#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NT5C1A	84618	broad.mit.edu	37	1	40126768	40126768	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:40126768T>C	ENST00000235628.1	-	5	723	c.724A>G	c.(724-726)Aac>Gac	p.N242D		NM_032526.1	NP_115915.1	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	242					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|purine nucleobase metabolic process (GO:0006144)|purine nucleoside monophosphate catabolic process (GO:0009128)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.N242D(1)		breast(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)	15	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGAGGTTTGTTCTCGTGGGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	105.0	106.0					1																	40126768		2203	4300	6503	39899355	SO:0001583	missense	84618			AF331801	CCDS440.1	1p34.3-p33	2008-07-18			ENSG00000116981	ENSG00000116981			17819	protein-coding gene	gene with protein product	"""cytosolic 5' nucleotidase, type 1A"", ""AMP-specific 5'-NT"", ""cytosolic 5'-nucleotidase IA"""	610525				11133996, 11690631	Standard	NM_032526		Approved	CN-I, CN-IA, CN1A, CN1, MGC119199, MGC119201	uc001cdq.1	Q9BXI3	OTTHUMG00000009244	ENST00000235628.1:c.724A>G	1.37:g.40126768T>C	ENSP00000235628:p.Asn242Asp		39899355	Q3SYB9|Q5TG98|Q9BWT8	Missense_Mutation	SNP	ENST00000235628.1	37	CCDS440.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	12.46	1.944005	0.34283	.	.	ENSG00000116981	ENST00000235628	.	.	.	5.19	5.19	0.71726	.	0.041945	0.85682	D	0.000000	T	0.40932	0.1137	N	0.16368	0.405	0.53005	D	0.99996	B	0.17038	0.02	B	0.20384	0.029	T	0.27905	-1.0060	9	0.11794	T	0.64	-3.8563	15.3637	0.74503	0.0:0.0:0.0:1.0	.	242	Q9BXI3	5NT1A_HUMAN	D	242	.	ENSP00000235628:N242D	N	-	1	0	NT5C1A	39899355	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.018000	0.57174	2.102000	0.63906	0.528000	0.53228	AAC		0.632	NT5C1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025626.1	NM_032526		Missense_Mutation
C1orf168	199920	broad.mit.edu	37	1	57189326	57189326	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:57189326T>C	ENST00000343433.6	-	17	1989	c.1909A>G	c.(1909-1911)Aag>Gag	p.K637E	C1orf168_ENST00000484327.1_5'Flank	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	637								p.K637E(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TTTTGCTTCTTGGTTTTGAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	51.0	51.0					1																	57189326		2201	4296	6497	56961914	SO:0001583	missense	199920			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1909A>G	1.37:g.57189326T>C	ENSP00000345972:p.Lys637Glu		56961914	Q63HM3|Q6ZUY6	Missense_Mutation	SNP	ENST00000343433.6	37	CCDS30729.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	17.91	3.504967	0.64410	.	.	ENSG00000187889	ENST00000343433	T	0.36699	1.24	4.74	4.74	0.60224	.	0.000000	0.53938	D	0.000049	T	0.53965	0.1829	M	0.68317	2.08	0.35277	D	0.780985	D	0.71674	0.998	D	0.66351	0.943	T	0.65307	-0.6200	10	0.45353	T	0.12	-11.5604	12.1494	0.54042	0.0:0.0:0.0:1.0	.	637	Q5VWT5	CA168_HUMAN	E	637	ENSP00000345972:K637E	ENSP00000345972:K637E	K	-	1	0	C1orf168	56961914	0.998000	0.40836	0.935000	0.37517	0.885000	0.51271	4.072000	0.57563	2.119000	0.64992	0.533000	0.62120	AAG		0.318	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		Missense_Mutation
PI4KB	5298	broad.mit.edu	37	1	151274713	151274713	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:151274713G>C	ENST00000368873.1	-	7	1750	c.1582C>G	c.(1582-1584)Cct>Gct	p.P528A	PI4KB_ENST00000529142.1_Missense_Mutation_p.P196A|PI4KB_ENST00000368875.2_Missense_Mutation_p.P540A|PI4KB_ENST00000368874.4_Missense_Mutation_p.P513A|RN7SL444P_ENST00000578948.1_RNA|PI4KB_ENST00000271657.5_Missense_Mutation_p.P540A|PI4KB_ENST00000368872.1_Missense_Mutation_p.P513A			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	528					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.P540A(1)		breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACTGCAGAAGGATCTTCTGGG	0.532																																					Colon(154;765 1838 9854 28443 37492)											1	Substitution - Missense(1)	ovary(1)	1											152.0	147.0	148.0					1																	151274713		2203	4300	6503	149541337	SO:0001583	missense	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.1582C>G	1.37:g.151274713G>C	ENSP00000357867:p.Pro528Ala		149541337	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.106670	0.94292	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000529142;ENST00000368872	T;T;T;T;T;T	0.73897	-0.77;-0.78;-0.78;-0.79;-0.52;-0.77	5.0	5.0	0.66597	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.85013	0.5600	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	0.972;1.0;1.0	P;D;D	0.97110	0.771;1.0;1.0	D	0.85583	0.1241	10	0.51188	T	0.08	-10.1944	17.0179	0.86424	0.0:0.0:1.0:0.0	.	528;513;196	Q9UBF8;Q9UBF8-2;Q9UBF8-3	PI4KB_HUMAN;.;.	A	513;540;540;528;196;513	ENSP00000357868:P513A;ENSP00000357869:P540A;ENSP00000271657:P540A;ENSP00000357867:P528A;ENSP00000433149:P196A;ENSP00000357866:P513A	ENSP00000271657:P540A	P	-	1	0	PI4KB	149541337	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.149000	0.94659	2.598000	0.87819	0.462000	0.41574	CCT		0.532	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651		Missense_Mutation
CD5L	922	broad.mit.edu	37	1	157803128	157803128	+	Missense_Mutation	SNP	C	C	A	rs555822563		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:157803128C>A	ENST00000368174.4	-	5	989	c.893G>T	c.(892-894)cGg>cTg	p.R298L	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	298	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.R298L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATAGCATTTCCGGTCTCTGAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	113.0	112.0					1																	157803128		2203	4300	6503	156069752	SO:0001583	missense	922			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.893G>T	1.37:g.157803128C>A	ENSP00000357156:p.Arg298Leu		156069752	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.81	1.748321	0.30955	.	.	ENSG00000073754	ENST00000368174	T	0.35421	1.31	5.06	2.05	0.26809	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.518270	0.17576	N	0.169301	T	0.19167	0.0460	L	0.48877	1.53	0.09310	N	1	D	0.55800	0.973	P	0.49421	0.61	T	0.04579	-1.0941	10	0.52906	T	0.07	.	6.4201	0.21738	0.0:0.6888:0.0:0.3112	.	298	O43866	CD5L_HUMAN	L	298	ENSP00000357156:R298L	ENSP00000357156:R298L	R	-	2	0	CD5L	156069752	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-2.028000	0.01431	0.261000	0.21753	0.655000	0.94253	CGG		0.582	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		Missense_Mutation
OR10T2	128360	broad.mit.edu	37	1	158369007	158369007	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:158369007C>T	ENST00000334438.1	-	1	249	c.250G>A	c.(250-252)Gtc>Atc	p.V84I		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V84I(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					AGCAGGTGGACCAGCAGCTGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	103.0	104.0					1																	158369007		2203	4300	6503	156635631	SO:0001583	missense	128360			AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.250G>A	1.37:g.158369007C>T	ENSP00000334115:p.Val84Ile		156635631	Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	CCDS30895.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	6.114	0.389357	0.11581	.	.	ENSG00000186306	ENST00000334438	T	0.17054	2.3	4.56	1.56	0.23342	GPCR, rhodopsin-like superfamily (1);	0.449907	0.16306	N	0.220229	T	0.02688	0.0081	L	0.31664	0.95	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45977	-0.9224	10	0.19590	T	0.45	.	3.3636	0.07196	0.1775:0.507:0.0:0.3155	.	84	Q8NGX3	O10T2_HUMAN	I	84	ENSP00000334115:V84I	ENSP00000334115:V84I	V	-	1	0	OR10T2	156635631	0.000000	0.05858	0.685000	0.30070	0.970000	0.65996	-2.693000	0.00829	0.140000	0.18849	-0.133000	0.14855	GTC		0.507	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475		Missense_Mutation
FAM71A	149647	broad.mit.edu	37	1	212798536	212798536	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:212798536A>T	ENST00000294829.3	+	1	748	c.317A>T	c.(316-318)aAg>aTg	p.K106M	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	106						nucleus (GO:0005634)		p.K106M(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CAGGCCACCAAGAGAAAAAAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	64.0	63.0					1																	212798536		2203	4300	6503	210865159	SO:0001583	missense	149647				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.317A>T	1.37:g.212798536A>T	ENSP00000294829:p.Lys106Met		210865159	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	CCDS1507.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	11.06	1.527345	0.27299	.	.	ENSG00000162771	ENST00000294829	T	0.04603	3.59	4.53	2.14	0.27477	.	1.759490	0.03403	N	0.203647	T	0.20414	0.0491	M	0.80028	2.48	0.09310	N	1	D	0.76494	0.999	D	0.64595	0.927	T	0.02632	-1.1131	10	0.72032	D	0.01	-11.0907	4.8562	0.13561	0.7143:0.1873:0.0983:0.0	.	106	Q8IYT1	FA71A_HUMAN	M	106	ENSP00000294829:K106M	ENSP00000294829:K106M	K	+	2	0	FAM71A	210865159	0.051000	0.20477	0.024000	0.17045	0.007000	0.05969	0.390000	0.20768	0.326000	0.23384	0.455000	0.32223	AAG		0.547	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	215848347	215848347	+	Silent	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:215848347C>T	ENST00000307340.3	-	63	13292	c.12906G>A	c.(12904-12906)agG>agA	p.R4302R	USH2A_ENST00000366943.2_Silent_p.R4302R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4302	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R4302R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCATTTCATTCCTTTGAAGCC	0.403										HNSCC(13;0.011)																																						1	Substitution - coding silent(1)	ovary(1)	1											100.0	98.0	99.0					1																	215848347		2203	4300	6503	213914970	SO:0001819	synonymous_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12906G>A	1.37:g.215848347C>T			213914970	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	30	Broad																																																																																				0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Silent
TRIM58	25893	broad.mit.edu	37	1	248039704	248039704	+	Silent	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:248039704G>A	ENST00000366481.3	+	6	1422	c.1374G>A	c.(1372-1374)ttG>ttA	p.L458L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	458	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.L458L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTCTTATCTTGCCACCCACAA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	1											120.0	114.0	116.0					1																	248039704		2203	4300	6503	246106327	SO:0001819	synonymous_variant	25893			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1374G>A	1.37:g.248039704G>A			246106327	Q6B0H9	Silent	SNP	ENST00000366481.3	37	CCDS1636.1	SNP	46	Broad																																																																																				0.418	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431		Silent
UPF2	26019	broad.mit.edu	37	10	12039755	12039755	+	Splice_Site	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr10:12039755G>C	ENST00000356352.2	-	7	2233	c.1760C>G	c.(1759-1761)gCa>gGa	p.A587G	UPF2_ENST00000357604.5_Splice_Site_p.A587G|UPF2_ENST00000397053.2_Splice_Site_p.A587G			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	587	MIF4G 2.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.A587G(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				ATCCATTGCTGCCTATTGGGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											154.0	142.0	146.0					10																	12039755		2203	4300	6503	12079761	SO:0001630	splice_region_variant	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.1759-1C>G	10.37:g.12039755G>C			12079761	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738378	0.89573	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.22945	1.93;1.93;1.93	5.7	5.7	0.88788	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.058100	0.64402	D	0.000002	T	0.58133	0.2101	M	0.89095	3.005	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.74674	0.971;0.984	T	0.57751	-0.7757	10	0.26408	T	0.33	.	19.4197	0.94716	0.0:0.0:1.0:0.0	.	557;587	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	G	587	ENSP00000348708:A587G;ENSP00000350221:A587G;ENSP00000380244:A587G	ENSP00000348708:A587G	A	-	2	0	UPF2	12079761	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	9.014000	0.93635	2.667000	0.90743	0.655000	0.94253	GCA		0.343	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		Missense_Mutation	Missense_Mutation
WAPAL	23063	broad.mit.edu	37	10	88197356	88197356	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr10:88197356C>G	ENST00000298767.5	-	19	3989	c.3517G>C	c.(3517-3519)Gga>Cga	p.G1173R	WAPAL_ENST00000263070.7_Missense_Mutation_p.G385R|WAPAL_ENST00000372075.1_Missense_Mutation_p.G385R|WAPAL_ENST00000484070.1_5'UTR	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1173					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.G1173R(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CCAGTTGTTCCAACAGCACAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											77.0	70.0	72.0					10																	88197356		2203	4300	6503	88187336	SO:0001583	missense	23063			AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3517G>C	10.37:g.88197356C>G	ENSP00000298767:p.Gly1173Arg		88187336	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969720	0.74246	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T;T;T	0.33216	1.42;1.42;1.42	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	L	0.45581	1.43	0.80722	D	1	D;D;D;D	0.69078	0.975;0.972;0.975;0.997	P;P;P;D	0.65773	0.706;0.755;0.706;0.938	T	0.39643	-0.9604	10	0.56958	D	0.05	.	20.3507	0.98813	0.0:1.0:0.0:0.0	.	1167;1211;1173;1210	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	R	1258;1173;1258;385;385	ENSP00000298767:G1173R;ENSP00000361145:G385R;ENSP00000263070:G385R	ENSP00000263070:G385R	G	-	1	0	WAPAL	88187336	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.520000	0.60524	2.808000	0.96608	0.655000	0.94253	GGA		0.373	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		Missense_Mutation
OPN4	94233	broad.mit.edu	37	10	88419730	88419730	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr10:88419730G>C	ENST00000241891.5	+	6	1046	c.879G>C	c.(877-879)aaG>aaC	p.K293N	OPN4_ENST00000372071.2_Missense_Mutation_p.K304N	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	293					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)	p.K304N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GCGAGTGCAAGATGGCCAAGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	10											149.0	102.0	118.0					10																	88419730		2203	4300	6503	88409710	SO:0001583	missense	94233			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.879G>C	10.37:g.88419730G>C	ENSP00000241891:p.Lys293Asn		88409710	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843728	0.71488	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.42900	0.96;0.96;0.96	5.24	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.71264	0.3319	H	0.97659	4.05	0.45979	D	0.998796	D;D;P	0.60575	0.988;0.963;0.953	D;P;P	0.64410	0.925;0.9;0.725	T	0.74147	-0.3759	9	0.87932	D	0	.	8.9886	0.36010	0.3288:0.0:0.6712:0.0	.	304;293;304	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	N	304;293;304	ENSP00000361141:K304N;ENSP00000241891:K293N;ENSP00000393132:K304N	ENSP00000241891:K293N	K	+	3	2	OPN4	88409710	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.641000	0.24720	0.158000	0.19367	0.650000	0.86243	AAG		0.627	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282		Missense_Mutation
HPSE2	60495	broad.mit.edu	37	10	100904126	100904126	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr10:100904126T>A	ENST00000370552.3	-	3	538	c.479A>T	c.(478-480)aAa>aTa	p.K160I	HPSE2_ENST00000370546.1_Missense_Mutation_p.K160I|HPSE2_ENST00000404542.1_Intron|HPSE2_ENST00000370549.1_Missense_Mutation_p.K160I	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	160					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.K160I(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GCCTTTCTGTTTATCTAAGGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	10											101.0	101.0	101.0					10																	100904126		2203	4300	6503	100894116	SO:0001583	missense	60495			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.479A>T	10.37:g.100904126T>A	ENSP00000359583:p.Lys160Ile		100894116	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648253	0.87958	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546	T;T;T	0.28666	7.09;1.6;7.09	5.81	5.81	0.92471	Glycoside hydrolase, superfamily (1);	0.060394	0.64402	D	0.000006	T	0.47488	0.1448	L	0.51422	1.61	0.80722	D	1	D;D;D	0.69078	0.99;0.997;0.984	P;P;P	0.61201	0.885;0.885;0.77	T	0.36939	-0.9727	10	0.46703	T	0.11	-5.7058	16.1498	0.81605	0.0:0.0:0.0:1.0	.	160;160;160	Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;HPSE2_HUMAN	I	160	ENSP00000359583:K160I;ENSP00000359580:K160I;ENSP00000359577:K160I	ENSP00000359577:K160I	K	-	2	0	HPSE2	100894116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.552000	0.82192	2.216000	0.71823	0.528000	0.53228	AAA		0.403	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		Missense_Mutation
OR51F2	119694	broad.mit.edu	37	11	4843561	4843561	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:4843561G>A	ENST00000322110.5	+	1	1011	c.946G>A	c.(946-948)Gcc>Acc	p.A316T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	316						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A316T(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GATTCAAAAGGCCATTATCAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	11											122.0	121.0	121.0					11																	4843561		2201	4298	6499	4800137	SO:0001583	missense	119694			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.946G>A	11.37:g.4843561G>A	ENSP00000323952:p.Ala316Thr		4800137	Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	CCDS31361.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	6.513	0.462822	0.12402	.	.	ENSG00000176925	ENST00000322110	T	0.42131	0.98	4.71	4.71	0.59529	.	0.436640	0.16696	U	0.203360	T	0.31765	0.0807	L	0.46614	1.455	0.09310	N	1	B	0.32245	0.361	B	0.25140	0.058	T	0.11542	-1.0583	10	0.21540	T	0.41	.	10.3692	0.44044	0.0913:0.0:0.9087:0.0	.	316	Q8NH61	O51F2_HUMAN	T	316	ENSP00000323952:A316T	ENSP00000323952:A316T	A	+	1	0	OR51F2	4800137	0.371000	0.25056	0.475000	0.27278	0.207000	0.24258	1.430000	0.34914	2.598000	0.87819	0.561000	0.74099	GCC		0.373	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		Missense_Mutation
ACCS	84680	broad.mit.edu	37	11	44099401	44099401	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:44099401G>C	ENST00000263776.8	+	8	1095	c.661G>C	c.(661-663)Ggg>Cgg	p.G221R		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	221			G -> E (in a breast cancer sample; somatic mutation; dbSNP:rs35514614). {ECO:0000269|PubMed:16959974}.		biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.G221R(1)		breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CCAGGTCACTGGGCTAGACAC	0.542																																					Esophageal Squamous(158;148 1889 8077 23160 41213)											1	Substitution - Missense(1)	ovary(1)	11											69.0	58.0	62.0					11																	44099401		2203	4300	6503	44055977	SO:0001583	missense	84680			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.661G>C	11.37:g.44099401G>C	ENSP00000263776:p.Gly221Arg		44055977	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350822	0.41599	.	.	ENSG00000110455	ENST00000263776	T	0.64991	-0.13	5.23	5.23	0.72850	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.104529	0.64402	D	0.000003	T	0.56702	0.2003	L	0.41710	1.295	0.80722	D	1	B	0.27997	0.197	B	0.34242	0.178	T	0.51872	-0.8650	10	0.20519	T	0.43	-19.6139	16.5869	0.84729	0.0:0.0:1.0:0.0	.	221	Q96QU6	1A1L1_HUMAN	R	221	ENSP00000263776:G221R	ENSP00000263776:G221R	G	+	1	0	ACCS	44055977	1.000000	0.71417	0.992000	0.48379	0.979000	0.70002	5.945000	0.70226	2.450000	0.82876	0.655000	0.94253	GGG		0.542	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592		Missense_Mutation
MS4A1	931	broad.mit.edu	37	11	60230518	60230518	+	Missense_Mutation	SNP	G	G	T	rs370620216		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:60230518G>T	ENST00000534668.1	+	3	492	c.203G>T	c.(202-204)gGt>gTt	p.G68V	MS4A1_ENST00000389939.2_Missense_Mutation_p.G68V|MS4A1_ENST00000534503.1_3'UTR|MS4A1_ENST00000345732.4_Missense_Mutation_p.G68V|MS4A1_ENST00000528313.1_Intron|MS4A1_ENST00000532073.1_Missense_Mutation_p.G68V	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	68					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.G68V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	GCCCTGGGGGGTCTTCTGATG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		17878	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11											109.0	107.0	108.0					11																	60230518		2203	4300	6503	59987094	SO:0001583	missense	931			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.203G>T	11.37:g.60230518G>T	ENSP00000433277:p.Gly68Val		59987094	A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	ENST00000534668.1	37	CCDS31570.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115348	0.56505	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000533306;ENST00000389939	T;T;T;T;T	0.02140	4.43;4.43;4.43;4.43;4.43	5.93	5.93	0.95920	.	0.232971	0.43260	D	0.000583	T	0.05318	0.0141	L	0.31157	0.91	0.41732	D	0.989569	P;D;D	0.63880	0.896;0.993;0.993	P;D;D	0.68039	0.596;0.955;0.955	T	0.49322	-0.8952	10	0.05620	T	0.96	-13.3524	15.854	0.78960	0.0:0.0:1.0:0.0	.	68;68;68	E9PKH8;A8K803;P11836	.;.;CD20_HUMAN	V	68;68;68;71;68	ENSP00000314620:G68V;ENSP00000433519:G68V;ENSP00000433277:G68V;ENSP00000437002:G71V;ENSP00000374589:G68V	ENSP00000314620:G68V	G	+	2	0	MS4A1	59987094	0.350000	0.24878	0.076000	0.20297	0.969000	0.65631	3.118000	0.50414	2.826000	0.97356	0.655000	0.94253	GGT		0.522	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1			Missense_Mutation
FADS2	9415	broad.mit.edu	37	11	61605272	61605272	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:61605272C>G	ENST00000278840.4	+	2	860	c.230C>G	c.(229-231)cCt>cGt	p.P77R	FADS2_ENST00000521849.1_Missense_Mutation_p.P77R|FADS2_ENST00000522056.1_Missense_Mutation_p.P46R|FADS2_ENST00000257261.6_Missense_Mutation_p.P55R	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	77	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.P77R(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	GCCTTCCACCCTGACCTGGAA	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											61.0	45.0	50.0					11																	61605272		2202	4299	6501	61361848	SO:0001583	missense	9415			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.230C>G	11.37:g.61605272C>G	ENSP00000278840:p.Pro77Arg		61361848	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	ENST00000278840.4	37	CCDS8012.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	1.717	-0.497564	0.04291	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000278840;ENST00000521849	T;T;T;T	0.80214	1.86;1.87;-1.35;-1.35	4.74	-1.21	0.09524	Cytochrome b5 (4);	0.512910	0.18271	N	0.146336	T	0.69360	0.3102	L	0.55017	1.72	0.24214	N	0.995469	B;B;B;B	0.20368	0.006;0.002;0.0;0.044	B;B;B;B	0.26416	0.013;0.021;0.005;0.069	T	0.55023	-0.8205	10	0.32370	T	0.25	-20.568	3.0092	0.06039	0.1079:0.4324:0.1203:0.3395	.	46;77;77;55	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	R	55;46;77;77	ENSP00000257261:P55R;ENSP00000429500:P46R;ENSP00000278840:P77R;ENSP00000431091:P77R	ENSP00000257261:P55R	P	+	2	0	FADS2	61361848	0.169000	0.23002	0.111000	0.21465	0.746000	0.42486	0.660000	0.25009	-0.045000	0.13468	0.655000	0.94253	CCT		0.597	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375586.2	NM_004265		Missense_Mutation
GAB2	9846	broad.mit.edu	37	11	77934516	77934516	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:77934516G>C	ENST00000361507.4	-	6	1594	c.1509C>G	c.(1507-1509)agC>agG	p.S503R	GAB2_ENST00000340149.2_Missense_Mutation_p.S465R	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	503					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.S503R(1)	INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CACTTCCTCTGCTGGGGCCTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	11											172.0	162.0	165.0					11																	77934516		2200	4292	6492	77612164	SO:0001583	missense	9846			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1509C>G	11.37:g.77934516G>C	ENSP00000354952:p.Ser503Arg		77612164	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	CCDS8259.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	8.724	0.915036	0.17907	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.15372	2.43;2.65	4.67	2.53	0.30540	.	0.362359	0.25400	U	0.030943	T	0.09423	0.0232	L	0.38175	1.15	0.41338	D	0.987284	B	0.12630	0.006	B	0.08055	0.003	T	0.22452	-1.0216	10	0.16420	T	0.52	-21.4563	1.0785	0.01638	0.1754:0.2008:0.3653:0.2585	.	503	Q9UQC2	GAB2_HUMAN	R	465;503	ENSP00000343959:S465R;ENSP00000354952:S503R	ENSP00000343959:S465R	S	-	3	2	GAB2	77612164	0.932000	0.31603	0.975000	0.42487	0.993000	0.82548	-0.074000	0.11450	0.551000	0.29008	0.561000	0.74099	AGC		0.547	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		Missense_Mutation
DSCAML1	57453	broad.mit.edu	37	11	117387316	117387316	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr11:117387316C>A	ENST00000321322.6	-	8	1830	c.1829G>T	c.(1828-1830)cGc>cTc	p.R610L	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R340L	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	550	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R610L(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CACCACCTGGCGGTGGTTGTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											94.0	75.0	81.0					11																	117387316		2201	4296	6497	116892526	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1829G>T	11.37:g.117387316C>A	ENSP00000315465:p.Arg610Leu		116892526	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722927	0.89298	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.64260	-0.09;-0.09	4.1	4.1	0.47936	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84415	0.5467	H	0.95004	3.61	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.89653	0.3871	9	0.87932	D	0	.	16.8526	0.85998	0.0:1.0:0.0:0.0	.	550	Q8TD84	DSCL1_HUMAN	L	340;610;317	ENSP00000434335:R340L;ENSP00000315465:R610L	ENSP00000315465:R610L	R	-	2	0	DSCAML1	116892526	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.609000	0.82925	2.273000	0.75805	0.462000	0.41574	CGC		0.592	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		Missense_Mutation
NAV3	89795	broad.mit.edu	37	12	78513480	78513480	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr12:78513480C>G	ENST00000397909.2	+	15	3677	c.3504C>G	c.(3502-3504)agC>agG	p.S1168R	NAV3_ENST00000266692.7_Missense_Mutation_p.S1168R|NAV3_ENST00000228327.6_Missense_Mutation_p.S1168R|NAV3_ENST00000536525.2_Missense_Mutation_p.S1168R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1168	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.S1168R(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACGTCAGCAGCAAGTCTGCTG	0.552										HNSCC(70;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											68.0	72.0	71.0					12																	78513480		1957	4129	6086	77037611	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3504C>G	12.37:g.78513480C>G	ENSP00000381007:p.Ser1168Arg		77037611	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		SNP	25	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.62|18.62	3.662745|3.662745	0.67700|0.67700	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	.|T;T;T;T	.|0.30714	.|1.52;1.52;1.52;1.52	5.55|5.55	3.74|3.74	0.42951|0.42951	.|.	.|0.000000	.|0.48286	.|U	.|0.000198	T|T	0.47002|0.47002	0.1422|0.1422	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.997;0.999;0.999;0.998	.|D;D;P;P	.|0.70935	.|0.929;0.971;0.869;0.876	T|T	0.41945|0.41945	-0.9480|-0.9480	5|10	.|0.72032	.|D	.|0.01	-17.1818|-17.1818	12.1108|12.1108	0.53838|0.53838	0.0:0.8608:0.0:0.1392|0.0:0.8608:0.0:0.1392	.|.	.|1168;1168;1168;1168	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	E|R	240|1168	.|ENSP00000446132:S1168R;ENSP00000381007:S1168R;ENSP00000228327:S1168R;ENSP00000266692:S1168R	.|ENSP00000228327:S1168R	Q|S	+|+	1|3	0|2	NAV3|NAV3	77037611|77037611	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	2.353000|2.353000	0.44089|0.44089	0.711000|0.711000	0.32018|0.32018	0.655000|0.655000	0.94253|0.94253	CAA|AGC		0.552	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		Missense_Mutation
LRRIQ1	84125	broad.mit.edu	37	12	85449556	85449556	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr12:85449556C>T	ENST00000393217.2	+	8	1046	c.985C>T	c.(985-987)Cga>Tga	p.R329*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	329	Glu-rich.							p.R329*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		agcaaaaatacgacaaaagga	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	12											26.0	27.0	26.0					12																	85449556		2196	4279	6475	83973687	SO:0001587	stop_gained	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.985C>T	12.37:g.85449556C>T	ENSP00000376910:p.Arg329*		83973687	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225824	0.39300	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.27	2.12	0.27331	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0023	0.58683	0.5332:0.4668:0.0:0.0	.	.	.	.	X	329;304;329	.	ENSP00000256007:R329X	R	+	1	2	LRRIQ1	83973687	0.025000	0.19082	0.620000	0.29132	0.117000	0.20001	0.396000	0.20867	0.554000	0.29061	0.313000	0.20887	CGA		0.343	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		Nonsense_Mutation
EP400	57634	broad.mit.edu	37	12	132516556	132516556	+	Missense_Mutation	SNP	A	A	C	rs75778935		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr12:132516556A>C	ENST00000333577.4	+	31	6030	c.5921A>C	c.(5920-5922)cAc>cCc	p.H1974P	EP400_ENST00000332482.4_Missense_Mutation_p.H1901P|SNORA49_ENST00000386157.1_RNA|EP400_ENST00000389561.2_Missense_Mutation_p.H1938P|EP400_ENST00000389562.2_Missense_Mutation_p.H1937P|EP400_ENST00000330386.6_Missense_Mutation_p.H1857P			Q96L91	EP400_HUMAN	E1A binding protein p400	1974	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.H1937P(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CTCTCCACTCACAGCCGTACC	0.453																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	12											149.0	150.0	150.0					12																	132516556		2203	4300	6503	131082509	SO:0001583	missense	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.5921A>C	12.37:g.132516556A>C	ENSP00000333602:p.His1974Pro		131082509	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	12.68	2.012076	0.35511	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89	5.9	4.76	0.60689	.	0.147691	0.64402	D	0.000019	T	0.79458	0.4449	L	0.46157	1.445	0.38154	D	0.93883	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.61201	0.885;0.885;0.885	T	0.82194	-0.0578	10	0.72032	D	0.01	.	11.8911	0.52630	0.9321:0.0:0.0679:0.0	.	1938;1857;1937	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	P	1974;1938;1937;1901;1857;1938	ENSP00000333602:H1974P;ENSP00000374212:H1938P;ENSP00000374213:H1937P;ENSP00000331737:H1901P;ENSP00000330620:H1857P	ENSP00000330620:H1857P	H	+	2	0	EP400	131082509	1.000000	0.71417	0.975000	0.42487	0.821000	0.46438	6.269000	0.72558	1.058000	0.40530	0.460000	0.39030	CAC		0.453	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		Missense_Mutation
SYNE2	23224	broad.mit.edu	37	14	64604641	64604641	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr14:64604641T>G	ENST00000344113.4	+	79	14995	c.14783T>G	c.(14782-14784)cTg>cGg	p.L4928R	SYNE2_ENST00000555002.1_Missense_Mutation_p.L1562R|SYNE2_ENST00000358025.3_Missense_Mutation_p.L4928R|SYNE2_ENST00000357395.3_Missense_Mutation_p.L1313R|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1313R|SYNE2_ENST00000554584.1_Missense_Mutation_p.L4845R|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4928					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L4928R(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGGTTGTCCCTGAACAAGAAA	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											77.0	68.0	71.0					14																	64604641		2203	4300	6503	63674394	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14783T>G	14.37:g.64604641T>G	ENSP00000341781:p.Leu4928Arg		63674394	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647780	0.29336	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.87	5.87	0.94306	.	0.000000	0.42172	D	0.000750	T	0.69895	0.3162	L	0.60455	1.87	0.35560	D	0.804607	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.91635	0.988;0.981;0.999	T	0.78094	-0.2338	10	0.66056	D	0.02	.	16.2676	0.82597	0.0:0.0:0.0:1.0	.	1313;4928;4928	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	R	4928;1313;4928;4845;4845;1562;1313	ENSP00000350719:L4928R;ENSP00000349969:L1313R;ENSP00000341781:L4928R;ENSP00000452570:L4845R;ENSP00000450831:L1562R;ENSP00000378249:L1313R	ENSP00000261678:L4845R	L	+	2	0	SYNE2	63674394	0.155000	0.22806	0.997000	0.53966	0.995000	0.86356	2.120000	0.41968	2.243000	0.73865	0.533000	0.62120	CTG		0.498	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		Missense_Mutation
DMXL2	23312	broad.mit.edu	37	15	51828974	51828974	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr15:51828974A>C	ENST00000251076.5	-	12	1990	c.1703T>G	c.(1702-1704)aTa>aGa	p.I568R	DMXL2_ENST00000543779.2_Missense_Mutation_p.I568R|DMXL2_ENST00000449909.3_Missense_Mutation_p.I568R	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	568						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.I568R(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TGTCGCATTTATACAGGCATA	0.433																																																1	Substitution - Missense(1)	ovary(1)	15											114.0	97.0	103.0					15																	51828974		2195	4293	6488	49616266	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1703T>G	15.37:g.51828974A>C	ENSP00000251076:p.Ile568Arg		49616266	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	10.77	1.442881	0.25987	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.50277	0.75;0.75;0.75	4.7	2.43	0.29744	.	0.356819	0.33712	N	0.004632	T	0.23492	0.0568	N	0.14661	0.345	0.30642	N	0.756302	B;B;B	0.16166	0.003;0.01;0.016	B;B;B	0.19666	0.012;0.026;0.017	T	0.13791	-1.0496	10	0.13470	T	0.59	.	4.7768	0.13184	0.559:0.0:0.441:0.0	.	568;568;568	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	R	568	ENSP00000251076:I568R;ENSP00000441858:I568R;ENSP00000400855:I568R	ENSP00000251076:I568R	I	-	2	0	DMXL2	49616266	0.728000	0.28080	0.990000	0.47175	0.981000	0.71138	3.181000	0.50903	0.896000	0.36366	0.533000	0.62120	ATA		0.433	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		Missense_Mutation
MEF2A	4205	broad.mit.edu	37	15	100250958	100250958	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr15:100250958T>A	ENST00000557785.1	+	10	1454	c.1105T>A	c.(1105-1107)Tct>Act	p.S369T	MEF2A_ENST00000558812.1_Missense_Mutation_p.S309T|MEF2A_ENST00000453228.2_Missense_Mutation_p.S369T|MEF2A_ENST00000449277.2_Missense_Mutation_p.S301T|MEF2A_ENST00000557942.1_Missense_Mutation_p.S377T|MEF2A_ENST00000338042.6_Missense_Mutation_p.S378T|MEF2A_ENST00000354410.5_Missense_Mutation_p.S371T	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	379					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.S379T(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			AGCCCTCAGCTCTCTTGTGTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	15											45.0	47.0	46.0					15																	100250958		2051	4204	6255	98068481	SO:0001583	missense	4205				CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1105T>A	15.37:g.100250958T>A	ENSP00000453441:p.Ser369Thr		98068481	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	37	CCDS53978.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	28.8	4.948502	0.92593	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T;T	0.10573	2.86;2.86;2.86;3.04	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.23289	0.0563	L	0.34521	1.04	0.39782	D	0.97231	D;D;D;D;D;D	0.67145	0.979;0.992;0.975;0.996;0.988;0.993	D;P;D;D;D;D	0.79108	0.983;0.868;0.942;0.99;0.992;0.981	T	0.01791	-1.1273	10	0.42905	T	0.14	-20.8248	15.8544	0.78965	0.0:0.0:0.0:1.0	.	379;309;290;369;371;377	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	T	369;371;378;309	ENSP00000404110:S369T;ENSP00000346389:S371T;ENSP00000337202:S378T;ENSP00000399460:S309T	ENSP00000337202:S378T	S	+	1	0	MEF2A	98068481	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.147000	0.66899	0.460000	0.39030	TCT		0.527	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1			Missense_Mutation
SLC9A3R2	9351	broad.mit.edu	37	16	2090018	2090018	+	IGR	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:2090018C>T	ENST00000424542.2	+	0	2194				NTHL1_ENST00000562951.1_5'UTR|NTHL1_ENST00000219066.1_Silent_p.L282L	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2						negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)	p.L282L(1)		central_nervous_system(1)|endometrium(1)	2						CGAAGCCCACCAAGAGTCCAT	0.682																																					Ovarian(69;105 1552 17724 23473)											1	Substitution - coding silent(1)	ovary(1)	16											52.0	55.0	54.0					16																	2090018		2198	4300	6498	2030019	SO:0001628	intergenic_variant	4913			AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956		16.37:g.2090018C>T			2030019	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Silent	SNP	ENST00000424542.2	37	CCDS45382.1	SNP	21	Broad																																																																																				0.682	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434448.1			Silent
ABCA3	21	broad.mit.edu	37	16	2347484	2347484	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:2347484G>C	ENST00000301732.5	-	17	2809	c.2109C>G	c.(2107-2109)atC>atG	p.I703M	ABCA3_ENST00000382381.3_Missense_Mutation_p.I645M	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	703	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.I703M(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GAAGATCCCAGATGGCCCTCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	16											159.0	120.0	134.0					16																	2347484		2198	4300	6498	2287485	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2109C>G	16.37:g.2347484G>C	ENSP00000301732:p.Ile703Met		2287485	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	9.571	1.121158	0.20877	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.94650	-3.48	6.17	5.22	0.72569	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.104288	0.64402	D	0.000004	D	0.90820	0.7117	N	0.16708	0.43	0.80722	D	1	B;B;B	0.33212	0.402;0.078;0.073	B;B;B	0.43386	0.418;0.067;0.082	D	0.89902	0.4045	10	0.66056	D	0.02	.	9.3489	0.38126	0.0747:0.232:0.6933:0.0	.	703;707;703	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	M	703;707	ENSP00000301732:I703M	ENSP00000301732:I703M	I	-	3	3	ABCA3	2287485	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	1.932000	0.40143	1.632000	0.50472	-0.140000	0.14226	ATC		0.617	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		Missense_Mutation
C16orf62	57020	broad.mit.edu	37	16	19584448	19584448	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:19584448C>G	ENST00000251143.5	+	4	305	c.293C>G	c.(292-294)tCc>tGc	p.S98C	C16orf62_ENST00000538853.1_Missense_Mutation_p.S187C|C16orf62_ENST00000542263.1_Missense_Mutation_p.S187C|C16orf62_ENST00000438132.3_Missense_Mutation_p.S187C|C16orf62_ENST00000417362.2_Missense_Mutation_p.S98C			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	98						integral component of membrane (GO:0016021)		p.S98C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TAGGACAGCTCCAGAAGGAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	16											128.0	125.0	126.0					16																	19584448		2197	4300	6497	19491949	SO:0001583	missense	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.293C>G	16.37:g.19584448C>G	ENSP00000251143:p.Ser98Cys		19491949	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048294	0.55110	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	T;T;T;T;T	0.53857	1.49;0.6;1.49;1.49;1.49	5.32	5.32	0.75619	.	0.500913	0.19378	N	0.115732	T	0.44180	0.1281	L	0.29908	0.895	0.80722	D	1	B;D;P	0.53885	0.32;0.963;0.921	B;P;P	0.46479	0.23;0.518;0.518	T	0.41413	-0.9510	10	0.56958	D	0.05	-5.8276	8.4506	0.32869	0.1537:0.7663:0.0:0.0799	.	187;98;187	F5H7K1;Q7Z3J2;E7EWW0	.;CP062_HUMAN;.	C	187;187;187;98;98	ENSP00000400815:S187C;ENSP00000444363:S187C;ENSP00000442468:S187C;ENSP00000251143:S98C;ENSP00000395973:S98C	ENSP00000251143:S98C	S	+	2	0	C16orf62	19491949	0.858000	0.29795	0.997000	0.53966	0.734000	0.41952	1.274000	0.33132	2.488000	0.83962	0.557000	0.71058	TCC		0.403	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314		Missense_Mutation
PALB2	79728	broad.mit.edu	37	16	23646759	23646759	+	Nonsense_Mutation	SNP	G	G	A	rs587776411		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:23646759G>A	ENST00000261584.4	-	4	1260	c.1108C>T	c.(1108-1110)Cag>Tag	p.Q370*		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	370	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q370*(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TCACTTTCCTGAAGATTTTCA	0.393			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	1	Substitution - Nonsense(1)	ovary(1)	16											131.0	132.0	132.0					16																	23646759		2197	4300	6497	23554260	SO:0001587	stop_gained	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1108C>T	16.37:g.23646759G>A	ENSP00000261584:p.Gln370*		23554260	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Nonsense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111780	0.56398	.	.	ENSG00000083093	ENST00000261584	.	.	.	5.97	2.88	0.33553	.	0.679765	0.14134	N	0.339144	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	0.2715	5.1457	0.14983	0.0783:0.1441:0.6283:0.1494	.	.	.	.	X	370	.	ENSP00000261584:Q370X	Q	-	1	0	PALB2	23554260	0.000000	0.05858	0.061000	0.19648	0.028000	0.11728	0.095000	0.15127	0.387000	0.25024	0.655000	0.94253	CAG		0.393	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675		Nonsense_Mutation
MT4	84560	broad.mit.edu	37	16	56602819	56602819	+	Nonsense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:56602819C>G	ENST00000219162.3	+	3	244	c.164C>G	c.(163-165)tCa>tGa	p.S55*		NM_032935.2	NP_116324	P47944	MT4_HUMAN	metallothionein 4	55					cellular metal ion homeostasis (GO:0006875)		metal ion binding (GO:0046872)	p.S55*(1)		ovary(1)|upper_aerodigestive_tract(1)	2						AAAGGAGGCTCAGACAAGTGC	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	16											95.0	103.0	101.0					16																	56602819		2193	4299	6492	55160320	SO:0001587	stop_gained	84560			BC113442	CCDS42165.1	16q13	2014-09-04	2007-01-26		ENSG00000102891	ENSG00000102891		"""Metallothioneins"""	18705	protein-coding gene	gene with protein product		606206	"""metallothionein IV"""			8003488	Standard	NM_032935		Approved	MTIV	uc002eje.1	P47944	OTTHUMG00000176863	ENST00000219162.3:c.164C>G	16.37:g.56602819C>G	ENSP00000219162:p.Ser55*		55160320	Q14DA1	Nonsense_Mutation	SNP	ENST00000219162.3	37	CCDS42165.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063216	0.76187	.	.	ENSG00000102891	ENST00000219162	.	.	.	5.92	5.92	0.95590	.	0.481217	0.19339	N	0.116694	.	.	.	.	.	.	0.46149	D	0.998895	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-0.0065	15.8214	0.78648	0.0:1.0:0.0:0.0	.	.	.	.	X	55	.	ENSP00000219162:S55X	S	+	2	0	MT4	55160320	0.801000	0.28930	0.139000	0.22197	0.969000	0.65631	5.330000	0.65899	2.810000	0.96702	0.650000	0.86243	TCA		0.592	MT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434118.1	NM_032935		Nonsense_Mutation
TLDC1	57707	broad.mit.edu	37	16	84523001	84523001	+	Missense_Mutation	SNP	C	C	A	rs531177116		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr16:84523001C>A	ENST00000343629.6	-	4	594	c.412G>T	c.(412-414)Gtg>Ttg	p.V138L	TLDC1_ENST00000535580.1_Missense_Mutation_p.V111L|TLDC1_ENST00000561807.1_5'UTR	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	138						lysosomal membrane (GO:0005765)		p.V138L(1)									AGCACGTGCACCACAGAGCCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											56.0	52.0	53.0					16																	84523001		2200	4300	6500	83080502	SO:0001583	missense	57707			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.412G>T	16.37:g.84523001C>A	ENSP00000343635:p.Val138Leu		83080502	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667276	0.47677	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	T;T	0.15256	2.44;2.44	5.04	4.06	0.47325	.	0.399254	0.27522	N	0.018990	T	0.18130	0.0435	M	0.74258	2.255	0.09310	N	0.999998	P;B	0.40431	0.717;0.168	B;B	0.37198	0.243;0.045	T	0.18085	-1.0348	10	0.39692	T	0.17	-5.9212	6.4774	0.22043	0.0:0.6849:0.1552:0.1599	.	111;138	F5GWS3;Q6P9B6	.;K1609_HUMAN	L	138;111	ENSP00000343635:V138L;ENSP00000441997:V111L	ENSP00000343635:V138L	V	-	1	0	KIAA1609	83080502	0.008000	0.16893	0.101000	0.21167	0.991000	0.79684	1.505000	0.35736	1.069000	0.40788	0.591000	0.81541	GTG		0.542	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947		Missense_Mutation
OR1D2	4991	broad.mit.edu	37	17	2995765	2995765	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr17:2995765A>T	ENST00000331459.1	-	1	525	c.526T>A	c.(526-528)Tac>Aac	p.Y176N		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	176					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y176N(1)		kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						CAGAAGATGTAGTGGATTTTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	17											102.0	94.0	97.0					17																	2995765		2203	4300	6503	2942515	SO:0001583	missense	4991			U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.526T>A	17.37:g.2995765A>T	ENSP00000327585:p.Tyr176Asn		2942515	Q6IFL8|Q96RA4|Q9UM78	Missense_Mutation	SNP	ENST00000331459.1	37	CCDS11019.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	a	12.06	1.824131	0.32237	.	.	ENSG00000184166	ENST00000331459	T	0.00058	8.79	3.21	0.674	0.17946	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	N	0.17838	0.53	0.09310	N	1	D	0.53885	0.963	P	0.56088	0.791	T	0.47636	-0.9102	9	0.66056	D	0.02	.	1.5596	0.02592	0.3674:0.0:0.3294:0.3032	.	176	P34982	OR1D2_HUMAN	N	176	ENSP00000327585:Y176N	ENSP00000327585:Y176N	Y	-	1	0	OR1D2	2942515	0.982000	0.34865	0.723000	0.30687	0.254000	0.26022	2.546000	0.45778	0.288000	0.22398	0.443000	0.29094	TAC		0.468	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1	NM_002548		Missense_Mutation
NLRP1	22861	broad.mit.edu	37	17	5462708	5462708	+	Silent	SNP	C	C	T	rs200867395		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr17:5462708C>T	ENST00000572272.1	-	4	1307	c.1308G>A	c.(1306-1308)gcG>gcA	p.A436A	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Silent_p.A436A|NLRP1_ENST00000345221.3_Silent_p.A436A|NLRP1_ENST00000269280.4_Silent_p.A436A|NLRP1_ENST00000262467.5_Silent_p.A436A|NLRP1_ENST00000354411.3_Silent_p.A436A			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	436	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.A436A(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GCAGTGCATCCGCCGGCTGTG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	17											30.0	31.0	31.0					17																	5462708		2203	4300	6503	5403432	SO:0001819	synonymous_variant	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1308G>A	17.37:g.5462708C>T			5403432	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	ENST00000572272.1	37	CCDS42246.1	SNP	23	Broad																																																																																				0.577	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004		Silent
CASC3	22794	broad.mit.edu	37	17	38319916	38319916	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr17:38319916G>C	ENST00000264645.7	+	7	1194	c.968G>C	c.(967-969)cGt>cCt	p.R323P		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	323					gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)	p.R323P(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						AAGGAAGGTCGTGCTGGTTTT	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											229.0	218.0	222.0					17																	38319916		2203	4300	6503	35573442	SO:0001583	missense	22794			X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.968G>C	17.37:g.38319916G>C	ENSP00000264645:p.Arg323Pro		35573442	A8K8R0	Missense_Mutation	SNP	ENST00000264645.7	37	CCDS11362.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460420	0.84317	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.74	5.74	0.90152	.	0.109592	0.64402	D	0.000018	T	0.73385	0.3580	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	T	0.74771	-0.3552	9	0.72032	D	0.01	-5.2928	19.5335	0.95239	0.0:0.0:1.0:0.0	.	323;323	B4DKR6;O15234	.;CASC3_HUMAN	P	323	.	ENSP00000264645:R323P	R	+	2	0	CASC3	35573442	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	6.778000	0.75043	2.717000	0.92951	0.655000	0.94253	CGT		0.542	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359		Missense_Mutation
MED13	9969	broad.mit.edu	37	17	60060105	60060105	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr17:60060105C>G	ENST00000397786.2	-	16	3335	c.3259G>C	c.(3259-3261)Gac>Cac	p.D1087H		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1087					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.D1087H(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AAGTTACAGTCTTTAAACAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	17											94.0	86.0	89.0					17																	60060105		1932	4148	6080	57414887	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3259G>C	17.37:g.60060105C>G	ENSP00000380888:p.Asp1087His		57414887	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114500	0.77210	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.89050	-2.46	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.95020	0.8388	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94935	0.8086	10	0.87932	D	0	-11.3291	20.1356	0.98028	0.0:1.0:0.0:0.0	.	1087	Q9UHV7	MED13_HUMAN	H	1087;1086	ENSP00000380888:D1087H	ENSP00000262436:D1086H	D	-	1	0	MED13	57414887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.755000	0.94549	0.650000	0.86243	GAC		0.403	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		Missense_Mutation
TRAPPC8	22878	broad.mit.edu	37	18	29412046	29412046	+	Splice_Site	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr18:29412046C>T	ENST00000283351.4	-	28	4409		c.e28+1		TRAPPC8_ENST00000582539.1_Splice_Site	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8						vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAAATCTTTACCTTGTTGTTT	0.323																																																1	Unknown(1)	ovary(1)	18											88.0	82.0	84.0					18																	29412046		2203	4294	6497	27666044	SO:0001630	splice_region_variant	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.4073+1G>A	18.37:g.29412046C>T			27666044	A0JP15|B3KME5|Q9H0L2	Splice_Site_SNP	SNP	ENST00000283351.4	37	CCDS11901.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128880	0.77549	.	.	ENSG00000153339	ENST00000283351	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6343	0.95724	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRAPPC8	27666044	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.611000	0.74183	2.648000	0.89879	0.460000	0.39030	.		0.323	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	Intron	Splice_Site_SNP
ISYNA1	51477	broad.mit.edu	37	19	18546730	18546730	+	Splice_Site	SNP	G	G	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr19:18546730G>T	ENST00000338128.8	-	8	1194	c.977C>A	c.(976-978)aCc>aAc	p.T326N	ISYNA1_ENST00000545187.1_Splice_Site_p.T176N|ISYNA1_ENST00000578963.1_Splice_Site_p.T198N|ISYNA1_ENST00000317018.6_Splice_Site_p.T124N|ISYNA1_ENST00000457269.4_Splice_Site_p.T272N	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	326					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)	p.T326N(1)		breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						GATGGACATGGTCTGTGGGTA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											127.0	135.0	132.0					19																	18546730		2203	4300	6503	18407730	SO:0001630	splice_region_variant	51477				CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.976-1C>A	19.37:g.18546730G>T			18407730	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Missense_Mutation	SNP	ENST00000338128.8	37	CCDS12379.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448362	0.43429	.	.	ENSG00000105655	ENST00000338128;ENST00000457269;ENST00000545187;ENST00000317018	.	.	.	4.58	4.58	0.56647	Myo-inositol-1-phosphate synthase, GAPDH-like (1);	0.136554	0.48767	D	0.000174	T	0.38957	0.1060	N	0.08118	0	0.44899	D	0.997919	P;B;B;B	0.35107	0.484;0.134;0.288;0.147	B;B;B;B	0.40038	0.317;0.212;0.317;0.169	T	0.49960	-0.8883	9	0.66056	D	0.02	-28.2331	15.2171	0.73277	0.0:0.0:1.0:0.0	.	124;272;326;176	B7Z3K3;G5E9U0;Q9NPH2;G3V1R9	.;.;INO1_HUMAN;.	N	326;272;176;124	.	ENSP00000315147:T124N	T	-	2	0	ISYNA1	18407730	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.695000	0.74593	2.264000	0.75181	0.561000	0.74099	ACC		0.627	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	Missense_Mutation	Missense_Mutation
SYNE4	163183	broad.mit.edu	37	19	36498131	36498131	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr19:36498131T>C	ENST00000324444.3	-	3	430	c.319A>G	c.(319-321)Aac>Gac	p.N107D	ALKBH6_ENST00000495116.2_5'Flank|AC002116.8_ENST00000473572.2_RNA|SYNE4_ENST00000340477.5_Intron	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	107					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)		p.N107D(1)									TGCAGGCTGTTCTGCTCAGCC	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											13.0	16.0	15.0					19																	36498131		1967	4144	6111	41189971	SO:0001583	missense	163183			BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.319A>G	19.37:g.36498131T>C	ENSP00000316130:p.Asn107Asp		41189971	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	ENST00000324444.3	37	CCDS42553.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	0.080	-1.184656	0.01620	.	.	ENSG00000181392	ENST00000324444;ENST00000490730	T;T	0.37584	1.88;1.19	5.11	3.0	0.34707	.	0.460773	0.18818	N	0.130312	T	0.06508	0.0167	N	0.00170	-1.935	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37663	-0.9696	10	0.02654	T	1	-10.7669	6.9356	0.24464	0.0:0.7999:0.0:0.2001	.	107;107	D6RAE3;Q8N205	.;SYNE4_HUMAN	D	107	ENSP00000316130:N107D;ENSP00000422716:N107D	ENSP00000316130:N107D	N	-	1	0	C19orf46	41189971	0.988000	0.35896	0.999000	0.59377	0.129000	0.20672	1.049000	0.30392	1.488000	0.48433	-0.232000	0.12228	AAC		0.652	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109525.3	NM_001039876		Missense_Mutation
PRR30	339779	broad.mit.edu	37	2	27360153	27360153	+	Missense_Mutation	SNP	G	G	C	rs200324255		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:27360153G>C	ENST00000335524.3	-	3	1570	c.1045C>G	c.(1045-1047)Cca>Gca	p.P349A	PREB_ENST00000406567.3_5'Flank|PREB_ENST00000260643.2_5'Flank|PREB_ENST00000416802.1_5'Flank	NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		349								p.P349A(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGGACTGGGTCGGCCCGG	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											88.0	87.0	87.0					2																	27360153		2203	4300	6503	27213657	SO:0001583	missense	339779																														ENST00000335524.3:c.1045C>G	2.37:g.27360153G>C	ENSP00000335017:p.Pro349Ala		27213657	Q86UE2	Missense_Mutation	SNP	ENST00000335524.3	37	CCDS1739.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.075870	0.00375	.	.	ENSG00000186143	ENST00000335524	T	0.28255	1.62	3.42	1.41	0.22369	.	0.742997	0.11060	N	0.604099	T	0.17238	0.0414	N	0.24115	0.695	0.09310	N	1	B	0.28291	0.206	B	0.28139	0.086	T	0.29912	-0.9996	10	0.20046	T	0.44	0.9292	5.1999	0.15258	0.3091:0.0:0.6909:0.0	.	349	Q53SZ7	CB053_HUMAN	A	349	ENSP00000335017:P349A	ENSP00000335017:P349A	P	-	1	0	C2orf53	27213657	0.000000	0.05858	0.026000	0.17262	0.013000	0.08279	-1.167000	0.03126	0.343000	0.23821	0.561000	0.74099	CCA		0.637	C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250188.1			Missense_Mutation
PLB1	151056	broad.mit.edu	37	2	28771751	28771751	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:28771751G>A	ENST00000327757.5	+	15	1005	c.961G>A	c.(961-963)Gag>Aag	p.E321K	PLB1_ENST00000329020.6_Missense_Mutation_p.E9K|PLB1_ENST00000422425.2_Missense_Mutation_p.E332K	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	321	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.E321K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					AGAGAAAGATGAGCCATTGAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	77.0	80.0					2																	28771751		2203	4300	6503	28625255	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.961G>A	2.37:g.28771751G>A	ENSP00000330442:p.Glu321Lys		28625255	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	SNP	45	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.118|7.118	0.577344|0.577344	0.13686|0.13686	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020|ENST00000404858	T;T;T;T|.	0.13420|.	2.66;2.65;2.59;2.61|.	5.85|5.85	4.85|4.85	0.62838|0.62838	.|.	0.511052|.	0.21331|.	N|.	0.076290|.	T|T	0.59487|0.59487	0.2197|0.2197	L|L	0.53617|0.53617	1.68|1.68	0.53688|0.53688	D|D	0.999977|0.999977	B;B;B|.	0.33512|.	0.164;0.007;0.415|.	B;B;B|.	0.38264|.	0.098;0.02;0.269|.	T|T	0.57087|0.57087	-0.7871|-0.7871	10|5	0.06365|.	T|.	0.9|.	-11.1153|-11.1153	8.7775|8.7775	0.34771|0.34771	0.1284:0.0:0.8716:0.0|0.1284:0.0:0.8716:0.0	.|.	332;9;321|.	Q6P1J6-3;Q6P1J6-2;Q6P1J6|.	.;.;PLB1_HUMAN|.	K|I	321;332;31;9|330	ENSP00000330442:E321K;ENSP00000416440:E332K;ENSP00000392493:E31K;ENSP00000330729:E9K|.	ENSP00000330442:E321K|.	E|M	+|+	1|3	0|0	PLB1|PLB1	28625255|28625255	0.941000|0.941000	0.31946|0.31946	0.247000|0.247000	0.24249|0.24249	0.029000|0.029000	0.11900|0.11900	1.774000|1.774000	0.38573|0.38573	1.225000|1.225000	0.43566|0.43566	0.561000|0.561000	0.74099|0.74099	GAG|ATG		0.532	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			Missense_Mutation
NLRC4	58484	broad.mit.edu	37	2	32477582	32477582	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:32477582G>T	ENST00000404025.2	-	4	656	c.168C>A	c.(166-168)caC>caA	p.H56Q	NLRC4_ENST00000402280.1_Missense_Mutation_p.H56Q|NLRC4_ENST00000342905.6_Missense_Mutation_p.H56Q|NLRC4_ENST00000360906.5_Missense_Mutation_p.H56Q			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	56	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.H56Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TCAAAATCATGTGAATGATCC	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											155.0	144.0	147.0					2																	32477582		2203	4300	6503	32331086	SO:0001583	missense	58484			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.168C>A	2.37:g.32477582G>T	ENSP00000385090:p.His56Gln		32331086	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	CCDS33174.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857235	0.32791	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	4.1	0.0842	0.14436	DEATH-like (2);Caspase Recruitment (2);	0.128238	0.32218	N	0.006405	T	0.11665	0.0284	L	0.29908	0.895	0.32602	N	0.525749	P;P	0.47677	0.899;0.857	B;B	0.40444	0.221;0.329	T	0.28138	-1.0053	9	0.25106	T	0.35	-7.9223	6.7953	0.23722	0.5699:0.0:0.4301:0.0	.	56;56	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	Q	56	ENSP00000354159:H56Q;ENSP00000385428:H56Q;ENSP00000339666:H56Q;ENSP00000385090:H56Q	ENSP00000339666:H56Q	H	-	3	2	NLRC4	32331086	0.186000	0.23225	0.670000	0.29842	0.185000	0.23345	-0.189000	0.09629	0.126000	0.18424	0.411000	0.27672	CAC		0.408	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		Missense_Mutation
LRP1B	53353	broad.mit.edu	37	2	141571340	141571340	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:141571340A>G	ENST00000389484.3	-	32	6216	c.5245T>C	c.(5245-5247)Tgg>Cgg	p.W1749R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1749					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.W1749R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAACTGATCCAATAAAGCTTG	0.338										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											141.0	125.0	130.0					2																	141571340		2203	4300	6503	141287810	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5245T>C	2.37:g.141571340A>G	ENSP00000374135:p.Trp1749Arg		141287810	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	18.56	3.649494	0.67358	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91686	-2.89	5.93	5.93	0.95920	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.97362	0.9137	H	0.95437	3.67	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	D	0.98481	1.0605	10	0.87932	D	0	.	16.3766	0.83401	1.0:0.0:0.0:0.0	.	1749	Q9NZR2	LRP1B_HUMAN	R	1749;1687	ENSP00000374135:W1749R	ENSP00000374135:W1749R	W	-	1	0	LRP1B	141287810	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.282000	0.95840	2.263000	0.75096	0.533000	0.62120	TGG		0.338	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
RIF1	55183	broad.mit.edu	37	2	152314273	152314273	+	Splice_Site	SNP	A	A	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:152314273A>G	ENST00000243326.5	+	23	3135		c.e23-1		RIF1_ENST00000453091.2_Splice_Site|RIF1_ENST00000428287.2_Splice_Site|RIF1_ENST00000444746.2_Splice_Site|RIF1_ENST00000430328.2_Splice_Site			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1						fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.?(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CGTTTTTCCTAGTTAGAAAAG	0.294																																																1	Unknown(1)	ovary(1)	2											55.0	55.0	55.0					2																	152314273		2203	4298	6501	152022519	SO:0001630	splice_region_variant	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.2653-1A>G	2.37:g.152314273A>G			152022519	A0AVS0|Q9NS16	Splice_Site_SNP	SNP	ENST00000243326.5	37	CCDS2194.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543273	0.86022	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2196	0.82251	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIF1	152022519	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.407000	0.90218	2.308000	0.77769	0.533000	0.62120	.		0.294	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		Intron	Splice_Site_SNP
TTN	7273	broad.mit.edu	37	2	179650397	179650397	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr2:179650397G>C	ENST00000591111.1	-	15	2667	c.2443C>G	c.(2443-2445)Cac>Gac	p.H815D	TTN_ENST00000342175.6_Missense_Mutation_p.H769D|TTN_ENST00000360870.5_Missense_Mutation_p.H815D|TTN_ENST00000342992.6_Missense_Mutation_p.H815D|TTN_ENST00000359218.5_Missense_Mutation_p.H769D|TTN_ENST00000589042.1_Missense_Mutation_p.H815D|TTN_ENST00000460472.2_Missense_Mutation_p.H769D			Q8WZ42	TITIN_HUMAN	titin	33646					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.H815D(2)|p.H769D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGTAAAGTGAGGGCTAGCT	0.378																																																3	Substitution - Missense(3)	ovary(3)	2											159.0	156.0	157.0					2																	179650397		2203	4300	6503	179358642	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2443C>G	2.37:g.179650397G>C	ENSP00000465570:p.His815Asp		179358642	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.78	2.932973	0.52866	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68181	-0.31;-0.08;-0.11;-0.12;0.12	5.73	5.73	0.89815	Ribonuclease H-like (1);	.	.	.	.	T	0.76528	0.4000	L	0.32530	0.975	0.40100	D	0.976366	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.91635	0.991;0.991;0.991;0.991;0.999	T	0.78247	-0.2278	9	0.87932	D	0	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	769;769;769;815;815	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	815;769;769;769;769;815	ENSP00000343764:H815D;ENSP00000434586:H769D;ENSP00000340554:H769D;ENSP00000352154:H769D;ENSP00000354117:H815D	ENSP00000340554:H769D	H	-	1	0	TTN	179358642	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.710000	0.84655	2.854000	0.98071	0.655000	0.94253	CAC		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
SCRT2	85508	broad.mit.edu	37	20	644519	644519	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr20:644519G>T	ENST00000246104.6	-	2	1297	c.720C>A	c.(718-720)ttC>ttA	p.F240L	RP5-850E9.3_ENST00000488788.2_Intron	NM_033129.3	NP_149120.1	Q9NQ03	SCRT2_HUMAN	scratch family zinc finger 2	240					negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.F240L(1)		kidney(1)|liver(1)|ovary(1)	3						GCGCGCAGCCGAACGGCTTTT	0.697																																																1	Substitution - Missense(1)	ovary(1)	20											16.0	16.0	16.0					20																	644519		2194	4293	6487	592519	SO:0001583	missense	85508				CCDS13006.1	20p13	2013-10-09	2013-10-09		ENSG00000215397	ENSG00000215397		"""Zinc fingers, C2H2-type"""	15952	protein-coding gene	gene with protein product			"""scratch (drosophila homolog) 2, zinc finger protein"", ""scratch homolog 2, zinc finger protein (Drosophila)"""			11274425	Standard	NM_033129		Approved	ZNF898B	uc002wec.3	Q9NQ03	OTTHUMG00000130829	ENST00000246104.6:c.720C>A	20.37:g.644519G>T	ENSP00000246104:p.Phe240Leu		592519		Missense_Mutation	SNP	ENST00000246104.6	37	CCDS13006.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	g	21.1	4.098919	0.76870	.	.	ENSG00000215397	ENST00000246104	T	0.21932	1.98	3.54	0.142	0.14816	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000001	T	0.36552	0.0971	M	0.71581	2.175	0.42961	D	0.994408	D	0.76494	0.999	D	0.73380	0.98	T	0.13202	-1.0518	10	0.87932	D	0	-7.5576	5.4901	0.16771	0.1923:0.0:0.6513:0.1564	.	240	Q9NQ03	SCRT2_HUMAN	L	240	ENSP00000246104:F240L	ENSP00000246104:F240L	F	-	3	2	SCRT2	592519	0.970000	0.33590	0.978000	0.43139	0.989000	0.77384	0.025000	0.13577	0.158000	0.19367	0.457000	0.33378	TTC		0.697	SCRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253383.2	NM_033129		Missense_Mutation
LRRN4	164312	broad.mit.edu	37	20	6032815	6032816	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr20:6032815_6032816GA>TC	ENST00000378858.4	-	2	854_855	c.630_631TC>GA	c.(628-633)gaTCtc>gaGAtc	p.210_211DL>EI		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	210					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.D210_L211>EI(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GTGCCGCTGAGATCCAGGACTT	0.733																																																1	Complex - compound substitution(1)	ovary(1)	20																																								5980816	SO:0001583	missense	164312			AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.630_631delinsTC	20.37:g.6032815_6032816delinsTC	ENSP00000368135:p.D210_L211delinsEI		5980815	A8K258|Q5JWV6|Q9H419	Missense_Mutation	DNP	ENST00000378858.4	37	CCDS13097.1	DNP	33	Broad																																																																																				0.733	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611		Missense_Mutation
LZTR1	8216	broad.mit.edu	37	22	21344673	21344673	+	Splice_Site	SNP	A	A	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr22:21344673A>C	ENST00000215739.8	+	8	1010		c.e8-1		LZTR1_ENST00000479606.1_Splice_Site|LZTR1_ENST00000389355.3_Splice_Site	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTCCCCCTGCAGGTGGCCCAG	0.577																																																1	Unknown(1)	ovary(1)	22											107.0	105.0	106.0					22																	21344673		2203	4300	6503	19674673	SO:0001630	splice_region_variant	8216			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.652-1A>C	22.37:g.21344673A>C			19674673	Q14776|Q20WK0	Splice_Site_SNP	SNP	ENST00000215739.8	37	CCDS33606.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	.	18.30	3.593773	0.66219	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6769	0.62460	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LZTR1	19674673	1.000000	0.71417	0.992000	0.48379	0.640000	0.38277	9.247000	0.95444	2.172000	0.68678	0.533000	0.62120	.		0.577	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Intron	Splice_Site_SNP
CCDC116	164592	broad.mit.edu	37	22	21988734	21988734	+	Missense_Mutation	SNP	G	G	C	rs35746656		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr22:21988734G>C	ENST00000292779.3	+	3	657	c.496G>C	c.(496-498)Gcc>Ccc	p.A166P	CCDC116_ENST00000607942.1_Missense_Mutation_p.A166P	NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	166								p.A166P(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					CAGCCTCATGGCCGGCTGTCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	22											57.0	64.0	62.0					22																	21988734		2201	4299	6500	20318734	SO:0001583	missense	164592			BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.496G>C	22.37:g.21988734G>C	ENSP00000292779:p.Ala166Pro		20318734	Q8N9Y9	Missense_Mutation	SNP	ENST00000292779.3	37	CCDS13791.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771417	0.49680	.	.	ENSG00000161180	ENST00000292779	T	0.21932	1.98	4.42	4.42	0.53409	.	0.393903	0.21692	N	0.070551	T	0.36853	0.0982	L	0.46157	1.445	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.976	T	0.05903	-1.0857	9	.	.	.	-61.6135	12.7004	0.57029	0.0:0.0:1.0:0.0	.	166;166	B7Z7H5;Q8IYX3-2	.;.	P	166	ENSP00000292779:A166P	.	A	+	1	0	CCDC116	20318734	0.001000	0.12720	0.025000	0.17156	0.625000	0.37756	0.920000	0.28705	2.456000	0.83038	0.491000	0.48974	GCC		0.617	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320199.1	NM_152612		Missense_Mutation
TRIOBP	11078	broad.mit.edu	37	22	38122021	38122021	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr22:38122021C>G	ENST00000406386.3	+	7	3713	c.3458C>G	c.(3457-3459)tCt>tGt	p.S1153C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1153					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.S1153C(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCATGGACTCTCTGCACGAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	22											74.0	82.0	79.0					22																	38122021		1983	4158	6141	36451967	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3458C>G	22.37:g.38122021C>G	ENSP00000384312:p.Ser1153Cys		36451967	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103579	0.56291	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.37584	1.19	4.85	4.85	0.62838	.	.	.	.	.	T	0.44582	0.1300	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.39781	-0.9597	9	0.87932	D	0	.	9.0512	0.36378	0.0:0.9023:0.0:0.0977	.	1153	Q9H2D6	TARA_HUMAN	C	1153	ENSP00000384312:S1153C	ENSP00000384312:S1153C	S	+	2	0	TRIOBP	36451967	0.996000	0.38824	0.968000	0.41197	0.903000	0.53119	3.715000	0.54897	2.529000	0.85273	0.449000	0.29647	TCT		0.667	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			Missense_Mutation
L3MBTL2	83746	broad.mit.edu	37	22	41623859	41623859	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr22:41623859A>C	ENST00000216237.5	+	15	2032	c.1874A>C	c.(1873-1875)cAg>cCg	p.Q625P		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	625					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.Q625P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAAAAGAAACAGTTTGGGAAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	22											58.0	58.0	58.0					22																	41623859		2203	4300	6503	39953805	SO:0001583	missense	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1874A>C	22.37:g.41623859A>C	ENSP00000216237:p.Gln625Pro		39953805	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503112	0.26949	.	.	ENSG00000100395	ENST00000216237	T	0.17854	2.25	4.52	3.37	0.38596	.	0.208914	0.41001	D	0.000965	T	0.08313	0.0207	N	0.08118	0	0.35277	D	0.781008	B	0.02656	0.0	B	0.01281	0.0	T	0.15694	-1.0428	10	0.32370	T	0.25	.	9.799	0.40753	0.5344:0.4655:0.0:0.0	.	625	Q969R5	LMBL2_HUMAN	P	625	ENSP00000216237:Q625P	ENSP00000216237:Q625P	Q	+	2	0	L3MBTL2	39953805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.232000	0.43018	1.817000	0.53016	0.459000	0.35465	CAG		0.587	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488		Missense_Mutation
ZC3H7B	23264	broad.mit.edu	37	22	41752364	41752364	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr22:41752364A>G	ENST00000352645.4	+	21	2658	c.2401A>G	c.(2401-2403)Acc>Gcc	p.T801A	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.T801A	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	817					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.T801A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CATGCAGCAGACCTATGACAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	22											133.0	126.0	128.0					22																	41752364		2203	4300	6503	40082310	SO:0001583	missense	23264				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2401A>G	22.37:g.41752364A>G	ENSP00000345793:p.Thr801Ala		40082310	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	16.10	3.028115	0.54790	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.11930	2.73;2.73	5.05	4.01	0.46588	.	0.259547	0.43747	D	0.000531	T	0.09158	0.0226	N	0.22421	0.69	0.37274	D	0.907552	B	0.20988	0.05	B	0.25506	0.061	T	0.17198	-1.0377	10	0.33940	T	0.23	-16.679	7.906	0.29763	0.8433:0.0:0.1567:0.0	.	801	Q9UGR2-2	.	A	801	ENSP00000345793:T801A;ENSP00000263243:T801A	ENSP00000263243:T801A	T	+	1	0	ZC3H7B	40082310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.554000	0.60760	2.046000	0.60703	0.533000	0.62120	ACC		0.587	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590		Missense_Mutation
MYLK	4638	broad.mit.edu	37	3	123471367	123471367	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr3:123471367G>C	ENST00000475616.1	-	2	183	c.184C>G	c.(184-186)Ccc>Gcc	p.P62A	MYLK_ENST00000346322.5_Missense_Mutation_p.P62A|MYLK_ENST00000360304.3_Missense_Mutation_p.P62A|MYLK_ENST00000359169.1_Missense_Mutation_p.P62A|MYLK_ENST00000360772.3_Missense_Mutation_p.P62A			Q15746	MYLK_HUMAN	myosin light chain kinase	62	Ig-like C2-type 1.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.P62A(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GTCACCTGGGGCTCTGGGTAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	3											26.0	26.0	26.0					3																	123471367		2203	4300	6503	124954057	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.184C>G	3.37:g.123471367G>C	ENSP00000418335:p.Pro62Ala		124954057	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614342	0.87359	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616;ENST00000360367	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.44	5.44	0.79542	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87055	0.6082	M	0.89478	3.035	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.983;0.971;0.999;0.971;1.0	D	0.87657	0.2532	9	0.46703	T	0.11	.	19.2624	0.93973	0.0:0.0:1.0:0.0	.	62;62;62;62;62;62;62	Q15746-6;Q15746-5;D3DN97;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;.;MYLK_HUMAN	A	62	ENSP00000354004:P62A;ENSP00000353452:P62A;ENSP00000352088:P62A;ENSP00000320622:P62A;ENSP00000418335:P62A	ENSP00000320622:P62A	P	-	1	0	MYLK	124954057	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.468000	0.73551	2.578000	0.87016	0.655000	0.94253	CCC		0.532	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		Missense_Mutation
CHST2	9435	broad.mit.edu	37	3	142839811	142839811	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr3:142839811C>G	ENST00000309575.3	+	2	1537	c.153C>G	c.(151-153)ttC>ttG	p.F51L		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	51					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.F51L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TGAAGGTGTTCCGTAGGAAGG	0.687																																																1	Substitution - Missense(1)	ovary(1)	3											22.0	16.0	18.0					3																	142839811		2182	4269	6451	144322501	SO:0001583	missense	9435			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.153C>G	3.37:g.142839811C>G	ENSP00000307911:p.Phe51Leu		144322501	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	6.936	0.542367	0.13250	.	.	ENSG00000175040	ENST00000309575	D	0.95622	-3.76	3.4	1.57	0.23409	.	0.076281	0.52532	U	0.000074	D	0.86347	0.5911	N	0.11560	0.145	0.37464	D	0.915331	B	0.10296	0.003	B	0.04013	0.001	T	0.75360	-0.3345	10	0.18276	T	0.48	-0.8334	7.745	0.28864	0.0:0.782:0.0:0.218	.	51	Q9Y4C5	CHST2_HUMAN	L	51	ENSP00000307911:F51L	ENSP00000307911:F51L	F	+	3	2	CHST2	144322501	0.066000	0.20996	1.000000	0.80357	0.272000	0.26649	-0.488000	0.06497	0.161000	0.19458	-0.379000	0.06801	TTC		0.687	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267		Missense_Mutation
SLITRK3	22865	broad.mit.edu	37	3	164906124	164906124	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr3:164906124G>A	ENST00000475390.1	-	2	2938	c.2495C>T	c.(2494-2496)aCg>aTg	p.T832M	SLITRK3_ENST00000241274.3_Missense_Mutation_p.T832M			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	832					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.T832M(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GTGATTCACCGTCACTATGGT	0.552										HNSCC(40;0.11)																																						1	Substitution - Missense(1)	ovary(1)	3											106.0	104.0	105.0					3																	164906124		2203	4300	6503	166388818	SO:0001583	missense	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2495C>T	3.37:g.164906124G>A	ENSP00000420091:p.Thr832Met		166388818	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715815	0.48622	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.58506	0.33;0.33	5.33	5.33	0.75918	.	0.000000	0.38897	N	0.001521	T	0.64616	0.2614	N	0.19112	0.55	0.58432	D	0.999997	D	0.89917	1.0	D	0.78314	0.991	T	0.68758	-0.5324	10	0.72032	D	0.01	-10.0278	17.9523	0.89057	0.0:0.0:1.0:0.0	.	832	O94933	SLIK3_HUMAN	M	832	ENSP00000420091:T832M;ENSP00000241274:T832M	ENSP00000241274:T832M	T	-	2	0	SLITRK3	166388818	1.000000	0.71417	0.974000	0.42286	0.966000	0.64601	3.418000	0.52721	2.778000	0.95560	0.655000	0.94253	ACG		0.552	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		Missense_Mutation
KIT	3815	broad.mit.edu	37	4	55573316	55573316	+	Silent	SNP	C	C	T	rs148594615		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr4:55573316C>T	ENST00000288135.5	+	6	1075	c.978C>T	c.(976-978)aaC>aaT	p.N326N		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	326	Ig-like C2-type 4.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N326N(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TATTTGTAAACGATGGAGAAA	0.333		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - coding silent(1)	ovary(1)	4						T	,	3,4403	6.2+/-15.9	0,3,2200	82.0	74.0	77.0		978,978	-11.3	0.0	4	dbSNP_134	77	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	KIT	NM_000222.2,NM_001093772.1	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	326/977,326/973	55573316	3,13003	2203	4300	6503	55268073	SO:0001819	synonymous_variant	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.978C>T	4.37:g.55573316C>T			55268073	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	19	Broad																																																																																				0.333	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Silent
NAF1	92345	broad.mit.edu	37	4	164067004	164067004	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr4:164067004G>C	ENST00000274054.2	-	4	840	c.647C>G	c.(646-648)tCt>tGt	p.S216C	NAF1_ENST00000422287.2_Missense_Mutation_p.S216C	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	216					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S216C(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GTTAGTCATAGATTCAATTAT	0.264																																																1	Substitution - Missense(1)	ovary(1)	4											30.0	30.0	30.0					4																	164067004		2192	4278	6470	164286454	SO:0001583	missense	92345				CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.647C>G	4.37:g.164067004G>C	ENSP00000274054:p.Ser216Cys		164286454	D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	CCDS3803.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791933	0.70452	.	.	ENSG00000145414	ENST00000422287;ENST00000274054	T;T	0.37584	1.19;1.19	5.22	5.22	0.72569	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.145166	0.47093	D	0.000245	T	0.64951	0.2645	M	0.83483	2.645	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.70464	-0.4864	10	0.72032	D	0.01	-23.0913	17.7519	0.88436	0.0:0.0:1.0:0.0	.	216;216	E9PAZ2;Q96HR8	.;NAF1_HUMAN	C	216	ENSP00000408963:S216C;ENSP00000274054:S216C	ENSP00000274054:S216C	S	-	2	0	NAF1	164286454	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	7.886000	0.87288	2.422000	0.82143	0.460000	0.39030	TCT		0.264	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386		Missense_Mutation
CDH9	1007	broad.mit.edu	37	5	26902612	26902612	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr5:26902612T>A	ENST00000231021.4	-	7	1398	c.1226A>T	c.(1225-1227)gAt>gTt	p.D409V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	409	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D409V(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GGCATCTGGATCGTATGCTGT	0.323																																					Melanoma(8;187 585 15745 40864 52829)											1	Substitution - Missense(1)	ovary(1)	5											101.0	94.0	97.0					5																	26902612		2203	4299	6502	26938369	SO:0001583	missense	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1226A>T	5.37:g.26902612T>A	ENSP00000231021:p.Asp409Val		26938369	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252494	0.80135	.	.	ENSG00000113100	ENST00000231021	T	0.75367	-0.93	5.62	5.62	0.85841	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92848	0.7725	H	0.99820	4.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95852	0.8875	9	.	.	.	.	14.6446	0.68751	0.0:0.0:0.0:1.0	.	409	Q9ULB4	CADH9_HUMAN	V	409	ENSP00000231021:D409V	.	D	-	2	0	CDH9	26938369	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.671000	0.83941	2.139000	0.66308	0.528000	0.53228	GAT		0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		Missense_Mutation
VCAN	1462	broad.mit.edu	37	5	82835617	82835617	+	Silent	SNP	T	T	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr5:82835617T>C	ENST00000265077.3	+	8	7360	c.6795T>C	c.(6793-6795)acT>acC	p.T2265T	VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Silent_p.T1278T|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2265	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.T2265T(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTTTACCTACTCTACCAACAG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	5											69.0	71.0	70.0					5																	82835617		2203	4300	6503	82871373	SO:0001819	synonymous_variant	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6795T>C	5.37:g.82835617T>C			82871373	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1	SNP	54	Broad																																																																																				0.388	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		Silent
FBN2	2201	broad.mit.edu	37	5	127645049	127645049	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr5:127645049G>A	ENST00000508053.1	-	47	6217	c.5243C>T	c.(5242-5244)aCt>aTt	p.T1748I	FBN2_ENST00000262464.4_Missense_Mutation_p.T1748I			P35556	FBN2_HUMAN	fibrillin 2	1748	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T1748I(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATTCTCACAAGTGGTTCCATT	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											136.0	123.0	127.0					5																	127645049		2203	4300	6503	127672948	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5243C>T	5.37:g.127645049G>A	ENSP00000424571:p.Thr1748Ile		127672948	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342468	0.81911	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92699	-3.09;-3.09	4.85	4.85	0.62838	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	D	0.000019	D	0.92815	0.7715	M	0.65498	2.005	0.42466	D	0.992803	B	0.33044	0.395	B	0.40602	0.334	D	0.93176	0.6570	10	0.72032	D	0.01	.	18.5272	0.90976	0.0:0.0:1.0:0.0	.	1748	P35556	FBN2_HUMAN	I	1748	ENSP00000262464:T1748I;ENSP00000424571:T1748I	ENSP00000262464:T1748I	T	-	2	0	FBN2	127672948	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.545000	0.82128	2.681000	0.91329	0.650000	0.86243	ACT		0.383	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Missense_Mutation
PCDHB2	56133	broad.mit.edu	37	5	140474829	140474829	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr5:140474829C>A	ENST00000194155.4	+	1	603	c.455C>A	c.(454-456)aCt>aAt	p.T152N		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	152	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T152N(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCCTGGAACTACTTTCTTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											29.0	31.0	30.0					5																	140474829		2196	4298	6494	140455013	SO:0001583	missense	56133			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.455C>A	5.37:g.140474829C>A	ENSP00000194155:p.Thr152Asn		140455013	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	9.387	1.074529	0.20227	.	.	ENSG00000112852	ENST00000194155	T	0.57907	0.37	5.14	2.18	0.27775	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.60612	0.2282	H	0.94222	3.51	0.09310	N	1	B	0.28880	0.226	B	0.27262	0.078	T	0.61202	-0.7110	9	0.72032	D	0.01	.	6.7242	0.23346	0.1339:0.6618:0.1298:0.0745	.	152	Q9Y5E7	PCDB2_HUMAN	N	152	ENSP00000194155:T152N	ENSP00000194155:T152N	T	+	2	0	PCDHB2	140455013	0.000000	0.05858	0.998000	0.56505	0.561000	0.35649	1.067000	0.30616	1.272000	0.44329	-0.175000	0.13238	ACT		0.388	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		Missense_Mutation
BTNL9	153579	broad.mit.edu	37	5	180486624	180486624	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr5:180486624C>T	ENST00000327705.9	+	11	1601	c.1370C>T	c.(1369-1371)gCc>gTc	p.A457V	BTNL9_ENST00000376842.3_Missense_Mutation_p.A458V	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	457	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)		p.A457V(1)		breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACTACGAGGCCGGAGAGCTG	0.682																																																1	Substitution - Missense(1)	ovary(1)	5											41.0	42.0	42.0					5																	180486624		2203	4300	6503	180419230	SO:0001583	missense	153579			AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.1370C>T	5.37:g.180486624C>T	ENSP00000330200:p.Ala457Val		180419230	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	37	CCDS4460.2	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	c	12.02	1.813825	0.32053	.	.	ENSG00000165810	ENST00000327705;ENST00000376842	T;T	0.69561	-0.41;-0.41	4.43	3.55	0.40652	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.247400	0.21017	U	0.081591	T	0.74520	0.3727	M	0.64567	1.98	0.09310	N	1	P	0.49253	0.921	D	0.64687	0.928	T	0.63346	-0.6658	10	0.59425	D	0.04	.	6.5597	0.22479	0.0:0.7154:0.183:0.1016	.	457	Q6UXG8	BTNL9_HUMAN	V	457;458	ENSP00000330200:A457V;ENSP00000366038:A458V	ENSP00000330200:A457V	A	+	2	0	BTNL9	180419230	0.013000	0.17824	0.005000	0.12908	0.002000	0.02628	0.677000	0.25262	0.999000	0.39023	0.449000	0.29647	GCC		0.682	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547		Missense_Mutation
PGK2	5232	broad.mit.edu	37	6	49754597	49754597	+	Missense_Mutation	SNP	C	C	A	rs572935257		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr6:49754597C>A	ENST00000304801.3	-	1	456	c.304G>T	c.(304-306)Gca>Tca	p.A102S		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	102					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.A102S(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					TCCACTTCTGCGCCTACACAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											120.0	113.0	116.0					6																	49754597		2203	4300	6503	49862556	SO:0001583	missense	5232			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.304G>T	6.37:g.49754597C>A	ENSP00000305995:p.Ala102Ser		49862556	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	0.104	-1.147467	0.01714	.	.	ENSG00000170950	ENST00000304801	D	0.91792	-2.91	4.09	-8.18	0.01053	Phosphoglycerate kinase, N-terminal (1);	0.641145	0.17456	N	0.173605	T	0.57125	0.2032	N	0.16233	0.39	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.52510	-0.8566	10	0.38643	T	0.18	4.6424	0.51	0.00594	0.3466:0.1611:0.255:0.2373	.	102	P07205	PGK2_HUMAN	S	102	ENSP00000305995:A102S	ENSP00000305995:A102S	A	-	1	0	PGK2	49862556	0.001000	0.12720	0.000000	0.03702	0.168000	0.22595	-0.879000	0.04188	-3.510000	0.00150	-3.398000	0.00039	GCA		0.527	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			Missense_Mutation
CASP8AP2	9994	broad.mit.edu	37	6	90575717	90575717	+	RNA	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr6:90575717C>G	ENST00000551025.1	+	0	4145									caspase 8 associated protein 2									p.S903C(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AAGAGTCAGTCTGATCTCAAT	0.294																																					Colon(187;1656 2025 17045 31481 39901)											1	Substitution - Missense(1)	ovary(1)	6											21.0	19.0	20.0					6																	90575717		1807	4072	5879	90632438			9994			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90575717C>G			90632438		Missense_Mutation	SNP	ENST00000551025.1	37		SNP	32	Broad																																																																																				0.294	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		Missense_Mutation
HOXA1	3198	broad.mit.edu	37	7	27134977	27134977	+	Silent	SNP	G	G	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr7:27134977G>T	ENST00000343060.4	-	1	616	c.555C>A	c.(553-555)gcC>gcA	p.A185A	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOXA1_ENST00000355633.5_Intron|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000425358.2_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	185					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A185A(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTTGGTGGCTGGCGTGGAGAG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	7											77.0	86.0	83.0					7																	27134977		2203	4300	6503	27101502	SO:0001819	synonymous_variant	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.555C>A	7.37:g.27134977G>T			27101502	A4D184|B2R8U7|O43363	Silent	SNP	ENST00000343060.4	37	CCDS5401.1	SNP	47	Broad																																																																																				0.557	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			Silent
PSPH	5723	broad.mit.edu	37	7	56079455	56079455	+	Nonstop_Mutation	SNP	T	T	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr7:56079455T>A	ENST00000395471.3	-	8	1483	c.678A>T	c.(676-678)taA>taT	p.*226Y	PSPH_ENST00000275605.3_Nonstop_Mutation_p.*226Y|PSPH_ENST00000459834.1_5'UTR			P78330	SERB_HUMAN	phosphoserine phosphatase	0					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.*226Y(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACAATGGATGTTATTCTTCCA	0.378																																																1	Nonstop extension(1)	ovary(1)	7											108.0	90.0	96.0					7																	56079455		2203	4300	6503	56046949	SO:0001578	stop_lost	5723			Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.678A>T	7.37:g.56079455T>A			56046949	B2RCR5|Q7Z3S5	Nonstop_Mutation	SNP	ENST00000395471.3	37	CCDS5522.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	9.443	1.088693	0.20390	.	.	ENSG00000146733	ENST00000275605;ENST00000395471	.	.	.	4.68	3.51	0.40186	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9986	0.24797	0.0:0.1789:0.0:0.8211	.	.	.	.	Y	226	.	.	X	-	3	2	PSPH	56046949	0.003000	0.15002	0.012000	0.15200	0.003000	0.03518	0.702000	0.25631	0.645000	0.30675	0.454000	0.30748	TAA		0.378	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577		Nonstop_Mutation
GAL3ST4	79690	broad.mit.edu	37	7	99758526	99758526	+	Silent	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr7:99758526C>T	ENST00000360039.4	-	4	878	c.486G>A	c.(484-486)gcG>gcA	p.A162A	C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000426974.2_Silent_p.A100A|GAL3ST4_ENST00000411994.1_Missense_Mutation_p.R61Q|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.R61Q|GAL3ST4_ENST00000413800.1_Silent_p.A162A|C7orf43_ENST00000316937.3_5'Flank	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	162					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.A162A(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGCCAGAGCCGCTGGGTCTC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	7											47.0	48.0	48.0					7																	99758526		2196	4275	6471	99596462	SO:0001819	synonymous_variant	79690			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.486G>A	7.37:g.99758526C>T			99596462	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Silent	SNP	ENST00000360039.4	37	CCDS5688.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667038	0.29604	.	.	ENSG00000197093	ENST00000423751;ENST00000411994	.	.	.	5.35	-10.2	0.00374	.	.	.	.	.	T	0.43100	0.1232	.	.	.	0.33914	D	0.64007	.	.	.	.	.	.	T	0.55823	-0.8080	5	0.41790	T	0.15	-5.7921	7.5206	0.27626	0.0918:0.1034:0.085:0.7199	.	.	.	.	Q	61	.	ENSP00000414733:R61Q	R	-	2	0	GAL3ST4	99596462	0.000000	0.05858	0.487000	0.27428	0.933000	0.57130	-2.672000	0.00843	-2.290000	0.00667	-0.535000	0.04281	CGG		0.542	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		Silent
NUP205	23165	broad.mit.edu	37	7	135269580	135269580	+	Splice_Site	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr7:135269580C>G	ENST00000285968.6	+	8	1069	c.1043C>G	c.(1042-1044)gCt>gGt	p.A348G	NUP205_ENST00000440390.2_Splice_Site_p.A142G	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	348					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A348G(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTGTTTCTAGCTCTGGCAGAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											66.0	58.0	60.0					7																	135269580		2203	4300	6503	134920120	SO:0001630	splice_region_variant	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1043-1C>G	7.37:g.135269580C>G			134920120	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876997	0.51801	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.32023	1.47;1.47	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	L	0.55481	1.735	0.80722	D	1	P	0.34934	0.476	B	0.32393	0.145	T	0.04413	-1.0953	9	.	.	.	.	17.6206	0.88080	0.0:1.0:0.0:0.0	.	348	Q92621	NU205_HUMAN	G	348;142	ENSP00000285968:A348G;ENSP00000401983:A142G	.	A	+	2	0	NUP205	134920120	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	4.899000	0.63245	2.586000	0.87340	0.591000	0.81541	GCT		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		Missense_Mutation	Missense_Mutation
GIMAP4	55303	broad.mit.edu	37	7	150269275	150269275	+	Silent	SNP	C	C	T	rs367979869		TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr7:150269275C>T	ENST00000255945.2	+	3	292	c.117C>T	c.(115-117)acC>acT	p.T39T	GIMAP4_ENST00000494750.1_3'UTR|GIMAP4_ENST00000461940.1_Silent_p.T53T	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	39	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)	p.T39T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGGTAAAACCGGAGCAGGAA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	7						C		0,4406		0,0,2203	72.0	78.0	76.0		117	-3.8	1.0	7		76	1,8599		0,1,4299	no	coding-synonymous	GIMAP4	NM_018326.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		39/330	150269275	1,13005	2203	4300	6503	149900208	SO:0001819	synonymous_variant	55303			AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.117C>T	7.37:g.150269275C>T			149900208		Silent	SNP	ENST00000255945.2	37	CCDS5904.1	SNP	23	Broad																																																																																				0.448	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348927.1	NM_018326		Silent
CSPP1	79848	broad.mit.edu	37	8	68071346	68071346	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr8:68071346G>C	ENST00000262210.5	+	19	2528	c.2497G>C	c.(2497-2499)Gac>Cac	p.D833H	CSPP1_ENST00000521168.1_3'UTR|CSPP1_ENST00000412460.1_Missense_Mutation_p.D488H	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	868	Glu-rich.				positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.D833H(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CTGTGAAAGAGACAATTTGAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											113.0	110.0	111.0					8																	68071346		1840	4086	5926	68233900	SO:0001583	missense	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2497G>C	8.37:g.68071346G>C	ENSP00000262210:p.Asp833His		68233900	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	CCDS43744.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807561	0.31961	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.78364	-1.17;1.48;1.48	4.65	2.71	0.32032	.	0.069188	0.56097	D	0.000035	T	0.55609	0.1931	N	0.08118	0	0.26968	N	0.965646	B;P;B	0.36315	0.25;0.547;0.115	B;B;B	0.34590	0.086;0.186;0.093	T	0.57533	-0.7795	10	0.72032	D	0.01	-12.2344	8.9673	0.35885	0.09:0.154:0.7561:0.0	.	488;833;868	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;CSPP1_HUMAN	H	833;868;488;488	ENSP00000262210:D833H;ENSP00000415782:D488H;ENSP00000430092:D488H	ENSP00000262210:D833H	D	+	1	0	CSPP1	68233900	1.000000	0.71417	0.996000	0.52242	0.504000	0.33889	2.669000	0.46825	2.302000	0.77476	0.557000	0.71058	GAC		0.348	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		Missense_Mutation
SULF1	23213	broad.mit.edu	37	8	70498683	70498683	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr8:70498683C>G	ENST00000260128.4	+	7	1221	c.504C>G	c.(502-504)ttC>ttG	p.F168L	SULF1_ENST00000458141.2_Missense_Mutation_p.F168L|SULF1_ENST00000419716.3_Missense_Mutation_p.F168L|SULF1_ENST00000402687.4_Missense_Mutation_p.F168L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	168					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.F168L(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ATTCTCGCTTCTATAATTACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	8											103.0	108.0	106.0					8																	70498683		2203	4300	6503	70661237	SO:0001583	missense	23213			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.504C>G	8.37:g.70498683C>G	ENSP00000260128:p.Phe168Leu		70661237	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769502	0.90020	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716;ENST00000525999	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	5.86	5.86	0.93980	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	M	0.76002	2.32	0.80722	D	1	B	0.20550	0.046	B	0.16289	0.015	D	0.91800	0.5451	10	0.87932	D	0	.	10.5418	0.45037	0.0:0.8572:0.0:0.1428	.	168	Q8IWU6	SULF1_HUMAN	L	168	ENSP00000403040:F168L;ENSP00000260128:F168L;ENSP00000385704:F168L;ENSP00000390315:F168L;ENSP00000431753:F168L	ENSP00000260128:F168L	F	+	3	2	SULF1	70661237	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.715000	0.47210	2.774000	0.95407	0.650000	0.86243	TTC		0.393	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		Missense_Mutation
RNF19A	25897	broad.mit.edu	37	8	101282199	101282199	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr8:101282199A>T	ENST00000519449.1	-	5	1242	c.926T>A	c.(925-927)aTa>aAa	p.I309K	RNF19A_ENST00000523255.1_5'Flank|RNF19A_ENST00000341084.2_Missense_Mutation_p.I309K	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	309					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.I309K(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			ATTCATCTTTATTATATAAGC	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											119.0	109.0	113.0					8																	101282199		2203	4300	6503	101351375	SO:0001583	missense	25897			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.926T>A	8.37:g.101282199A>T	ENSP00000428968:p.Ile309Lys		101351375	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	29.0	4.966983	0.92855	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	T;T	0.64085	-0.08;-0.08	5.68	5.68	0.88126	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	T	0.74558	0.3732	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75110	-0.3433	10	0.49607	T	0.09	.	15.6165	0.76773	1.0:0.0:0.0:0.0	.	309	Q9NV58	RN19A_HUMAN	K	309	ENSP00000428968:I309K;ENSP00000342667:I309K	ENSP00000342667:I309K	I	-	2	0	RNF19A	101351375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.253000	0.95501	2.176000	0.68965	0.477000	0.44152	ATA		0.348	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435		Missense_Mutation
PKHD1L1	93035	broad.mit.edu	37	8	110504192	110504192	+	Nonsense_Mutation	SNP	T	T	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chr8:110504192T>G	ENST00000378402.5	+	62	10309	c.10205T>G	c.(10204-10206)tTa>tGa	p.L3402*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3402					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L3404*(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGAAAAGATTTAAGTTCAACT	0.333										HNSCC(38;0.096)																																						1	Substitution - Nonsense(1)	ovary(1)	8											40.0	40.0	40.0					8																	110504192		1803	4073	5876	110573368	SO:0001587	stop_gained	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10205T>G	8.37:g.110504192T>G	ENSP00000367655:p.Leu3402*		110573368	Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	24.7	4.562669	0.86335	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	.	.	.	5.61	-1.52	0.08637	.	0.763045	0.11952	N	0.513589	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	5.0448	0.14477	0.1328:0.3372:0.0:0.53	.	.	.	.	X	3402;330	.	ENSP00000367655:L3402X	L	+	2	0	PKHD1L1	110573368	0.003000	0.15002	0.633000	0.29310	0.992000	0.81027	0.001000	0.13038	-0.237000	0.09739	0.460000	0.39030	TTA		0.333	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Nonsense_Mutation
MID1	4281	broad.mit.edu	37	X	10437842	10437842	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chrX:10437842C>G	ENST00000317552.4	-	7	1580	c.1180G>C	c.(1180-1182)Gct>Cct	p.A394P	MID1_ENST00000453318.2_Missense_Mutation_p.A394P|MID1_ENST00000380785.1_Missense_Mutation_p.A394P|MID1_ENST00000380787.1_Missense_Mutation_p.A394P|MID1_ENST00000380779.1_Missense_Mutation_p.A394P|MID1_ENST00000380780.1_Missense_Mutation_p.A394P|MID1_ENST00000380782.2_Missense_Mutation_p.A394P	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	394	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A394P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						TCATATGAAGCTGTGCAGAGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	X											157.0	120.0	133.0					X																	10437842		2203	4300	6503	10397842	SO:0001583	missense	4281			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.1180G>C	X.37:g.10437842C>G	ENSP00000312678:p.Ala394Pro		10397842	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	ENST00000317552.4	37	CCDS14138.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.132013	0.94473	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894	T;T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.76	5.76	0.90799	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	L	0.43152	1.355	0.80722	D	1	D;D;D	0.63880	0.985;0.993;0.973	D;D;D	0.71184	0.958;0.972;0.915	T	0.52990	-0.8501	10	0.37606	T	0.19	.	18.9882	0.92780	0.0:1.0:0.0:0.0	.	394;394;344	A8K5A0;O15344;B4DLX8	.;TRI18_HUMAN;.	P	394;394;394;394;394;394;394;344;394	ENSP00000414521:A394P;ENSP00000312678:A394P;ENSP00000370162:A394P;ENSP00000370156:A394P;ENSP00000370164:A394P;ENSP00000370157:A394P;ENSP00000370159:A394P;ENSP00000391154:A394P	ENSP00000312678:A394P	A	-	1	0	MID1	10397842	1.000000	0.71417	0.923000	0.36655	0.955000	0.61496	7.290000	0.78711	2.433000	0.82419	0.600000	0.82982	GCT		0.502	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1			Missense_Mutation
ARAF	369	broad.mit.edu	37	X	47430408	47430408	+	Silent	SNP	C	C	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chrX:47430408C>T	ENST00000377045.4	+	15	1877	c.1683C>T	c.(1681-1683)ccC>ccT	p.P561P	ARAF_ENST00000470206.1_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	561	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.P561P(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CCCTCTTCCCCCAGGTGGGCT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	X											16.0	16.0	16.0					X																	47430408		2202	4299	6501	47315352	SO:0001819	synonymous_variant	369			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1683C>T	X.37:g.47430408C>T			47315352	P07557|Q5H9B2|Q5H9B3	Silent	SNP	ENST00000377045.4	37	CCDS35232.1	SNP	22	Broad																																																																																				0.607	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1			Silent
KDM5C	8242	broad.mit.edu	37	X	53222650	53222650	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chrX:53222650G>A	ENST00000375401.3	-	25	4818	c.4286C>T	c.(4285-4287)cCa>cTa	p.P1429L	KDM5C_ENST00000404049.3_Missense_Mutation_p.P1428L|KDM5C_ENST00000375383.3_Missense_Mutation_p.P1385L|KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375379.3_Missense_Mutation_p.P1426L	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1429					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.P1429L(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTCCAGGTCTGGGGGCTGTCC	0.662			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Substitution - Missense(1)	ovary(1)	X											56.0	52.0	53.0					X																	53222650		2203	4300	6503	53239375	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.4286C>T	X.37:g.53222650G>A	ENSP00000364550:p.Pro1429Leu		53239375	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	g	17.77	3.470276	0.63625	.	.	ENSG00000126012	ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D	0.85629	-1.87;-1.87;-1.87;-2.01	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.90903	0.7141	M	0.67700	2.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91983	0.5596	10	0.87932	D	0	-2.8012	14.0099	0.64490	0.0:0.0:1.0:0.0	.	1428;1429	B0QZ44;P41229	.;KDM5C_HUMAN	L	1429;1428;1426;1385	ENSP00000364550:P1429L;ENSP00000385394:P1428L;ENSP00000364528:P1426L;ENSP00000364532:P1385L	ENSP00000364528:P1426L	P	-	2	0	KDM5C	53239375	1.000000	0.71417	0.943000	0.38184	0.673000	0.39480	8.675000	0.91195	1.875000	0.54330	0.354000	0.21935	CCA		0.662	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Missense_Mutation
NXF2B	728343	broad.mit.edu	37	X	101615533	101615533	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-09-2056-01	TCGA-09-2056-11	g.chrX:101615533G>T	ENST00000372750.1	-	27	2669	c.1870C>A	c.(1870-1872)Caa>Aaa	p.Q624K	NXF2B_ENST00000372752.1_3'UTR|NXF2B_ENST00000457521.2_Missense_Mutation_p.Q624K|NXF2B_ENST00000372749.1_Missense_Mutation_p.Q624K|NXF2B_ENST00000412230.2_Missense_Mutation_p.Q624K			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	624	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Q624K(1)		breast(1)|kidney(1)|lung(4)|ovary(1)	7						TAGGAGATTTGCTTGAAGGCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	X											175.0	136.0	151.0					X																	101615533		1980	3310	5290	101502189	SO:0001583	missense	56001				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.1870C>A	X.37:g.101615533G>T	ENSP00000361836:p.Gln624Lys		101502189	Q9BXU4|Q9NSS1|Q9NX66	Missense_Mutation	SNP	ENST00000372750.1	37	CCDS43979.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	.	7.141	0.581814	0.13749	.	.	ENSG00000185945	ENST00000457521;ENST00000372749;ENST00000372750;ENST00000412230	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	2.73	0.834	0.18880	.	0.373083	0.21694	U	0.070527	T	0.14743	0.0356	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31861	-0.9928	7	0.02654	T	1	0.0826	6.7236	0.23345	0.0:0.0:0.4944:0.5056	.	.	.	.	K	624	ENSP00000396447:Q624K;ENSP00000361835:Q624K;ENSP00000361836:Q624K;ENSP00000413087:Q624K	ENSP00000361835:Q624K	Q	-	1	0	NXF2B	101502189	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.627000	0.05521	0.102000	0.17638	0.502000	0.49764	CAA		0.517	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058979.1			Missense_Mutation
OVGP1	5016	broad.mit.edu	37	1	111963991	111963992	+	Frame_Shift_Ins	INS	-	-	A			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2056-01	TCGA-09-2056-11	g.chr1:111963991_111963992insA	ENST00000369732.3	-	8	864_865	c.809_810insT	c.(808-810)ctcfs	p.L270fs	OVGP1_ENST00000481495.1_5'UTR|OVGP1_ENST00000540696.1_Intron	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	270					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.K271fs*4(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TAGAGGCTTTGAGGAGGCGAAA	0.515																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								111765515	SO:0001589	frameshift_variant	5016			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.810dupT	1.37:g.111963992_111963992dupA	ENSP00000358747:p.Leu270fs		111765514	A0AV19|B9EGE1|Q15841	Frame_Shift_Ins	INS	ENST00000369732.3	37	CCDS834.1	INS	45	Broad																																																																																				0.515	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557		Frame_Shift_Ins
COPB2	9276	broad.mit.edu	37	3	139077948	139077949	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2056-01	TCGA-09-2056-11	g.chr3:139077948_139077949delTG	ENST00000333188.5	-	19	2556_2557	c.2375_2376delCA	c.(2374-2376)acafs	p.T792fs	COPB2_ENST00000507777.1_Frame_Shift_Del_p.T763fs	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	792					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.T792fs*3(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						TTTCATACTCTGTTGGGTCAGC	0.431																																																1	Deletion - Frameshift(1)	ovary(1)	3																																								140560639	SO:0001589	frameshift_variant	9276			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2375_2376delCA	3.37:g.139077948_139077949delTG	ENSP00000329419:p.Thr792fs		140560638	B4DZI8	Frame_Shift_Del	DEL	ENST00000333188.5	37	CCDS3108.1	DEL	55	Broad																																																																																				0.431	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766		Frame_Shift_Del
ZFPM2	23414	broad.mit.edu	37	8	106815707	106815714	+	Frame_Shift_Del	DEL	AACTTTAT	AACTTTAT	-			TCGA-09-2056-01	TCGA-09-2056-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-09-2056-01	TCGA-09-2056-11	g.chr8:106815707_106815714delAACTTTAT	ENST00000407775.2	+	8	3647_3654	c.3397_3404delAACTTTAT	c.(3397-3405)aactttatafs	p.NFI1133fs	RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000517361.1_Frame_Shift_Del_p.NFI1001fs|ZFPM2_ENST00000520492.1_Frame_Shift_Del_p.NFI1001fs|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000378472.4_Frame_Shift_Del_p.NFI864fs|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000522296.1_3'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	1133					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.F1134fs>16(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CAACCTTTCAAACTTTATAACTCACAAG	0.389																																																1	Deletion - Frameshift(1)	ovary(1)	8																																								106884890	SO:0001589	frameshift_variant	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.3397_3404delAACTTTAT	8.37:g.106815707_106815714delAACTTTAT	ENSP00000384179:p.Asn1133fs		106884883	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Frame_Shift_Del	DEL	ENST00000407775.2	37	CCDS47908.1	DEL	1	Broad																																																																																				0.389	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			Frame_Shift_Del
