#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAMTS14	140766	hgsc.bcm.edu	37	10	72489923	72489923	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr10:72489923C>A	ENST00000373207.1	+	6	1020	c.1020C>A	c.(1018-1020)caC>caA	p.H340Q	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.H340Q	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	340	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H340Q(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GCTGGGCACACTCCCAGCAGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	10											80.0	72.0	75.0					10																	72489923		2203	4300	6503	72159929	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1020C>A	10.37:g.72489923C>A	ENSP00000362303:p.His340Gln		72159929	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594421	0.28445	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.61742	0.08;0.08	4.7	-0.705	0.11252	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.358636	0.28371	N	0.015591	T	0.23611	0.0571	N	0.04669	-0.19	0.29650	N	0.844066	B;B	0.12013	0.005;0.005	B;B	0.15870	0.014;0.014	T	0.05989	-1.0852	10	0.19147	T	0.46	.	1.3485	0.02168	0.1262:0.3438:0.2466:0.2834	.	340;340	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	Q	340	ENSP00000362304:H340Q;ENSP00000362303:H340Q	ENSP00000362303:H340Q	H	+	3	2	ADAMTS14	72159929	1.000000	0.71417	0.111000	0.21465	0.863000	0.49368	1.434000	0.34958	-0.204000	0.10235	-0.768000	0.03414	CAC		0.652	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		Missense_Mutation
ADCY2	108	hgsc.bcm.edu	37	5	7520994	7520994	+	Silent	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr5:7520994G>A	ENST00000338316.4	+	3	641	c.552G>A	c.(550-552)aaG>aaA	p.K184K		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	184					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.K184K(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CGGGAGGCAAGGAGCACCTGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	5											160.0	109.0	126.0					5																	7520994		2203	4300	6503	7573994	SO:0001819	synonymous_variant	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.552G>A	5.37:g.7520994G>A			7573994	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2	SNP	35	Baylor																																																																																				0.612	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		Silent
AIFM3	150209	hgsc.bcm.edu	37	22	21330811	21330811	+	Silent	SNP	G	G	T			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr22:21330811G>T	ENST00000399167.2	+	11	1254	c.1014G>T	c.(1012-1014)gtG>gtT	p.V338V	AIFM3_ENST00000399163.2_Silent_p.V338V|AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000405089.1_Silent_p.V344V|AIFM3_ENST00000440238.2_Silent_p.V338V|AIFM3_ENST00000335375.5_Silent_p.V326V|AIFM3_ENST00000333607.6_Silent_p.V338V	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	338					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)	p.V338V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGGTCGTCGTGGGAGCCGGCT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	22											84.0	55.0	65.0					22																	21330811		2203	4300	6503	19660811	SO:0001819	synonymous_variant	150209			AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.1014G>T	22.37:g.21330811G>T			19660811	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Silent	SNP	ENST00000399167.2	37	CCDS13786.1	SNP	47	Baylor																																																																																				0.622	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1	NM_144704		Silent
ANXA6	309	hgsc.bcm.edu	37	5	150512081	150512081	+	Missense_Mutation	SNP	C	C	T	rs370325414		TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr5:150512081C>T	ENST00000354546.5	-	10	919	c.692G>A	c.(691-693)cGa>cAa	p.R231Q	ANXA6_ENST00000377751.5_Intron|ANXA6_ENST00000356496.5_Missense_Mutation_p.R231Q|ANXA6_ENST00000523714.1_Missense_Mutation_p.R199Q|ANXA6_ENST00000521512.1_Intron	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	231					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)	p.R231Q(1)		endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGCTCCCCTCGGATGCTGGC	0.552																																																1	Substitution - Missense(1)	ovary(1)	5						C	GLN/ARG,GLN/ARG	2,3832		0,2,1915	50.0	52.0	51.0		692,596	5.3	1.0	5		51	0,8256		0,0,4128	no	missense,missense	ANXA6	NM_001155.4,NM_001193544.1	43,43	0,2,6043	TT,TC,CC		0.0,0.0522,0.0165	possibly-damaging,possibly-damaging	231/674,199/642	150512081	2,12088	1917	4128	6045	150492274	SO:0001583	missense	309			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.692G>A	5.37:g.150512081C>T	ENSP00000346550:p.Arg231Gln		150492274	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	ENST00000354546.5	37	CCDS47315.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.25	3.792333	0.70452	5.22E-4	0.0	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000540153	T;T;T	0.03094	4.05;4.05;4.05	5.31	5.31	0.75309	Annexin repeat, conserved site (1);	0.269315	0.37715	N	0.001970	T	0.02119	0.0066	N	0.05158	-0.105	0.43734	D	0.996229	P;D	0.53312	0.912;0.959	B;B	0.34489	0.089;0.184	T	0.63686	-0.6581	10	0.51188	T	0.08	.	15.8962	0.79336	0.0:1.0:0.0:0.0	.	231;231	A6NN80;P08133	.;ANXA6_HUMAN	Q	231;199;231;105	ENSP00000346550:R231Q;ENSP00000430517:R199Q;ENSP00000348889:R231Q	ENSP00000346550:R231Q	R	-	2	0	ANXA6	150492274	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.008000	0.57103	2.487000	0.83934	0.650000	0.86243	CGA		0.552	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155		Missense_Mutation
ARMS2	387715	hgsc.bcm.edu	37	10	124214258	124214258	+	Nonsense_Mutation	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr10:124214258C>A	ENST00000528446.1	+	1	90	c.15C>A	c.(13-15)taC>taA	p.Y5*		NM_001099667.1	NP_001093137.1	P0C7Q2	ARMS2_HUMAN	age-related maculopathy susceptibility 2	5					retina homeostasis (GO:0001895)	mitochondrion (GO:0005739)|photoreceptor inner segment (GO:0001917)		p.Y5*(1)		ovary(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGCGCCTATACCCAGGACCGA	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	10											90.0	95.0	93.0					10																	124214258		2065	4203	6268	124204248	SO:0001587	stop_gained	387715			BC066349	CCDS53585.1	10q26.13	2013-01-23			ENSG00000254636	ENSG00000254636			32685	protein-coding gene	gene with protein product		611313				16080115, 16174643	Standard	NM_001099667		Approved	LOC387715, ARMD8	uc001lgi.3	P0C7Q2	OTTHUMG00000048232	ENST00000528446.1:c.15C>A	10.37:g.124214258C>A	ENSP00000436682:p.Tyr5*		124204248	B2Y7I5	Nonsense_Mutation	SNP	ENST00000528446.1	37	CCDS53585.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207839	0.39003	.	.	ENSG00000254636	ENST00000528446	.	.	.	1.78	-0.575	0.11734	.	.	.	.	.	.	.	.	.	.	.	0.52099	A	0.999944	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	2.2155	0.03958	0.0:0.352:0.3382:0.3098	.	.	.	.	X	5	.	ENSP00000436682:Y5X	Y	+	3	2	ARMS2	124204248	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.067000	0.11579	-0.139000	0.11414	-0.182000	0.12963	TAC		0.567	ARMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109727.2			Nonsense_Mutation
BNIP3L	665	hgsc.bcm.edu	37	8	26265553	26265553	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr8:26265553A>C	ENST00000380629.2	+	4	628	c.395A>C	c.(394-396)gAg>gCg	p.E132A	BNIP3L_ENST00000518611.1_Missense_Mutation_p.E92A|BNIP3L_ENST00000521254.1_3'UTR|BNIP3L_ENST00000520409.1_Missense_Mutation_p.E92A|BNIP3L_ENST00000523515.1_Missense_Mutation_p.E92A	NM_004331.2	NP_004322.1	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3-like	132					defense response to virus (GO:0051607)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		AAGGAAGTCGAGGCTTTGAAG	0.408																																																0			8											102.0	95.0	97.0					8																	26265553		2203	4300	6503	26321470	SO:0001583	missense	665			AB004788	CCDS6050.1	8p21	2014-05-13	2002-08-29		ENSG00000104765	ENSG00000104765			1085	protein-coding gene	gene with protein product		605368	"""BCL2/adenovirus E1B 19kD-interacting protein 3-like"""			9523198, 9973195	Standard	NM_004331		Approved	Nix, BNIP3a	uc003xex.1	O60238	OTTHUMG00000099433	ENST00000380629.2:c.395A>C	8.37:g.26265553A>C	ENSP00000370003:p.Glu132Ala		26321470	B0AZS9|Q5JW63|Q8NF87	Missense_Mutation	SNP	ENST00000380629.2	37	CCDS6050.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512062	0.85389	.	.	ENSG00000104765	ENST00000380629;ENST00000221209;ENST00000523949;ENST00000523515;ENST00000520409;ENST00000518611	.	.	.	6.01	6.01	0.97437	.	0.354163	0.36519	N	0.002552	T	0.64483	0.2602	L	0.60957	1.885	0.45747	D	0.998649	B;P	0.47484	0.052;0.896	B;P	0.48952	0.055;0.596	T	0.66420	-0.5928	9	0.54805	T	0.06	.	16.5285	0.84344	1.0:0.0:0.0:0.0	.	92;132	B0AZS9;O60238	.;BNI3L_HUMAN	A	132;132;110;92;92;92	.	ENSP00000221209:E132A	E	+	2	0	BNIP3L	26321470	1.000000	0.71417	0.944000	0.38274	0.978000	0.69477	7.044000	0.76578	2.307000	0.77673	0.528000	0.53228	GAG		0.408	BNIP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216895.1	NM_004331		Missense_Mutation
BPNT1	10380	hgsc.bcm.edu	37	1	220253167	220253167	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0937-01	TCGA-10-0937-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr1:220253167A>C	ENST00000469520.2	-	3	471	c.22T>G	c.(22-24)Ttg>Gtg	p.L8V	BPNT1_ENST00000354807.3_Missense_Mutation_p.L8V|BPNT1_ENST00000544404.1_Intron|BPNT1_ENST00000322067.7_Missense_Mutation_p.L8V|BPNT1_ENST00000482136.1_Intron|BPNT1_ENST00000414869.2_Missense_Mutation_p.L8V			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	8					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)	p.L8V(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		AACCGCATCAACACAGTGTTA	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	87.0	91.0					1																	220253167		1902	4114	6016	218319790	SO:0001583	missense	10380			AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.22T>G	1.37:g.220253167A>C	ENSP00000446828:p.Leu8Val		218319790	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Missense_Mutation	SNP	ENST00000469520.2	37	CCDS41469.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.870	1.198596	0.22121	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000354807;ENST00000302686;ENST00000414869;ENST00000463953;ENST00000498791;ENST00000498237	D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.51	-1.67	0.08238	.	0.145283	0.42172	D	0.000758	T	0.76723	0.4027	L	0.28740	0.885	0.80722	D	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.29785	0.107;0.072;0.082	T	0.60777	-0.7196	10	0.33940	T	0.23	.	13.7995	0.63190	0.3487:0.0:0.6513:0.0	.	8;8;8	B4DUS9;A6NF51;O95861	.;.;BPNT1_HUMAN	V	8	ENSP00000318852:L8V;ENSP00000446828:L8V;ENSP00000346862:L8V;ENSP00000410348:L8V;ENSP00000446953:L8V;ENSP00000446850:L8V;ENSP00000449883:L8V	ENSP00000307087:L8V	L	-	1	2	BPNT1	218319790	0.829000	0.29322	0.979000	0.43373	0.513000	0.34164	0.124000	0.15728	-0.561000	0.06094	-0.341000	0.08007	TTG		0.398	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085		Missense_Mutation
BRF1	2972	hgsc.bcm.edu	37	14	105684028	105684028	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr14:105684028A>G	ENST00000546474.1	-	15	16584	c.1625T>C	c.(1624-1626)gTg>gCg	p.V542A	BRF1_ENST00000392557.4_Missense_Mutation_p.V338A|BRF1_ENST00000446501.2_Missense_Mutation_p.V304A|BRF1_ENST00000379932.4_Intron|BRF1_ENST00000440513.3_Missense_Mutation_p.V449A|BRF1_ENST00000547530.1_Missense_Mutation_p.V68A|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000379937.2_Missense_Mutation_p.V515A|BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000327359.3_Missense_Mutation_p.V427A	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	542			V -> M (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)	p.V542A(1)		NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GCCCCGGAGCACGCTATAATT	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											49.0	46.0	47.0					14																	105684028		2202	4300	6502	104755073	SO:0001583	missense	2972			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1625T>C	14.37:g.105684028A>G	ENSP00000448323:p.Val542Ala		104755073	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	ENST00000546474.1	37	CCDS10001.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	29.9	5.043572	0.93685	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000547530;ENST00000446501;ENST00000327359;ENST00000440513;ENST00000547562	.	.	.	5.35	5.35	0.76521	Brf1-like TBP-binding (1);	0.000000	0.85682	D	0.000000	T	0.65512	0.2698	L	0.38692	1.165	0.80722	D	1	P;D;P;D	0.89917	0.845;1.0;0.911;0.972	P;D;P;P	0.91635	0.699;0.999;0.55;0.836	T	0.62558	-0.6829	9	0.29301	T	0.29	.	13.2869	0.60247	1.0:0.0:0.0:0.0	.	449;101;515;542	F5H5Z7;Q6ZV39;Q92994-5;Q92994	.;.;.;TF3B_HUMAN	A	338;515;542;68;304;427;449;262	.	ENSP00000329029:V427A	V	-	2	0	BRF1	104755073	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	8.764000	0.91719	2.030000	0.59900	0.459000	0.35465	GTG		0.622	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519		Missense_Mutation
C20orf96	140680	hgsc.bcm.edu	37	20	257959	257959	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr20:257959G>C	ENST00000360321.2	-	7	769	c.631C>G	c.(631-633)Ctg>Gtg	p.L211V	C20orf96_ENST00000382369.5_Missense_Mutation_p.L176V|C20orf96_ENST00000400269.3_Missense_Mutation_p.L153V	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	211										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TAAGTGCTCAGGAAGTTCACT	0.542																																																0			20											201.0	205.0	203.0					20																	257959		2203	4300	6503	205959	SO:0001583	missense	140680			AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.631C>G	20.37:g.257959G>C	ENSP00000353470:p.Leu211Val		205959	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Missense_Mutation	SNP	ENST00000360321.2	37	CCDS12994.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545438	0.45280	.	.	ENSG00000196476	ENST00000382369;ENST00000360321;ENST00000400269	T;T;T	0.65549	-0.16;-0.16;-0.16	4.95	0.738	0.18319	.	0.104362	0.39759	N	0.001265	T	0.42040	0.1185	L	0.31578	0.945	0.29369	N	0.86417	D;P;P;P	0.54772	0.968;0.937;0.937;0.937	B;B;B;B	0.43274	0.414;0.414;0.414;0.414	T	0.43893	-0.9363	10	0.44086	T	0.13	-16.0363	1.9789	0.03422	0.1806:0.1558:0.5029:0.1607	.	153;176;211;176	F5GZA9;B7Z971;Q9NUD7;Q5JYC3	.;.;CT096_HUMAN;.	V	176;211;153	ENSP00000371806:L176V;ENSP00000353470:L211V;ENSP00000383128:L153V	ENSP00000353470:L211V	L	-	1	2	C20orf96	205959	1.000000	0.71417	0.988000	0.46212	0.826000	0.46750	0.344000	0.19962	-0.078000	0.12730	0.313000	0.20887	CTG		0.542	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269		Missense_Mutation
CREB3L4	148327	hgsc.bcm.edu	37	1	153941144	153941144	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr1:153941144A>G	ENST00000368607.3	+	2	409	c.143A>G	c.(142-144)cAa>cGa	p.Q48R	CREB3L4_ENST00000405694.3_5'UTR|CREB3L4_ENST00000368600.3_Intron|CREB3L4_ENST00000271889.4_Missense_Mutation_p.Q48R|CREB3L4_ENST00000368603.1_Missense_Mutation_p.Q48R|CREB3L4_ENST00000368601.1_Missense_Mutation_p.Q48R|RP11-422P24.10_ENST00000608147.1_RNA|SLC39A1_ENST00000310483.6_5'Flank	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	48					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.Q48R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGGGACTGCAAGGCTGGAAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	78.0	77.0					1																	153941144		2203	4300	6503	152207768	SO:0001583	missense	148327			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.143A>G	1.37:g.153941144A>G	ENSP00000357596:p.Gln48Arg		152207768	D3DV62|Q5T4L0|Q86YW6	Missense_Mutation	SNP	ENST00000368607.3	37	CCDS1056.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	4.930	0.172808	0.09391	.	.	ENSG00000143578	ENST00000368607;ENST00000271889;ENST00000368601;ENST00000368603;ENST00000431292	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	4.61	0.903	0.19296	.	0.931884	0.09017	N	0.860716	T	0.09335	0.0230	N	0.22421	0.69	0.80722	D	1	P;B	0.36535	0.557;0.281	B;B	0.41860	0.368;0.038	T	0.42120	-0.9470	10	0.23891	T	0.37	.	4.8109	0.13342	0.5139:0.3846:0.1015:0.0	.	48;48	B4E2G3;Q8TEY5	.;CR3L4_HUMAN	R	48	ENSP00000357596:Q48R;ENSP00000271889:Q48R;ENSP00000357590:Q48R;ENSP00000357592:Q48R;ENSP00000402308:Q48R	ENSP00000271889:Q48R	Q	+	2	0	CREB3L4	152207768	0.009000	0.17119	0.952000	0.39060	0.447000	0.32167	-0.050000	0.11904	0.313000	0.23062	0.459000	0.35465	CAA		0.602	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898		Missense_Mutation
EXD1	161829	hgsc.bcm.edu	37	15	41476620	41476620	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0937-01	TCGA-10-0937-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr15:41476620T>G	ENST00000314992.5	-	10	1244	c.1054A>C	c.(1054-1056)Aaa>Caa	p.K352Q	EXD1_ENST00000458580.2_Missense_Mutation_p.K410Q	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	352							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.K352Q(1)		large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						AAGAAGCCTTTGACTTTCTCC	0.388																																																1	Substitution - Missense(1)	ovary(1)	15											130.0	141.0	137.0					15																	41476620		2203	4300	6503	39263912	SO:0001583	missense	161829			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1054A>C	15.37:g.41476620T>G	ENSP00000321029:p.Lys352Gln		39263912	A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	ENST00000314992.5	37	CCDS10072.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	7.672	0.687139	0.14973	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.46819	0.86;0.87	5.35	-3.9	0.04181	.	0.724866	0.12920	N	0.428227	T	0.24774	0.0601	N	0.19112	0.55	0.09310	N	1	B;B;B	0.17667	0.0;0.0;0.023	B;B;B	0.09377	0.0;0.0;0.004	T	0.25984	-1.0116	10	0.15066	T	0.55	-27.5861	9.2643	0.37632	0.0:0.1421:0.5757:0.2822	.	410;352;150	B7Z839;Q8NHP7;Q8NHP7-2	.;EXD1_HUMAN;.	Q	352;410	ENSP00000321029:K352Q;ENSP00000415056:K410Q	ENSP00000321029:K352Q	K	-	1	0	EXD1	39263912	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.362000	0.20284	-0.739000	0.04809	-0.250000	0.11733	AAA		0.388	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596		Missense_Mutation
FAM177B	400823	hgsc.bcm.edu	37	1	222922897	222922897	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr1:222922897A>C	ENST00000445590.2	+	5	598	c.332A>C	c.(331-333)cAa>cCa	p.Q111P	FAM177B_ENST00000360827.2_Missense_Mutation_p.Q111P	NM_207468.2	NP_997351.2	A6PVY3	F177B_HUMAN	family with sequence similarity 177, member B	111								p.Q111P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	8						TATAGGATACAAAACAAGGTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	73.0	76.0					1																	222922897		1860	4091	5951	220989520	SO:0001583	missense	400823			AK125494	CCDS1535.2	1q41	2008-08-08			ENSG00000197520	ENSG00000197520			34395	protein-coding gene	gene with protein product							Standard	NM_207468		Approved	RP11-452F19.2, FLJ43505	uc001hnt.3	A6PVY3	OTTHUMG00000037766	ENST00000445590.2:c.332A>C	1.37:g.222922897A>C	ENSP00000414451:p.Gln111Pro		220989520	Q6ZUN8	Missense_Mutation	SNP	ENST00000445590.2	37	CCDS1535.2	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	a	13.24	2.178424	0.38511	.	.	ENSG00000197520	ENST00000445590;ENST00000360827	T;T	0.35605	1.3;1.3	5.05	3.92	0.45320	.	.	.	.	.	T	0.55878	0.1948	M	0.75777	2.31	0.19575	N	0.999969	D	0.76494	0.999	D	0.74674	0.984	T	0.45629	-0.9248	9	0.72032	D	0.01	.	7.459	0.27283	0.9001:0.0:0.0999:0.0	.	111	A6PVY3	F177B_HUMAN	P	111	ENSP00000414451:Q111P;ENSP00000354070:Q111P	ENSP00000354070:Q111P	Q	+	2	0	FAM177B	220989520	0.159000	0.22864	0.017000	0.16124	0.436000	0.31835	3.358000	0.52284	0.777000	0.33496	0.477000	0.44152	CAA		0.393	FAM177B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092151.2	NM_207468		Missense_Mutation
FAM71B	153745	hgsc.bcm.edu	37	5	156590102	156590102	+	Nonsense_Mutation	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr5:156590102C>A	ENST00000302938.4	-	2	1269	c.1174G>T	c.(1174-1176)Gga>Tga	p.G392*		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	392						nucleus (GO:0005634)		p.G392*(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTGCTGGTCCTTCAGTTCTT	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	5											58.0	61.0	60.0					5																	156590102		2203	4300	6503	156522680	SO:0001587	stop_gained	153745				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1174G>T	5.37:g.156590102C>A	ENSP00000305596:p.Gly392*		156522680	Q1EDD9|Q8TC64|Q96LY8	Nonsense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390720	0.62066	.	.	ENSG00000170613	ENST00000302938	.	.	.	2.93	0.881	0.19166	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	7.5837	0.27980	0.4561:0.5439:0.0:0.0	.	.	.	.	X	392	.	ENSP00000305596:G392X	G	-	1	0	FAM71B	156522680	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.303000	0.08210	0.043000	0.15746	0.313000	0.20887	GGA		0.567	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		Nonsense_Mutation
FBXO24	26261	hgsc.bcm.edu	37	7	100192162	100192162	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0937-01	TCGA-10-0937-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr7:100192162C>G	ENST00000241071.6	+	6	1272	c.950C>G	c.(949-951)aCa>aGa	p.T317R	FBXO24_ENST00000465843.1_Missense_Mutation_p.T303R|FBXO24_ENST00000468962.1_Missense_Mutation_p.T305R|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000427939.2_Missense_Mutation_p.T355R|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000360609.2_Missense_Mutation_p.T303R	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	317					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.T317R(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CTCTACGTCACAGGTATGGAC	0.597																																																1	Substitution - Missense(1)	ovary(1)	7											79.0	55.0	63.0					7																	100192162		2203	4300	6503	100030098	SO:0001583	missense	26261			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.950C>G	7.37:g.100192162C>G	ENSP00000241071:p.Thr317Arg		100030098	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729847	0.48833	.	.	ENSG00000106336	ENST00000241071;ENST00000360609;ENST00000465843;ENST00000468962;ENST00000427939	D;T;T;D;D	0.83250	-1.7;0.44;0.44;-1.7;-1.7	5.03	5.03	0.67393	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.64402	D	0.000004	D	0.82388	0.5026	N	0.08118	0	0.49483	D	0.999798	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.96	D;P;D;D;P	0.80764	0.994;0.897;0.994;0.994;0.663	D	0.86355	0.1713	10	0.87932	D	0	-8.1608	15.9481	0.79809	0.0:1.0:0.0:0.0	.	305;355;317;317;303	B4DY42;B4DX91;A4D2D3;O75426;O75426-2	.;.;.;FBX24_HUMAN;.	R	317;303;303;305;355	ENSP00000241071:T317R;ENSP00000353821:T303R;ENSP00000419602:T303R;ENSP00000420239:T305R;ENSP00000416558:T355R	ENSP00000241071:T317R	T	+	2	0	FBXO24	100030098	0.990000	0.36364	0.959000	0.39883	0.042000	0.13812	3.161000	0.50747	2.646000	0.89796	0.478000	0.44815	ACA		0.597	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1			Missense_Mutation
GLG1	2734	hgsc.bcm.edu	37	16	74499607	74499607	+	Nonsense_Mutation	SNP	G	G	C			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr16:74499607G>C	ENST00000422840.2	-	19	2633	c.2634C>G	c.(2632-2634)taC>taG	p.Y878*	GLG1_ENST00000447066.2_Nonsense_Mutation_p.Y867*|Y_RNA_ENST00000384794.1_RNA|GLG1_ENST00000205061.5_Nonsense_Mutation_p.Y878*	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	878					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.Y878*(2)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TCATGAGGGTGTAGTCTAGCT	0.478																																																2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	16											215.0	207.0	210.0					16																	74499607		2198	4300	6498	73057108	SO:0001587	stop_gained	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2634C>G	16.37:g.74499607G>C	ENSP00000405984:p.Tyr878*		73057108	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Nonsense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	38	6.994491	0.97990	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.95	-4.71	0.03279	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.4652	15.2551	0.73579	0.4678:0.0:0.5322:0.0	.	.	.	.	X	878;867;878	.	ENSP00000205061:Y878X	Y	-	3	2	GLG1	73057108	0.029000	0.19370	0.939000	0.37840	0.949000	0.60115	-0.881000	0.04179	-0.753000	0.04721	-0.251000	0.11542	TAC		0.478	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		Nonsense_Mutation
HJURP	55355	hgsc.bcm.edu	37	2	234750096	234750096	+	Missense_Mutation	SNP	C	C	T	rs546977139		TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr2:234750096C>T	ENST00000411486.2	-	8	1395	c.1330G>A	c.(1330-1332)Gaa>Aaa	p.E444K	HJURP_ENST00000441687.1_Missense_Mutation_p.E359K|HJURP_ENST00000432087.1_Missense_Mutation_p.E390K|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	444					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)	p.E444K(1)		NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		AGGCAATATTCCCGATGAAGC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17779	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											98.0	98.0	98.0					2																	234750096		2203	4300	6503	234414835	SO:0001583	missense	55355				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1330G>A	2.37:g.234750096C>T	ENSP00000414109:p.Glu444Lys		234414835	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	37	CCDS33406.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777771	0.49786	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	4.35	0.601	0.17529	Holliday junction regulator protein family C-terminal repeat (1);	0.674446	0.14356	N	0.324774	T	0.49081	0.1536	L	0.61218	1.895	0.09310	N	1	B;B;B	0.32862	0.336;0.15;0.387	B;B;B	0.31016	0.044;0.044;0.123	T	0.45454	-0.9260	10	0.87932	D	0	-14.6442	6.5845	0.22612	0.0:0.6012:0.0:0.3988	.	359;390;444	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	K	444;390;359;359	ENSP00000414109:E444K;ENSP00000407208:E390K;ENSP00000401944:E359K;ENSP00000393253:E359K	ENSP00000414109:E444K	E	-	1	0	HJURP	234414835	0.005000	0.15991	0.002000	0.10522	0.007000	0.05969	0.565000	0.23578	0.093000	0.17368	-0.793000	0.03317	GAA		0.532	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410		Missense_Mutation
IFT88	8100	hgsc.bcm.edu	37	13	21230512	21230512	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr13:21230512C>G	ENST00000319980.6	+	24	2365	c.2038C>G	c.(2038-2040)Caa>Gaa	p.Q680E	IFT88_ENST00000351808.5_Missense_Mutation_p.Q671E|IFT88_ENST00000537103.1_Missense_Mutation_p.Q652E|IFT88_ENST00000382778.4_Missense_Mutation_p.Q680E	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	680					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.Q680E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AGGTAACTACCAAAAAGCATT	0.269																																																1	Substitution - Missense(1)	ovary(1)	13											49.0	50.0	50.0					13																	21230512		2186	4260	6446	20128512	SO:0001583	missense	8100			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2038C>G	13.37:g.21230512C>G	ENSP00000323580:p.Gln680Glu		20128512	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253768	0.59212	.	.	ENSG00000032742	ENST00000382778;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.74315	-0.72;-0.83;-0.83;-0.83	5.39	5.39	0.77823	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.121150	0.56097	D	0.000024	D	0.87497	0.6192	M	0.88775	2.98	0.80722	D	1	D;P	0.67145	0.996;0.568	P;B	0.61722	0.893;0.321	D	0.89021	0.3435	10	0.54805	T	0.06	-14.7206	18.7629	0.91860	0.0:1.0:0.0:0.0	.	652;680	F5H6C2;Q13099	.;IFT88_HUMAN	E	680;671;680;652	ENSP00000372228:Q680E;ENSP00000261632:Q671E;ENSP00000323580:Q680E;ENSP00000437719:Q652E	ENSP00000323580:Q680E	Q	+	1	0	IFT88	20128512	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	5.983000	0.70540	2.535000	0.85469	0.467000	0.42956	CAA		0.269	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		Missense_Mutation
ILF3	3609	hgsc.bcm.edu	37	19	10789296	10789296	+	Silent	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr19:10789296A>G	ENST00000590261.1	+	5	567	c.567A>G	c.(565-567)ctA>ctG	p.L189L	ILF3_ENST00000592763.1_Silent_p.L189L|ILF3_ENST00000420083.1_Silent_p.L189L|ILF3_ENST00000588657.1_Silent_p.L189L|ILF3_ENST00000449870.1_Silent_p.L189L|ILF3_ENST00000589998.1_Silent_p.L189L|ILF3_ENST00000318511.3_Silent_p.L189L|ILF3_ENST00000407004.3_Silent_p.L189L|ILF3_ENST00000250241.8_Silent_p.L189L			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	189	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L189L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TAGAAACGCTATCAGTCAACG	0.522																																																1	Substitution - coding silent(1)	ovary(1)	19											95.0	83.0	87.0					19																	10789296		2203	4300	6503	10650296	SO:0001819	synonymous_variant	3609			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.567A>G	19.37:g.10789296A>G			10650296	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	ENST00000590261.1	37	CCDS12246.1	SNP	16	Baylor																																																																																				0.522	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1			Silent
LMCD1	29995	hgsc.bcm.edu	37	3	8609271	8609271	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr3:8609271C>G	ENST00000157600.3	+	6	1317	c.1085C>G	c.(1084-1086)tCc>tGc	p.S362C	LMCD1_ENST00000397386.3_Missense_Mutation_p.S250C|LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000454244.1_Missense_Mutation_p.S289C	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	362	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		TGCAGCAAGTCCAAACGCTCC	0.597																																																0			3											162.0	156.0	158.0					3																	8609271		2203	4300	6503	8584271	SO:0001583	missense	29995			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.1085C>G	3.37:g.8609271C>G	ENSP00000157600:p.Ser362Cys		8584271	B4DG80	Missense_Mutation	SNP	ENST00000157600.3	37	CCDS33688.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822615	0.71028	.	.	ENSG00000071282	ENST00000157600;ENST00000454244;ENST00000397386	T;T;T	0.50001	0.78;0.78;0.76	5.52	5.52	0.82312	Zinc finger, LIM-type (1);	0.362635	0.23799	N	0.044455	T	0.66607	0.2806	M	0.74467	2.265	0.35185	D	0.772816	D;D	0.69078	0.997;0.995	D;D	0.64237	0.911;0.923	T	0.76189	-0.3050	10	0.72032	D	0.01	-33.9422	14.8503	0.70292	0.0:0.8555:0.1445:0.0	.	250;362	B4DEY6;Q9NZU5	.;LMCD1_HUMAN	C	362;289;250	ENSP00000157600:S362C;ENSP00000396515:S289C;ENSP00000380542:S250C	ENSP00000157600:S362C	S	+	2	0	LMCD1	8584271	1.000000	0.71417	0.955000	0.39395	0.995000	0.86356	3.875000	0.56108	2.765000	0.95021	0.591000	0.81541	TCC		0.597	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583		Missense_Mutation
MAGED2	10916	hgsc.bcm.edu	37	X	54841100	54841100	+	Silent	SNP	G	G	C			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chrX:54841100G>C	ENST00000375068.1	+	11	1511	c.1278G>C	c.(1276-1278)ctG>ctC	p.L426L	MAGED2_ENST00000396224.1_Silent_p.L426L|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000375053.2_Silent_p.L426L|MAGED2_ENST00000347546.4_Silent_p.L408L|MAGED2_ENST00000375060.1_Silent_p.L341L|MAGED2_ENST00000375058.1_Silent_p.L426L|MAGED2_ENST00000218439.4_Silent_p.L426L|MAGED2_ENST00000375062.4_Silent_p.L341L			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	426	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					membrane (GO:0016020)		p.L426L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						CAAGGTACCTGGACTATGCCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	X											79.0	67.0	71.0					X																	54841100		2203	4300	6503	54857825	SO:0001819	synonymous_variant	10916			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1278G>C	X.37:g.54841100G>C			54857825	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	ENST00000375068.1	37	CCDS14362.1	SNP	47	Baylor																																																																																				0.483	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599		Silent
KMT2B	9757	hgsc.bcm.edu	37	19	36211742	36211742	+	Missense_Mutation	SNP	C	C	A	rs80216638	byFrequency	TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr19:36211742C>A	ENST00000222270.7	+	3	1493	c.1493C>A	c.(1492-1494)aCc>aAc	p.T498N	KMT2B_ENST00000341701.1_Missense_Mutation_p.T498N|KMT2B_ENST00000420124.1_Missense_Mutation_p.T498N|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	498	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T498N(1)									CCCACTCCAACCCCCAGCACC	0.667													C|||	201	0.0401358	0.0726	0.0202	5008	,	,		8855	0.005		0.0457	False		,,,				2504	0.0409															1	Substitution - Missense(1)	central_nervous_system(1)	19						C	ASN/THR	143,3727		3,137,1795	8.0	11.0	10.0		1493	-1.8	0.4	19	dbSNP_131	10	250,7964		8,234,3865	yes	missense	MLL4	NM_014727.1	65	11,371,5660	AA,AC,CC		3.0436,3.6951,3.2522	benign	498/2716	36211742	393,11691	1935	4107	6042	40903582	SO:0001583	missense	9757			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1493C>A	19.37:g.36211742C>A	ENSP00000222270:p.Thr498Asn		40903582	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	SNP	18	Baylor	84	0.038461538461538464	34	0.06910569105691057	10	0.027624309392265192	4	0.006993006993006993	36	0.047493403693931395	C	5.237	0.229293	0.09916	0.036951	0.030436	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.82984	-1.67;-1.67;0.95	4.12	-1.77	0.07982	.	0.982517	0.08277	N	0.970445	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11036	-1.0604	10	0.16896	T	0.51	.	3.7443	0.08542	0.3907:0.3727:0.0:0.2367	.	498	Q9UMN6	MLL4_HUMAN	N	498	ENSP00000222270:T498N;ENSP00000398837:T498N;ENSP00000345761:T498N	ENSP00000222270:T498N	T	+	2	0	AD000671.1	40903582	0.002000	0.14202	0.400000	0.26346	0.965000	0.64279	-0.214000	0.09292	-0.093000	0.12396	0.455000	0.32223	ACC		0.667	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727		Missense_Mutation
MMP3	4314	hgsc.bcm.edu	37	11	102709964	102709964	+	Missense_Mutation	SNP	G	G	A	rs147533686		TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr11:102709964G>A	ENST00000299855.5	-	7	1202	c.946C>T	c.(946-948)Cgc>Tgc	p.R316C	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	316					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R316C(3)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	AGGGATTTGCGCCAAAAGTGC	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17541	0.0		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	ovary(1)|lung(1)|kidney(1)	11						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	84.0	82.0		946	5.7	1.0	11	dbSNP_134	82	0,8598		0,0,4299	no	missense	MMP3	NM_002422.3	180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	316/478	102709964	1,13003	2203	4299	6502	102215174	SO:0001583	missense	4314			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.946C>T	11.37:g.102709964G>A	ENSP00000299855:p.Arg316Cys		102215174	B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	ENST00000299855.5	37	CCDS8323.1	SNP	38	Baylor	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	22.4	4.285195	0.80803	2.27E-4	0.0	ENSG00000149968	ENST00000299855	T	0.04454	3.62	5.65	5.65	0.86999	Hemopexin/matrixin (2);	0.000000	0.36740	N	0.002424	T	0.37571	0.1008	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54886	-0.8226	10	0.87932	D	0	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	316	P08254	MMP3_HUMAN	C	316	ENSP00000299855:R316C	ENSP00000299855:R316C	R	-	1	0	MMP3	102215174	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.837000	0.55820	2.941000	0.99782	0.655000	0.94253	CGC		0.403	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422		Missense_Mutation
MYBPC1	4604	hgsc.bcm.edu	37	12	102038454	102038454	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0937-01	TCGA-10-0937-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr12:102038454T>C	ENST00000550270.1	+	10	770	c.770T>C	c.(769-771)aTt>aCt	p.I257T	RP11-755O11.2_ENST00000552081.1_RNA|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000441232.1_Missense_Mutation_p.I257T|MYBPC1_ENST00000549145.1_Missense_Mutation_p.I270T|MYBPC1_ENST00000360610.2_Missense_Mutation_p.I257T|MYBPC1_ENST00000547509.1_Missense_Mutation_p.I243T|MYBPC1_ENST00000361685.2_Missense_Mutation_p.I282T|MYBPC1_ENST00000547405.1_Missense_Mutation_p.I231T|MYBPC1_ENST00000361466.2_Missense_Mutation_p.I282T|MYBPC1_ENST00000392934.3_Missense_Mutation_p.I244T|MYBPC1_ENST00000551300.1_Missense_Mutation_p.I158T|MYBPC1_ENST00000553190.1_Missense_Mutation_p.I257T|MYBPC1_ENST00000452455.2_Missense_Mutation_p.I257T|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000545503.2_Missense_Mutation_p.I257T|MYBPC1_ENST00000536007.1_Missense_Mutation_p.I238T|MYBPC1_ENST00000541119.1_Missense_Mutation_p.I245T			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	257	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TTTGCAAAAATTCTTGATCCT	0.348																																																0			12											68.0	66.0	67.0					12																	102038454		2203	4300	6503	100562585	SO:0001583	missense	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.770T>C	12.37:g.102038454T>C	ENSP00000449702:p.Ile257Thr		100562585	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.33	2.203551	0.38905	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57907	0.39;0.39;0.38;0.37;0.39;0.38;0.4;0.37;0.37;0.37;0.42;0.38;0.37;0.43;0.37	5.7	5.7	0.88788	Immunoglobulin-like fold (1);	0.270693	0.26262	N	0.025387	T	0.37210	0.0995	N	0.05078	-0.115	0.31717	N	0.638763	B;P;B;B;B;B;B;B;B;B;B	0.36086	0.387;0.536;0.126;0.387;0.227;0.387;0.336;0.387;0.051;0.336;0.336	B;B;B;B;B;B;B;P;B;B;B	0.44921	0.348;0.396;0.247;0.396;0.179;0.348;0.275;0.464;0.159;0.275;0.333	T	0.49447	-0.8939	10	0.46703	T	0.11	.	7.803	0.29185	0.1361:0.0:0.1417:0.7222	.	238;245;257;257;244;231;257;257;282;282;270	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	T	231;257;257;257;244;243;282;270;257;282;257;238;245;282;158;257	ENSP00000448175:I231T;ENSP00000400908:I257T;ENSP00000388989:I257T;ENSP00000353822:I257T;ENSP00000376665:I244T;ENSP00000447362:I243T;ENSP00000354845:I282T;ENSP00000447660:I270T;ENSP00000447900:I257T;ENSP00000440034:I257T;ENSP00000446128:I238T;ENSP00000442847:I245T;ENSP00000354849:I282T;ENSP00000447116:I158T;ENSP00000449702:I257T	ENSP00000353822:I257T	I	+	2	0	MYBPC1	100562585	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.552000	0.45828	2.175000	0.68902	0.533000	0.62120	ATT		0.348	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			Missense_Mutation
MYO5C	55930	hgsc.bcm.edu	37	15	52553279	52553279	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0937-01	TCGA-10-0937-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr15:52553279C>G	ENST00000261839.7	-	10	1254	c.1093G>C	c.(1093-1095)Gag>Cag	p.E365Q	MYO5C_ENST00000541028.1_5'UTR|MYO5C_ENST00000443683.2_Missense_Mutation_p.E308Q	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	365	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E365Q(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		CTGCCACTCTCCAGGCCCAGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											61.0	64.0	63.0					15																	52553279		2050	4206	6256	50340571	SO:0001583	missense	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1093G>C	15.37:g.52553279C>G	ENSP00000261839:p.Glu365Gln		50340571	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436057	0.25813	.	.	ENSG00000128833	ENST00000261839;ENST00000443683	D;D	0.87491	-2.26;-2.26	5.51	4.59	0.56863	Myosin head, motor domain (2);	0.271415	0.41001	D	0.000972	D	0.84964	0.5589	M	0.62723	1.935	0.36094	D	0.843675	B	0.18610	0.029	B	0.25759	0.063	D	0.85756	0.1346	10	0.66056	D	0.02	.	11.0105	0.47659	0.0:0.8584:0.0:0.1416	.	365	Q9NQX4	MYO5C_HUMAN	Q	365;308	ENSP00000261839:E365Q;ENSP00000410582:E308Q	ENSP00000261839:E365Q	E	-	1	0	MYO5C	50340571	0.968000	0.33430	0.997000	0.53966	0.204000	0.24138	1.490000	0.35573	2.609000	0.88269	0.655000	0.94253	GAG		0.552	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728		Missense_Mutation
NCAPD2	9918	hgsc.bcm.edu	37	12	6635291	6635291	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0937-01	TCGA-10-0937-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr12:6635291T>G	ENST00000315579.5	+	19	3205	c.2406T>G	c.(2404-2406)gaT>gaG	p.D802E	NCAPD2_ENST00000545962.1_Missense_Mutation_p.D757E|NCAPD2_ENST00000542492.1_3'UTR	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	802					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.D802E(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						TAGGGCTGGATGAGAAGTTTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	81.0	82.0					12																	6635291		2203	4300	6503	6505552	SO:0001583	missense	9918			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2406T>G	12.37:g.6635291T>G	ENSP00000325017:p.Asp802Glu		6505552	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	37	CCDS8548.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	3.563	-0.089295	0.07097	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	D;D;D	0.91577	-2.87;-2.87;-2.87	5.8	-11.6	0.00059	Armadillo-type fold (1);	0.439614	0.27122	N	0.020836	T	0.65678	0.2714	N	0.02011	-0.69	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.58075	-0.7700	10	0.44086	T	0.13	-0.7624	6.1981	0.20561	0.1326:0.2088:0.4922:0.1664	.	757;763;802	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	E	802;674;757;674	ENSP00000325017:D802E;ENSP00000371895:D674E;ENSP00000444417:D757E	ENSP00000325017:D802E	D	+	3	2	NCAPD2	6505552	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-3.350000	0.00502	-4.382000	0.00052	-0.250000	0.11733	GAT		0.512	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865		Missense_Mutation
NIT2	56954	hgsc.bcm.edu	37	3	100058713	100058713	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr3:100058713A>G	ENST00000394140.4	+	3	272	c.181A>G	c.(181-183)Att>Gtt	p.I61V		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	61	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						TGCAGAGAAAATTCCTGGTGA	0.373																																																0			3											75.0	74.0	74.0					3																	100058713		2203	4300	6503	101541403	SO:0001583	missense	56954			AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.181A>G	3.37:g.100058713A>G	ENSP00000377696:p.Ile61Val		101541403	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	ENST00000394140.4	37	CCDS33806.1	SNP	4	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.81|15.81	2.943285|2.943285	0.53079|0.53079	.|.	.|.	ENSG00000114021|ENSG00000114021	ENST00000394140|ENST00000497785	D|.	0.87729|.	-2.29|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);|.	0.150802|.	0.64402|.	D|.	0.000013|.	T|T	0.48205|0.48205	0.1487|0.1487	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999999|0.999999	B;B|.	0.22683|.	0.073;0.015|.	B;B|.	0.27380|.	0.079;0.041|.	T|T	0.45116|0.45116	-0.9283|-0.9283	10|5	0.45353|.	T|.	0.12|.	-20.9364|-20.9364	15.6035|15.6035	0.76642|0.76642	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	61;61|.	B7Z3F9;Q9NQR4|.	.;NIT2_HUMAN|.	V|S	61|154	ENSP00000377696:I61V|.	ENSP00000377696:I61V|.	I|N	+|+	1|2	0|0	NIT2|NIT2	101541403|101541403	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.629000|8.629000	0.90983|0.90983	2.148000|2.148000	0.66965|0.66965	0.533000|0.533000	0.62120|0.62120	ATT|AAT		0.373	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2	NM_020202		Missense_Mutation
NUP205	23165	hgsc.bcm.edu	37	7	135258567	135258567	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr7:135258567C>A	ENST00000285968.6	+	3	363	c.337C>A	c.(337-339)Ctt>Att	p.L113I	NUP205_ENST00000440390.2_De_novo_Start_InFrame	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	113					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.L113I(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TGAGCTTCTTCTTGCTGGTAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	7											91.0	85.0	87.0					7																	135258567		2203	4300	6503	134909107	SO:0001583	missense	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.337C>A	7.37:g.135258567C>A	ENSP00000285968:p.Leu113Ile		134909107	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765659	0.49574	.	.	ENSG00000155561	ENST00000285968	T	0.37915	1.17	5.1	3.01	0.34805	.	0.132141	0.48767	D	0.000166	T	0.50752	0.1634	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.46610	-0.9179	10	0.44086	T	0.13	-31.1385	9.3618	0.38201	0.0:0.723:0.0:0.277	.	113	Q92621	NU205_HUMAN	I	113	ENSP00000285968:L113I	ENSP00000285968:L113I	L	+	1	0	NUP205	134909107	0.996000	0.38824	0.986000	0.45419	0.971000	0.66376	2.443000	0.44881	1.152000	0.42452	0.484000	0.47621	CTT		0.333	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			Missense_Mutation
OTUD6B	51633	hgsc.bcm.edu	37	8	92082606	92082606	+	Silent	SNP	G	G	T			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr8:92082606G>T	ENST00000285420.4	+	1	183	c.84G>T	c.(82-84)ctG>ctT	p.L28L	GS1-251I9.4_ENST00000522817.1_RNA|OTUD6B_ENST00000404789.3_5'UTR|GS1-251I9.4_ENST00000524003.1_RNA	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	0							cysteine-type peptidase activity (GO:0008234)	p.L28L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TGGGGTACCTGGTCGTCATGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	8											94.0	96.0	95.0					8																	92082606		2203	4300	6503	92151782	SO:0001819	synonymous_variant	51633				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.84G>T	8.37:g.92082606G>T			92151782	A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Silent	SNP	ENST00000285420.4	37	CCDS6253.2	SNP	47	Baylor																																																																																				0.592	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000319968.1	NM_016023		Silent
PACS2	23241	hgsc.bcm.edu	37	14	105857547	105857547	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr14:105857547G>A	ENST00000325438.8	+	20	2539	c.2035G>A	c.(2035-2037)Gtg>Atg	p.V679M	PACS2_ENST00000430725.2_Missense_Mutation_p.V604M|PACS2_ENST00000551743.1_Missense_Mutation_p.V193M|PACS2_ENST00000551801.1_5'Flank|PACS2_ENST00000447393.1_Missense_Mutation_p.V683M|PACS2_ENST00000547217.1_Missense_Mutation_p.V649M|PACS2_ENST00000458164.2_Missense_Mutation_p.V694M			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	679					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)		p.V679M(1)		endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TTTCTAGGTTGTGAAGGTTGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	14											158.0	127.0	137.0					14																	105857547		2202	4300	6502	104928592	SO:0001583	missense	23241			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.2035G>A	14.37:g.105857547G>A	ENSP00000321834:p.Val679Met		104928592	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468638	0.84533	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743	T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000002	T	0.73590	0.3606	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.76494	0.998;0.971;0.999;0.983	D;D;D;P	0.76575	0.981;0.919;0.988;0.877	T	0.77867	-0.2428	10	0.87932	D	0	-29.3904	15.4427	0.75200	0.0:0.0:1.0:0.0	.	683;694;679;680	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	M	604;679;694;683;649;193	ENSP00000393524:V604M;ENSP00000321834:V679M;ENSP00000399732:V694M;ENSP00000393559:V683M;ENSP00000449525:V649M;ENSP00000449254:V193M	ENSP00000321834:V679M	V	+	1	0	PACS2	104928592	1.000000	0.71417	0.999000	0.59377	0.941000	0.58515	7.242000	0.78210	1.967000	0.57214	0.561000	0.74099	GTG		0.632	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		Missense_Mutation
PACS2	23241	hgsc.bcm.edu	37	14	105857549	105857549	+	Silent	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr14:105857549G>A	ENST00000325438.8	+	20	2541	c.2037G>A	c.(2035-2037)gtG>gtA	p.V679V	PACS2_ENST00000430725.2_Silent_p.V604V|PACS2_ENST00000551743.1_Silent_p.V193V|PACS2_ENST00000551801.1_5'Flank|PACS2_ENST00000447393.1_Silent_p.V683V|PACS2_ENST00000547217.1_Silent_p.V649V|PACS2_ENST00000458164.2_Silent_p.V694V			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	679					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TCTAGGTTGTGAAGGTTGGAA	0.632																																																0			14											158.0	127.0	138.0					14																	105857549		2202	4300	6502	104928594	SO:0001819	synonymous_variant	23241			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.2037G>A	14.37:g.105857549G>A			104928594	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	ENST00000325438.8	37	CCDS32168.1	SNP	45	Baylor																																																																																				0.632	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		Silent
PCLO	27445	hgsc.bcm.edu	37	7	82390692	82390692	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr7:82390692G>A	ENST00000333891.9	-	23	15462	c.15125C>T	c.(15124-15126)tCt>tTt	p.S5042F		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.S5042F(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGATCAGGAGACTTAAATTT	0.294																																																1	Substitution - Missense(1)	ovary(1)	7											101.0	90.0	94.0					7																	82390692		1799	4050	5849	82228628	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15125C>T	7.37:g.82390692G>A	ENSP00000334319:p.Ser5042Phe		82228628		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.97	1.798489	0.31777	.	.	ENSG00000186472	ENST00000333891	T	0.08282	3.11	5.33	5.33	0.75918	.	0.362654	0.19574	U	0.111027	T	0.29190	0.0726	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.00878	-1.1530	10	0.87932	D	0	.	19.0273	0.92937	0.0:0.0:1.0:0.0	.	5042	Q9Y6V0-5	.	F	5042	ENSP00000334319:S5042F	ENSP00000334319:S5042F	S	-	2	0	PCLO	82228628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.334000	0.65923	2.470000	0.83445	0.650000	0.86243	TCT		0.294	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		Missense_Mutation
PLSCR1	5359	hgsc.bcm.edu	37	3	146246450	146246450	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr3:146246450G>A	ENST00000342435.4	-	4	673	c.263C>T	c.(262-264)gCg>gTg	p.A88V	PLSCR1_ENST00000448787.2_Intron|PLSCR1_ENST00000448205.1_Intron|PLSCR1_ENST00000487389.1_Missense_Mutation_p.A81V	NM_021105.2	NP_066928.1	O15162	PLS1_HUMAN	phospholipid scramblase 1	88					acute-phase response (GO:0006953)|apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|negative regulation of viral genome replication (GO:0045071)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid scrambling (GO:0017121)|platelet activation (GO:0030168)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of gene expression (GO:0010628)|positive regulation of innate immune response (GO:0045089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|regulation of mast cell activation (GO:0033003)|response to interferon-beta (GO:0035456)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|epidermal growth factor receptor binding (GO:0005154)|phospholipid scramblase activity (GO:0017128)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SH3 domain binding (GO:0017124)	p.A88V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15						AGGCTGTGGCGCTGGCATCCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											99.0	104.0	103.0					3																	146246450		2203	4300	6503	147729140	SO:0001583	missense	5359			AF098642	CCDS3135.1	3q23	2004-02-27			ENSG00000188313	ENSG00000188313			9092	protein-coding gene	gene with protein product		604170				9218461	Standard	NM_021105		Approved	MMTRA1B	uc003evx.4	O15162	OTTHUMG00000159427	ENST00000342435.4:c.263C>T	3.37:g.146246450G>A	ENSP00000345494:p.Ala88Val		147729140	B2R8H8|B4DTE8	Missense_Mutation	SNP	ENST00000342435.4	37	CCDS3135.1	SNP	38	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.71|10.71	1.425618|1.425618	0.25639|0.25639	.|.	.|.	ENSG00000188313|ENSG00000188313	ENST00000342435;ENST00000487389;ENST00000462666;ENST00000472349|ENST00000483300	T;T;T;T|.	0.23147|.	1.92;1.92;1.92;1.92|.	4.46|4.46	4.46|4.46	0.54185|0.54185	.|.	.|.	.|.	.|.	.|.	T|T	0.57198|0.57198	0.2037|0.2037	L|L	0.41961|0.41961	1.31|1.31	0.80722|0.80722	D|D	1|1	D;P|.	0.71674|.	0.998;0.875|.	P;B|.	0.53760|.	0.734;0.121|.	T|T	0.53872|0.53872	-0.8377|-0.8377	9|5	0.24483|.	T|.	0.36|.	.|.	11.5728|11.5728	0.50843|0.50843	0.096:0.0:0.904:0.0|0.096:0.0:0.904:0.0	.|.	88;88|.	Q8WVK1;O15162|.	.;PLS1_HUMAN|.	V|C	88;81;88;88|30	ENSP00000345494:A88V;ENSP00000417792:A81V;ENSP00000418103:A88V;ENSP00000420523:A88V|.	ENSP00000345494:A88V|.	A|R	-|-	2|1	0|0	PLSCR1|PLSCR1	147729140|147729140	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.086000|0.086000	0.17979|0.17979	3.145000|3.145000	0.50623|0.50623	2.197000|2.197000	0.70478|0.70478	0.491000|0.491000	0.48974|0.48974	GCG|CGC		0.463	PLSCR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355257.2	NM_021105		Missense_Mutation
PPIG	9360	hgsc.bcm.edu	37	2	170493409	170493409	+	Silent	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr2:170493409A>G	ENST00000260970.3	+	14	1861	c.1641A>G	c.(1639-1641)agA>agG	p.R547R	PPIG_ENST00000409714.3_Silent_p.R532R|PPIG_ENST00000448752.2_Silent_p.R547R	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	547	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.R547R(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	CCAGGAGTAGAGAATGTGATA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	2											84.0	81.0	82.0					2																	170493409		2203	4300	6503	170201655	SO:0001819	synonymous_variant	9360			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1641A>G	2.37:g.170493409A>G			170201655	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Silent	SNP	ENST00000260970.3	37	CCDS2235.1	SNP	11	Baylor																																																																																				0.388	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			Silent
PRKCZ	5590	hgsc.bcm.edu	37	1	2082319	2082319	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr1:2082319C>T	ENST00000400921.2	+	6	912	c.229C>T	c.(229-231)Cgc>Tgc	p.R77C	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.R77C	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	260	OPR.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.R260C(3)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AGTCATCGGGCGCGGGAGCTA	0.517																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	1											79.0	77.0	78.0					1																	2082319		2203	4300	6503	2072179	SO:0001583	missense	5590			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.229C>T	1.37:g.2082319C>T	ENSP00000383712:p.Arg77Cys		2072179	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	ENST00000400921.2	37	CCDS41229.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434901	0.62955	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000470596;ENST00000400920;ENST00000486681;ENST00000470986;ENST00000470511;ENST00000497183	T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;1.85;-0.26;-0.26;-0.26;-0.26	4.8	4.8	0.61643	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84683	0.0718	10	0.87932	D	0	.	12.1602	0.54099	0.1709:0.8291:0.0:0.0	.	156;84;260	E9PCW2;B3KUN5;Q05513	.;.;KPCZ_HUMAN	C	260;77;156;77;77;73;77;77;73	ENSP00000367830:R260C;ENSP00000383712:R77C;ENSP00000426412:R156C;ENSP00000424228:R77C;ENSP00000383711:R77C;ENSP00000424763:R73C;ENSP00000421219:R77C;ENSP00000422764:R73C	ENSP00000367830:R260C	R	+	1	0	PRKCZ	2072179	1.000000	0.71417	0.999000	0.59377	0.682000	0.39822	3.091000	0.50199	2.493000	0.84123	0.591000	0.81541	CGC		0.517	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744		Missense_Mutation
PTPN12	5782	hgsc.bcm.edu	37	7	77247807	77247807	+	Missense_Mutation	SNP	A	A	T	rs375165418		TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr7:77247807A>T	ENST00000248594.6	+	12	1222	c.950A>T	c.(949-951)aAc>aTc	p.N317I	PTPN12_ENST00000435495.2_Missense_Mutation_p.N187I|PTPN12_ENST00000415482.2_Missense_Mutation_p.N198I	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	317					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.N317I(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						AATGAAATTAACACTGAAAAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	7						A	ILE/ASN,ILE/ASN,ILE/ASN	1,4405	2.1+/-5.4	0,1,2202	109.0	115.0	113.0		593,560,950	-2.7	1.0	7		113	0,8600		0,0,4300	no	missense,missense,missense	PTPN12	NM_001131008.1,NM_001131009.1,NM_002835.3	149,149,149	0,1,6502	TT,TA,AA		0.0,0.0227,0.0077	benign,benign,benign	198/662,187/651,317/781	77247807	1,13005	2203	4300	6503	77085743	SO:0001583	missense	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.950A>T	7.37:g.77247807A>T	ENSP00000248594:p.Asn317Ile		77085743	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169881	0.38315	2.27E-4	0.0	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;T;T	0.31510	1.49;1.49;1.49	5.21	-2.7	0.06004	.	0.550358	0.21140	N	0.079487	T	0.19525	0.0469	L	0.47716	1.5	0.29777	N	0.834303	P	0.35923	0.528	B	0.33521	0.165	T	0.13575	-1.0504	10	0.33940	T	0.23	.	6.9361	0.24466	0.5076:0.1529:0.3395:0.0	.	317	Q05209	PTN12_HUMAN	I	317;198;198;187	ENSP00000248594:N317I;ENSP00000392429:N198I;ENSP00000397991:N187I	ENSP00000248594:N317I	N	+	2	0	PTPN12	77085743	0.900000	0.30661	0.959000	0.39883	0.573000	0.36030	0.958000	0.29227	-0.232000	0.09811	0.383000	0.25322	AAC		0.363	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			Missense_Mutation
RAG2	5897	hgsc.bcm.edu	37	11	36614566	36614566	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0937-01	TCGA-10-0937-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr11:36614566A>G	ENST00000311485.3	-	2	1314	c.1153T>C	c.(1153-1155)Tgt>Cgt	p.C385R	C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	385					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.C385R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				GCACTGAAACAAAATTCTTCA	0.383									Familial Hemophagocytic Lymphohistiocytosis																																							1	Substitution - Missense(1)	ovary(1)	11											133.0	130.0	131.0					11																	36614566		2202	4298	6500	36571142	SO:0001583	missense	5897	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1153T>C	11.37:g.36614566A>G	ENSP00000308620:p.Cys385Arg		36571142	A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	37	CCDS7903.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.45	2.539259	0.45176	.	.	ENSG00000175097	ENST00000311485	D	0.89875	-2.58	5.45	5.45	0.79879	.	0.193425	0.47093	D	0.000242	D	0.92782	0.7705	M	0.73962	2.25	0.51012	D	0.999903	D	0.69078	0.997	D	0.65874	0.939	D	0.93084	0.6494	10	0.72032	D	0.01	-10.0296	9.7781	0.40632	0.7351:0.0:0.0:0.2649	.	385	P55895	RAG2_HUMAN	R	385	ENSP00000308620:C385R	ENSP00000308620:C385R	C	-	1	0	RAG2	36571142	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.652000	0.67959	2.192000	0.70111	0.528000	0.53228	TGT		0.383	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		Missense_Mutation
RASSF5	83593	hgsc.bcm.edu	37	1	206760175	206760175	+	Silent	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr1:206760175C>A	ENST00000355294.4	+	6	1179	c.1122C>A	c.(1120-1122)atC>atA	p.I374I	RASSF5_ENST00000491368.1_3'UTR|RASSF5_ENST00000304534.8_Silent_p.I221I|EIF2D_ENST00000472709.2_Intron|RASSF5_ENST00000367117.3_Missense_Mutation_p.P336T	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	374	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.I374I(1)|p.I221I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CCTTCTCCATCCCTGAACTTC	0.473																																					GBM(162;656 1984 11916 22872 31529)											2	Substitution - coding silent(2)	ovary(2)	1											146.0	148.0	147.0					1																	206760175		2203	4300	6503	204826798	SO:0001819	synonymous_variant	83593			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.1122C>A	1.37:g.206760175C>A			204826798	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Missense_Mutation	SNP	ENST00000355294.4	37	CCDS30998.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779761	0.49891	.	.	ENSG00000136653	ENST00000367117	T	0.14022	2.54	5.82	3.92	0.45320	.	.	.	.	.	T	0.11367	0.0277	.	.	.	0.80722	D	1	B	0.24426	0.103	B	0.23419	0.046	T	0.08432	-1.0722	8	0.87932	D	0	-14.6524	5.963	0.19310	0.1548:0.6896:0.0:0.1556	.	336	Q8WWW0-3	.	T	336	ENSP00000356084:P336T	ENSP00000356084:P336T	P	+	1	0	RASSF5	204826798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.898000	0.28404	0.764000	0.33197	0.655000	0.94253	CCC		0.473	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437		Missense_Mutation
RUNDC3A	10900	hgsc.bcm.edu	37	17	42392134	42392134	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr17:42392134C>T	ENST00000426726.3	+	5	764	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W	RUNDC3A_ENST00000225441.7_Missense_Mutation_p.R164W|RUNDC3A_ENST00000590941.1_Missense_Mutation_p.R159W|AC003102.3_ENST00000588097.1_RNA	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	164	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)	p.R164W(1)		large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CATCATGCTGCGGGATGAAGC	0.657																																					Pancreas(82;1061 1416 11136 20771 23901)											1	Substitution - Missense(1)	ovary(1)	17											50.0	51.0	51.0					17																	42392134		2057	4203	6260	39747660	SO:0001583	missense	10900			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.490C>T	17.37:g.42392134C>T	ENSP00000410862:p.Arg164Trp		39747660	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	ENST00000426726.3	37	CCDS45698.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	c	17.07	3.296352	0.60086	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.11821	2.74;2.74	4.21	0.844	0.18943	RUN (3);	0.062767	0.64402	D	0.000009	T	0.28499	0.0705	L	0.57536	1.79	0.49483	D	0.999793	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.65010	0.931;0.928;0.928;0.928	T	0.01405	-1.1363	10	0.66056	D	0.02	-11.4355	13.0165	0.58759	0.7383:0.2616:0.0:0.0	.	164;164;159;164	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	W	164	ENSP00000410862:R164W;ENSP00000225441:R164W	ENSP00000225441:R164W	R	+	1	2	RUNDC3A	39747660	0.982000	0.34865	0.937000	0.37676	0.785000	0.44390	0.783000	0.26802	0.028000	0.15324	0.456000	0.33151	CGG		0.657	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403173.2	NM_006695		Missense_Mutation
SCAP	22937	hgsc.bcm.edu	37	3	47484372	47484372	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0937-01	TCGA-10-0937-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr3:47484372A>C	ENST00000265565.5	-	2	524	c.112T>G	c.(112-114)Tta>Gta	p.L38V	SCAP_ENST00000441517.2_5'UTR|SCAP_ENST00000545718.1_5'UTR	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	38					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)	p.L38V(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CAGCAGGCTAAGATGCAGAAC	0.512																																					Pancreas(149;978 1908 29304 37806 46700)											1	Substitution - Missense(1)	ovary(1)	3											141.0	122.0	128.0					3																	47484372		2203	4300	6503	47459376	SO:0001583	missense	22937			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.112T>G	3.37:g.47484372A>C	ENSP00000265565:p.Leu38Val		47459376	Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	CCDS2755.2	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.98	2.698582	0.48307	.	.	ENSG00000114650	ENST00000339815;ENST00000265565;ENST00000416847;ENST00000495603;ENST00000448217	D	0.86230	-2.09	4.75	-0.684	0.11331	.	0.097415	0.39909	N	0.001240	T	0.80358	0.4608	M	0.62723	1.935	0.80722	D	1	B	0.09022	0.002	B	0.16722	0.016	T	0.63528	-0.6617	10	0.24483	T	0.36	0.1046	5.4434	0.16521	0.5559:0.1393:0.3049:0.0	.	38	Q12770	SCAP_HUMAN	V	38	ENSP00000265565:L38V	ENSP00000265565:L38V	L	-	1	2	SCAP	47459376	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.371000	0.34250	-0.258000	0.09446	0.454000	0.30748	TTA		0.512	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235		Missense_Mutation
RYK	6259	hgsc.bcm.edu	37	3	133896881	133896881	+	Silent	SNP	T	T	C			TCGA-10-0937-01	TCGA-10-0937-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr3:133896881T>C	ENST00000427044.2	-	12	1252	c.642A>G	c.(640-642)gaA>gaG	p.E214E	RYK_ENST00000296084.4_Silent_p.E404E			P34925	RYK_HUMAN	receptor-like tyrosine kinase	400					axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						GCTTTTCTCCTTCTTCTATAC	0.353																																																0			3											83.0	74.0	77.0					3																	133896881		1804	4067	5871	135379571	SO:0001819	synonymous_variant	6259			S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.642A>G	3.37:g.133896881T>C			135379571	Q04696	Silent	SNP	ENST00000427044.2	37		SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.490	1.100378	0.20552	.	.	ENSG00000163785	ENST00000460933	.	.	.	5.55	4.4	0.53042	.	.	.	.	.	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53041	-0.8494	4	.	.	.	-7.824	5.1739	0.15124	0.1377:0.1377:0.0:0.7246	.	.	.	.	R	383	.	.	K	-	2	0	RYK	135379571	0.904000	0.30761	1.000000	0.80357	0.998000	0.95712	-0.079000	0.11357	2.115000	0.64714	0.455000	0.32223	AAG		0.353	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001005861		Silent
SOCS4	122809	hgsc.bcm.edu	37	14	55510295	55510295	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr14:55510295G>C	ENST00000395472.2	+	2	868	c.536G>C	c.(535-537)aGa>aCa	p.R179T	SOCS4_ENST00000555846.1_Missense_Mutation_p.R179T|SOCS4_ENST00000339298.2_Missense_Mutation_p.R179T	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	179					intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)			p.R179T(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						CTAAAACGAAGAAATATGGAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	14											85.0	79.0	81.0					14																	55510295		2203	4300	6503	54580048	SO:0001583	missense	122809			AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.536G>C	14.37:g.55510295G>C	ENSP00000378855:p.Arg179Thr		54580048		Missense_Mutation	SNP	ENST00000395472.2	37	CCDS9722.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.707	-0.269725	0.05716	.	.	ENSG00000180008	ENST00000395472;ENST00000555846;ENST00000339298	T;T;T	0.31510	1.49;1.49;1.49	5.45	5.45	0.79879	.	0.396263	0.24352	N	0.039264	T	0.21186	0.0510	N	0.22421	0.69	0.09310	N	1	B	0.32245	0.361	B	0.31686	0.134	T	0.14952	-1.0454	10	0.30854	T	0.27	-8.8083	12.7572	0.57341	0.0741:0.0:0.9259:0.0	.	179	Q8WXH5	SOCS4_HUMAN	T	179	ENSP00000378855:R179T;ENSP00000452522:R179T;ENSP00000341327:R179T	ENSP00000341327:R179T	R	+	2	0	SOCS4	54580048	0.968000	0.33430	0.057000	0.19452	0.002000	0.02628	3.806000	0.55583	2.835000	0.97688	0.650000	0.86243	AGA		0.398	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276910.1			Missense_Mutation
SPTB	6710	hgsc.bcm.edu	37	14	65252635	65252635	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0937-01	TCGA-10-0937-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr14:65252635G>C	ENST00000389721.5	-	16	3628	c.3596C>G	c.(3595-3597)tCc>tGc	p.S1199C	SPTB_ENST00000389720.3_Missense_Mutation_p.S1199C|SPTB_ENST00000556626.1_Missense_Mutation_p.S1199C|SPTB_ENST00000542895.1_Missense_Mutation_p.S1199C|SPTB_ENST00000389722.3_Missense_Mutation_p.S1199C	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1199					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.S1199C(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGCTTCCAGGGAGTCTGGGGG	0.532																																																1	Substitution - Missense(1)	ovary(1)	14											110.0	118.0	115.0					14																	65252635		2203	4300	6503	64322388	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3596C>G	14.37:g.65252635G>C	ENSP00000374371:p.Ser1199Cys		64322388	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973573	0.74246	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	4.94	4.94	0.65067	.	0.124864	0.56097	D	0.000038	T	0.66799	0.2826	M	0.65975	2.015	0.44702	D	0.99769	D;D	0.69078	0.997;0.997	D;P	0.63113	0.911;0.881	T	0.70249	-0.4924	10	0.87932	D	0	.	12.4146	0.55486	0.0:0.0:0.8316:0.1684	.	1199;1203	P11277;Q59FP5	SPTB1_HUMAN;.	C	1203;1199;1199;1199;1199;1199	ENSP00000374372:S1199C;ENSP00000451752:S1199C;ENSP00000374371:S1199C;ENSP00000443882:S1199C;ENSP00000374370:S1199C	ENSP00000374370:S1199C	S	-	2	0	SPTB	64322388	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.798000	0.85924	2.451000	0.82905	0.542000	0.68232	TCC		0.532	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			Missense_Mutation
SRPR	6734	hgsc.bcm.edu	37	11	126137087	126137087	+	Frame_Shift_Del	DEL	T	T	-			TCGA-10-0937-01	TCGA-10-0937-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr11:126137087delT	ENST00000332118.6	-	4	663	c.509delA	c.(508-510)aagfs	p.K170fs	FOXRED1_ENST00000442061.2_5'Flank|FOXRED1_ENST00000263578.5_5'Flank|SRPR_ENST00000530680.1_5'Flank|SRPR_ENST00000532259.1_Frame_Shift_Del_p.K142fs|FOXRED1_ENST00000532125.1_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	170					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.K170fs*33(2)		endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		CTTGGCCCCCTTTTTTTTGCT	0.438																																																2	Deletion - Frameshift(2)	ovary(2)	11											347.0	340.0	342.0					11																	126137087		2201	4299	6500	125642297	SO:0001589	frameshift_variant	6734			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.509delA	11.37:g.126137087delT	ENSP00000328023:p.Lys170fs		125642297	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Frame_Shift_Del	DEL	ENST00000332118.6	37	CCDS31717.1	DEL	56	Baylor																																																																																				0.438	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386425.2	NM_003139		Frame_Shift_Del
TP53	7157	hgsc.bcm.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp		7517819	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TXNDC2	84203	hgsc.bcm.edu	37	18	9887064	9887064	+	Silent	SNP	G	G	A			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr18:9887064G>A	ENST00000306084.6	+	2	787	c.588G>A	c.(586-588)aaG>aaA	p.K196K	TXNDC2_ENST00000357775.5_Silent_p.K129K|TXNDC2_ENST00000536353.2_Intron	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	196	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.K129K(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						ACCTCCCCAAGTCCTCAGAAG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	18											145.0	147.0	146.0					18																	9887064		2203	4300	6503	9877064	SO:0001819	synonymous_variant	84203			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.588G>A	18.37:g.9887064G>A			9877064	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	CCDS42414.1	SNP	36	Baylor																																																																																				0.557	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1			Silent
UGDH	7358	hgsc.bcm.edu	37	4	39511972	39511972	+	Splice_Site	SNP	C	C	A			TCGA-10-0937-01	TCGA-10-0937-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr4:39511972C>A	ENST00000316423.6	-	5	1006		c.e5+1		UGDH_ENST00000501493.2_Splice_Site|UGDH_ENST00000507089.1_Splice_Site|UGDH_ENST00000515398.1_5'Flank|UGDH_ENST00000506179.1_Splice_Site	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase						cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.?(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TATATACTAACCAGTTTGGAA	0.378																																																1	Unknown(1)	ovary(1)	4											85.0	90.0	88.0					4																	39511972		2203	4300	6503	39188367	SO:0001630	splice_region_variant	7358			AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.663+1G>T	4.37:g.39511972C>A			39188367	B3KUU2|B4DN25|O60589	Splice_Site_SNP	SNP	ENST00000316423.6	37	CCDS3455.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	c	21.4	4.143221	0.77888	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000507089	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0677	0.93119	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UGDH	39188367	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	7.266000	0.78452	2.747000	0.94245	0.650000	0.86243	.		0.378	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359	Intron	Splice_Site_SNP
ZDHHC8	29801	hgsc.bcm.edu	37	22	20126823	20126823	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0937-01	TCGA-10-0937-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr22:20126823G>T	ENST00000334554.7	+	2	352	c.211G>T	c.(211-213)Ggt>Tgt	p.G71C	ZDHHC8_ENST00000405930.3_Missense_Mutation_p.G71C|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.G71C|ZDHHC8_ENST00000468112.1_Intron	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	71					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.G71C(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CATGGACCCTGGTGTTTTCCC	0.557																																																1	Substitution - Missense(1)	ovary(1)	22											165.0	141.0	149.0					22																	20126823		2203	4300	6503	18506823	SO:0001583	missense	29801			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.211G>T	22.37:g.20126823G>T	ENSP00000334490:p.Gly71Cys		18506823	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525536	0.85600	.	.	ENSG00000099904	ENST00000436518;ENST00000334554;ENST00000320602;ENST00000405930	D;D;D;D	0.97688	-4.49;-4.49;-4.49;-4.49	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.99399	0.9788	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98047	1.0385	10	0.87932	D	0	.	18.1579	0.89700	0.0:0.0:1.0:0.0	.	71;71	Q9ULC8-3;Q9ULC8	.;ZDHC8_HUMAN	C	60;71;71;71	ENSP00000412807:G60C;ENSP00000334490:G71C;ENSP00000317804:G71C;ENSP00000384716:G71C	ENSP00000317804:G71C	G	+	1	0	ZDHHC8	18506823	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	9.414000	0.97362	2.361000	0.80049	0.462000	0.41574	GGT		0.557	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373		Missense_Mutation
ZER1	10444	hgsc.bcm.edu	37	9	131516172	131516172	+	Silent	SNP	C	C	T	rs141354360		TCGA-10-0937-01	TCGA-10-0937-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-10-0937-01	TCGA-10-0937-11	g.chr9:131516172C>T	ENST00000291900.2	-	3	631	c.225G>A	c.(223-225)tcG>tcA	p.S75S	ZER1_ENST00000494461.1_5'UTR	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	75					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.S75S(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						TGCGGGGGTCCGAAAAGAGGC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9						C		1,4403		0,1,2201	37.0	26.0	30.0		225	-10.8	0.0	9	dbSNP_134	30	0,8600		0,0,4300	no	coding-synonymous	ZER1	NM_006336.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		75/767	131516172	1,13003	2202	4300	6502	130555993	SO:0001819	synonymous_variant	10444			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.225G>A	9.37:g.131516172C>T			130555993	O00156|Q5T272|Q5T273	Silent	SNP	ENST00000291900.2	37	CCDS6910.1	SNP	23	Baylor																																																																																				0.632	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336		Silent
