#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZNF281	23528	broad.mit.edu	37	1	200376568	200376568	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr1:200376568G>T	ENST00000294740.3	-	2	2390	c.2266C>A	c.(2266-2268)Cat>Aat	p.H756N	ZNF281_ENST00000367353.1_Missense_Mutation_p.H756N|ZNF281_ENST00000367352.3_Missense_Mutation_p.H720N	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	756					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.H756N(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						AACTGCTGATGTGTAGCATCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	57.0	57.0					1																	200376568		2203	4300	6503	198643191	SO:0001583	missense	23528			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.2266C>A	1.37:g.200376568G>T	ENSP00000294740:p.His756Asn		198643191	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	ENST00000294740.3	37	CCDS1402.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237640	0.58886	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.09630	2.96;2.96;2.96	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	L	0.51422	1.61	0.58432	D	0.999998	D;D	0.63880	0.993;0.993	D;D	0.74674	0.984;0.984	T	0.00386	-1.1772	10	0.62326	D	0.03	-3.5665	19.6035	0.95573	0.0:0.0:1.0:0.0	.	720;756	A6NF48;Q9Y2X9	.;ZN281_HUMAN	N	756;756;720;461	ENSP00000294740:H756N;ENSP00000356322:H756N;ENSP00000356321:H720N	ENSP00000294740:H756N	H	-	1	0	ZNF281	198643191	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.612000	0.82975	2.626000	0.88956	0.655000	0.94253	CAT		0.448	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482		Missense_Mutation
NSUN6	221078	broad.mit.edu	37	10	18937511	18937511	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr10:18937511A>T	ENST00000377304.4	-	2	557	c.139T>A	c.(139-141)Tca>Aca	p.S47T	RP11-139J15.7_ENST00000606425.1_Missense_Mutation_p.S35T	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	47							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.S47T(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						GGAGGATGTGACAGGTGCTTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	10											216.0	204.0	208.0					10																	18937511		2203	4300	6503	18977517	SO:0001583	missense	221078			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.139T>A	10.37:g.18937511A>T	ENSP00000366519:p.Ser47Thr		18977517	B0YJ54	Missense_Mutation	SNP	ENST00000377304.4	37	CCDS7130.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	11.07	1.530752	0.27387	.	.	ENSG00000241058	ENST00000377304	T	0.28895	1.59	4.95	4.95	0.65309	.	0.060303	0.64402	D	0.000002	T	0.28001	0.0690	L	0.51853	1.615	0.49389	D	0.999788	B	0.25351	0.124	B	0.24269	0.052	T	0.06373	-1.0830	10	0.39692	T	0.17	.	10.7457	0.46179	0.8407:0.1593:0.0:0.0	.	47	Q8TEA1	NSUN6_HUMAN	T	47	ENSP00000366519:S47T	ENSP00000366519:S47T	S	-	1	0	NSUN6	18977517	0.983000	0.35010	0.795000	0.32087	0.822000	0.46500	2.066000	0.41452	1.864000	0.54056	0.383000	0.25322	TCA		0.348	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543		Missense_Mutation
F2	2147	broad.mit.edu	37	11	46750326	46750326	+	Missense_Mutation	SNP	C	C	T	rs377462682		TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr11:46750326C>T	ENST00000311907.5	+	11	1467	c.1411C>T	c.(1411-1413)Cct>Tct	p.P471S	F2_ENST00000530231.1_Intron	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	471	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.P471S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	GCTGAAGAAGCCTGTTGCCTT	0.547																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)											1	Substitution - Missense(1)	ovary(1)	11											122.0	105.0	111.0					11																	46750326		2201	4299	6500	46706902	SO:0001583	missense	2147			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1411C>T	11.37:g.46750326C>T	ENSP00000308541:p.Pro471Ser		46706902	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498422	0.64298	.	.	ENSG00000180210	ENST00000311907	D	0.94576	-3.46	5.97	5.05	0.67936	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.96809	0.8958	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97373	0.9977	10	0.87932	D	0	.	17.208	0.86923	0.0:0.8739:0.1261:0.0	.	471	P00734	THRB_HUMAN	S	471	ENSP00000308541:P471S	ENSP00000308541:P471S	P	+	1	0	F2	46706902	1.000000	0.71417	0.615000	0.29064	0.232000	0.25224	5.917000	0.69989	1.511000	0.48818	-0.175000	0.13238	CCT		0.547	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			Missense_Mutation
SLC43A1	8501	broad.mit.edu	37	11	57268483	57268483	+	Silent	SNP	G	G	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr11:57268483G>A	ENST00000278426.3	-	4	721	c.366C>T	c.(364-366)gcC>gcT	p.A122A	SLC43A1_ENST00000528450.1_Silent_p.A122A|SLC43A1_ENST00000533515.1_5'Flank	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1									p.A122A(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GGGAGGCCAGGGCCATGAGGG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	11											71.0	68.0	69.0					11																	57268483		2193	4295	6488	57025059	SO:0001819	synonymous_variant	8501			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.366C>T	11.37:g.57268483G>A			57025059		Silent	SNP	ENST00000278426.3	37	CCDS7958.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	5.094	0.202924	0.09704	.	.	ENSG00000149150	ENST00000525764	.	.	.	5.28	0.743	0.18347	.	.	.	.	.	T	0.57242	0.2040	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51325	-0.8720	4	.	.	.	-24.6501	9.4275	0.38590	0.3572:0.0:0.6428:0.0	.	.	.	.	S	68	.	.	P	-	1	0	SLC43A1	57025059	0.028000	0.19301	0.985000	0.45067	0.393000	0.30537	0.198000	0.17217	0.245000	0.21373	-0.136000	0.14681	CCT		0.637	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627		Silent
FGF3	2248	broad.mit.edu	37	11	69625283	69625283	+	Silent	SNP	G	G	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr11:69625283G>A	ENST00000334134.2	-	3	600	c.510C>T	c.(508-510)cgC>cgT	p.R170R		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	170					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)	p.R170R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			TCTGTGTGCGGCGGGTCTTGA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	11											21.0	24.0	23.0					11																	69625283		2193	4270	6463	69334464	SO:0001819	synonymous_variant	2248				CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.510C>T	11.37:g.69625283G>A			69334464	Q0VG69	Silent	SNP	ENST00000334134.2	37	CCDS8195.1	SNP	42	Broad																																																																																				0.682	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247		Silent
ABCC1	4363	broad.mit.edu	37	16	16196532	16196532	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0931-01	TCGA-10-0931-11			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr16:16196532A>G	ENST00000399410.3	+	20	2868	c.2693A>G	c.(2692-2694)aAt>aGt	p.N898S	ABCC1_ENST00000399408.2_Missense_Mutation_p.N908S|ABCC1_ENST00000349029.5_Missense_Mutation_p.N783S|ABCC1_ENST00000345148.5_Missense_Mutation_p.N898S|ABCC1_ENST00000576557.1_3'UTR|ABCC1_ENST00000351154.5_Missense_Mutation_p.N839S|ABCC1_ENST00000346370.5_Missense_Mutation_p.N842S	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	898					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.N898S(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CAAATGGAGAATGGCATGCTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											38.0	44.0	42.0					16																	16196532		2078	4210	6288	16104033	SO:0001583	missense	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2693A>G	16.37:g.16196532A>G	ENSP00000382342:p.Asn898Ser		16104033	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	10.42	1.344154	0.24339	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.89343	-2.49;-2.5;-2.12;-2.27;-2.43;-2.3	4.64	4.64	0.57946	.	0.454172	0.26112	N	0.026274	T	0.81133	0.4759	L	0.35341	1.055	0.36090	D	0.843387	B;B;B;B;B;B	0.23058	0.02;0.0;0.016;0.079;0.001;0.008	B;B;B;B;B;B	0.20577	0.03;0.002;0.015;0.02;0.002;0.006	T	0.77443	-0.2586	10	0.10636	T	0.68	-24.9417	12.0965	0.53757	1.0:0.0:0.0:0.0	.	783;898;842;839;898;908	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	S	898;908;842;839;898;783;582	ENSP00000382342:N898S;ENSP00000382340:N908S;ENSP00000263019:N842S;ENSP00000263017:N839S;ENSP00000263014:N898S;ENSP00000263016:N783S	ENSP00000263014:N898S	N	+	2	0	ABCC1	16104033	1.000000	0.71417	0.987000	0.45799	0.692000	0.40212	4.866000	0.63005	1.852000	0.53769	0.533000	0.62120	AAT		0.592	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		Missense_Mutation
CD19	930	broad.mit.edu	37	16	28944295	28944295	+	Missense_Mutation	SNP	C	C	A	rs79073646		TCGA-10-0931-01	TCGA-10-0931-11			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr16:28944295C>A	ENST00000324662.3	+	3	463	c.419C>A	c.(418-420)tCc>tAc	p.S140Y	CD19_ENST00000538922.1_Missense_Mutation_p.S140Y|CD19_ENST00000567541.1_Missense_Mutation_p.S140Y			P15391	CD19_HUMAN	CD19 molecule	140					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)	p.S140Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						AAGAACAGGTCCTCAGAGGGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	16																																								28851796	SO:0001583	missense	930				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.419C>A	16.37:g.28944295C>A	ENSP00000313419:p.Ser140Tyr		28851796	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	37	CCDS10644.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332606	0.81801	.	.	ENSG00000177455	ENST00000538922;ENST00000324662	T;T	0.56103	0.48;0.48	5.11	4.16	0.48862	.	1.104680	0.06948	N	0.813990	T	0.58323	0.2114	L	0.48642	1.525	0.09310	N	1	P;P	0.52061	0.95;0.917	P;P	0.51355	0.667;0.467	T	0.46205	-0.9208	10	0.87932	D	0	-2.2788	9.5018	0.39022	0.0:0.9015:0.0:0.0985	.	140;140	F5H635;P15391	.;CD19_HUMAN	Y	140	ENSP00000437940:S140Y;ENSP00000313419:S140Y	ENSP00000313419:S140Y	S	+	2	0	CD19	28851796	0.002000	0.14202	0.002000	0.10522	0.793000	0.44817	1.418000	0.34782	1.140000	0.42260	0.563000	0.77884	TCC		0.612	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2			Missense_Mutation
PAPD5	64282	broad.mit.edu	37	16	50261840	50261840	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr16:50261840G>C	ENST00000561678.1	+	10	1590	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q	PAPD5_ENST00000436909.3_Missense_Mutation_p.E616Q|PAPD5_ENST00000357464.3_Missense_Mutation_p.E537Q|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5	490	Ser-rich.				histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)	p.E616Q(1)		endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TGTATCCTTGGAGTCCTCTCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	16											102.0	99.0	100.0					16																	50261840		1943	4148	6091	48819341	SO:0001583	missense	64282			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.1516G>C	16.37:g.50261840G>C	ENSP00000455837:p.Glu506Gln		48819341	B4DV38|Q9NW67|Q9Y6C0	Missense_Mutation	SNP	ENST00000561678.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560966	0.65538	.	.	ENSG00000121274	ENST00000436909;ENST00000357464	T;T	0.46819	0.86;0.88	6.17	6.17	0.99709	.	0.377447	0.33110	N	0.005275	T	0.30324	0.0761	N	0.08118	0	0.32111	N	0.589356	B;B	0.27559	0.181;0.079	B;B	0.31686	0.134;0.019	T	0.34477	-0.9827	10	0.24483	T	0.36	.	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	616;490	B4DV38;Q8NDF8	.;PAPD5_HUMAN	Q	616;537	ENSP00000396995:E616Q;ENSP00000350054:E537Q	ENSP00000350054:E537Q	E	+	1	0	PAPD5	48819341	1.000000	0.71417	0.992000	0.48379	0.955000	0.61496	3.978000	0.56881	2.941000	0.99782	0.655000	0.94253	GAG		0.498	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000423150.1	NM_022447		Missense_Mutation
REEP6	92840	broad.mit.edu	37	19	1488242	1488242	+	5'Flank	SNP	A	A	C	rs200277717		TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr19:1488242A>C	ENST00000233596.3	+	0	0				PCSK4_ENST00000300954.5_Missense_Mutation_p.V111G|CTB-25B13.6_ENST00000585643.1_RNA|PCSK4_ENST00000587784.1_5'UTR	NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6						regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.V111G(1)		lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGCGTTTCACCCGCCGCTG	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											36.0	35.0	36.0					19																	1488242		2203	4300	6503	1439242	SO:0001631	upstream_gene_variant	54760			BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072		19.37:g.1488242A>C	Exception_encountered		1439242	B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	ENST00000233596.3	37	CCDS12070.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	4.455	0.084197	0.08583	.	.	ENSG00000115257	ENST00000300954	T	0.72051	-0.62	2.97	1.91	0.25777	.	0.401303	0.18538	N	0.138299	T	0.62490	0.2432	M	0.76574	2.34	0.49798	D	0.999821	B	0.06786	0.001	B	0.06405	0.002	T	0.61671	-0.7015	10	0.44086	T	0.13	.	1.8851	0.03236	0.5032:0.0:0.2449:0.2519	.	111	Q6UW60	PCSK4_HUMAN	G	111	ENSP00000300954:V111G	ENSP00000300954:V111G	V	-	2	0	PCSK4	1439242	0.000000	0.05858	0.995000	0.50966	0.266000	0.26442	0.197000	0.17197	1.117000	0.41842	0.352000	0.21897	GTG		0.682	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449623.1	NM_138393		Missense_Mutation
RETN	56729	broad.mit.edu	37	19	7734747	7734747	+	Silent	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr19:7734747C>T	ENST00000221515.2	+	3	247	c.159C>T	c.(157-159)agC>agT	p.S53S	RETN_ENST00000381324.2_Intron	NM_001193374.1|NM_020415.3	NP_001180303.1|NP_065148.1	Q9HD89	RETN_HUMAN	resistin	53					aging (GO:0007568)|fat cell differentiation (GO:0045444)|negative regulation of feeding behavior (GO:2000252)|positive regulation of collagen metabolic process (GO:0010714)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.S53S(1)		ovary(1)	1						AGTGCCAGAGCGTCACCTCCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											61.0	58.0	59.0					19																	7734747		2203	4300	6503	7640747	SO:0001819	synonymous_variant	56729			AF205952	CCDS12182.1	19p13.2	2008-02-05				ENSG00000104918			20389	protein-coding gene	gene with protein product		605565				12050208	Standard	NM_020415		Approved	FIZZ3, ADSF, RETN1	uc002mhf.1	Q9HD89		ENST00000221515.2:c.159C>T	19.37:g.7734747C>T			7640747	D6W649|Q540D9|Q76B53	Silent	SNP	ENST00000221515.2	37	CCDS12182.1	SNP	27	Broad																																																																																				0.617	RETN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461731.1	NM_020415		Silent
SLC7A9	11136	broad.mit.edu	37	19	33355029	33355029	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr19:33355029C>G	ENST00000023064.4	-	4	642	c.451G>C	c.(451-453)Gtg>Ctg	p.V151L	RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_Missense_Mutation_p.V151L|SLC7A9_ENST00000587772.1_Missense_Mutation_p.V151L	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	151					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.V151L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	AGGCATTTCACAACGATTTGA	0.597																																					GBM(181;1335 2108 9644 44178 46689)											1	Substitution - Missense(1)	ovary(1)	19											75.0	63.0	67.0					19																	33355029		2203	4300	6503	38046869	SO:0001583	missense	11136			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.451G>C	19.37:g.33355029C>G	ENSP00000023064:p.Val151Leu		38046869	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.75	1.733068	0.30684	.	.	ENSG00000021488	ENST00000023064	D	0.89939	-2.59	4.97	2.83	0.33086	Amino acid permease domain (1);	0.333086	0.36066	N	0.002819	D	0.85239	0.5651	M	0.69248	2.105	0.29922	N	0.822662	B	0.14805	0.011	B	0.15870	0.014	T	0.76942	-0.2772	10	0.33141	T	0.24	.	8.4357	0.32786	0.0:0.6929:0.0:0.3071	.	151	P82251	BAT1_HUMAN	L	151	ENSP00000023064:V151L	ENSP00000023064:V151L	V	-	1	0	SLC7A9	38046869	0.987000	0.35691	0.012000	0.15200	0.007000	0.05969	2.087000	0.41653	0.616000	0.30141	0.491000	0.48974	GTG		0.597	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1			Missense_Mutation
PAFAH1B3	5050	broad.mit.edu	37	19	42801424	42801424	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr19:42801424G>A	ENST00000262890.3	-	5	763	c.502C>T	c.(502-504)Cgg>Tgg	p.R168W	PAFAH1B3_ENST00000538771.1_Missense_Mutation_p.R168W	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	168					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)	p.R168W(1)		breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				AAGTGGGCCCGAGGGTGGCCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											55.0	53.0	54.0					19																	42801424		2203	4300	6503	47493264	SO:0001583	missense	5050			D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.502C>T	19.37:g.42801424G>A	ENSP00000262890:p.Arg168Trp		47493264	Q53X88	Missense_Mutation	SNP	ENST00000262890.3	37	CCDS12602.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125015	0.56721	.	.	ENSG00000079462	ENST00000538771;ENST00000262890	T;T	0.44482	0.92;0.92	5.93	3.7	0.42460	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.127605	0.53938	D	0.000044	T	0.47154	0.1430	N	0.21373	0.66	0.37632	D	0.921719	D	0.89917	1.0	D	0.67103	0.949	T	0.52895	-0.8514	10	0.54805	T	0.06	-25.4548	12.3885	0.55345	0.0:0.0:0.4861:0.5139	.	168	Q15102	PA1B3_HUMAN	W	168	ENSP00000444935:R168W;ENSP00000262890:R168W	ENSP00000262890:R168W	R	-	1	2	PAFAH1B3	47493264	0.043000	0.20138	0.385000	0.26158	0.349000	0.29174	1.774000	0.38573	0.692000	0.31613	0.561000	0.74099	CGG		0.607	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463726.1	NM_002573		Missense_Mutation
USP29	57663	broad.mit.edu	37	19	57642198	57642198	+	Nonsense_Mutation	SNP	A	A	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr19:57642198A>T	ENST00000254181.4	+	4	2609	c.2155A>T	c.(2155-2157)Aaa>Taa	p.K719*	USP29_ENST00000598197.1_Nonsense_Mutation_p.K719*	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	719	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.K719*(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTATGACTGTAAAGAAAACAG	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	19											73.0	71.0	72.0					19																	57642198		2203	4300	6503	62334010	SO:0001587	stop_gained	57663				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2155A>T	19.37:g.57642198A>T	ENSP00000254181:p.Lys719*		62334010		Nonsense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	39	7.634070	0.98403	.	.	ENSG00000131864	ENST00000254181	.	.	.	2.0	-1.91	0.07641	.	1.241770	0.06266	U	0.694774	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7445	3.4188	0.07385	0.4481:0.2136:0.3383:0.0	.	.	.	.	X	719	.	ENSP00000254181:K719X	K	+	1	0	USP29	62334010	0.982000	0.34865	0.000000	0.03702	0.189000	0.23516	0.686000	0.25392	-0.609000	0.05724	0.383000	0.25322	AAA		0.428	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			Nonsense_Mutation
HOXD12	3238	broad.mit.edu	37	2	176964687	176964687	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr2:176964687C>A	ENST00000406506.2	+	1	230	c.158C>A	c.(157-159)gCc>gAc	p.A53D	HOXD12_ENST00000404162.2_Missense_Mutation_p.A53D			P35452	HXD12_HUMAN	homeobox D12	53					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.A53D(1)		central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CCCTGGGCCGCCACGCCCGCC	0.731																																																1	Substitution - Missense(1)	ovary(1)	2											13.0	15.0	14.0					2																	176964687		1753	3970	5723	176672933	SO:0001583	missense	3238				CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.158C>A	2.37:g.176964687C>A	ENSP00000385586:p.Ala53Asp		176672933	B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	SNP	ENST00000406506.2	37	CCDS46456.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533094	0.45073	.	.	ENSG00000170178	ENST00000406506;ENST00000404162	T;T	0.29142	1.58;1.58	3.9	3.9	0.45041	.	0.546985	0.20077	N	0.099721	T	0.25419	0.0618	L	0.38175	1.15	0.09310	N	1	P;B	0.41848	0.763;0.072	B;B	0.39840	0.311;0.033	T	0.16424	-1.0403	10	0.56958	D	0.05	.	11.9172	0.52771	0.0:0.8231:0.1769:0.0	.	53;53	B5MCD3;P35452	.;HXD12_HUMAN	D	53	ENSP00000385586:A53D;ENSP00000385132:A53D	ENSP00000385132:A53D	A	+	2	0	HOXD12	176672933	1.000000	0.71417	0.972000	0.41901	0.951000	0.60555	4.896000	0.63222	2.470000	0.83445	0.655000	0.94253	GCC		0.731	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193		Missense_Mutation
OBSL1	23363	broad.mit.edu	37	2	220421377	220421377	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr2:220421377A>C	ENST00000404537.1	-	13	4191	c.4135T>G	c.(4135-4137)Ttc>Gtc	p.F1379V	OBSL1_ENST00000603926.1_Missense_Mutation_p.F1379V|OBSL1_ENST00000265317.5_Missense_Mutation_p.F278V|OBSL1_ENST00000373876.1_Missense_Mutation_p.F1287V|OBSL1_ENST00000265318.4_Missense_Mutation_p.F1287V|RP11-256I23.2_ENST00000597192.1_RNA	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1379	Ig-like 12.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)	p.F1379V(1)					Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TCACACCGGAACGTGGCATCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	2											51.0	56.0	54.0					2																	220421377		2171	4256	6427	220129621	SO:0001583	missense	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.4135T>G	2.37:g.220421377A>C	ENSP00000385636:p.Phe1379Val		220129621	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	15.05	2.716852	0.48622	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317	T;T;T;T	0.74209	3.38;-0.82;-0.82;-0.82	4.16	4.16	0.48862	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85239	0.5651	M	0.77313	2.365	0.35429	D	0.793921	D;D;D;P	0.71674	0.988;0.996;0.998;0.952	D;D;D;P	0.85130	0.962;0.982;0.997;0.792	D	0.90117	0.4196	9	0.62326	D	0.03	.	13.4259	0.61026	1.0:0.0:0.0:0.0	.	186;1380;1379;278	B7Z5P5;A4KVA4;O75147;E7ER99	.;.;OBSL1_HUMAN;.	V	1287;1379;1287;278	ENSP00000265318:F1287V;ENSP00000385636:F1379V;ENSP00000362983:F1287V;ENSP00000265317:F278V	ENSP00000265317:F278V	F	-	1	0	OBSL1	220129621	0.999000	0.42202	0.871000	0.34182	0.175000	0.22909	4.111000	0.57838	1.766000	0.52107	0.254000	0.18369	TTC		0.627	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1			Missense_Mutation
LPIN3	64900	broad.mit.edu	37	20	39977418	39977418	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr20:39977418C>G	ENST00000373257.3	+	4	539	c.448C>G	c.(448-450)Ccc>Gcc	p.P150A		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	150					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.P150A(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CAGGAGGAAACCCAAGCAGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	20											48.0	47.0	47.0					20																	39977418		2203	4300	6503	39410832	SO:0001583	missense	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.448C>G	20.37:g.39977418C>G	ENSP00000362354:p.Pro150Ala		39410832	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	ENST00000373257.3	37	CCDS33469.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.327809	0.01309	.	.	ENSG00000132793	ENST00000373257	T	0.79653	-1.29	4.35	-1.67	0.08238	.	1.290630	0.05027	N	0.473901	T	0.72431	0.3459	L	0.59436	1.845	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.50363	-0.8837	9	.	.	.	-5.4256	2.3363	0.04248	0.1328:0.3964:0.2936:0.1772	.	150;150	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	A	150	ENSP00000362354:P150A	.	P	+	1	0	LPIN3	39410832	0.231000	0.23751	0.458000	0.27068	0.248000	0.25809	-0.042000	0.12063	-0.056000	0.13221	0.650000	0.86243	CCC		0.627	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896		Missense_Mutation
SEC61A1	29927	broad.mit.edu	37	3	127788458	127788458	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0931-01	TCGA-10-0931-11			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr3:127788458G>T	ENST00000243253.3	+	12	1568	c.1384G>T	c.(1384-1386)Gtt>Ttt	p.V462F	SEC61A1_ENST00000464451.1_Missense_Mutation_p.V468F|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000424880.2_Missense_Mutation_p.V342F|SEC61A1_ENST00000483956.1_3'UTR	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	462					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)	p.V462F(1)		central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						TGAGATCTTCGTTAAGGAGCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											103.0	111.0	108.0					3																	127788458		2203	4300	6503	129271148	SO:0001583	missense	29927			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.1384G>T	3.37:g.127788458G>T	ENSP00000243253:p.Val462Phe		129271148	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	ENST00000243253.3	37	CCDS3046.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238456	0.58886	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.96	5.96	0.96718	SecY subunit domain (2);	0.055610	0.64402	D	0.000001	T	0.78084	0.4228	M	0.86953	2.85	0.80722	D	1	B	0.29835	0.258	B	0.38020	0.263	T	0.77694	-0.2492	9	0.66056	D	0.02	.	20.4084	0.99013	0.0:0.0:1.0:0.0	.	462	P61619	S61A1_HUMAN	F	468;462;342	.	ENSP00000243253:V462F	V	+	1	0	SEC61A1	129271148	1.000000	0.71417	0.986000	0.45419	0.008000	0.06430	9.869000	0.99810	2.833000	0.97629	0.650000	0.86243	GTT		0.607	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336		Missense_Mutation
XRN1	54464	broad.mit.edu	37	3	142051904	142051904	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr3:142051904C>T	ENST00000264951.4	-	35	4084	c.3967G>A	c.(3967-3969)Gca>Aca	p.A1323T	XRN1_ENST00000392981.2_Missense_Mutation_p.A1323T	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1323					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A1323T(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TTCAAAGATGCTAAAAAGTTC	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											84.0	80.0	81.0					3																	142051904		2203	4300	6503	143534594	SO:0001583	missense	54464			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3967G>A	3.37:g.142051904C>T	ENSP00000264951:p.Ala1323Thr		143534594	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375042	0.82682	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.39592	1.07;1.07	5.5	4.61	0.57282	.	0.236666	0.42420	D	0.000713	T	0.47801	0.1465	L	0.32530	0.975	0.80722	D	1	D;D	0.64830	0.994;0.99	P;P	0.59825	0.864;0.735	T	0.37911	-0.9685	10	0.51188	T	0.08	-11.5693	13.2221	0.59894	0.0:0.9253:0.0:0.0747	.	1323;1323	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	T	1323	ENSP00000264951:A1323T;ENSP00000376707:A1323T	ENSP00000264951:A1323T	A	-	1	0	XRN1	143534594	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.402000	0.52608	2.854000	0.98071	0.655000	0.94253	GCA		0.368	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		Missense_Mutation
SKIL	6498	broad.mit.edu	37	3	170078893	170078893	+	Silent	SNP	T	T	C			TCGA-10-0931-01	TCGA-10-0931-11			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr3:170078893T>C	ENST00000458537.3	+	1	1483	c.774T>C	c.(772-774)acT>acC	p.T258T	SKIL_ENST00000259119.4_Silent_p.T258T|SKIL_ENST00000426052.2_Silent_p.T238T|SKIL_ENST00000413427.2_Silent_p.T258T	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	258					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.T258T(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TAAAGGAAACTGGCAGTGCCT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	3											137.0	121.0	126.0					3																	170078893		2203	4300	6503	171561587	SO:0001819	synonymous_variant	6498			X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.774T>C	3.37:g.170078893T>C			171561587	A6NGT1|B4DT50|O00464|P12756|Q07501	Silent	SNP	ENST00000458537.3	37	CCDS33890.1	SNP	55	Broad																																																																																				0.438	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414		Silent
ZCCHC4	29063	broad.mit.edu	37	4	25363484	25363484	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr4:25363484G>C	ENST00000302874.4	+	9	1039	c.1015G>C	c.(1015-1017)Gat>Cat	p.D339H		NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	339							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.D339H(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				TTTCTAGGTAGATTATGATAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											44.0	43.0	43.0					4																	25363484		1811	4078	5889	24972582	SO:0001583	missense	29063			AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.1015G>C	4.37:g.25363484G>C	ENSP00000303468:p.Asp339His		24972582	B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Missense_Mutation	SNP	ENST00000302874.4	37	CCDS43218.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.63|14.63	2.592132|2.592132	0.46214|0.46214	.|.	.|.	ENSG00000168228|ENSG00000168228	ENST00000302874|ENST00000505412	T|.	0.33865|.	1.39|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.125440|.	0.64402|.	D|.	0.000001|.	T|T	0.77980|0.77980	0.4212|0.4212	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.70716|.	0.97|.	T|T	0.77059|0.77059	-0.2728|-0.2728	10|5	0.72032|.	D|.	0.01|.	-17.9633|-17.9633	18.7943|18.7943	0.91988|0.91988	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	339|.	Q9H5U6|.	ZCHC4_HUMAN|.	H|T	339|203	ENSP00000303468:D339H|.	ENSP00000303468:D339H|.	D|R	+|+	1|2	0|0	ZCCHC4|ZCCHC4	24972582|24972582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.867000|7.867000	0.87062|0.87062	2.809000|2.809000	0.96659|0.96659	0.655000|0.655000	0.94253|0.94253	GAT|AGA		0.333	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361151.1			Missense_Mutation
LNX1	84708	broad.mit.edu	37	4	54347947	54347947	+	Silent	SNP	G	G	A	rs201113367		TCGA-10-0931-01	TCGA-10-0931-11			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr4:54347947G>A	ENST00000263925.7	-	7	1739	c.1425C>T	c.(1423-1425)gcC>gcT	p.A475A	FIP1L1_ENST00000507166.1_Intron|LNX1_ENST00000306888.2_Silent_p.A379A	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	475					protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A379A(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGTTCCAGCCGGCTTCCTGAA	0.632																																																1	Substitution - coding silent(1)	ovary(1)	4											44.0	43.0	43.0					4																	54347947		2203	4299	6502	54042704	SO:0001819	synonymous_variant	84708			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1425C>T	4.37:g.54347947G>A			54042704	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	37	CCDS47057.1	SNP	39	Broad																																																																																				0.632	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2			Silent
EXOC1	55763	broad.mit.edu	37	4	56726676	56726676	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr4:56726676T>C	ENST00000381295.2	+	3	572	c.224T>C	c.(223-225)cTt>cCt	p.L75P	EXOC1_ENST00000346134.7_Missense_Mutation_p.L75P|EXOC1_ENST00000349598.6_Missense_Mutation_p.L75P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	75					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L75P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					CTTCGAGATCTTGCTGTGGTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	4											139.0	135.0	136.0					4																	56726676		2203	4300	6503	56421433	SO:0001583	missense	55763			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.224T>C	4.37:g.56726676T>C	ENSP00000370695:p.Leu75Pro		56421433	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	24.6	4.545522	0.86022	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.79941	0.4533	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	T	0.82552	-0.0400	9	0.87932	D	0	.	16.2025	0.82095	0.0:0.0:0.0:1.0	.	75;75	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	75	.	ENSP00000326514:L75P	L	+	2	0	EXOC1	56421433	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.517000	0.81783	2.289000	0.77006	0.528000	0.53228	CTT		0.413	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261		Missense_Mutation
GFOD1	54438	broad.mit.edu	37	6	13365261	13365261	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr6:13365261C>T	ENST00000379287.3	-	2	1551	c.887G>A	c.(886-888)aGc>aAc	p.S296N	GFOD1_ENST00000379284.1_Missense_Mutation_p.S193N	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	296						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.S296N(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			GGGGATGTCGCTGAAGGCCTT	0.692																																																1	Substitution - Missense(1)	ovary(1)	6											49.0	51.0	50.0					6																	13365261		2203	4300	6503	13473240	SO:0001583	missense	54438			AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.887G>A	6.37:g.13365261C>T	ENSP00000368589:p.Ser296Asn		13473240	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	37	CCDS4524.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271345	0.40194	.	.	ENSG00000145990	ENST00000379287;ENST00000379284	T;T	0.46063	1.45;0.88	5.6	4.72	0.59763	.	0.039193	0.85682	D	0.000000	T	0.17195	0.0413	L	0.34521	1.04	0.49687	D	0.99981	B	0.20887	0.049	B	0.23275	0.045	T	0.05517	-1.0880	10	0.17832	T	0.49	-21.8561	14.9956	0.71428	0.1435:0.8565:0.0:0.0	.	296	Q9NXC2	GFOD1_HUMAN	N	296;193	ENSP00000368589:S296N;ENSP00000368586:S193N	ENSP00000368586:S193N	S	-	2	0	GFOD1	13473240	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.089000	0.71384	1.337000	0.45525	0.555000	0.69702	AGC		0.692	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988		Missense_Mutation
BTN2A1	11120	broad.mit.edu	37	6	26459887	26459887	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr6:26459887G>C	ENST00000312541.5	+	3	509	c.261G>C	c.(259-261)gaG>gaC	p.E87D	BTN2A1_ENST00000541522.1_Missense_Mutation_p.E26D|BTN2A1_ENST00000469185.1_Missense_Mutation_p.E87D|BTN2A1_ENST00000429381.1_Missense_Mutation_p.E87D	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	87	Ig-like V-type.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.E87D(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						GAACAGAGGAGCAGATGGAGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	6											165.0	142.0	150.0					6																	26459887		2203	4300	6503	26567866	SO:0001583	missense	11120			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.261G>C	6.37:g.26459887G>C	ENSP00000312158:p.Glu87Asp		26567866	B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	ENST00000312541.5	37	CCDS4613.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200242	0.58126	.	.	ENSG00000112763	ENST00000312541;ENST00000493173;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	3.01	1.19	0.21007	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000072	T	0.58380	0.2118	M	0.68728	2.09	0.25661	N	0.986005	P;D	0.71674	0.857;0.998	P;D	0.67548	0.666;0.952	T	0.50783	-0.8787	10	0.49607	T	0.09	.	7.1371	0.25535	0.2412:0.0:0.7588:0.0	.	87;87	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	D	87;26;26;87;87;87	ENSP00000312158:E87D;ENSP00000420447:E26D;ENSP00000443909:E26D;ENSP00000416945:E87D;ENSP00000419043:E87D	ENSP00000265424:E87D	E	+	3	2	BTN2A1	26567866	0.973000	0.33851	0.998000	0.56505	0.942000	0.58702	0.253000	0.18296	0.311000	0.23014	0.561000	0.74099	GAG		0.547	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040122.2	NM_007049		Missense_Mutation
BMP5	653	broad.mit.edu	37	6	55659173	55659173	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr6:55659173C>T	ENST00000370830.3	-	3	1434	c.736G>A	c.(736-738)Ggt>Agt	p.G246S	BMP5_ENST00000446683.2_Missense_Mutation_p.G246S	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	246					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.G246S(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACAAGCCAACCCACATCTAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											104.0	104.0	104.0					6																	55659173		2203	4300	6503	55767132	SO:0001583	missense	653				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.736G>A	6.37:g.55659173C>T	ENSP00000359866:p.Gly246Ser		55767132	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.584364	0.96578	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.67698	-0.28;-0.28	5.53	5.53	0.82687	Transforming growth factor-beta, N-terminal (1);	0.047845	0.85682	D	0.000000	T	0.81555	0.4847	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.82758	-0.0299	10	0.72032	D	0.01	.	19.8185	0.96581	0.0:1.0:0.0:0.0	.	246;246	B4E0Y4;P22003	.;BMP5_HUMAN	S	246	ENSP00000359866:G246S;ENSP00000391818:G246S	ENSP00000359866:G246S	G	-	1	0	BMP5	55767132	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.691000	0.68249	2.750000	0.94351	0.655000	0.94253	GGT		0.393	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1			Missense_Mutation
TAGAP	117289	broad.mit.edu	37	6	159459153	159459153	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr6:159459153G>T	ENST00000367066.3	-	9	1222	c.891C>A	c.(889-891)gaC>gaA	p.D297E	TAGAP_ENST00000326965.6_Missense_Mutation_p.D119E|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	297					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.D297E(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TACCTGAACTGTCAGTGTGCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	6											135.0	123.0	127.0					6																	159459153		2203	4300	6503	159379141	SO:0001583	missense	117289			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.891C>A	6.37:g.159459153G>T	ENSP00000356033:p.Asp297Glu		159379141	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	CCDS5261.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393222	0.42410	.	.	ENSG00000164691	ENST00000367066;ENST00000326965	T;T	0.19669	2.13;2.39	6.17	4.41	0.53225	.	0.063541	0.64402	D	0.000006	T	0.13114	0.0318	M	0.78049	2.395	0.80722	D	1	P	0.47106	0.89	B	0.39840	0.311	T	0.02743	-1.1116	10	0.40728	T	0.16	-48.1994	9.6308	0.39778	0.2136:0.0:0.7864:0.0	.	297	Q8N103	TAGAP_HUMAN	E	297;119	ENSP00000356033:D297E;ENSP00000322650:D119E	ENSP00000322650:D119E	D	-	3	2	TAGAP	159379141	1.000000	0.71417	0.951000	0.38953	0.188000	0.23474	2.289000	0.43523	0.948000	0.37687	-0.137000	0.14449	GAC		0.423	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114		Missense_Mutation
TSPAN13	27075	broad.mit.edu	37	7	16817486	16817486	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr7:16817486C>G	ENST00000262067.4	+	4	809	c.376C>G	c.(376-378)Cta>Gta	p.L126V	TSPAN13_ENST00000466195.1_3'UTR	NM_014399.3	NP_055214.1	O95857	TSN13_HUMAN	tetraspanin 13	126						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.L126V(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	7	Lung NSC(10;0.0494)|all_lung(11;0.109)			UCEC - Uterine corpus endometrioid carcinoma (126;0.188)		CCAGAGAAATCTAAACTGCTG	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											101.0	95.0	97.0					7																	16817486		2203	4300	6503	16784011	SO:0001583	missense	27075			AF100759	CCDS5363.1	7p21.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000106537	ENSG00000106537		"""Tetraspanins"""	21643	protein-coding gene	gene with protein product		613139	"""transmembrane 4 superfamily member 13"""	TM4SF13			Standard	NM_014399		Approved	NET-6	uc003stq.3	O95857	OTTHUMG00000022968	ENST00000262067.4:c.376C>G	7.37:g.16817486C>G	ENSP00000262067:p.Leu126Val		16784011		Missense_Mutation	SNP	ENST00000262067.4	37	CCDS5363.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504838	0.64410	.	.	ENSG00000106537	ENST00000262067	D	0.82526	-1.62	5.74	0.00658	0.14068	.	0.000000	0.85682	D	0.000000	D	0.89849	0.6834	M	0.85197	2.74	0.45307	D	0.998301	D	0.76494	0.999	D	0.85130	0.997	D	0.88689	0.3207	10	0.62326	D	0.03	-6.7638	10.7989	0.46476	0.0:0.3655:0.0:0.6345	.	126	O95857	TSN13_HUMAN	V	126	ENSP00000262067:L126V	ENSP00000262067:L126V	L	+	1	2	TSPAN13	16784011	1.000000	0.71417	0.964000	0.40570	0.993000	0.82548	0.933000	0.28897	0.119000	0.18210	-0.290000	0.09829	CTA		0.373	TSPAN13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250178.2	NM_014399		Missense_Mutation
ZFHX4	79776	broad.mit.edu	37	8	77766496	77766496	+	Nonsense_Mutation	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr8:77766496C>T	ENST00000521891.2	+	10	7787	c.7339C>T	c.(7339-7341)Cag>Tag	p.Q2447*	ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.Q2421*|ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.Q2402*|ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.Q2402*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.Q2431*(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			agcccagccacagccacagcc	0.577										HNSCC(33;0.089)																																						1	Substitution - Nonsense(1)	ovary(1)	8											69.0	121.0	103.0					8																	77766496		2098	4224	6322	77929051	SO:0001587	stop_gained	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7339C>T	8.37:g.77766496C>T	ENSP00000430497:p.Gln2447*		77929051	G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	51	17.689213	0.99891	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	5.62	4.69	0.59074	.	0.357280	0.19983	U	0.101740	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	11.6863	0.51487	0.0:0.8219:0.1781:0.0	.	.	.	.	X	2447;2431;2402;2402;2421	.	ENSP00000050961:Q2402X	Q	+	1	0	ZFHX4	77929051	1.000000	0.71417	0.429000	0.26710	0.823000	0.46562	7.208000	0.77907	2.652000	0.90054	0.555000	0.69702	CAG		0.577	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Nonsense_Mutation
MED22	6837	broad.mit.edu	37	9	136211065	136211065	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr9:136211065C>T	ENST00000491289.1	-	4	909	c.328G>A	c.(328-330)Gag>Aag	p.E110K	MED22_ENST00000344469.5_Missense_Mutation_p.E110K|MED22_ENST00000476080.1_Missense_Mutation_p.E110K|MED22_ENST00000471524.1_5'UTR|MED22_ENST00000343730.5_Missense_Mutation_p.E110K|MED22_ENST00000371999.1_Missense_Mutation_p.E104K			Q15528	MED22_HUMAN	mediator complex subunit 22	110						cytoplasm (GO:0005737)|mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.E110K(2)		endometrium(1)|large_intestine(1)|ovary(1)|urinary_tract(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		TCGCACTCCTCCTGCAGTGTG	0.567																																																2	Substitution - Missense(2)	ovary(2)	9											132.0	110.0	117.0					9																	136211065		2203	4300	6503	135200886	SO:0001583	missense	6837				CCDS6963.1, CCDS6964.1	9q34.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000148297	ENSG00000148297			11477	protein-coding gene	gene with protein product		185641	"""surfeit 5"""	SURF5		8499913, 15175163	Standard	NM_133640		Approved	Med24	uc004cdc.3	Q15528	OTTHUMG00000020869	ENST00000491289.1:c.328G>A	9.37:g.136211065C>T	ENSP00000420393:p.Glu110Lys		135200886	B3KW83|B3KWX4|O76072|Q5T8U0	Missense_Mutation	SNP	ENST00000491289.1	37	CCDS6963.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281993	0.59867	.	.	ENSG00000148297	ENST00000491289;ENST00000486395;ENST00000343730;ENST00000344469;ENST00000476080;ENST00000371999;ENST00000446777;ENST00000494177;ENST00000457204	.	.	.	5.08	5.08	0.68730	.	0.144593	0.64402	D	0.000008	T	0.59032	0.2164	L	0.49126	1.545	0.80722	D	1	B;B	0.19200	0.021;0.034	B;B	0.21151	0.012;0.033	T	0.55730	-0.8095	9	0.37606	T	0.19	-18.3246	17.4741	0.87655	0.0:1.0:0.0:0.0	.	110;110	Q15528-2;Q15528	.;MED22_HUMAN	K	110;110;110;110;110;104;110;110;110	.	ENSP00000342343:E110K	E	-	1	0	MED22	135200886	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	7.388000	0.79795	2.362000	0.80069	0.655000	0.94253	GAG		0.567	MED22-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054898.2	NM_133640		Missense_Mutation
BRD3	8019	broad.mit.edu	37	9	136917543	136917543	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chr9:136917543T>C	ENST00000303407.7	-	3	421	c.236A>G	c.(235-237)aAc>aGc	p.N79S	BRD3_ENST00000371834.2_Missense_Mutation_p.N79S|RP11-374P20.4_ENST00000412181.1_RNA|BRD3_ENST00000357885.2_Missense_Mutation_p.N79S	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	79	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)	p.N79S(1)	BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		ATCCATTGGGTTTTTAATTAT	0.343			T	C15orf55	lethal midline carcinoma of young people																																		Dom	yes		9	9q34	8019	bromodomain containing 3		E	1	Substitution - Missense(1)	ovary(1)	9											76.0	84.0	81.0					9																	136917543		2203	4299	6502	135907364	SO:0001583	missense	8019				CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.236A>G	9.37:g.136917543T>C	ENSP00000305918:p.Asn79Ser		135907364	B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Missense_Mutation	SNP	ENST00000303407.7	37	CCDS6980.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	14.12	2.439552	0.43326	.	.	ENSG00000169925	ENST00000303407;ENST00000371834;ENST00000357885	T;T;T	0.30714	1.52;1.52;1.52	4.97	3.8	0.43715	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.28200	0.0696	L	0.49778	1.585	0.51482	D	0.999928	B;B	0.24963	0.115;0.002	B;B	0.23419	0.046;0.004	T	0.05131	-1.0904	10	0.46703	T	0.11	-50.8785	11.2903	0.49245	0.0:0.0:0.1532:0.8468	.	79;79	Q15059-2;Q15059	.;BRD3_HUMAN	S	79	ENSP00000305918:N79S;ENSP00000360900:N79S;ENSP00000350557:N79S	ENSP00000305918:N79S	N	-	2	0	BRD3	135907364	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	3.147000	0.50639	0.812000	0.34326	0.459000	0.35465	AAC		0.343	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055390.4	NM_007371		Missense_Mutation
RBBP7	5931	broad.mit.edu	37	X	16870701	16870701	+	Silent	SNP	G	G	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-10-0931-01	TCGA-10-0931-11	g.chrX:16870701G>A	ENST00000380087.2	-	8	1296	c.936C>T	c.(934-936)ttC>ttT	p.F312F	RBBP7_ENST00000404022.1_Silent_p.F303F|RBBP7_ENST00000380084.4_Silent_p.F356F			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	312					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)	p.F312F(1)		biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					TATGAGATTCGAAGGTATGGA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	X											63.0	58.0	60.0					X																	16870701		2203	4300	6503	16780622	SO:0001819	synonymous_variant	5931			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.936C>T	X.37:g.16870701G>A			16780622	Q5JP00	Silent	SNP	ENST00000380087.2	37	CCDS14179.1	SNP	37	Broad																																																																																				0.338	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893		Silent
TP53	7157	broad.mit.edu	37	17	7578524	7578524	+	Nonsense_Mutation	SNP	G	G	A			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-10-0931-01	TCGA-10-0931-11	g.chr17:7578524G>A	ENST00000269305.4	-	5	595	c.406C>T	c.(406-408)Caa>Taa	p.Q136*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q136*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q136*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	136	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> E (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q136*(34)|p.0?(8)|p.C135fs*9(3)|p.Q136E(3)|p.N131fs*27(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.Q136K(1)|p.S127_Q136del10(1)|p.V73fs*9(1)|p.Q43*(1)|p.Y126fs*11(1)|p.Q4*(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.Q136_K139delQLAK(1)|p.Q136fs*34(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGCCAGTTGGCAAAACATC	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Nonsense(36)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(4)|Insertion - In frame(2)|Insertion - Frameshift(1)|Complex - deletion inframe(1)	upper_aerodigestive_tract(9)|ovary(9)|urinary_tract(8)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|stomach(5)|breast(4)|bone(4)|large_intestine(3)|oesophagus(3)|skin(3)|lung(3)|soft_tissue(1)|endometrium(1)|pancreas(1)	17	GRCh37	CM971503	TP53	M							52.0	52.0	52.0					17																	7578524		2203	4300	6503	7519249	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.406C>T	17.37:g.7578524G>A	ENSP00000269305:p.Gln136*		7519249	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.349260	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.5387	17.2272	0.86973	0.0:0.0:1.0:0.0	.	.	.	.	X	136;136;136;136;136;136;125;43;4;43;4;136	.	ENSP00000269305:Q136X	Q	-	1	0	TP53	7519249	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.809000	0.99208	2.733000	0.93635	0.655000	0.94253	CAA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
KLHDC3	116138	broad.mit.edu	37	6	42985674	42985695	+	Frame_Shift_Del	DEL	ATCATGTACATTTTTGGGGGCT	ATCATGTACATTTTTGGGGGCT	-			TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-10-0931-01	TCGA-10-0931-11	g.chr6:42985674_42985695delATCATGTACATTTTTGGGGGCT	ENST00000326974.4	+	4	610_631	c.415_436delATCATGTACATTTTTGGGGGCT	c.(415-438)atcatgtacatttttgggggctacfs	p.IMYIFGGY139fs	KLHDC3_ENST00000244670.8_Intron|KLHDC3_ENST00000332245.8_Frame_Shift_Del_p.IMYIFGGY80fs	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	139					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCTAGGCAAGATCATGTACATTTTTGGGGGCTACGAGCAGCA	0.514																																																0			6																																								43093673	SO:0001589	frameshift_variant	116138			AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.415_436delATCATGTACATTTTTGGGGGCT	6.37:g.42985674_42985695delATCATGTACATTTTTGGGGGCT	ENSP00000313995:p.Ile139fs		43093652	A8K2W9	Frame_Shift_Del	DEL	ENST00000326974.4	37	CCDS4880.1	DEL	12	Broad																																																																																				0.514	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040570.1	NM_057161		Frame_Shift_Del
PYCRL	65263	broad.mit.edu	37	8	144687927	144687953	+	In_Frame_Del	DEL	GGCTGCTCGCAGCCCGCCCTGCTCCAG	GGCTGCTCGCAGCCCGCCCTGCTCCAG	-	rs138226068|rs575409447|rs199825286|rs375748238		TCGA-10-0931-01	TCGA-10-0931-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-10-0931-01	TCGA-10-0931-11	g.chr8:144687927_144687953delGGCTGCTCGCAGCCCGCCCTGCTCCAG	ENST00000220966.6	-	6	807_833	c.778_804delCTGGAGCAGGGCGGGCTGCGAGCAGCC	c.(778-804)ctggagcagggcgggctgcgagcagccdel	p.LEQGGLRAA260del	RP11-661A12.14_ENST00000606452.1_lincRNA|PYCRL_ENST00000377579.3_In_Frame_Del_p.LEQGGLRAA111del|PYCRL_ENST00000495276.1_5'UTR	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	248					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)	p.A255V(1)|p.L248_A256delLEQGGLRAA(1)		central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	CGCTCATGGTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGCGTGGAGT	0.683																																																2	Substitution - Missense(1)|Deletion - In frame(1)	ovary(1)|endometrium(1)	8																																								144759096	SO:0001651	inframe_deletion	65263			AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.778_804delCTGGAGCAGGGCGGGCTGCGAGCAGCC	8.37:g.144687927_144687953delGGCTGCTCGCAGCCCGCCCTGCTCCAG	ENSP00000220966:p.Leu260_Ala268del		144759070	B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	In_Frame_Del	DEL	ENST00000220966.6	37	CCDS6407.2	DEL	47	Broad																																																																																				0.683	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347081.2	NM_023078		In_Frame_Del
