000198315	ENST00000330236;ENST00000457389;ENST00000536028	T;T;T	0.04917	3.53;3.53;3.53	5.13	5.13	0.70059	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.52532	D	0.000075	T	0.02494	0.0076	N	0.04787	-0.16	0.34085	D	0.659986	D	0.62365	0.991	D	0.78314	0.991	T	0.36939	-0.9727	10	0.02654	T	1	.	8.1758	0.31281	0.9089:0.0:0.0911:0.0	.	77	Q15776	ZN192_HUMAN	R	77	ENSP00000332750:H77R;ENSP00000402948:H77R;ENSP00000439117:H77R	ENSP00000332750:H77R	H	+	2	0	ZNF192	28224394	0.892000	0.30473	1.000000	0.80357	0.995000	0.86356	0.881000	0.28173	2.237000	0.73441	0.460000	0.39030	CAT		0.567	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2			Missense_Mutation
FGD2	221472	broad.mit.edu	37	6	36988318	36988318	+	Splice_Site	SNP	T	T	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:36988318T>G	ENST00000274963.8	+	10	1295	c.1124T>G	c.(1123-1125)gTg>gGg	p.V375G		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	375	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.V375G(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						TCTTGGCAGGTGCGGGAGCTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	6																																								37096296	SO:0001630	splice_region_variant	221472			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1123-1T>G	6.37:g.36988318T>G			37096296	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735168	0.69189	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	D	0.91068	-2.78	5.46	4.28	0.50868	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.38436	N	0.001686	D	0.94006	0.8080	M	0.90425	3.115	0.80722	D	1	D	0.56968	0.978	P	0.60473	0.875	D	0.94515	0.7722	10	0.87932	D	0	-4.5654	12.4227	0.55529	0.0:0.0:0.1405:0.8595	.	375	Q7Z6J4	FGD2_HUMAN	G	375;3	ENSP00000274963:V375G	ENSP00000274963:V375G	V	+	2	0	FGD2	37096296	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	7.198000	0.77823	0.898000	0.36418	0.477000	0.44152	GTG		0.637	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	Missense_Mutation	Missense_Mutation
DST	667	broad.mit.edu	37	6	56376012	56376012	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:56376012T>C	ENST00000361203.3	-	68	17810	c.17803A>G	c.(17803-17805)Att>Gtt	p.I5935V	DST_ENST00000244364.6_Missense_Mutation_p.I3632V|DST_ENST00000370754.5_Missense_Mutation_p.I6224V|DST_ENST00000421834.2_Missense_Mutation_p.I3958V|DST_ENST00000340834.4_5'UTR|DST_ENST00000370769.4_Missense_Mutation_p.I6046V|DST_ENST00000370788.2_Missense_Mutation_p.I3849V|DST_ENST00000446842.2_Missense_Mutation_p.I5720V|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5936					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.I6046V(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATTGAGAAATGGCTTCATCC	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	44.0	45.0					6																	56376012		1892	4116	6008	56483971	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17803A>G	6.37:g.56376012T>C	ENSP00000354508:p.Ile5935Val		56483971	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	14.85	2.658674	0.47467	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.95	4.8	0.61643	.	0.247893	0.28140	N	0.016451	T	0.24044	0.0582	N	0.21142	0.635	0.25299	N	0.9893	B;D;P;B;B	0.54047	0.124;0.964;0.869;0.0;0.076	B;P;B;B;B	0.52031	0.075;0.688;0.418;0.002;0.024	T	0.06899	-1.0801	9	0.18710	T	0.47	.	8.8774	0.35354	0.0:0.0663:0.1273:0.8065	.	3958;6046;6224;6044;3632	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	3632;6224;6046;3958;5720;3849;5935;48	ENSP00000244364:I3632V;ENSP00000359790:I6224V;ENSP00000359805:I6046V;ENSP00000400883:I3958V;ENSP00000393645:I5720V;ENSP00000359824:I3849V;ENSP00000354508:I5935V	ENSP00000244364:I3632V	I	-	1	0	DST	56483971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.149000	0.58091	1.083000	0.41159	0.533000	0.62120	ATT		0.403	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Missense_Mutation
MDN1	23195	broad.mit.edu	37	6	90380756	90380756	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:90380756A>T	ENST00000369393.3	-	83	13953	c.13838T>A	c.(13837-13839)gTc>gAc	p.V4613D	MDN1_ENST00000468568.1_5'UTR|MDN1_ENST00000428876.1_Missense_Mutation_p.V4613D|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4613					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.V4613D(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCTGGAGAGGACCGGCACCAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											74.0	67.0	69.0					6																	90380756		2203	4300	6503	90437477	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13838T>A	6.37:g.90380756A>T	ENSP00000358400:p.Val4613Asp		90437477	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	15.85	2.954512	0.53293	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03607	3.87;3.87	5.92	5.92	0.95590	.	0.288499	0.38897	N	0.001522	T	0.01523	0.0049	N	0.19112	0.55	0.54753	D	0.99998	B	0.33448	0.412	B	0.28011	0.085	T	0.57619	-0.7780	10	0.54805	T	0.06	.	16.3631	0.83280	1.0:0.0:0.0:0.0	.	4613	Q9NU22	MDN1_HUMAN	D	4613	ENSP00000358400:V4613D;ENSP00000413970:V4613D	ENSP00000358400:V4613D	V	-	2	0	MDN1	90437477	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	9.109000	0.94291	2.266000	0.75297	0.533000	0.62120	GTC		0.527	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			Missense_Mutation
AIM1	202	broad.mit.edu	37	6	106992511	106992511	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:106992511G>C	ENST00000369066.3	+	10	4368	c.3881G>C	c.(3880-3882)aGg>aCg	p.R1294T	AIM1_ENST00000487681.1_3'UTR|AIM1_ENST00000535438.1_Missense_Mutation_p.R113T	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R1294T(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GGAGAATACAGGGACTGGAAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	96.0	95.0					6																	106992511		2203	4300	6503	107099204	SO:0001583	missense	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3881G>C	6.37:g.106992511G>C	ENSP00000358062:p.Arg1294Thr		107099204	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	8.040	0.763739	0.15914	.	.	ENSG00000112297	ENST00000369066;ENST00000457437;ENST00000535438	T;T;T	0.76968	-1.06;-1.06;-1.06	5.85	0.885	0.19188	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.818934	0.11938	N	0.515068	T	0.66567	0.2802	M	0.91818	3.245	0.29631	N	0.845438	B;B	0.27264	0.173;0.007	B;B	0.32022	0.139;0.044	T	0.57883	-0.7734	10	0.30078	T	0.28	.	5.7331	0.18051	0.522:0.1394:0.3387:0.0	.	113;1294	B4DU04;Q9Y4K1	.;AIM1_HUMAN	T	1294;113;113	ENSP00000358062:R1294T;ENSP00000391419:R113T;ENSP00000439183:R113T	ENSP00000358062:R1294T	R	+	2	0	AIM1	107099204	0.970000	0.33590	0.997000	0.53966	0.852000	0.48524	0.833000	0.27504	0.132000	0.18615	-0.175000	0.13238	AGG		0.428	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			Missense_Mutation
VNN1	8876	broad.mit.edu	37	6	133004446	133004446	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:133004446G>C	ENST00000367928.4	-	7	1388	c.1375C>G	c.(1375-1377)Cgc>Ggc	p.R459G		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	459					acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.R459G(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CTAAACAAGCGTCCGTCAGTT	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											96.0	88.0	91.0					6																	133004446		2203	4300	6503	133046139	SO:0001583	missense	8876			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.1375C>G	6.37:g.133004446G>C	ENSP00000356905:p.Arg459Gly		133046139	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	ENST00000367928.4	37	CCDS5159.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840750	0.51057	.	.	ENSG00000112299	ENST00000367928	D	0.93189	-3.18	5.86	4.99	0.66335	.	0.074910	0.64402	D	0.000020	D	0.95414	0.8511	M	0.85630	2.765	0.46336	D	0.998993	D	0.64830	0.994	D	0.63597	0.916	D	0.94444	0.7661	10	0.29301	T	0.29	-14.1688	14.953	0.71088	0.0682:0.0:0.9318:0.0	.	459	O95497	VNN1_HUMAN	G	459	ENSP00000356905:R459G	ENSP00000356905:R459G	R	-	1	0	VNN1	133046139	0.968000	0.33430	0.713000	0.30519	0.839000	0.47603	4.509000	0.60448	1.490000	0.48466	-0.142000	0.14014	CGC		0.398	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1			Missense_Mutation
RSPH3	83861	broad.mit.edu	37	6	159420883	159420883	+	Silent	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr6:159420883G>C	ENST00000252655.1	-	1	315	c.126C>G	c.(124-126)ccC>ccG	p.P42P	RSPH3_ENST00000367069.2_5'UTR|RSPH3_ENST00000297262.3_Silent_p.P42P|RSPH3_ENST00000449822.1_5'Flank|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	42								p.P42P(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		CAGGTTTCCCGGGAAGGACTG	0.687																																																1	Substitution - coding silent(1)	ovary(1)	6											22.0	27.0	26.0					6																	159420883		2202	4296	6498	159340871	SO:0001819	synonymous_variant	83861			AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.126C>G	6.37:g.159420883G>C			159340871	Q96LQ5|Q96LX2|Q9BX75	Silent	SNP	ENST00000252655.1	37	CCDS5260.1	SNP	39	Broad																																																																																				0.687	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924		Silent
EIF3B	8662	broad.mit.edu	37	7	2409311	2409311	+	Silent	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr7:2409311C>T	ENST00000360876.4	+	10	1664	c.1608C>T	c.(1606-1608)ggC>ggT	p.G536G	EIF3B_ENST00000397011.2_Silent_p.G536G	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B									p.G536G(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CTCCGAAAGGCACCCAGGTAT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	7											73.0	67.0	69.0					7																	2409311		2203	4300	6503	2375837	SO:0001819	synonymous_variant	8662			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1608C>T	7.37:g.2409311C>T			2375837		Silent	SNP	ENST00000360876.4	37	CCDS5332.1	SNP	25	Broad																																																																																				0.463	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			Silent
WBSCR17	64409	broad.mit.edu	37	7	70853311	70853311	+	Silent	SNP	C	C	T	rs202215580		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr7:70853311C>T	ENST00000333538.5	+	3	1147	c.513C>T	c.(511-513)tcC>tcT	p.S171S	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	171	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.S171S(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TCCTGCGGTCCGTGCACAGTG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	7											137.0	108.0	118.0					7																	70853311		2203	4300	6503	70491247	SO:0001819	synonymous_variant	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.513C>T	7.37:g.70853311C>T			70491247	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	37	CCDS5540.1	SNP	23	Broad																																																																																				0.557	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		Silent
HYAL4	23553	broad.mit.edu	37	7	123508562	123508562	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr7:123508562C>G	ENST00000223026.4	+	3	873	c.235C>G	c.(235-237)Ctg>Gtg	p.L79V	HYAL4_ENST00000476325.1_Missense_Mutation_p.L79V	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	79					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)	p.L79V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TGGAAGCCCACTGGCCAAGGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	7											44.0	50.0	48.0					7																	123508562		2200	4300	6500	123295798	SO:0001583	missense	23553			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.235C>G	7.37:g.123508562C>G	ENSP00000223026:p.Leu79Val		123295798	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	9.122	1.009182	0.19277	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.21932	1.98;1.98	5.49	-0.42	0.12336	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.168665	0.40728	N	0.001026	T	0.17195	0.0413	M	0.64404	1.975	0.09310	N	1	P;P	0.39717	0.634;0.684	B;B	0.37780	0.124;0.258	T	0.10086	-1.0645	9	.	.	.	1.7045	5.5989	0.17343	0.0:0.3442:0.2425:0.4133	.	79;79	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	V	79	ENSP00000223026:L79V;ENSP00000417186:L79V	.	L	+	1	2	HYAL4	123295798	0.004000	0.15560	0.604000	0.28916	0.953000	0.61014	0.009000	0.13219	0.279000	0.22186	0.655000	0.94253	CTG		0.398	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269		Missense_Mutation
CCDC136	64753	broad.mit.edu	37	7	128447443	128447443	+	Silent	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr7:128447443G>A	ENST00000297788.4	+	10	1816	c.1449G>A	c.(1447-1449)gaG>gaA	p.E483E	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000487361.1_Silent_p.E430E|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	483						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.E483E(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						AGCTTCAGGAGATGAAGCAGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	7											28.0	31.0	30.0					7																	128447443		2127	4224	6351	128234679	SO:0001819	synonymous_variant	64753				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1449G>A	7.37:g.128447443G>A			128234679	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Silent	SNP	ENST00000297788.4	37	CCDS47704.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	1.535	-0.543302	0.04053	.	.	ENSG00000128596	ENST00000494552	.	.	.	5.92	0.629	0.17687	.	.	.	.	.	T	0.40473	0.1118	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24728	-1.0152	4	.	.	.	-21.9484	0.9725	0.01419	0.2714:0.1704:0.4031:0.1552	.	.	.	.	K	360	.	.	R	+	2	0	CCDC136	128234679	0.973000	0.33851	0.985000	0.45067	0.132000	0.20833	0.566000	0.23593	0.384000	0.24942	0.655000	0.94253	AGA		0.637	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742		Silent
LRGUK	136332	broad.mit.edu	37	7	133859352	133859352	+	Silent	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr7:133859352C>T	ENST00000285928.2	+	8	1053	c.984C>T	c.(982-984)atC>atT	p.I328I		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	328						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)	p.I328I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						ATTTACCCATCCTTCGAGTTC	0.348																																																1	Substitution - coding silent(1)	ovary(1)	7											64.0	75.0	71.0					7																	133859352		2202	4298	6500	133509892	SO:0001819	synonymous_variant	136332			AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.984C>T	7.37:g.133859352C>T			133509892	Q2M3I1	Silent	SNP	ENST00000285928.2	37	CCDS5830.1	SNP	30	Broad																																																																																				0.348	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648		Silent
MTMR9	66036	broad.mit.edu	37	8	11174205	11174205	+	Silent	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:11174205C>G	ENST00000221086.3	+	8	1610	c.1137C>G	c.(1135-1137)cgC>cgG	p.R379R	AF131216.6_ENST00000498997.2_RNA|MTMR9_ENST00000526292.1_Silent_p.R294R	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	379	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)	p.R379R(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		TCCAGCAGCGCTGTGCACAGT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	8											71.0	56.0	61.0					8																	11174205		2203	4300	6503	11211615	SO:0001819	synonymous_variant	66036			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1137C>G	8.37:g.11174205C>G			11211615	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Silent	SNP	ENST00000221086.3	37	CCDS5979.1	SNP	28	Broad																																																																																				0.527	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458		Silent
CA3	761	broad.mit.edu	37	8	86352050	86352050	+	Silent	SNP	T	T	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:86352050T>G	ENST00000285381.2	+	2	227	c.144T>G	c.(142-144)tcT>tcG	p.S48S	RP11-317J10.2_ENST00000521761.1_RNA|RP11-317J10.2_ENST00000517697.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	48					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)	p.S48S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	AGCCATGGTCTGTGTCTTATG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	8											112.0	94.0	100.0					8																	86352050		2203	4300	6503	86539302	SO:0001819	synonymous_variant	761			AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.144T>G	8.37:g.86352050T>G			86539302	B2R867|B3KUC8|O60842	Silent	SNP	ENST00000285381.2	37	CCDS6238.1	SNP	55	Broad																																																																																				0.468	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181		Silent
OSR2	116039	broad.mit.edu	37	8	99962883	99962883	+	Splice_Site	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:99962883G>T	ENST00000297565.4	+	3	1152		c.e3-1		OSR2_ENST00000523368.1_Splice_Site|OSR2_ENST00000522510.1_Splice_Site|OSR2_ENST00000457907.2_Splice_Site|OSR2_ENST00000435298.2_Splice_Site	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2						bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.?(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			TTGATTTTCAGATACATCCAT	0.358																																																1	Unknown(1)	ovary(1)	8											60.0	57.0	58.0					8																	99962883		1843	4085	5928	100032059	SO:0001630	splice_region_variant	116039			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.657-1G>T	8.37:g.99962883G>T			100032059	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Splice_Site_SNP	SNP	ENST00000297565.4	37	CCDS47901.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628732	0.67015	.	.	ENSG00000164920	ENST00000523368;ENST00000297565;ENST00000435298;ENST00000522510;ENST00000457907	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1074	0.93301	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OSR2	100032059	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.657000	0.98554	2.738000	0.93877	0.655000	0.94253	.		0.358	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001	Intron	Splice_Site_SNP
TG	7038	broad.mit.edu	37	8	134034366	134034366	+	Missense_Mutation	SNP	G	G	A	rs121912650		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:134034366G>A	ENST00000220616.4	+	40	7047	c.7007G>A	c.(7006-7008)cGa>cAa	p.R2336Q	TG_ENST00000542445.1_Missense_Mutation_p.R706Q|TG_ENST00000519543.1_Missense_Mutation_p.R469Q|TG_ENST00000377869.1_Missense_Mutation_p.R2279Q	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2336			R -> Q (in TDH3). {ECO:0000269|PubMed:16477365}.		hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.R2336Q(2)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCCAGCTACCGAGTGGGTGTC	0.602																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	8	GRCh37	CM063181	TG	M	rs121912650						154.0	139.0	144.0					8																	134034366		2203	4300	6503	134103548	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7007G>A	8.37:g.134034366G>A	ENSP00000220616:p.Arg2336Gln		134103548	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.739622	0.96873	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543	D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71	5.93	5.93	0.95920	Carboxylesterase, type B (1);	0.000000	0.64402	D	0.000002	D	0.97539	0.9194	H	0.99026	4.405	0.51767	A	0.999937	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98698	1.0699	9	0.87932	D	0	.	17.0766	0.86588	0.0:0.0:1.0:0.0	.	469;706;2336	E7EVM0;F5GWW5;P01266	.;.;THYG_HUMAN	Q	2279;1142;2336;706;469	ENSP00000367100:R2279Q;ENSP00000220616:R2336Q;ENSP00000441693:R706Q;ENSP00000430430:R469Q	ENSP00000220616:R2336Q	R	+	2	0	TG	134103548	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	8.497000	0.90488	2.815000	0.96918	0.561000	0.74099	CGA		0.602	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Missense_Mutation
MROH6	642475	broad.mit.edu	37	8	144652734	144652734	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:144652734G>C	ENST00000398882.3	-	5	1070	c.814C>G	c.(814-816)Cag>Gag	p.Q272E	RP11-661A12.9_ENST00000531730.1_RNA|MROH6_ENST00000534459.1_5'Flank|MROH6_ENST00000533679.1_5'Flank|MROH6_ENST00000532704.1_5'Flank|MROH6_ENST00000524906.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	272								p.Q272E(1)									TTGTGCAGCTGTGTGACCAGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	8											47.0	54.0	52.0					8																	144652734		2089	4217	6306	144723877	SO:0001583	missense	642475			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.814C>G	8.37:g.144652734G>C	ENSP00000381857:p.Gln272Glu		144723877	A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	37	CCDS47928.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656902	0.67586	.	.	ENSG00000204839	ENST00000398882;ENST00000529971	T;T	0.30714	3.75;1.52	4.82	4.82	0.62117	.	0.732114	0.11146	N	0.594649	T	0.56187	0.1968	M	0.77486	2.375	0.80722	D	1	D;D	0.59767	0.986;0.975	P;P	0.62560	0.876;0.904	T	0.54576	-0.8273	10	0.56958	D	0.05	-53.94	15.4232	0.75031	0.0:0.0:1.0:0.0	.	272;272	E9PPP7;A6NGR9	.;CH073_HUMAN	E	272	ENSP00000381857:Q272E;ENSP00000436959:Q272E	ENSP00000381857:Q272E	Q	-	1	0	C8orf73	144723877	0.963000	0.33076	0.997000	0.53966	0.686000	0.39977	1.654000	0.37334	2.502000	0.84385	0.555000	0.69702	CAG		0.642	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878		Missense_Mutation
CYHR1	50626	broad.mit.edu	37	8	145689746	145689746	+	Intron	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr8:145689746C>T	ENST00000438911.2	-	2	380				KIFC2_ENST00000301332.2_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000306145.5_Missense_Mutation_p.A115T|CYHR1_ENST00000530374.1_5'Flank|CYHR1_ENST00000403000.2_Missense_Mutation_p.A115T|CYHR1_ENST00000424149.2_Missense_Mutation_p.A115T	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1							cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)	p.A115T(1)		haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GCCTGACCAGCCACAGAGCGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	8											56.0	64.0	62.0					8																	145689746		2201	4296	6497	145660554	SO:0001627	intron_variant	50626			AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.246+96G>A	8.37:g.145689746C>T			145660554	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	ENST00000438911.2	37	CCDS47943.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841097	0.91197	.	.	ENSG00000187954	ENST00000403000;ENST00000424149;ENST00000306145;ENST00000533764	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	4.66	4.66	0.58398	.	0.300882	0.25792	U	0.028261	T	0.47581	0.1453	N	0.24115	0.695	0.24440	N	0.994538	D	0.56035	0.974	P	0.54026	0.74	T	0.45116	-0.9283	10	0.62326	D	0.03	.	15.0345	0.71734	0.0:1.0:0.0:0.0	.	115	Q6ZMK1-3	.	T	115	ENSP00000385962:A115T;ENSP00000414647:A115T;ENSP00000304826:A115T;ENSP00000432902:A115T	ENSP00000304826:A115T	A	-	1	0	CYHR1	145660554	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.722000	0.38042	2.145000	0.66743	0.491000	0.48974	GCT		0.642	CYHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382438.1	NM_032687		Missense_Mutation
SPTLC1	10558	broad.mit.edu	37	9	94821591	94821591	+	Splice_Site	SNP	C	C	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr9:94821591C>T	ENST00000262554.2	-	7	566		c.e7-1		SPTLC1_ENST00000482632.1_Splice_Site	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1						ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)	p.?(1)		breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	AGCTCTATCTCTGCAAGGAAA	0.403																																																1	Unknown(1)	ovary(1)	9											87.0	77.0	81.0					9																	94821591		2203	4300	6503	93861412	SO:0001630	splice_region_variant	10558			Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.561-1G>A	9.37:g.94821591C>T			93861412	A8K681|Q5VWB4|Q96IX6	Splice_Site_SNP	SNP	ENST00000262554.2	37	CCDS6692.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233920	0.79688	.	.	ENSG00000090054	ENST00000262554	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3941	0.94598	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTLC1	93861412	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.400000	0.79949	2.822000	0.97130	0.557000	0.71058	.		0.403	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	Intron	Splice_Site_SNP
INVS	27130	broad.mit.edu	37	9	103014594	103014594	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr9:103014594G>T	ENST00000262457.2	+	9	1293	c.1108G>T	c.(1108-1110)Gtc>Ttc	p.V370F	INVS_ENST00000541287.1_Missense_Mutation_p.V274F|INVS_ENST00000262456.2_Missense_Mutation_p.V370F	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	370					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.V370F(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				TTCTGGCCATGTCAGCACCGT	0.388																																																1	Substitution - Missense(1)	ovary(1)	9											209.0	194.0	199.0					9																	103014594		2203	4300	6503	102054415	SO:0001583	missense	27130			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.1108G>T	9.37:g.103014594G>T	ENSP00000262457:p.Val370Phe		102054415	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	ENST00000262457.2	37	CCDS6746.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458159	0.84317	.	.	ENSG00000119509	ENST00000262457;ENST00000541287;ENST00000262456	T;T;T	0.66460	-0.21;-0.21;-0.21	5.57	5.57	0.84162	Ankyrin repeat-containing domain (4);	0.055854	0.64402	D	0.000001	T	0.75012	0.3792	L	0.46741	1.465	0.58432	D	0.999999	D;D;D	0.58970	0.981;0.984;0.961	P;D;P	0.67900	0.888;0.954;0.725	T	0.76236	-0.3033	10	0.66056	D	0.02	.	12.8433	0.57815	0.0746:0.0:0.9254:0.0	.	274;370;370	F5GZH2;Q9Y283;Q9Y283-2	.;INVS_HUMAN;.	F	370;274;370	ENSP00000262457:V370F;ENSP00000444454:V274F;ENSP00000262456:V370F	ENSP00000262456:V370F	V	+	1	0	INVS	102054415	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.755000	0.74914	2.634000	0.89283	0.557000	0.71058	GTC		0.388	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425		Missense_Mutation
LRRC8A	56262	broad.mit.edu	37	9	131670608	131670608	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr9:131670608C>G	ENST00000259324.5	+	3	1688	c.1165C>G	c.(1165-1167)Cgc>Ggc	p.R389G	LRRC8A_ENST00000372600.4_Missense_Mutation_p.R389G|LRRC8A_ENST00000372599.3_Missense_Mutation_p.R389G	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	389					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R389G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CTACTCCAAGCGCTTCGCCGT	0.587																																																1	Substitution - Missense(1)	ovary(1)	9											117.0	101.0	106.0					9																	131670608		2203	4300	6503	130710429	SO:0001583	missense	56262			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1165C>G	9.37:g.131670608C>G	ENSP00000259324:p.Arg389Gly		130710429	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	37	CCDS35155.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.62	3.172646	0.57584	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.29917	1.55;1.55;1.55	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	M	0.81341	2.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.64774	-0.6328	10	0.87932	D	0	.	18.4034	0.90525	0.0:1.0:0.0:0.0	.	389	Q8IWT6	LRC8A_HUMAN	G	389	ENSP00000361682:R389G;ENSP00000361680:R389G;ENSP00000259324:R389G	ENSP00000259324:R389G	R	+	1	0	LRRC8A	130710429	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.692000	0.61746	2.595000	0.87683	0.561000	0.74099	CGC		0.587	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594		Missense_Mutation
ABL1	25	broad.mit.edu	37	9	133730195	133730195	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr9:133730195G>C	ENST00000318560.5	+	3	642	c.261G>C	c.(259-261)aaG>aaC	p.K87N		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	87	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.K87N(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CAGGTGAAAAGCTCCGGGTCT	0.433			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Substitution - Missense(1)	ovary(1)	9											73.0	73.0	73.0					9																	133730195		2203	4300	6503	132720016	SO:0001583	missense	25			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.261G>C	9.37:g.133730195G>C	ENSP00000323315:p.Lys87Asn		132720016	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293614	0.80914	.	.	ENSG00000097007	ENST00000372348;ENST00000438426;ENST00000318560	T;T	0.51574	0.7;0.7	5.67	3.82	0.43975	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.51822	0.1697	L	0.59436	1.845	0.80722	D	1	P;P	0.40197	0.706;0.706	P;P	0.47015	0.534;0.534	T	0.56986	-0.7888	10	0.72032	D	0.01	.	11.7627	0.51912	0.1436:0.0:0.8564:0.0	.	87;124	P00519;Q59FK4	ABL1_HUMAN;.	N	106;133;87	ENSP00000361423:K106N;ENSP00000323315:K87N	ENSP00000323315:K87N	K	+	3	2	ABL1	132720016	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.902000	0.87389	1.407000	0.46875	0.638000	0.83543	AAG		0.433	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313		Missense_Mutation
SEC16A	9919	broad.mit.edu	37	9	139342581	139342581	+	Silent	SNP	T	T	G			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chr9:139342581T>G	ENST00000371706.3	-	22	5844	c.5811A>C	c.(5809-5811)ggA>ggC	p.G1937G	SEC16A_ENST00000398335.1_3'UTR|SEC16A_ENST00000313084.5_Silent_p.G121G|SEC16A_ENST00000313050.7_Silent_p.G2115G|SEC16A_ENST00000431893.2_Silent_p.G1937G|SEC16A_ENST00000290037.6_Silent_p.G1937G			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1937	Pro-rich.|Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.G2115G(1)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCTTTTTCTTTCCAGGTAGCC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	9											115.0	100.0	105.0					9																	139342581		1882	4132	6014	138462402	SO:0001819	synonymous_variant	9919			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.5811A>C	9.37:g.139342581T>G			138462402	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	37		SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	6.319	0.426921	0.11987	.	.	ENSG00000148396	ENST00000433860	.	.	.	4.48	1.56	0.23342	.	.	.	.	.	T	0.57036	0.2026	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48317	-0.9046	4	.	.	.	-12.7393	8.5395	0.33384	0.0:0.5917:0.0:0.4083	.	.	.	.	Q	245	.	.	K	-	1	0	SEC16A	138462402	0.032000	0.19561	0.063000	0.19743	0.663000	0.39108	-0.404000	0.07205	0.102000	0.17638	-0.239000	0.12128	AAA		0.388	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459		Silent
RBBP7	5931	broad.mit.edu	37	X	16870748	16870748	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chrX:16870748C>A	ENST00000380087.2	-	8	1249	c.889G>T	c.(889-891)Gta>Tta	p.V297L	RBBP7_ENST00000380084.4_Missense_Mutation_p.V341L|RBBP7_ENST00000404022.1_Missense_Mutation_p.V288L			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	297					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)	p.V297L(1)		biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					CATAAAGCTACGGTCTAAAGA	0.328																																																1	Substitution - Missense(1)	ovary(1)	X											52.0	49.0	50.0					X																	16870748		2203	4300	6503	16780669	SO:0001583	missense	5931			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.889G>T	X.37:g.16870748C>A	ENSP00000369427:p.Val297Leu		16780669	Q5JP00	Missense_Mutation	SNP	ENST00000380087.2	37	CCDS14179.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749415	0.89753	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000444437	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.57	5.57	0.84162	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66752	0.2821	M	0.64567	1.98	0.80722	D	1	B;P;B	0.36874	0.41;0.572;0.253	B;B;B	0.41571	0.19;0.36;0.135	T	0.70565	-0.4837	10	0.87932	D	0	-10.9932	17.6398	0.88132	0.0:1.0:0.0:0.0	.	288;297;341	E9PC52;Q16576;Q5JP00	.;RBBP7_HUMAN;.	L	297;341;288;101	ENSP00000369427:V297L;ENSP00000369424:V341L;ENSP00000386068:V288L;ENSP00000402796:V101L	ENSP00000369424:V341L	V	-	1	0	RBBP7	16780669	1.000000	0.71417	0.972000	0.41901	0.828000	0.46876	7.772000	0.85439	2.469000	0.83416	0.594000	0.82650	GTA		0.328	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893		Missense_Mutation
RAB40AL	282808	broad.mit.edu	37	X	102192810	102192810	+	Silent	SNP	G	G	A			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2051-01	TCGA-09-2051-10	g.chrX:102192810G>A	ENST00000218249.5	+	1	611	c.564G>A	c.(562-564)aaG>aaA	p.K188K	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	188	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.K188K(2)		endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						GGCCGAGCAAGGTACTGAGCT	0.577																																																2	Substitution - coding silent(2)	ovary(2)	X											65.0	49.0	55.0					X																	102192810		2203	4300	6503	102079466	SO:0001819	synonymous_variant	282808			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.564G>A	X.37:g.102192810G>A			102079466	Q495H3	Silent	SNP	ENST00000218249.5	37	CCDS35353.1	SNP	35	Broad																																																																																				0.577	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057679.1	NM_001031834		Silent
NPIPB5	100132247	broad.mit.edu	37	16	22545984	22545995	+	In_Frame_Del	DEL	TCCACCCTCAGC	TCCACCCTCAGC	-			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2051-01	TCGA-09-2051-10	g.chr16:22545984_22545995delTCCACCCTCAGC	ENST00000517539.1	+	8	1755_1766	c.1680_1691delTCCACCCTCAGC	c.(1678-1692)cttccaccctcagct>ctt	p.PPSA565del	NPIPB5_ENST00000424340.1_In_Frame_Del_p.PPSA565del|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	565	Pro-rich.					integral component of membrane (GO:0016021)											TCACTCCCCTTCCACCCTCAGCTCCACCCTCA	0.566																																																0			16								51,2055		10,31,1012										2	51,3809		4,43,1883	no	coding	LOC100132247	NM_001135865.1		14,74,2895	A1A1,A1R,RR		1.3212,2.4217,1.7097				102,5864				22453496	SO:0001651	inframe_deletion	100132247				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1680_1691delTCCACCCTCAGC	16.37:g.22545984_22545995delTCCACCCTCAGC	ENSP00000430633:p.Pro565_Ala568del		22453485	B4DK13	In_Frame_Del	DEL	ENST00000517539.1	37	CCDS45443.1	DEL	62	Broad																																																																																				0.566	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865		In_Frame_Del
TP53	7157	broad.mit.edu	37	17	7578182	7578183	+	Frame_Shift_Del	DEL	GC	GC	-	rs72661118		TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2051-01	TCGA-09-2051-10	g.chr17:7578182_7578183delGC	ENST00000269305.4	-	6	855_856	c.666_667delGC	c.(664-669)ccgcctfs	p.PP222fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.PP222fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.PP222fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.PP222fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.PP222fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.PP222fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	222	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in a sporadic cancer; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> Q (in sporadic cancers; somatic mutation).|P -> R (in a sporadic cancer; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(11)|p.0?(8)|p.P222P(5)|p.P223fs*1(3)|p.Y220_P223delYEPP(1)|p.P223S(1)|p.P130fs*1(1)|p.V218_E224delVPYEPPE(1)|p.P222fs*24(1)|p.P223A(1)|p.P223fs*24(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGACCTCAGGCGGCTCATAGG	0.55		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - coding silent(5)|Deletion - In frame(2)|Substitution - Missense(2)	biliary_tract(5)|endometrium(5)|ovary(5)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|breast(1)	17																																								7518908	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.666_667delGC	17.37:g.7578182_7578183delGC	ENSP00000269305:p.Pro222fs		7518907	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	42	Broad																																																																																				0.550	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
ZNF415	55786	broad.mit.edu	37	19	53611670	53611682	+	Frame_Shift_Del	DEL	TGATGTCTGAAGA	TGATGTCTGAAGA	-			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2051-01	TCGA-09-2051-10	g.chr19:53611670_53611682delTGATGTCTGAAGA	ENST00000500065.4	-	4	1949_1961	c.1616_1628delTCTTCAGACATCA	c.(1615-1629)ctcttcagacatcaafs	p.LFRHQ539fs	ZNF415_ENST00000243643.4_Frame_Shift_Del_p.LFRHQ539fs|ZNF415_ENST00000601493.1_Frame_Shift_Del_p.LFRHQ309fs|ZNF415_ENST00000440291.1_Frame_Shift_Del_p.LFRHQ526fs|ZNF415_ENST00000448501.1_Frame_Shift_Del_p.LFRHQ587fs|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000455735.2_Frame_Shift_Del_p.LFRHQ587fs|ZNF415_ENST00000421033.1_Frame_Shift_Del_p.LFRHQ551fs|ZNF415_ENST00000597503.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	587					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L539fs*>13(1)		breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		ATGGATAATTTGATGTCTGAAGAGGTTTGGGCG	0.371																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								58303494	SO:0001589	frameshift_variant	55786			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.1616_1628delTCTTCAGACATCA	19.37:g.53611670_53611682delTGATGTCTGAAGA	ENSP00000439435:p.Leu539fs		58303482	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Frame_Shift_Del	DEL	ENST00000500065.4	37	CCDS54313.1	DEL	63	Broad																																																																																				0.371	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355		Frame_Shift_Del
RPL9	6133	broad.mit.edu	37	4	39460751	39460756	+	5'Flank	DEL	GCGGGG	GCGGGG	-			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2051-01	TCGA-09-2051-10	g.chr4:39460751_39460756delGCGGGG	ENST00000449470.2	-	0	0				LIAS_ENST00000513731.1_In_Frame_Del_p.5_7CGD>Y|LIAS_ENST00000515061.1_3'UTR|RPL9_ENST00000295955.9_5'Flank|LIAS_ENST00000261434.3_In_Frame_Del_p.5_7CGD>Y|LIAS_ENST00000340169.2_In_Frame_Del_p.5_7CGD>Y|LIAS_ENST00000381846.1_In_Frame_Del_p.5_7CGD>Y	NM_001024921.2	NP_001020092.1	P32969	RL9_HUMAN	ribosomal protein L9						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.C5_D7>Y(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|skin(1)	8						TCTCTACGCTGCGGGGATGCAGCCCG	0.617																																																1	Complex - deletion inframe(1)	ovary(1)	4																																								39137151	SO:0001631	upstream_gene_variant	11019			D14531	CCDS3452.1	4p13	2011-04-06			ENSG00000163682	ENSG00000163682		"""L ribosomal proteins"""	10369	protein-coding gene	gene with protein product		603686				8597601, 8415001	Standard	XM_005262661		Approved	L9	uc021sso.1	P32969	OTTHUMG00000099367		4.37:g.39460751_39460756delGCGGGG	Exception_encountered		39137146		In_Frame_Del	DEL	ENST00000449470.2	37	CCDS3452.1	DEL	46	Broad																																																																																				0.617	RPL9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361018.1			In_Frame_Del
DRP2	1821	broad.mit.edu	37	X	100490976	100491018	+	Splice_Site	DEL	GTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA	GTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA	-			TCGA-09-2051-01	TCGA-09-2051-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2051-01	TCGA-09-2051-10	g.chrX:100490976_100491018delGTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA	ENST00000395209.3	+	4	772_808	c.245_281delGTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA	c.(244-282)tgttggaatgaaataaaaaagaagtctcacaacctccgg>tg	p.CWNEIKKKSHNLR82fs	DRP2_ENST00000541709.1_Splice_Site_p.CWNEIKKKSHNLR4fs|DRP2_ENST00000538510.1_Splice_Site_p.CWNEIKKKSHNLR82fs|DRP2_ENST00000402866.1_Splice_Site_p.CWNEIKKKSHNLR82fs	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	82					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						ATGAATCTGTGTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGAAACAGGTGCC	0.527																																																1	Unknown(1)	ovary(1)	X																																								100377674	SO:0001630	splice_region_variant	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.281+1GTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA>-	X.37:g.100490976_100491018delGTTGGAATGAAATAAAAAAGAAGTCTCACAACCTCCGGTAAGA			100377632	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Splice_Site_Del	DEL	ENST00000395209.3	37	CCDS14480.2	DEL	48	Broad																																																																																				0.527	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	Frame_Shift_Del	Splice_Site_Del
