#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCA3	21	hgsc.bcm.edu	37	16	2339472	2339472	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr16:2339472A>G	ENST00000301732.5	-	20	3363	c.2663T>C	c.(2662-2664)aTc>aCc	p.I888T	ABCA3_ENST00000382381.3_Missense_Mutation_p.I830T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	888					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.I888T(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CTCCTCCTCGATGAGGGCTCC	0.687																																																1	Substitution - Missense(1)	ovary(1)	16											30.0	28.0	29.0					16																	2339472		2195	4298	6493	2279473	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2663T>C	16.37:g.2339472A>G	ENSP00000301732:p.Ile888Thr		2279473	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.96	2.392982	0.42410	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.94330	-3.4	4.68	4.68	0.58851	.	0.230149	0.42682	D	0.000680	D	0.90403	0.6996	L	0.56769	1.78	0.80722	D	1	B;B;B	0.22346	0.009;0.068;0.004	B;B;B	0.20384	0.007;0.029;0.004	D	0.86744	0.1956	10	0.18710	T	0.47	.	13.1336	0.59397	1.0:0.0:0.0:0.0	.	888;892;888	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	T	888;892	ENSP00000301732:I888T	ENSP00000301732:I888T	I	-	2	0	ABCA3	2279473	1.000000	0.71417	0.032000	0.17829	0.012000	0.07955	8.388000	0.90170	1.963000	0.57068	0.459000	0.35465	ATC		0.687	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		Missense_Mutation
ACTC1	70	hgsc.bcm.edu	37	15	35084378	35084378	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr15:35084378T>C	ENST00000290378.4	-	5	1376	c.721A>G	c.(721-723)Agc>Ggc	p.S241G	RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000558707.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	241					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)	p.S241G(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AGTTCATAGCTCTTCTCCAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	15											88.0	83.0	85.0					15																	35084378		2201	4298	6499	32871670	SO:0001583	missense	70			BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.721A>G	15.37:g.35084378T>C	ENSP00000290378:p.Ser241Gly		32871670	P04270	Missense_Mutation	SNP	ENST00000290378.4	37	CCDS10041.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.03	2.114268	0.37339	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.94862	-3.54	4.75	4.75	0.60458	.	0.206670	0.30809	U	0.008825	D	0.95364	0.8495	M	0.92691	3.335	0.49299	D	0.999778	B	0.19935	0.04	B	0.15870	0.014	D	0.94548	0.7751	10	0.87932	D	0	.	14.7193	0.69294	0.0:0.0:0.0:1.0	.	241	P68032	ACTC_HUMAN	G	241;206	ENSP00000290378:S241G	ENSP00000290378:S241G	S	-	1	0	ACTC1	32871670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.919000	0.70005	2.126000	0.65437	0.533000	0.62120	AGC		0.512	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159		Missense_Mutation
AFM	173	hgsc.bcm.edu	37	4	74353498	74353498	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr4:74353498G>T	ENST00000226355.3	+	6	766	c.673G>T	c.(673-675)Ggg>Tgg	p.G225W		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	225	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)	p.G225W(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACATGTCTGTGGGGCACTTTT	0.328																																																1	Substitution - Missense(1)	ovary(1)	4											117.0	115.0	115.0					4																	74353498		2201	4298	6499	74572362	SO:0001583	missense	173			L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.673G>T	4.37:g.74353498G>T	ENSP00000226355:p.Gly225Trp		74572362	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699496	0.30142	.	.	ENSG00000079557	ENST00000226355	T	0.73152	-0.72	4.27	3.43	0.39272	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.360322	0.30989	N	0.008471	T	0.78394	0.4276	L	0.58101	1.795	0.39735	D	0.971666	D	0.89917	1.0	D	0.83275	0.996	T	0.79140	-0.1926	10	0.87932	D	0	.	7.9298	0.29895	0.1128:0.0:0.8872:0.0	.	225	P43652	AFAM_HUMAN	W	225	ENSP00000226355:G225W	ENSP00000226355:G225W	G	+	1	0	AFM	74572362	1.000000	0.71417	0.998000	0.56505	0.174000	0.22865	2.451000	0.44952	1.025000	0.39708	0.655000	0.94253	GGG		0.328	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2			Missense_Mutation
ANK2	287	hgsc.bcm.edu	37	4	114280134	114280135	+	Frame_Shift_Ins	INS	-	-	G			TCGA-13-0714-01	TCGA-13-0714-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr4:114280134_114280135insG	ENST00000357077.4	+	38	10413_10414	c.10360_10361insG	c.(10360-10362)aggfs	p.R3454fs	ANK2_ENST00000264366.6_Frame_Shift_Ins_p.R3421fs|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3454					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T3457fs*8(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCTTCCTGCAGGGGGGGCACG	0.455																																																1	Insertion - Frameshift(1)	ovary(1)	4																																								114499584	SO:0001589	frameshift_variant	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10367dupG	4.37:g.114280141_114280141dupG	ENSP00000349588:p.Arg3454fs		114499583	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Ins	INS	ENST00000357077.4	37	CCDS3702.1	INS	7	Baylor																																																																																				0.455	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		Frame_Shift_Ins
ANKEF1	63926	hgsc.bcm.edu	37	20	10030141	10030141	+	Missense_Mutation	SNP	A	A	T	rs146891340		TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr20:10030141A>T	ENST00000378380.3	+	6	1253	c.924A>T	c.(922-924)agA>agT	p.R308S	ANKEF1_ENST00000378392.1_Missense_Mutation_p.R308S|ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000603542.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	308							calcium ion binding (GO:0005509)	p.R308S(1)									GAGCAGAGAGAATCGCTAATA	0.507																																																1	Substitution - Missense(1)	ovary(1)	20											81.0	89.0	87.0					20																	10030141		2203	4300	6503	9978141	SO:0001583	missense	63926			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.924A>T	20.37:g.10030141A>T	ENSP00000367631:p.Arg308Ser		9978141	B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	ENST00000378380.3	37	CCDS13108.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545679	0.27652	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.68331	-0.32;-0.32	5.86	0.178	0.15058	Ankyrin repeat-containing domain (1);	0.216063	0.45361	D	0.000373	T	0.52289	0.1725	M	0.72894	2.215	0.26792	N	0.969382	B	0.32573	0.376	B	0.30943	0.122	T	0.30966	-0.9960	10	0.15066	T	0.55	-0.0841	1.9796	0.03423	0.309:0.2389:0.3353:0.1168	.	308	Q9NU02	ANKR5_HUMAN	S	308	ENSP00000367644:R308S;ENSP00000367631:R308S	ENSP00000367631:R308S	R	+	3	2	ANKRD5	9978141	0.000000	0.05858	0.492000	0.27490	0.344000	0.29017	-0.669000	0.05262	0.130000	0.18549	0.528000	0.53228	AGA		0.507	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096		Missense_Mutation
ANXA11	311	hgsc.bcm.edu	37	10	81930605	81930605	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr10:81930605T>A	ENST00000438331.1	-	5	604	c.122A>T	c.(121-123)aAc>aTc	p.N41I	ANXA11_ENST00000360615.4_Missense_Mutation_p.N41I|ANXA11_ENST00000422982.3_Missense_Mutation_p.N41I|ANXA11_ENST00000463657.1_5'Flank|ANXA11_ENST00000535999.1_Missense_Mutation_p.N41I|ANXA11_ENST00000537102.1_Missense_Mutation_p.N8I|ANXA11_ENST00000372231.3_Missense_Mutation_p.N41I|ANXA11_ENST00000265447.4_Missense_Mutation_p.N41I	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	41					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.N41I(1)		endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			GGTGGCCACGTTATCCAGCCC	0.652																																																1	Substitution - Missense(1)	ovary(1)	10											73.0	65.0	67.0					10																	81930605		2203	4300	6503	81920585	SO:0001583	missense	311			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.122A>T	10.37:g.81930605T>A	ENSP00000398610:p.Asn41Ile		81920585	B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	CCDS7364.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	.	12.50	1.957838	0.34565	.	.	ENSG00000122359	ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000537102;ENST00000445524;ENST00000437799	T;T;T;T;T;T;T	0.02446	4.48;4.48;4.48;4.48;4.48;4.48;4.29	4.69	4.69	0.59074	.	3.387150	0.00706	N	0.000810	T	0.13200	0.0320	L	0.44542	1.39	0.49582	D	0.999805	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.79784	0.993;0.987;0.987	T	0.00219	-1.1907	10	0.51188	T	0.08	.	12.4176	0.55502	0.0:0.0:0.0:1.0	.	141;41;41	B7Z6L0;Q5T0G8;P50995	.;.;ANX11_HUMAN	I	41;41;41;41;41;41;41;8;41;41	ENSP00000361305:N41I;ENSP00000404412:N41I;ENSP00000398610:N41I;ENSP00000353827:N41I;ENSP00000265447:N41I;ENSP00000441748:N41I;ENSP00000441400:N8I	ENSP00000265447:N41I	N	-	2	0	ANXA11	81920585	1.000000	0.71417	0.992000	0.48379	0.096000	0.18686	4.811000	0.62606	1.886000	0.54624	0.364000	0.22116	AAC		0.652	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869		Missense_Mutation
ARHGAP1	392	hgsc.bcm.edu	37	11	46702633	46702633	+	Missense_Mutation	SNP	T	T	C	rs566268205		TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr11:46702633T>C	ENST00000311956.4	-	7	660	c.563A>G	c.(562-564)tAt>tGt	p.Y188C		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	188	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.Y188C(1)		endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		GTAATTCACATAGAAGATCTT	0.627													T|||	1	0.000199681	0.0008	0.0	5008	,	,		15226	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11											81.0	86.0	84.0					11																	46702633		2201	4299	6500	46659209	SO:0001583	missense	392			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.563A>G	11.37:g.46702633T>C	ENSP00000310491:p.Tyr188Cys		46659209	D3DQQ6	Missense_Mutation	SNP	ENST00000311956.4	37	CCDS7922.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	24.6	4.547166	0.86022	.	.	ENSG00000175220	ENST00000311956;ENST00000443332;ENST00000525488	T;T	0.67865	-0.29;-0.29	5.0	5.0	0.66597	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.86347	0.5911	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90327	0.4349	10	0.87932	D	0	.	14.7387	0.69437	0.0:0.0:0.0:1.0	.	188	Q07960	RHG01_HUMAN	C	188	ENSP00000310491:Y188C;ENSP00000432794:Y188C	ENSP00000310491:Y188C	Y	-	2	0	ARHGAP1	46659209	1.000000	0.71417	0.984000	0.44739	0.971000	0.66376	7.723000	0.84788	1.889000	0.54706	0.459000	0.35465	TAT		0.627	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390472.1	NM_004308		Missense_Mutation
ARPP21	10777	hgsc.bcm.edu	37	3	35835264	35835264	+	Silent	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr3:35835264G>A	ENST00000187397.4	+	20	2709	c.2253G>A	c.(2251-2253)caG>caA	p.Q751Q	ARPP21_ENST00000337271.5_Silent_p.Q732Q|ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000444190.1_Silent_p.Q732Q|ARPP21_ENST00000417925.1_Silent_p.Q752Q|ARPP21_ENST00000458225.1_Silent_p.Q752Q	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	751	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.Q751Q(1)|p.Q751H(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TACCTAACCAGGCAGGTCAAG	0.537																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	3											121.0	112.0	115.0					3																	35835264		2203	4300	6503	35810268	SO:0001819	synonymous_variant	10777			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2253G>A	3.37:g.35835264G>A			35810268	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Silent	SNP	ENST00000187397.4	37	CCDS2661.1	SNP	35	Baylor																																																																																				0.537	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		Silent
ASXL3	80816	hgsc.bcm.edu	37	18	31324250	31324250	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr18:31324250A>T	ENST00000269197.5	+	12	4438	c.4438A>T	c.(4438-4440)Acg>Tcg	p.T1480S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1480S(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCACAGCACCACGCTGACCTC	0.542											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	18											62.0	66.0	65.0					18																	31324250		2203	4300	6503	29578248	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4438A>T	18.37:g.31324250A>T	ENSP00000269197:p.Thr1480Ser	823	29578248	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.23	3.336910	0.60963	.	.	ENSG00000141431	ENST00000269197	T	0.15834	2.39	6.06	6.06	0.98353	.	.	.	.	.	T	0.14141	0.0342	L	0.29908	0.895	0.38198	D	0.940095	P	0.42456	0.78	B	0.34931	0.192	T	0.03887	-1.0995	9	0.66056	D	0.02	.	16.6154	0.84909	1.0:0.0:0.0:0.0	.	1480	Q9C0F0	ASXL3_HUMAN	S	1480	ENSP00000269197:T1480S	ENSP00000269197:T1480S	T	+	1	0	ASXL3	29578248	0.955000	0.32602	0.997000	0.53966	0.996000	0.88848	3.123000	0.50453	2.315000	0.78130	0.533000	0.62120	ACG		0.542	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			Missense_Mutation
BAP1	8314	hgsc.bcm.edu	37	3	52440373	52440373	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr3:52440373G>A	ENST00000460680.1	-	9	1150	c.679C>T	c.(679-681)Cgc>Tgc	p.R227C	BAP1_ENST00000296288.5_Intron	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R227C(2)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGTTGAAGCGGATGTCGTGG	0.627			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	2	Substitution - Missense(2)	ovary(2)	3											89.0	69.0	75.0					3																	52440373		2203	4300	6503	52415413	SO:0001583	missense	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.679C>T	3.37:g.52440373G>A	ENSP00000417132:p.Arg227Cys		52415413	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995807	0.74703	.	.	ENSG00000163930	ENST00000460680	T	0.49432	0.78	6.04	6.04	0.98038	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (2);	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.73217	2.22	0.80722	D	1	D	0.60160	0.987	P	0.49387	0.609	T	0.61608	-0.7028	10	0.72032	D	0.01	-4.619	15.3219	0.74129	0.0:0.0:0.8603:0.1397	.	227	Q92560	BAP1_HUMAN	C	227	ENSP00000417132:R227C	ENSP00000417132:R227C	R	-	1	0	BAP1	52415413	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.828000	0.86729	2.876000	0.98609	0.650000	0.86243	CGC		0.627	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			Missense_Mutation
CASP14	23581	hgsc.bcm.edu	37	19	15166304	15166304	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr19:15166304T>A	ENST00000427043.3	+	6	892	c.584T>A	c.(583-585)tTc>tAc	p.F195Y	CASP14_ENST00000221740.1_Missense_Mutation_p.F195Y|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	195					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.F195Y(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						GTGGATGTGTTCACGAAGAGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											110.0	94.0	100.0					19																	15166304		2203	4300	6503	15027304	SO:0001583	missense	23581				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.584T>A	19.37:g.15166304T>A	ENSP00000393417:p.Phe195Tyr		15027304	O95823|Q3SYC9	Missense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	t	16.05	3.014054	0.54468	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.03524	3.9;3.9	4.48	4.48	0.54585	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.961343	0.08635	N	0.916387	T	0.23572	0.0570	M	0.90082	3.085	0.34588	D	0.715224	D	0.69078	0.997	D	0.79108	0.992	T	0.05716	-1.0868	10	0.72032	D	0.01	.	10.4233	0.44363	0.0:0.0:0.0:1.0	.	195	P31944	CASPE_HUMAN	Y	195	ENSP00000393417:F195Y;ENSP00000221740:F195Y	ENSP00000221740:F195Y	F	+	2	0	CASP14	15027304	1.000000	0.71417	0.993000	0.49108	0.279000	0.26890	3.671000	0.54576	1.774000	0.52232	0.368000	0.22195	TTC		0.542	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114		Missense_Mutation
CES1	1066	hgsc.bcm.edu	37	16	55844443	55844443	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr16:55844443G>C	ENST00000361503.4	-	11	1431	c.1301C>G	c.(1300-1302)gCc>gGc	p.A434G	CES1_ENST00000360526.3_Missense_Mutation_p.A435G|CES1_ENST00000422046.2_Missense_Mutation_p.A433G			P23141	EST1_HUMAN	carboxylesterase 1	434					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GTGGTTCCGGGCCACAATCAC	0.512																																					NSCLC(162;1801 2756 42904 52896)											0			16											152.0	157.0	155.0					16																	55844443		2198	4300	6498	54401944	SO:0001583	missense	1066			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.1301C>G	16.37:g.55844443G>C	ENSP00000355193:p.Ala434Gly		54401944	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	.	14.96	2.691499	0.48097	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.13538	2.74;2.74;2.58	4.69	4.69	0.59074	Carboxylesterase, type B (1);	0.096419	0.45867	D	0.000325	T	0.27731	0.0682	M	0.84433	2.695	0.28710	N	0.903588	B;B;B	0.23937	0.036;0.094;0.029	B;B;B	0.36289	0.114;0.221;0.069	T	0.20773	-1.0265	10	0.72032	D	0.01	.	13.1724	0.59606	0.0:0.0:1.0:0.0	.	433;434;435	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	G	435;434;433;299	ENSP00000353720:A435G;ENSP00000355193:A434G;ENSP00000390492:A433G	ENSP00000353720:A435G	A	-	2	0	CES1	54401944	0.877000	0.30153	0.156000	0.22583	0.190000	0.23558	4.309000	0.59135	2.182000	0.69389	0.456000	0.33151	GCC		0.512	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266		Missense_Mutation
CNGA3	1261	hgsc.bcm.edu	37	2	99013218	99013218	+	Missense_Mutation	SNP	G	G	A	rs104893619		TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:99013218G>A	ENST00000272602.2	+	7	1624	c.1585G>A	c.(1585-1587)Gtg>Atg	p.V529M	CNGA3_ENST00000393504.1_Missense_Mutation_p.V529M|CNGA3_ENST00000409937.1_Missense_Mutation_p.V533M|CNGA3_ENST00000436404.2_Missense_Mutation_p.V511M			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	529			V -> M (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:15712225, ECO:0000269|PubMed:24903488, ECO:0000269|PubMed:9662398}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.V529M(1)|p.V529L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CAAGCTGGCCGTGGTGGCTGA	0.552																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2	GRCh37	CM980379	CNGA3	M	rs104893619	G	MET/VAL,MET/VAL	0,4406		0,0,2203	117.0	110.0	112.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1531,1585	5.1	1.0	2	dbSNP_132	112	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNGA3	NM_001079878.1,NM_001298.2	21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	511/677,529/695	99013218	1,13005	2203	4300	6503	98379650	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1585G>A	2.37:g.99013218G>A	ENSP00000272602:p.Val529Met		98379650	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673220	0.67928	0.0	1.16E-4	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.06	5.06	0.68205	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.98492	0.9497	H	0.98276	4.19	0.80722	A	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.99605	1.0979	9	0.87932	D	0	.	17.3584	0.87343	0.0:0.0:1.0:0.0	.	533;511;529	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	M	529;511;529;533	ENSP00000377140:V529M;ENSP00000410070:V511M;ENSP00000272602:V529M;ENSP00000386761:V533M	ENSP00000272602:V529M	V	+	1	0	CNGA3	98379650	1.000000	0.71417	0.976000	0.42696	0.667000	0.39255	9.263000	0.95617	2.626000	0.88956	0.563000	0.77884	GTG		0.552	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		Missense_Mutation
CPN2	1370	hgsc.bcm.edu	37	3	194063286	194063286	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr3:194063286G>A	ENST00000323830.3	-	2	235	c.146C>T	c.(145-147)cCa>cTa	p.P49L	CPN2_ENST00000429275.1_Missense_Mutation_p.P49L	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	49	LRRNT.				protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.P49L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TTTCGTATATGGCGGGATGTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											134.0	126.0	129.0					3																	194063286		2203	4300	6503	195544981	SO:0001583	missense	1370			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.146C>T	3.37:g.194063286G>A	ENSP00000319464:p.Pro49Leu		195544981	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	CCDS33920.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.048	-1.261075	0.01445	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.25414	1.8;1.8	5.19	4.26	0.50523	Leucine-rich repeat-containing N-terminal (1);	0.213797	0.23852	N	0.043928	T	0.18635	0.0447	L	0.45137	1.4	0.09310	N	0.999997	P	0.35077	0.483	B	0.30251	0.113	T	0.13415	-1.0510	10	0.13470	T	0.59	.	12.5612	0.56281	0.0:0.131:0.7487:0.1203	.	49	P22792	CPN2_HUMAN	L	49	ENSP00000319464:P49L;ENSP00000402232:P49L	ENSP00000319464:P49L	P	-	2	0	CPN2	195544981	0.000000	0.05858	0.039000	0.18376	0.012000	0.07955	0.481000	0.22260	2.590000	0.87494	0.561000	0.74099	CCA		0.547	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342856.2	NM_001080513		Missense_Mutation
CPS1	1373	hgsc.bcm.edu	37	2	211523337	211523337	+	Silent	SNP	C	C	A			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:211523337C>A	ENST00000233072.5	+	31	3877	c.3681C>A	c.(3679-3681)acC>acA	p.T1227T	CPS1_ENST00000430249.2_Silent_p.T1233T|CPS1_ENST00000451903.2_Silent_p.T776T	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1227	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.T1227T(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGGATGCTACCCGGAAGATTG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	2											116.0	109.0	112.0					2																	211523337		2203	4300	6503	211231582	SO:0001819	synonymous_variant	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3681C>A	2.37:g.211523337C>A			211231582	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1	SNP	22	Baylor																																																																																				0.383	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			Silent
DAG1	1605	hgsc.bcm.edu	37	3	49569910	49569910	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr3:49569910G>A	ENST00000539901.1	+	3	2524	c.1966G>A	c.(1966-1968)Gtg>Atg	p.V656M	DAG1_ENST00000515359.2_Missense_Mutation_p.V656M|DAG1_ENST00000541308.1_Missense_Mutation_p.V656M|DAG1_ENST00000545947.1_Missense_Mutation_p.V656M|DAG1_ENST00000308775.2_Missense_Mutation_p.V656M|DAG1_ENST00000538711.1_Missense_Mutation_p.V656M	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	656	Peptidase S72.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)	p.V656M(1)		NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGGCTCCATCGTGGTGGAATG	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											41.0	42.0	42.0					3																	49569910		2203	4300	6503	49544914	SO:0001583	missense	1605			L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1966G>A	3.37:g.49569910G>A	ENSP00000439334:p.Val656Met		49544914	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	CCDS2799.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728613	0.30593	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	6.0	3.21	0.36854	.	0.377786	0.30593	N	0.009298	T	0.52451	0.1735	M	0.74258	2.255	0.30282	N	0.791218	P	0.50369	0.934	P	0.46543	0.52	T	0.57791	-0.7750	9	.	.	.	-6.2647	12.1293	0.53934	0.0:0.2446:0.6283:0.1271	.	656	Q14118	DAG1_HUMAN	M	656	ENSP00000440705:V656M;ENSP00000312435:V656M;ENSP00000442600:V656M;ENSP00000440590:V656M;ENSP00000439334:V656M;ENSP00000438421:V656M	.	V	+	1	0	DAG1	49544914	0.940000	0.31905	0.332000	0.25469	0.832000	0.47134	1.467000	0.35321	0.409000	0.25649	-0.127000	0.14921	GTG		0.567	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			Missense_Mutation
DENND1A	57706	hgsc.bcm.edu	37	9	126146015	126146015	+	Silent	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr9:126146015C>T	ENST00000373624.2	-	21	1956	c.1755G>A	c.(1753-1755)caG>caA	p.Q585Q	DENND1A_ENST00000394219.3_Silent_p.Q596Q|DENND1A_ENST00000542603.1_Silent_p.Q370Q|DENND1A_ENST00000473039.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	585					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q585Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GGCCCAGTGGCTGCAGTGCGG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	9											80.0	73.0	75.0					9																	126146015		2203	4300	6503	125185836	SO:0001819	synonymous_variant	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1755G>A	9.37:g.126146015C>T			125185836	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	37	CCDS35133.1	SNP	28	Baylor																																																																																				0.622	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		Silent
DSCAM	1826	hgsc.bcm.edu	37	21	41648079	41648079	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr21:41648079C>G	ENST00000400454.1	-	11	2778	c.2301G>C	c.(2299-2301)aaG>aaC	p.K767N		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	767	Ig-like C2-type 8.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.K767N(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGTTGCTGACCTTGCAGAGGT	0.473																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Missense(1)	ovary(1)	21											80.0	85.0	84.0					21																	41648079		2060	4246	6306	40569949	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2301G>C	21.37:g.41648079C>G	ENSP00000383303:p.Lys767Asn		40569949	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760708	0.69763	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.68765	-0.35;-0.35	5.78	4.89	0.63831	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.058737	0.64402	D	0.000002	T	0.64405	0.2595	L	0.38649	1.16	0.47123	D	0.999322	P	0.51147	0.942	P	0.50270	0.636	T	0.60596	-0.7232	10	0.30078	T	0.28	.	14.2557	0.66051	0.0:0.9291:0.0:0.0709	.	767	O60469	DSCAM_HUMAN	N	767;519	ENSP00000383303:K767N;ENSP00000385342:K519N	ENSP00000383303:K767N	K	-	3	2	DSCAM	40569949	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.386000	0.44380	2.729000	0.93468	0.650000	0.86243	AAG		0.473	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Missense_Mutation
FAM83B	222584	hgsc.bcm.edu	37	6	54805235	54805235	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr6:54805235A>G	ENST00000306858.7	+	5	1582	c.1466A>G	c.(1465-1467)aAg>aGg	p.K489R	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	489								p.K489R(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					CATACCACAAAGTCATTCCTA	0.423																																																1	Substitution - Missense(1)	ovary(1)	6											94.0	94.0	94.0					6																	54805235		2203	4300	6503	54913194	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1466A>G	6.37:g.54805235A>G	ENSP00000304078:p.Lys489Arg		54913194	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.05	3.288979	0.59976	.	.	ENSG00000168143	ENST00000306858	T	0.37915	1.17	5.56	4.37	0.52481	.	0.060918	0.64402	N	0.000003	T	0.12475	0.0303	L	0.29908	0.895	0.46725	D	0.999175	P	0.38110	0.618	B	0.32211	0.142	T	0.04140	-1.0974	10	0.59425	D	0.04	-22.0251	10.8888	0.46984	0.9217:0.0:0.0783:0.0	.	489	Q5T0W9	FA83B_HUMAN	R	489	ENSP00000304078:K489R	ENSP00000304078:K489R	K	+	2	0	FAM83B	54913194	1.000000	0.71417	0.877000	0.34402	0.989000	0.77384	5.818000	0.69236	1.006000	0.39211	-0.408000	0.06270	AAG		0.423	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		Missense_Mutation
GPATCH2	55105	hgsc.bcm.edu	37	1	217604630	217604630	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:217604630G>A	ENST00000366935.3	-	10	1554	c.1444C>T	c.(1444-1446)Cct>Tct	p.P482S		NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	482	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)	p.P482S(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		CCTGACCCAGGCGTCCAGCCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	118.0	117.0					1																	217604630		2203	4300	6503	215671253	SO:0001583	missense	55105			AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.1444C>T	1.37:g.217604630G>A	ENSP00000355902:p.Pro482Ser		215671253	Q5VYK7|Q5VYK8|Q86YE7	Missense_Mutation	SNP	ENST00000366935.3	37	CCDS1518.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005736	0.93287	.	.	ENSG00000092978	ENST00000366935	T	0.38722	1.12	5.83	5.83	0.93111	D111/G-patch (3);	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	L	0.41573	1.285	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.58572	-0.7613	10	0.66056	D	0.02	.	20.111	0.97911	0.0:0.0:1.0:0.0	.	482	Q9NW75	GPTC2_HUMAN	S	482	ENSP00000355902:P482S	ENSP00000355902:P482S	P	-	1	0	GPATCH2	215671253	1.000000	0.71417	0.576000	0.28549	0.942000	0.58702	8.805000	0.91925	2.747000	0.94245	0.650000	0.86243	CCT		0.463	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001272.1	NM_018040		Missense_Mutation
GPR101	83550	hgsc.bcm.edu	37	X	136113068	136113068	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chrX:136113068A>T	ENST00000298110.1	-	1	765	c.766T>A	c.(766-768)Ttc>Atc	p.F256I		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.F256I(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TCATCCTGGAACTCCTCCTTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											158.0	132.0	141.0					X																	136113068		2203	4300	6503	135940734	SO:0001583	missense	83550			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.766T>A	X.37:g.136113068A>T	ENSP00000298110:p.Phe256Ile		135940734	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.020	-1.443926	0.01089	.	.	ENSG00000165370	ENST00000298110	T	0.63255	-0.03	4.46	-2.34	0.06704	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.39253	0.1071	N	0.22421	0.69	0.09310	N	1	B	0.20261	0.043	B	0.19666	0.026	T	0.20438	-1.0275	9	0.20519	T	0.43	-3.9407	4.3692	0.11239	0.337:0.3493:0.3137:0.0	.	256	Q96P66	GP101_HUMAN	I	256	ENSP00000298110:F256I	ENSP00000298110:F256I	F	-	1	0	GPR101	135940734	0.009000	0.17119	0.000000	0.03702	0.017000	0.09413	0.827000	0.27421	-0.401000	0.07644	-0.369000	0.07265	TTC		0.547	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			Missense_Mutation
GSG2	83903	hgsc.bcm.edu	37	17	3628421	3628422	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-13-0714-01	TCGA-13-0714-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr17:3628421_3628422insAA	ENST00000325418.4	+	1	1211_1212	c.1192_1193insAA	c.(1192-1194)gatfs	p.D398fs	ITGAE_ENST00000571185.1_Intron|ITGAE_ENST00000263087.4_Intron|CTD-3195I5.3_ENST00000571741.1_RNA	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	398					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										AATTGTGACTGATGTGTCAGAG	0.475																																																0			17																																								3575171	SO:0001589	frameshift_variant	83903			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	Exception_encountered	17.37:g.3628421_3628422insAA	ENSP00000325290:p.Asp398fs		3575170	Q5U5K3|Q96MN1|Q9BXS7	Frame_Shift_Ins	INS	ENST00000325418.4	37	CCDS11036.1	INS	45	Baylor																																																																																				0.475	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965		Frame_Shift_Ins
GSK3A	2931	hgsc.bcm.edu	37	19	42744212	42744212	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr19:42744212G>C	ENST00000222330.3	-	2	493	c.366C>G	c.(364-366)atC>atG	p.I122M	AC006486.1_ENST00000378108.1_5'Flank|AC006486.9_ENST00000594664.1_Missense_Mutation_p.I35M|GSK3A_ENST00000398249.4_Missense_Mutation_p.I40M	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.I122M(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CAATCACTTTGATGTCCGTGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											166.0	126.0	139.0					19																	42744212		2203	4300	6503	47436052	SO:0001583	missense	2931				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.366C>G	19.37:g.42744212G>C	ENSP00000222330:p.Ile122Met		47436052	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526748	0.44969	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.46063	1.99;0.88	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.33792	1.035	0.51233	D	0.999912	B;B	0.23249	0.082;0.014	B;B	0.25987	0.065;0.038	T	0.19192	-1.0313	10	0.54805	T	0.06	-5.9144	17.9284	0.88990	0.0:0.0:1.0:0.0	.	122;40	P49840;A8MT37	GSK3A_HUMAN;.	M	122;40;67	ENSP00000222330:I122M;ENSP00000381301:I40M	ENSP00000222330:I122M	I	-	3	3	GSK3A	47436052	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.502000	0.53332	2.622000	0.88805	0.555000	0.69702	ATC		0.567	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1			Missense_Mutation
HAPLN1	1404	hgsc.bcm.edu	37	5	82937601	82937601	+	Missense_Mutation	SNP	C	C	T	rs555462462		TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr5:82937601C>T	ENST00000274341.4	-	5	1629	c.779G>A	c.(778-780)cGt>cAt	p.R260H		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	260	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.R260H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	ATAGTAAAAACGGCCTGTAGA	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		17904	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											107.0	110.0	109.0					5																	82937601		2203	4300	6503	82973357	SO:0001583	missense	1404				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.779G>A	5.37:g.82937601C>T	ENSP00000274341:p.Arg260His		82973357	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.58	1.681038	0.29872	.	.	ENSG00000145681	ENST00000274341	T	0.09630	2.96	5.1	4.22	0.49857	Link (3);	0.102971	0.64402	D	0.000002	T	0.09642	0.0237	L	0.41573	1.285	0.80722	D	1	P	0.41232	0.743	B	0.33799	0.17	T	0.12734	-1.0536	10	0.38643	T	0.18	.	15.1733	0.72891	0.1423:0.8577:0.0:0.0	.	260	P10915	HPLN1_HUMAN	H	260	ENSP00000274341:R260H	ENSP00000274341:R260H	R	-	2	0	HAPLN1	82973357	0.771000	0.28555	0.856000	0.33681	0.870000	0.49936	1.924000	0.40065	1.245000	0.43885	0.655000	0.94253	CGT		0.458	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884		Missense_Mutation
HECTD1	25831	hgsc.bcm.edu	37	14	31578715	31578715	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr14:31578715A>T	ENST00000399332.1	-	36	6856	c.6368T>A	c.(6367-6369)tTt>tAt	p.F2123Y	HECTD1_ENST00000553700.1_Missense_Mutation_p.F2123Y	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2123					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.F2123Y(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ACCAACTCGAAACTCTCCAGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	109.0	108.0					14																	31578715		2051	4207	6258	30648466	SO:0001583	missense	25831			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6368T>A	14.37:g.31578715A>T	ENSP00000382269:p.Phe2123Tyr		30648466	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	SNP	1	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.1|22.1	4.248873|4.248873	0.80024|0.80024	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000554882|ENST00000553700;ENST00000261312;ENST00000399332	T|T;T	0.14391|0.12672	2.51|2.66;2.66	5.73|5.73	5.73|5.73	0.89815|0.89815	.|HECT (1);	0.000000|0.000000	0.85682|0.85682	U|U	0.000000|0.000000	T|T	0.23330|0.23330	0.0564|0.0564	L|L	0.39326|0.39326	1.205|1.205	0.80722|0.80722	D|D	1|1	.|P	.|0.49447	.|0.924	.|P	.|0.57776	.|0.827	T|T	0.02933|0.02933	-1.1092|-1.1092	7|10	.|0.13853	.|T	.|0.58	-13.3026|-13.3026	16.0096|16.0096	0.80391|0.80391	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|2123	.|Q9ULT8	.|HECD1_HUMAN	I|Y	489|2123;2125;2123	ENSP00000451260:F489I|ENSP00000450697:F2123Y;ENSP00000382269:F2123Y	.|ENSP00000261312:F2125Y	F|F	-|-	1|2	0|0	HECTD1|HECTD1	30648466|30648466	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.678000|8.678000	0.91211|0.91211	2.184000|2.184000	0.69523|0.69523	0.477000|0.477000	0.44152|0.44152	TTC|TTT		0.473	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			Missense_Mutation
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056475	26056475	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr6:26056475G>A	ENST00000343677.2	-	1	224	c.182C>T	c.(181-183)gCt>gTt	p.A61V		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	61	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.A61V(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TTTTTTCAGAGCAGCCAGAGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											80.0	89.0	86.0					6																	26056475		2203	4300	6503	26164454	SO:0001583	missense	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.182C>T	6.37:g.26056475G>A	ENSP00000339566:p.Ala61Val		26164454	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925109	0.73213	.	.	ENSG00000187837	ENST00000343677	T	0.15718	2.4	5.73	5.73	0.89815	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.111358	0.64402	D	0.000012	T	0.53899	0.1825	H	0.97265	3.97	0.80722	D	1	D	0.55605	0.972	D	0.66716	0.946	T	0.69870	-0.5028	10	0.87932	D	0	-17.3791	19.2479	0.93909	0.0:0.0:1.0:0.0	.	61	P16403	H12_HUMAN	V	61	ENSP00000339566:A61V	ENSP00000339566:A61V	A	-	2	0	HIST1H1C	26164454	1.000000	0.71417	0.991000	0.47740	0.004000	0.04260	6.551000	0.73909	2.861000	0.98227	0.655000	0.94253	GCT		0.577	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319		Missense_Mutation
INHBA	3624	hgsc.bcm.edu	37	7	41729762	41729763	+	In_Frame_Ins	INS	-	-	GTC			TCGA-13-0714-01	TCGA-13-0714-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr7:41729762_41729763insGTC	ENST00000242208.4	-	3	1012_1013	c.766_767insGAC	c.(766-768)ctc>cGACtc	p.255_256insR	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_In_Frame_Ins_p.255_256insR|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	255					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.V255_L256insR(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ctTGCCCAGGAGAACCAAGCTG	0.589										TSP Lung(11;0.080)																																						1	Insertion - In frame(1)	ovary(1)	7																																								41696288	SO:0001652	inframe_insertion	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.766_767insGAC	7.37:g.41729762_41729763insGTC	ENSP00000242208:p.Val255_Leu256insArg		41696287	Q14599	In_Frame_Ins	INS	ENST00000242208.4	37	CCDS5464.1	INS	11	Baylor																																																																																				0.589	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			In_Frame_Ins
ITPKB	3707	hgsc.bcm.edu	37	1	226822487	226822487	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:226822487G>C	ENST00000272117.3	-	7	2725	c.2726C>G	c.(2725-2727)aCc>aGc	p.T909S	ITPKB_ENST00000429204.1_Missense_Mutation_p.T909S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	909					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.T435S(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				ATGCTGCAGGGTCTGGCCCTC	0.592																																					Colon(84;110 1851 5306 33547)											1	Substitution - Missense(1)	ovary(1)	1											90.0	72.0	78.0					1																	226822487		2203	4300	6503	224889110	SO:0001583	missense	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2726C>G	1.37:g.226822487G>C	ENSP00000272117:p.Thr909Ser		224889110	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502443	0.44455	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.14144	2.53;2.53	5.05	5.05	0.67936	.	0.185344	0.48767	D	0.000173	T	0.12008	0.0292	L	0.49571	1.57	0.25556	N	0.987032	B	0.26363	0.147	B	0.24394	0.053	T	0.14200	-1.0481	10	0.33141	T	0.24	-30.7112	6.5799	0.22588	0.226:0.0:0.774:0.0	.	909	P27987	IP3KB_HUMAN	S	909	ENSP00000272117:T909S;ENSP00000411152:T909S	ENSP00000272117:T909S	T	-	2	0	ITPKB	224889110	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.994000	0.40757	2.359000	0.80004	0.555000	0.69702	ACC		0.592	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221		Missense_Mutation
KCNJ12	3768	hgsc.bcm.edu	37	17	21319392	21319392	+	Silent	SNP	G	G	A	rs73979899	byFrequency	TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr17:21319392G>A	ENST00000583088.1	+	3	1633	c.738G>A	c.(736-738)ctG>ctA	p.L246L	KCNJ12_ENST00000331718.5_Silent_p.L246L	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	246					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	ACATCCCGCTGGACCAGATCG	0.627										Prostate(3;0.18)																																						0			17											124.0	90.0	101.0					17																	21319392		2203	4300	6503	21259985	SO:0001819	synonymous_variant	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.738G>A	17.37:g.21319392G>A			21259985	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1	SNP	47	Baylor																																																																																				0.627	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		Silent
KCNJ9	3765	hgsc.bcm.edu	37	1	160057394	160057394	+	Missense_Mutation	SNP	C	C	A	rs138491089	byFrequency	TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:160057394C>A	ENST00000368088.3	+	3	1211	c.969C>A	c.(967-969)caC>caA	p.H323Q		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	323					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.H323Q(1)		biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCAGCTTTCACGAGACTTTTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	73.0	76.0					1																	160057394		2203	4300	6503	158324018	SO:0001583	missense	3765			U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.969C>A	1.37:g.160057394C>A	ENSP00000357067:p.His323Gln		158324018	Q5JW75	Missense_Mutation	SNP	ENST00000368088.3	37	CCDS1194.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	c	17.98	3.521492	0.64747	.	.	ENSG00000162728	ENST00000368088	D	0.92299	-3.01	4.21	-3.28	0.05033	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.94212	0.8142	M	0.93462	3.42	0.40894	D	0.984091	D	0.58268	0.982	P	0.59889	0.865	D	0.93955	0.7235	10	0.72032	D	0.01	.	11.4919	0.50385	0.0:0.5433:0.0:0.4567	.	323	Q92806	IRK9_HUMAN	Q	323	ENSP00000357067:H323Q	ENSP00000357067:H323Q	H	+	3	2	KCNJ9	158324018	0.000000	0.05858	0.977000	0.42913	0.963000	0.63663	-0.391000	0.07323	-0.556000	0.06134	-0.273000	0.10243	CAC		0.617	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060628.1	NM_004983		Missense_Mutation
KIF4A	24137	hgsc.bcm.edu	37	X	69510633	69510633	+	Silent	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chrX:69510633A>T	ENST00000374403.3	+	3	295	c.213A>T	c.(211-213)ccA>ccT	p.P71P	KIF4A_ENST00000485406.1_3'UTR|PDZD11_ENST00000239666.4_5'Flank|KIF4A_ENST00000374388.3_Silent_p.P71P|PDZD11_ENST00000473667.1_5'Flank|PDZD11_ENST00000374454.1_5'Flank	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	71	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.P71P(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CAGTAGCGCCACTCATAAAAG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	X											116.0	91.0	99.0					X																	69510633		2203	4300	6503	69427358	SO:0001819	synonymous_variant	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.213A>T	X.37:g.69510633A>T			69427358	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	ENST00000374403.3	37	CCDS14401.1	SNP	6	Baylor																																																																																				0.408	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		Silent
KLHL29	114818	hgsc.bcm.edu	37	2	23914547	23914547	+	Silent	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:23914547C>T	ENST00000486442.1	+	7	1800	c.1083C>T	c.(1081-1083)tcC>tcT	p.S361S		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	361	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.S141S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						TGCCTAGGTCCGTGCAAGACA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	2											45.0	51.0	49.0					2																	23914547		692	1591	2283	23768052	SO:0001819	synonymous_variant	114818				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.1083C>T	2.37:g.23914547C>T			23768052	Q8N388|Q96BF0|Q96PW7	Silent	SNP	ENST00000486442.1	37	CCDS54335.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.918	0.539052	0.13250	.	.	ENSG00000119771	ENST00000288548	.	.	.	5.58	-8.34	0.00988	.	.	.	.	.	T	0.43433	0.1247	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47761	-0.9092	4	.	.	.	.	5.5487	0.17079	0.2216:0.1946:0.4657:0.1181	.	.	.	.	L	201	.	.	P	+	2	0	KLHL29	23768052	0.009000	0.17119	0.466000	0.27168	0.944000	0.59088	-1.131000	0.03238	-1.753000	0.01323	-0.165000	0.13383	CCG		0.642	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920		Silent
LBP	3929	hgsc.bcm.edu	37	20	36997702	36997702	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr20:36997702C>A	ENST00000217407.2	+	10	1206	c.1045C>A	c.(1045-1047)Ctg>Atg	p.L349M		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	349					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)	p.L349M(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TGCTCCGCTCCTGAACTTCAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	20											129.0	127.0	128.0					20																	36997702		2203	4300	6503	36431116	SO:0001583	missense	3929				CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.1045C>A	20.37:g.36997702C>A	ENSP00000217407:p.Leu349Met		36431116	B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	CCDS13304.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235566	0.22626	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.11277	2.79	5.54	1.11	0.20524	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.212960	0.32719	N	0.005737	T	0.22085	0.0532	M	0.74647	2.275	0.27946	N	0.937332	P	0.51791	0.948	P	0.62298	0.9	T	0.03818	-1.1001	10	0.52906	T	0.07	-7.2226	3.3818	0.07257	0.1366:0.5692:0.1327:0.1615	.	349	P18428	LBP_HUMAN	M	349	ENSP00000217407:L349M	ENSP00000217407:L349M	L	+	1	2	LBP	36431116	0.380000	0.25131	0.141000	0.22245	0.035000	0.12851	0.613000	0.24299	0.401000	0.25424	-0.136000	0.14681	CTG		0.537	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139		Missense_Mutation
LRP1	4035	hgsc.bcm.edu	37	12	57604989	57604989	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr12:57604989G>T	ENST00000243077.3	+	84	13413	c.12947G>T	c.(12946-12948)gGc>gTc	p.G4316V		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4316	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.G4316V(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGAACTTTGGCACATGCCAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	72.0	78.0					12																	57604989		2203	4300	6503	55891256	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12947G>T	12.37:g.57604989G>T	ENSP00000243077:p.Gly4316Val		55891256	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.60	3.657942	0.67586	.	.	ENSG00000123384	ENST00000243077	T	0.10668	2.85	4.39	4.39	0.52855	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.56097	D	0.000033	T	0.11110	0.0271	L	0.38175	1.15	0.80722	D	1	P	0.35982	0.531	B	0.34779	0.189	T	0.08994	-1.0695	10	0.72032	D	0.01	.	15.8831	0.79219	0.0:0.0:1.0:0.0	.	4316	Q07954	LRP1_HUMAN	V	4316	ENSP00000243077:G4316V	ENSP00000243077:G4316V	G	+	2	0	LRP1	55891256	1.000000	0.71417	0.989000	0.46669	0.817000	0.46193	5.447000	0.66606	2.292000	0.77174	0.462000	0.41574	GGC		0.577	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Missense_Mutation
MAN2A1	4124	hgsc.bcm.edu	37	5	109190892	109190892	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr5:109190892T>A	ENST00000261483.4	+	20	4080	c.3028T>A	c.(3028-3030)Tct>Act	p.S1010T	MAN2A1_ENST00000505313.1_3'UTR	NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	1010					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.S1010T(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		CCACATAACTTCTTCTCTCAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											156.0	130.0	139.0					5																	109190892		2202	4300	6502	109218791	SO:0001583	missense	4124				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.3028T>A	5.37:g.109190892T>A	ENSP00000261483:p.Ser1010Thr		109218791	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.4	3.991324	0.74703	.	.	ENSG00000112893	ENST00000261483	D	0.83673	-1.75	5.96	4.77	0.60923	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.056337	0.64402	D	0.000001	D	0.87966	0.6311	M	0.82517	2.595	0.47441	D	0.999427	P	0.41159	0.74	P	0.50440	0.641	D	0.86471	0.1785	10	0.38643	T	0.18	-20.5302	12.3645	0.55221	0.1265:0.0:0.0:0.8735	.	1010	Q16706	MA2A1_HUMAN	T	1010	ENSP00000261483:S1010T	ENSP00000261483:S1010T	S	+	1	0	MAN2A1	109218791	0.996000	0.38824	0.025000	0.17156	0.905000	0.53344	4.855000	0.62925	1.022000	0.39626	0.533000	0.62120	TCT		0.393	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1			Missense_Mutation
MAPK9	5601	hgsc.bcm.edu	37	5	179691823	179691823	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr5:179691823T>C	ENST00000452135.2	-	4	567	c.269A>G	c.(268-270)aAt>aGt	p.N90S	MAPK9_ENST00000425491.2_Missense_Mutation_p.N90S|MAPK9_ENST00000347470.4_Missense_Mutation_p.N90S|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000393360.3_Missense_Mutation_p.N90S|MAPK9_ENST00000524170.1_5'Flank|MAPK9_ENST00000539014.1_Missense_Mutation_p.N90S|MAPK9_ENST00000455781.1_Missense_Mutation_p.N90S|MAPK9_ENST00000343111.6_Missense_Mutation_p.N90S			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)	p.N90S(1)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTAAACACATTTAACAAACT	0.244																																																1	Substitution - Missense(1)	ovary(1)	5											36.0	37.0	37.0					5																	179691823		2180	4279	6459	179624429	SO:0001583	missense	5601			U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.269A>G	5.37:g.179691823T>C	ENSP00000394560:p.Asn90Ser		179624429	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Missense_Mutation	SNP	ENST00000452135.2	37	CCDS4453.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372566	0.61624	.	.	ENSG00000050748	ENST00000452135;ENST00000393360;ENST00000455781;ENST00000343111;ENST00000347470;ENST00000425491;ENST00000539014;ENST00000523583	D;D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75295	0.3830	L	0.35288	1.05	0.80722	D	1	B;B;B;P;B	0.39044	0.145;0.409;0.232;0.656;0.09	B;B;B;B;B	0.33890	0.064;0.172;0.113;0.171;0.053	T	0.79157	-0.1919	10	0.87932	D	0	-35.4792	15.6337	0.76933	0.0:0.0:0.0:1.0	.	90;90;90;90;90	P45984-5;P45984-4;P45984-3;P45984-2;P45984	.;.;.;.;MK09_HUMAN	S	90	ENSP00000394560:N90S;ENSP00000377028:N90S;ENSP00000389338:N90S;ENSP00000345524:N90S;ENSP00000321410:N90S;ENSP00000397422:N90S;ENSP00000443149:N90S;ENSP00000430608:N90S	ENSP00000345524:N90S	N	-	2	0	MAPK9	179624429	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.189000	0.72051	2.110000	0.64415	0.533000	0.62120	AAT		0.244	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253530.3			Missense_Mutation
MARK3	4140	hgsc.bcm.edu	37	14	103918266	103918266	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr14:103918266G>A	ENST00000429436.2	+	5	868	c.358G>A	c.(358-360)Gaa>Aaa	p.E120K	MARK3_ENST00000303622.9_Missense_Mutation_p.E120K|MARK3_ENST00000440884.3_Missense_Mutation_p.E120K|MARK3_ENST00000335102.5_Missense_Mutation_p.E120K|MARK3_ENST00000216288.7_Missense_Mutation_p.E120K|MARK3_ENST00000561071.1_3'UTR|MARK3_ENST00000416682.2_Missense_Mutation_p.E120K|MARK3_ENST00000553942.1_Missense_Mutation_p.E120K	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	120	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E120K(4)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			GAAGTTATTCGAAGTCATTGA	0.353																																																4	Substitution - Missense(4)	prostate(2)|ovary(1)|large_intestine(1)	14											171.0	168.0	169.0					14																	103918266		1851	4107	5958	102988019	SO:0001583	missense	4140			M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.358G>A	14.37:g.103918266G>A	ENSP00000411397:p.Glu120Lys		102988019	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	ENST00000429436.2	37	CCDS45165.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086533	0.76642	.	.	ENSG00000075413	ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942	T;T;T;T;T;T;T	0.26223	1.75;3.07;1.75;1.75;1.75;1.75;1.75	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	M	0.70108	2.13	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.87578	0.903;0.997;0.998;0.998;0.993;0.996	T	0.51957	-0.8639	10	0.72032	D	0.01	.	19.0276	0.92939	0.0:0.0:1.0:0.0	.	120;120;120;120;120;120	P27448-2;P27448-6;P27448;Q86TT8;P27448-4;P27448-3	.;.;MARK3_HUMAN;.;.;.	K	120	ENSP00000335347:E120K;ENSP00000402104:E120K;ENSP00000408092:E120K;ENSP00000411397:E120K;ENSP00000303698:E120K;ENSP00000216288:E120K;ENSP00000450772:E120K	ENSP00000216288:E120K	E	+	1	0	MARK3	102988019	1.000000	0.71417	0.999000	0.59377	0.020000	0.10135	8.655000	0.91098	2.797000	0.96272	0.563000	0.77884	GAA		0.353	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918		Missense_Mutation
MCM3AP	8888	hgsc.bcm.edu	37	21	47662800	47662800	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr21:47662800T>C	ENST00000397708.1	-	26	5596	c.5342A>G	c.(5341-5343)aAc>aGc	p.N1781S	MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.N1781S|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1781	Acetyltransferase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.N1781S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TTTCAAATCGTTTTTAAAAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	21											93.0	86.0	89.0					21																	47662800		2203	4300	6503	46487228	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5342A>G	21.37:g.47662800T>C	ENSP00000380820:p.Asn1781Ser		46487228	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.40	1.338755	0.24253	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03301	3.98;3.98	5.84	4.5	0.54988	.	0.302964	0.40302	N	0.001132	T	0.02533	0.0077	N	0.17082	0.46	0.22489	N	0.999053	B;B	0.22276	0.067;0.004	B;B	0.16289	0.015;0.002	T	0.47142	-0.9140	10	0.18710	T	0.47	-25.5528	10.3404	0.43875	0.0:0.1318:0.0:0.8682	.	1781;276	O60318;B3KT88	MCM3A_HUMAN;.	S	1781;1781;276	ENSP00000380820:N1781S;ENSP00000291688:N1781S	ENSP00000291688:N1781S	N	-	2	0	MCM3AP	46487228	0.879000	0.30193	0.934000	0.37439	0.722000	0.41435	1.119000	0.31258	2.232000	0.73038	0.533000	0.62120	AAC		0.443	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		Missense_Mutation
MUC6	4588	hgsc.bcm.edu	37	11	1017773	1017773	+	Silent	SNP	G	G	A	rs57384288	byFrequency	TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr11:1017773G>A	ENST00000421673.2	-	31	5078	c.5028C>T	c.(5026-5028)agC>agT	p.S1676S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1676	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.S1676S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCTGGTCCCGCTGGTGGTCA	0.557													A|||	1486	0.296725	0.3298	0.1542	5008	,	,		31162	0.3165		0.2505	False		,,,				2504	0.3804															1	Substitution - coding silent(1)	ovary(1)	11											688.0	686.0	687.0					11																	1017773		2198	4294	6492	1007773	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5028C>T	11.37:g.1017773G>A			1007773	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1	SNP	38	Baylor																																																																																				0.557	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		Silent
MYO3B	140469	hgsc.bcm.edu	37	2	171056682	171056682	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:171056682C>G	ENST00000408978.4	+	3	352	c.209C>G	c.(208-210)gCa>gGa	p.A70G	MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000409044.3_Missense_Mutation_p.A70G|MYO3B_ENST00000334231.6_Missense_Mutation_p.A79G	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	70	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)	p.A70G(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GAAATTGAGGCAGAATACAAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											108.0	107.0	108.0					2																	171056682		1867	4109	5976	170764928	SO:0001583	missense	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.209C>G	2.37:g.171056682C>G	ENSP00000386213:p.Ala70Gly		170764928	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290173	0.80914	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	L	0.35414	1.06	0.80722	D	1	D;D;D;D	0.62365	0.991;0.974;0.991;0.988	D;P;P;D	0.65684	0.937;0.908;0.798;0.932	T	0.74688	-0.3581	10	0.51188	T	0.08	.	19.8125	0.96553	0.0:1.0:0.0:0.0	.	70;70;70;70	Q8WXR4-5;B7ZM71;Q8WXR4-4;Q8WXR4	.;.;.;MYO3B_HUMAN	G	70;70;69;79;79	ENSP00000386497:A70G;ENSP00000386213:A70G;ENSP00000446237:A79G;ENSP00000335100:A79G	ENSP00000314213:A69G	A	+	2	0	MYO3B	170764928	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.745000	0.94114	0.655000	0.94253	GCA		0.393	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			Missense_Mutation
MYO5A	4644	hgsc.bcm.edu	37	15	52606344	52606344	+	Silent	SNP	A	A	G			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr15:52606344A>G	ENST00000399231.3	-	40	5634	c.5391T>C	c.(5389-5391)tcT>tcC	p.S1797S	MYO5A_ENST00000399233.2_Silent_p.S1794S|MYO5A_ENST00000358212.6_Silent_p.S1822S|MYO5A_ENST00000553916.1_Silent_p.S1795S|MYO5A_ENST00000356338.6_Silent_p.S1770S	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1797	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.S1797S(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGAACGACACAGAGACTCTTT	0.328																																																1	Substitution - coding silent(1)	ovary(1)	15											93.0	86.0	88.0					15																	52606344		1817	4077	5894	50393636	SO:0001819	synonymous_variant	4644				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.5391T>C	15.37:g.52606344A>G			50393636	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	37	CCDS42037.1	SNP	7	Baylor																																																																																				0.328	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259		Silent
KAT6A	7994	hgsc.bcm.edu	37	8	41801475	41801475	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr8:41801475T>G	ENST00000396930.3	-	14	2562	c.2019A>C	c.(2017-2019)gaA>gaC	p.E673D	KAT6A_ENST00000406337.1_Missense_Mutation_p.E673D|KAT6A_ENST00000265713.2_Missense_Mutation_p.E673D|KAT6A_ENST00000485568.1_Missense_Mutation_p.E673D	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	673	Catalytic.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E673D(1)									CTGCTTGGCCTTCACGCTTTG	0.398																																																1	Substitution - Missense(1)	ovary(1)	8											89.0	76.0	80.0					8																	41801475		2203	4300	6503	41920632	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2019A>C	8.37:g.41801475T>G	ENSP00000380136:p.Glu673Asp		41920632	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444511	0.43429	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721;ENST00000485568	T;T;T;D	0.87966	-0.31;-0.31;-0.31;-2.32	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.93380	0.7889	M	0.89658	3.05	0.58432	D	0.999997	P;D	0.54207	0.817;0.965	P;D	0.66196	0.889;0.942	D	0.93963	0.7242	10	0.87932	D	0	-24.869	8.3892	0.32518	0.0:0.1484:0.0:0.8516	.	673;673	A5PLL3;Q92794	.;KAT6A_HUMAN	D	673;673;673;253;673	ENSP00000265713:E673D;ENSP00000385888:E673D;ENSP00000380136:E673D;ENSP00000430606:E673D	ENSP00000265713:E673D	E	-	3	2	KAT6A	41920632	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.613000	0.24299	2.279000	0.76181	0.533000	0.62120	GAA		0.398	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		Missense_Mutation
NCK2	8440	hgsc.bcm.edu	37	2	106471535	106471535	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:106471535A>T	ENST00000233154.4	+	3	458	c.16A>T	c.(16-18)Att>Ttt	p.I6F	AC009505.2_ENST00000598281.1_RNA|AC009505.2_ENST00000596418.1_RNA|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000393349.2_Missense_Mutation_p.I6F|NCK2_ENST00000451463.2_Missense_Mutation_p.I6F|NCK2_ENST00000522586.1_Missense_Mutation_p.I6F	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	6	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)	p.I6F(1)		endometrium(1)|lung(3)|ovary(1)	5						AGAAGAAGTTATTGTGATAGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	83.0	83.0					2																	106471535		2203	4300	6503	105837967	SO:0001583	missense	8440			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.16A>T	2.37:g.106471535A>T	ENSP00000233154:p.Ile6Phe		105837967	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	ENST00000233154.4	37	CCDS33266.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.01	3.280021	0.59758	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	5.84	5.84	0.93424	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.16300	0.0392	N	0.03268	-0.37	0.80722	D	1	B;B	0.16396	0.002;0.017	B;B	0.14578	0.002;0.011	T	0.11036	-1.0604	10	0.25106	T	0.35	.	16.2141	0.82191	1.0:0.0:0.0:0.0	.	6;6	E7ERP6;O43639	.;NCK2_HUMAN	F	6	ENSP00000233154:I6F;ENSP00000410428:I6F;ENSP00000377017:I6F;ENSP00000431109:I6F;ENSP00000408040:I6F;ENSP00000377018:I6F	ENSP00000233154:I6F	I	+	1	0	NCK2	105837967	1.000000	0.71417	0.788000	0.31933	0.996000	0.88848	8.922000	0.92789	2.230000	0.72887	0.528000	0.53228	ATT		0.507	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581		Missense_Mutation
NDRG1	10397	hgsc.bcm.edu	37	8	134296506	134296506	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr8:134296506C>A	ENST00000414097.2	-	2	916	c.49G>T	c.(49-51)Gtg>Ttg	p.V17L	NDRG1_ENST00000537882.1_5'UTR|NDRG1_ENST00000323851.7_Missense_Mutation_p.V17L|NDRG1_ENST00000518176.1_Splice_Site|NDRG1_ENST00000522476.1_Intron|NDRG1_ENST00000354944.5_Missense_Mutation_p.V17L|NDRG1_ENST00000518066.1_Intron	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	17					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)	p.V17L(1)	NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCTTTCTCCACCAAAGGCTTC	0.542			T	ERG	prostate																																		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	1	Substitution - Missense(1)	ovary(1)	8											240.0	172.0	195.0					8																	134296506		2203	4300	6503	134365688	SO:0001583	missense	10397			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.49G>T	8.37:g.134296506C>A	ENSP00000404854:p.Val17Leu		134365688	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	SNP	18	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.41|19.41	3.822292|3.822292	0.71028|0.71028	.|.	.|.	ENSG00000104419|ENSG00000104419	ENST00000518176|ENST00000323851;ENST00000537144;ENST00000354944;ENST00000414097;ENST00000520230;ENST00000519228;ENST00000519580;ENST00000522890;ENST00000520943;ENST00000521544;ENST00000522738	.|T;T;T;T;T;T;T;T;T;T	.|0.16073	.|2.65;2.77;2.65;2.54;2.6;2.57;2.57;2.55;2.57;2.37	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	.|0.146267	.|0.50627	.|D	.|0.000118	.|T	.|0.08935	.|0.0221	N|N	0.13043|0.13043	0.29|0.29	0.80722|0.80722	D|D	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.06405	.|0.002	.|T	.|0.07731	.|-1.0757	.|10	.|0.02654	.|T	.|1	.|-37.4411	13.4226|13.4226	0.61007|0.61007	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|17	.|Q92597	.|NDRG1_HUMAN	.|L	-1|17;17;17;17;34;17;17;17;28;17;71	.|ENSP00000319977:V17L;ENSP00000347028:V17L;ENSP00000404854:V17L;ENSP00000428345:V34L;ENSP00000429994:V17L;ENSP00000429272:V17L;ENSP00000428384:V17L;ENSP00000429840:V28L;ENSP00000429524:V17L;ENSP00000428991:V71L	.|ENSP00000319977:V17L	.|V	-|-	.|1	.|0	NDRG1|NDRG1	134365688|134365688	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.701000|3.701000	0.54793|0.54793	2.539000|2.539000	0.85634|0.85634	0.555000|0.555000	0.69702|0.69702	.|GTG		0.542	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378805.1			Missense_Mutation
OR2B11	127623	hgsc.bcm.edu	37	1	247615262	247615262	+	Missense_Mutation	SNP	A	A	G	rs35305980|rs397733455	byFrequency	TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:247615262A>G	ENST00000318749.6	-	1	46	c.23T>C	c.(22-24)tTc>tCc	p.F8S		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GTCCCCTAAGAAGCTATGGTT	0.473																																																0			1											74.0	72.0	73.0					1																	247615262		2167	4183	6350	245681885	SO:0001583	missense	127623				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.23T>C	1.37:g.247615262A>G	ENSP00000325682:p.Phe8Ser		245681885	B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	CCDS31090.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.336	-0.953364	0.02285	.	.	ENSG00000177535	ENST00000318749	T	0.36157	1.27	4.81	-0.489	0.12052	.	1.437710	0.04272	N	0.342190	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15178	-1.0446	10	0.20519	T	0.43	.	4.2883	0.10865	0.4326:0.3673:0.2001:0.0	.	8	Q5JQS5	OR2BB_HUMAN	S	8	ENSP00000325682:F8S	ENSP00000325682:F8S	F	-	2	0	OR2B11	245681885	.	.	0.000000	0.03702	0.071000	0.16799	.	.	-0.162000	0.10964	0.445000	0.29226	TTC		0.473	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		Missense_Mutation
OR9Q1	219956	hgsc.bcm.edu	37	11	57947605	57947605	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr11:57947605C>T	ENST00000335397.3	+	3	1005	c.689C>T	c.(688-690)gCt>gTt	p.A230V		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A230V(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				GGGATCCCTGCTGGAAGCCAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											237.0	185.0	203.0					11																	57947605		2201	4296	6497	57704181	SO:0001583	missense	219956			AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.689C>T	11.37:g.57947605C>T	ENSP00000334934:p.Ala230Val		57704181	Q2TAN3|Q96RA7	Missense_Mutation	SNP	ENST00000335397.3	37	CCDS31543.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.448	0.450824	0.12223	.	.	ENSG00000186509	ENST00000335397	T	0.00198	8.57	4.77	2.9	0.33743	GPCR, rhodopsin-like superfamily (1);	0.139437	0.32935	N	0.005473	T	0.00144	0.0004	N	0.17764	0.52	0.09310	N	1	B	0.19817	0.039	B	0.25987	0.065	T	0.32402	-0.9908	10	0.87932	D	0	-4.2786	7.5583	0.27837	0.0:0.7069:0.1365:0.1566	.	230	Q8NGQ5	OR9Q1_HUMAN	V	230	ENSP00000334934:A230V	ENSP00000334934:A230V	A	+	2	0	OR9Q1	57704181	0.000000	0.05858	0.011000	0.14972	0.031000	0.12232	0.023000	0.13533	0.740000	0.32651	0.484000	0.47621	GCT		0.498	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212		Missense_Mutation
OSMR	9180	hgsc.bcm.edu	37	5	38881711	38881711	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr5:38881711C>G	ENST00000274276.3	+	4	665	c.263C>G	c.(262-264)aCt>aGt	p.T88S	OSMR_ENST00000502536.1_Missense_Mutation_p.T88S	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	88					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.T88S(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TACAGCACCACTGTGAAGTGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											121.0	110.0	114.0					5																	38881711		2203	4300	6503	38917468	SO:0001583	missense	9180			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.263C>G	5.37:g.38881711C>G	ENSP00000274276:p.Thr88Ser		38917468	Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053807	0.55218	.	.	ENSG00000145623	ENST00000502536;ENST00000274276	T;T	0.64618	-0.11;-0.11	5.81	3.08	0.35506	.	1.057210	0.07219	N	0.860514	T	0.70833	0.3269	M	0.70275	2.135	0.22050	N	0.9994	D;P	0.63046	0.992;0.787	P;P	0.55545	0.778;0.526	T	0.52983	-0.8502	10	0.33940	T	0.23	.	7.1461	0.25583	0.0:0.7333:0.0:0.2666	.	88;88	Q99650;Q99650-2	OSMR_HUMAN;.	S	88	ENSP00000422023:T88S;ENSP00000274276:T88S	ENSP00000274276:T88S	T	+	2	0	OSMR	38917468	0.002000	0.14202	0.942000	0.38095	0.432000	0.31715	0.283000	0.18846	0.805000	0.34159	0.655000	0.94253	ACT		0.433	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		Missense_Mutation
PAOX	196743	hgsc.bcm.edu	37	10	135197635	135197639	+	Frame_Shift_Del	DEL	CGCCC	CGCCC	-	rs200606164		TCGA-13-0714-01	TCGA-13-0714-10	CGCCC	CGCCC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr10:135197635_135197639delCGCCC	ENST00000278060.5	+	4	1123_1127	c.1040_1044delCGCCC	c.(1039-1044)tcgcccfs	p.SP347fs	PAOX_ENST00000357296.3_Frame_Shift_Del_p.SP347fs|PAOX_ENST00000480071.2_Intron|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000368539.4_3'UTR	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	485					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GAGGACACGTCGCCCCTGGAGGATG	0.571																																																0			10																																								135047629	SO:0001589	frameshift_variant	196743			BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.1040_1044delCGCCC	10.37:g.135197635_135197639delCGCCC	ENSP00000278060:p.Ser347fs		135047625	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Frame_Shift_Del	DEL	ENST00000278060.5	37	CCDS7683.1	DEL	31	Baylor																																																																																				0.571	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911		Frame_Shift_Del
PAX3	5077	hgsc.bcm.edu	37	2	223096882	223096882	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:223096882C>T	ENST00000350526.4	-	5	843	c.707G>A	c.(706-708)cGt>cAt	p.R236H	PAX3_ENST00000392069.2_Missense_Mutation_p.R236H|PAX3_ENST00000392070.2_Missense_Mutation_p.R236H|PAX3_ENST00000344493.4_Missense_Mutation_p.R236H|PAX3_ENST00000336840.6_Missense_Mutation_p.R236H|PAX3_ENST00000409551.3_Missense_Mutation_p.R235H	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	236					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R236H(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCAAAAGCACGCTCCAGTTC	0.512			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																																Dom	yes		2	2q35	5077	paired box gene 3	yes	M	1	Substitution - Missense(1)	ovary(1)	2											159.0	156.0	157.0					2																	223096882		2203	4300	6503	222805126	SO:0001583	missense	5077				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.707G>A	2.37:g.223096882C>T	ENSP00000343052:p.Arg236His		222805126	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766099	0.90020	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551	D;D;D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02;-4.02;-4.02	5.37	5.37	0.77165	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.84773	2.715	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.932;0.999;0.987;0.969;0.982	D	0.99267	1.0892	10	0.87932	D	0	.	19.1177	0.93348	0.0:1.0:0.0:0.0	.	236;235;236;236;236	P23760;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.	H	236;236;236;236;236;235	ENSP00000375921:R236H;ENSP00000342092:R236H;ENSP00000343052:R236H;ENSP00000375922:R236H;ENSP00000338767:R236H;ENSP00000386750:R235H	ENSP00000338767:R236H	R	-	2	0	PAX3	222805126	1.000000	0.71417	0.760000	0.31359	0.961000	0.63080	6.089000	0.71384	2.510000	0.84645	0.557000	0.71058	CGT		0.512	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			Missense_Mutation
PC	5091	hgsc.bcm.edu	37	11	66639505	66639505	+	Silent	SNP	C	C	G			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr11:66639505C>G	ENST00000393958.2	-	3	219	c.126G>C	c.(124-126)gtG>gtC	p.V42V	PC_ENST00000524491.1_Silent_p.V2V|PC_ENST00000393955.2_Silent_p.V42V|PC_ENST00000355677.3_Silent_p.V42V|PC_ENST00000393960.1_Silent_p.V42V	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	42	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)	p.V42V(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CTCTGTTGGCCACCATGACTT	0.657																																																1	Substitution - coding silent(1)	ovary(1)	11											26.0	20.0	22.0					11																	66639505		2175	4268	6443	66396081	SO:0001819	synonymous_variant	5091			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.126G>C	11.37:g.66639505C>G			66396081	B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	CCDS8152.1	SNP	21	Baylor																																																																																				0.657	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716		Silent
PIGM	93183	hgsc.bcm.edu	37	1	160000819	160000819	+	Silent	SNP	C	C	A			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:160000819C>A	ENST00000368090.2	-	1	964	c.711G>T	c.(709-711)acG>acT	p.T237T		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	237					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.T237T(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGGCAAAAAACGTGAGTCCAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	1											105.0	108.0	107.0					1																	160000819		2203	4300	6503	158267443	SO:0001819	synonymous_variant	93183			AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.711G>T	1.37:g.160000819C>A			158267443		Silent	SNP	ENST00000368090.2	37	CCDS1192.1	SNP	19	Baylor																																																																																				0.473	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	NM_145167		Silent
PPP1R3A	5506	hgsc.bcm.edu	37	7	113517843	113517843	+	Missense_Mutation	SNP	C	C	T	rs201451205		TCGA-13-0714-01	TCGA-13-0714-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr7:113517843C>T	ENST00000284601.3	-	4	3372	c.3304G>A	c.(3304-3306)Gtt>Att	p.V1102I		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1102					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.V1102I(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AATGACAAAACGTAGAATGTC	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		19558	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7											87.0	88.0	88.0					7																	113517843		2203	4299	6502	113305079	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3304G>A	7.37:g.113517843C>T	ENSP00000284601:p.Val1102Ile		113305079	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	19	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	18.33	3.600409	0.66332	.	.	ENSG00000154415	ENST00000284601	T	0.16457	2.34	5.85	4.97	0.65823	.	0.363457	0.23243	N	0.050334	T	0.09598	0.0236	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.23691	-1.0181	10	0.87932	D	0	-3.8195	9.6476	0.39877	0.1023:0.2367:0.661:0.0	.	1102	Q16821	PPR3A_HUMAN	I	1102	ENSP00000284601:V1102I	ENSP00000284601:V1102I	V	-	1	0	PPP1R3A	113305079	1.000000	0.71417	0.979000	0.43373	0.898000	0.52572	1.354000	0.34056	0.825000	0.34637	-0.127000	0.14921	GTT		0.338	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Missense_Mutation
RNF113B	140432	hgsc.bcm.edu	37	13	98828795	98828795	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr13:98828795C>A	ENST00000267291.6	-	1	724	c.696G>T	c.(694-696)gaG>gaT	p.E232D	FARP1_ENST00000595437.1_Intron|FARP1_ENST00000319562.6_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000376581.5_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	232							zinc ion binding (GO:0008270)	p.E232D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			AGTAGCGACCCTCTTCAAGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	13											100.0	93.0	95.0					13																	98828795		2203	4300	6503	97626796	SO:0001583	missense	140432			AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.696G>T	13.37:g.98828795C>A	ENSP00000267291:p.Glu232Asp		97626796	Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	CCDS9486.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.846	0.525438	0.13066	.	.	ENSG00000139797	ENST00000267291	T	0.35236	1.32	1.57	1.57	0.23409	.	0.000000	0.85682	U	0.000000	T	0.24890	0.0604	L	0.46670	1.46	0.34798	D	0.736388	B	0.15719	0.014	B	0.18561	0.022	T	0.14448	-1.0472	10	0.30854	T	0.27	.	3.9617	0.09413	0.0:0.7742:0.0:0.2258	.	232	Q8IZP6	R113B_HUMAN	D	232	ENSP00000267291:E232D	ENSP00000267291:E232D	E	-	3	2	RNF113B	97626796	1.000000	0.71417	0.998000	0.56505	0.288000	0.27193	0.924000	0.28777	1.176000	0.42840	0.591000	0.81541	GAG		0.527	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3	NM_178861		Missense_Mutation
RSPH10B2	728194	hgsc.bcm.edu	37	7	6829286	6829286	+	Missense_Mutation	SNP	G	G	A	rs200987050		TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr7:6829286G>A	ENST00000403107.1	+	17	2422	c.2035G>A	c.(2035-2037)Gcg>Acg	p.A679T	RSPH10B2_ENST00000404077.1_Missense_Mutation_p.A679T|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.A679T|RSPH10B2_ENST00000359718.3_3'UTR|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.A679T			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	679								p.A679T(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GAGTCCCAGCGCGGTCATGAG	0.493																																																2	Substitution - Missense(2)	ovary(2)	7											0.0	1.0	1.0					7																	6829286		0	3	3	6795811	SO:0001583	missense	728194				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2035G>A	7.37:g.6829286G>A	ENSP00000384766:p.Ala679Thr		6795811	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	SNP	38	Baylor	86	0.039377289377289376	9	0.018292682926829267	30	0.08287292817679558	6	0.01048951048951049	41	0.05408970976253298	G	5.800	0.331926	0.10956	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859;ENST00000540958	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	2.71	1.8	0.24995	.	3.732080	0.01230	N	0.008334	T	0.03011	0.0089	L	0.47716	1.5	0.09310	N	1	B;B	0.32731	0.037;0.382	B;B	0.23018	0.002;0.043	T	0.03514	-1.1029	10	0.26408	T	0.33	.	5.3278	0.15917	0.1737:0.0:0.8263:0.0	.	538;679	B3KSE9;B2RC85	.;R10B2_HUMAN	T	679;679;679;679;538	ENSP00000384766:A679T;ENSP00000386102:A679T;ENSP00000297186:A679T;ENSP00000416710:A679T	ENSP00000297186:A679T	A	+	1	0	RSPH10B2	6795811	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	0.617000	0.24359	0.468000	0.27243	0.186000	0.17326	GCG		0.493	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697		Missense_Mutation
SCCPDH	51097	hgsc.bcm.edu	37	1	246890202	246890202	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:246890202A>G	ENST00000366510.3	+	2	575	c.199A>G	c.(199-201)Aca>Gca	p.T67A		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	67						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.T67A(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		AGGAAGACCAACACTGTCATC	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											134.0	121.0	125.0					1																	246890202		2203	4300	6503	244956825	SO:0001583	missense	51097				CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.199A>G	1.37:g.246890202A>G	ENSP00000355467:p.Thr67Ala		244956825	Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	CCDS31084.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.463	1.093668	0.20471	.	.	ENSG00000143653	ENST00000366510	T	0.40756	1.02	5.95	4.81	0.61882	.	0.220253	0.48767	D	0.000177	T	0.16896	0.0406	N	0.10733	0.035	0.23386	N	0.997786	B	0.06786	0.001	B	0.09377	0.004	T	0.24368	-1.0162	10	0.09084	T	0.74	.	3.0813	0.06262	0.6346:0.1483:0.0751:0.1419	.	67	Q8NBX0	SCPDL_HUMAN	A	67	ENSP00000355467:T67A	ENSP00000355467:T67A	T	+	1	0	SCCPDH	244956825	0.998000	0.40836	0.962000	0.40283	0.889000	0.51656	2.163000	0.42377	1.040000	0.40099	0.533000	0.62120	ACA		0.373	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002		Missense_Mutation
SCN4A	6329	hgsc.bcm.edu	37	17	62034608	62034608	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr17:62034608C>T	ENST00000435607.1	-	13	2366	c.2290G>A	c.(2290-2292)Gag>Aag	p.E764K	SCN4A_ENST00000578147.1_Missense_Mutation_p.E764K	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	764					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E764K(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACATGGTCTCGATCCACTCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											76.0	77.0	77.0					17																	62034608		2203	4300	6503	59388340	SO:0001583	missense	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2290G>A	17.37:g.62034608C>T	ENSP00000396320:p.Glu764Lys		59388340	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.129851	0.94473	.	.	ENSG00000007314	ENST00000435607	D	0.97430	-4.38	3.91	3.91	0.45181	Ion transport (1);	0.103452	0.64402	D	0.000004	D	0.98422	0.9475	M	0.86864	2.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.76071	0.987	D	0.99282	1.0896	10	0.87932	D	0	.	15.018	0.71600	0.0:1.0:0.0:0.0	.	764	P35499	SCN4A_HUMAN	K	764	ENSP00000396320:E764K	ENSP00000396320:E764K	E	-	1	0	SCN4A	59388340	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.180000	0.69256	0.561000	0.74099	GAG		0.582	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		Missense_Mutation
SEMA4F	10505	hgsc.bcm.edu	37	2	74900821	74900821	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:74900821G>C	ENST00000357877.2	+	7	837	c.688G>C	c.(688-690)Gcc>Ccc	p.A230P	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	230	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.A230P(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CTTTGTCGCAGCCGTGGCCTT	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											63.0	62.0	63.0					2																	74900821		2203	4300	6503	74754329	SO:0001583	missense	10505			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.688G>C	2.37:g.74900821G>C	ENSP00000350547:p.Ala230Pro		74754329	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018287	0.75275	.	.	ENSG00000135622	ENST00000357877	T	0.15603	2.41	4.79	4.79	0.61399	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.082508	0.50627	D	0.000101	T	0.43456	0.1248	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.44862	-0.9300	10	0.87932	D	0	.	13.6891	0.62535	0.0:0.0:1.0:0.0	.	230	O95754	SEM4F_HUMAN	P	230	ENSP00000350547:A230P	ENSP00000350547:A230P	A	+	1	0	SEMA4F	74754329	0.993000	0.37304	0.872000	0.34217	0.967000	0.64934	4.689000	0.61723	2.371000	0.80710	0.462000	0.41574	GCC		0.572	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263		Missense_Mutation
SLC16A13	201232	hgsc.bcm.edu	37	17	6941624	6941624	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0714-01	TCGA-13-0714-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr17:6941624A>T	ENST00000308027.6	+	3	805	c.497A>T	c.(496-498)tAc>tTc	p.Y166F		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	166						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.Y166F(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						CTCAGCCACTACGCCTGGAGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	17											49.0	53.0	52.0					17																	6941624		2203	4300	6503	6882348	SO:0001583	missense	201232			BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.497A>T	17.37:g.6941624A>T	ENSP00000309751:p.Tyr166Phe		6882348	A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	ENST00000308027.6	37	CCDS11085.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.563	1.118932	0.20877	.	.	ENSG00000174327	ENST00000308027	T	0.29655	1.56	5.74	3.49	0.39957	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.20700	0.0498	L	0.35723	1.085	0.50467	D	0.999871	B	0.24768	0.111	B	0.33042	0.157	T	0.06267	-1.0836	10	0.06625	T	0.88	.	6.2037	0.20590	0.7786:0.0:0.0786:0.1428	.	166	Q7RTY0	MOT13_HUMAN	F	166	ENSP00000309751:Y166F	ENSP00000309751:Y166F	Y	+	2	0	SLC16A13	6882348	1.000000	0.71417	0.982000	0.44146	0.658000	0.38924	4.753000	0.62183	0.421000	0.25980	0.460000	0.39030	TAC		0.662	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2			Missense_Mutation
SLC34A1	6569	hgsc.bcm.edu	37	5	176815137	176815137	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr5:176815137G>A	ENST00000324417.5	+	7	878	c.787G>A	c.(787-789)Gct>Act	p.A263T	SLC34A1_ENST00000512593.1_Missense_Mutation_p.A263T	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	263					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.A263T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCGTGATGCTCCTGACCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											77.0	66.0	70.0					5																	176815137		2203	4300	6503	176747743	SO:0001583	missense	6569			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.787G>A	5.37:g.176815137G>A	ENSP00000321424:p.Ala263Thr		176747743	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	CCDS4418.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897231	0.33535	.	.	ENSG00000131183	ENST00000512593;ENST00000324417	T;T	0.51325	0.71;1.27	5.05	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.49795	0.1578	M	0.73598	2.24	0.47037	D	0.999296	B	0.12013	0.005	B	0.17433	0.018	T	0.51608	-0.8684	10	0.56958	D	0.05	-22.1023	13.6673	0.62403	0.0753:0.0:0.9247:0.0	.	263	Q06495	NPT2A_HUMAN	T	263	ENSP00000423022:A263T;ENSP00000321424:A263T	ENSP00000321424:A263T	A	+	1	0	SLC34A1	176747743	1.000000	0.71417	0.769000	0.31535	0.095000	0.18619	7.876000	0.87215	1.151000	0.42436	-0.254000	0.11334	GCT		0.602	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		Missense_Mutation
SMAD1	4086	hgsc.bcm.edu	37	4	146478948	146478948	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr4:146478948G>C	ENST00000515385.1	+	7	1802	c.1260G>C	c.(1258-1260)tgG>tgC	p.W420C	SMAD1_ENST00000394092.2_Missense_Mutation_p.W420C|SMAD1_ENST00000302085.4_Missense_Mutation_p.W420C			Q15797	SMAD1_HUMAN	SMAD family member 1	420	L3 loop. {ECO:0000269|PubMed:11779505}.|MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle cell proliferation (GO:0060038)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|embryonic pattern specification (GO:0009880)|gamete generation (GO:0007276)|hindbrain development (GO:0030902)|homeostatic process (GO:0042592)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|mesodermal cell fate commitment (GO:0001710)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|osteoblast fate commitment (GO:0002051)|positive regulation of cartilage development (GO:0061036)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of gene expression (GO:0010628)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|primary miRNA processing (GO:0031053)|protein phosphorylation (GO:0006468)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|signal transduction (GO:0007165)|SMAD protein complex assembly (GO:0007183)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)	p.W420C(1)		endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	17	all_hematologic(180;0.151)					CCTAGGGCTGGGGAGCAGAAT	0.438											OREG0016348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(182;1287 2092 10326 35158 50562)											1	Substitution - Missense(1)	ovary(1)	4											121.0	126.0	125.0					4																	146478948		2203	4300	6503	146698398	SO:0001583	missense	4086			U59423	CCDS3765.1	4q31.21	2013-10-22	2006-11-06	2004-05-26	ENSG00000170365	ENSG00000170365		"""SMADs"""	6767	protein-coding gene	gene with protein product		601595	"""MAD, mothers against decapentaplegic homolog 1 (Drosophila)"", ""SMAD, mothers against DPP homolog 1 (Drosophila)"""	MADH1		8653785, 8673135	Standard	NM_005900		Approved	MADR1, JV4-1	uc003ikc.3	Q15797	OTTHUMG00000161592	ENST00000515385.1:c.1260G>C	4.37:g.146478948G>C	ENSP00000426568:p.Trp420Cys	1702	146698398	A8KAJ0|D3DNZ9|Q16636|Q9UFT8	Missense_Mutation	SNP	ENST00000515385.1	37	CCDS3765.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562101	0.65538	.	.	ENSG00000170365	ENST00000302085;ENST00000394092;ENST00000515385	D;D;D	0.99113	-5.44;-5.44;-5.44	5.49	5.49	0.81192	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99612	0.9859	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97782	1.0233	10	0.87932	D	0	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	420	Q15797	SMAD1_HUMAN	C	420	ENSP00000305769:W420C;ENSP00000377652:W420C;ENSP00000426568:W420C	ENSP00000305769:W420C	W	+	3	0	SMAD1	146698398	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.735000	0.93741	0.591000	0.81541	TGG		0.438	SMAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365467.1	NM_005900		Missense_Mutation
STAB2	55576	hgsc.bcm.edu	37	12	104089335	104089335	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr12:104089335T>A	ENST00000388887.2	+	32	3587	c.3383T>A	c.(3382-3384)gTc>gAc	p.V1128D		NM_017564.9	NP_060034.9			stabilin 2									p.V1128D(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CAGGTGCTGGTCCCACAAAGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	12											147.0	144.0	145.0					12																	104089335		2203	4300	6503	102613465	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3383T>A	12.37:g.104089335T>A	ENSP00000373539:p.Val1128Asp		102613465		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.19	1.565569	0.27915	.	.	ENSG00000136011	ENST00000388887	D	0.91295	-2.82	6.17	6.17	0.99709	FAS1 domain (4);Growth factor, receptor (1);	0.978988	0.08375	N	0.955446	D	0.88403	0.6427	L	0.42744	1.35	0.26108	N	0.980729	P	0.42941	0.794	B	0.43413	0.419	T	0.79037	-0.1967	10	0.34782	T	0.22	.	8.5498	0.33444	0.0:0.1784:0.0:0.8216	.	1128	Q8WWQ8	STAB2_HUMAN	D	1128	ENSP00000373539:V1128D	ENSP00000373539:V1128D	V	+	2	0	STAB2	102613465	0.302000	0.24454	0.838000	0.33150	0.169000	0.22640	1.775000	0.38584	2.371000	0.80710	0.533000	0.62120	GTC		0.468	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			Missense_Mutation
STARD6	147323	hgsc.bcm.edu	37	18	51863579	51863583	+	Frame_Shift_Del	DEL	TAGTT	TAGTT	-	rs200318360		TCGA-13-0714-01	TCGA-13-0714-10	TAGTT	TAGTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr18:51863579_51863583delTAGTT	ENST00000581310.1	-	6	552_556	c.179_183delAACTA	c.(178-183)aaactafs	p.KL60fs	STARD6_ENST00000307844.3_Frame_Shift_Del_p.KL60fs|STARD6_ENST00000580990.2_5'UTR			P59095	STAR6_HUMAN	StAR-related lipid transfer (START) domain containing 6	60	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)	p.K60fs*2(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)	8				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)		GGAAATCAGATAGTTTAGCTGGTGA	0.312																																																1	Deletion - Frameshift(1)	ovary(1)	18																																								50117581	SO:0001589	frameshift_variant	147323			AF480305	CCDS11955.1	18q21.2	2011-09-12	2007-08-16		ENSG00000174448	ENSG00000174448		"""StAR-related lipid transfer (START) domain containing"""	18066	protein-coding gene	gene with protein product		607051	"""START domain containing 6"""			12011452	Standard	NM_139171		Approved		uc010xdt.2	P59095	OTTHUMG00000132702	ENST00000581310.1:c.179_183delAACTA	18.37:g.51863579_51863583delTAGTT	ENSP00000462349:p.Lys60fs		50117577		Frame_Shift_Del	DEL	ENST00000581310.1	37	CCDS11955.1	DEL	49	Baylor																																																																																				0.312	STARD6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256000.3	NM_139171		Frame_Shift_Del
Unknown	0	hgsc.bcm.edu	37	10	0	0	+	IGR	TNP	GNA	GNA	CNT			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Invalid:failed_liftOver	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr10:0_0GNA>CNT								None (None upstream) : TUBB8 (92827 downstream)																							NNNNNNNNNN	0.0																																																0			10																																								133889027	SO:0001628	intergenic_variant	282974																															10.37:g.0GNA>CNT			133889025		Missense	Complex_substitution		37		Complex_substitution	48	Baylor																																																																																			0	0.000									Missense
TBC1D4	9882	hgsc.bcm.edu	37	13	75936198	75936198	+	Silent	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr13:75936198G>A	ENST00000377636.3	-	2	1390	c.1044C>T	c.(1042-1044)ccC>ccT	p.P348P	TBC1D4_ENST00000431480.2_Silent_p.P348P|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Silent_p.P348P	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	348	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CCGAGTCCGAGGGCTGGACGT	0.622																																																0			13											84.0	91.0	89.0					13																	75936198		2148	4255	6403	74834199	SO:0001819	synonymous_variant	9882			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1044C>T	13.37:g.75936198G>A			74834199	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	ENST00000377636.3	37	CCDS41901.1	SNP	35	Baylor																																																																																				0.622	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		Silent
THSD7B	80731	hgsc.bcm.edu	37	2	137852472	137852472	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr2:137852472C>T	ENST00000409968.1	+	4	1158	c.980C>T	c.(979-981)aCt>aTt	p.T327I	THSD7B_ENST00000543459.1_Missense_Mutation_p.T186I|THSD7B_ENST00000272643.3_Missense_Mutation_p.T327I|THSD7B_ENST00000413152.2_Missense_Mutation_p.T296I			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	327						integral component of membrane (GO:0016021)		p.T327I(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TTCCCATTGACTGTTCAGTCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	133.0	131.0					2																	137852472		1888	4101	5989	137568942	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.980C>T	2.37:g.137852472C>T	ENSP00000387145:p.Thr327Ile		137568942		Missense_Mutation	SNP	ENST00000409968.1	37		SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530196	0.64860	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.26067	2.28;2.16;1.77;1.76	5.42	5.42	0.78866	.	0.149265	0.64402	D	0.000012	T	0.35038	0.0918	M	0.66939	2.045	0.47949	D	0.99955	P;P	0.45672	0.864;0.864	P;P	0.46885	0.53;0.53	T	0.04664	-1.0935	10	0.36615	T	0.2	.	13.7402	0.62842	0.154:0.846:0.0:0.0	.	327;296	Q9C0I4;C9JKN6	THS7B_HUMAN;.	I	327;327;296;186	ENSP00000387145:T327I;ENSP00000272643:T327I;ENSP00000413841:T296I;ENSP00000443370:T186I	ENSP00000272643:T327I	T	+	2	0	THSD7B	137568942	0.998000	0.40836	1.000000	0.80357	0.910000	0.53928	3.604000	0.54081	2.547000	0.85894	0.655000	0.94253	ACT		0.468	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		Missense_Mutation
TIMELESS	8914	hgsc.bcm.edu	37	12	56817161	56817161	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr12:56817161T>C	ENST00000553532.1	-	18	2339	c.2189A>G	c.(2188-2190)cAc>cGc	p.H730R	TIMELESS_ENST00000554616.1_Intron|TIMELESS_ENST00000229201.4_Missense_Mutation_p.H729R					timeless circadian clock									p.H730R(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GGCCAGCCGGTGCAGCATCTT	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											146.0	131.0	136.0					12																	56817161		2203	4300	6503	55103428	SO:0001583	missense	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2189A>G	12.37:g.56817161T>C	ENSP00000450607:p.His730Arg		55103428		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634429	0.87660	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.12465	2.68;2.68	5.61	5.61	0.85477	Timeless C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.36853	0.0982	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04621	-1.0938	10	0.44086	T	0.13	-23.2738	15.0896	0.72183	0.0:0.0:0.0:1.0	.	730	Q9UNS1	TIM_HUMAN	R	729;730	ENSP00000229201:H729R;ENSP00000450607:H730R	ENSP00000229201:H730R	H	-	2	0	TIMELESS	55103428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.656000	0.83736	2.271000	0.75665	0.459000	0.35465	CAC		0.507	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578550	7578550	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr17:7578550G>A	ENST00000269305.4	-	5	569	c.380C>T	c.(379-381)tCc>tTc	p.S127F	TP53_ENST00000359597.4_Missense_Mutation_p.S127F|TP53_ENST00000413465.2_Missense_Mutation_p.S127F|TP53_ENST00000445888.2_Missense_Mutation_p.S127F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.S127F|TP53_ENST00000420246.2_Missense_Mutation_p.S127F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	127	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in a sporadic cancer; somatic mutation).|S -> F (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S127F(23)|p.0?(8)|p.S127Y(8)|p.S127C(7)|p.Y126_K132delYSPALNK(6)|p.A129fs*20(3)|p.Y126_N131delYSPALN(3)|p.S34C(2)|p.P128fs*42(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.P128fs*18(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.P13fs*18(1)|p.?(1)|p.S34F(1)|p.A36fs*20(1)|p.S127fs*42(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGGGCAGGGGAGTACTGTAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	73	Substitution - Missense(41)|Deletion - In frame(10)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(4)|Unknown(1)	lung(13)|ovary(8)|upper_aerodigestive_tract(7)|large_intestine(6)|central_nervous_system(6)|skin(5)|NS(4)|prostate(4)|bone(4)|urinary_tract(3)|breast(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|oesophagus(2)|biliary_tract(1)|pancreas(1)	17											44.0	44.0	44.0					17																	7578550		2203	4300	6503	7519275	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.380C>T	17.37:g.7578550G>A	ENSP00000269305:p.Ser127Phe		7519275	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338648	0.81911	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99940	-8.4;-8.4;-8.4;-8.4;-8.4;-8.4;-8.4;-8.4;-8.4	5.48	4.51	0.55191	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99933	0.9970	M	0.91038	3.17	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.95614	0.8675	10	0.87932	D	0	-30.2503	12.2742	0.54724	0.0828:0.0:0.9172:0.0	.	88;127;127;34;127;127;127	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	127;127;127;127;127;127;116;34;34;127;127	ENSP00000410739:S127F;ENSP00000352610:S127F;ENSP00000269305:S127F;ENSP00000398846:S127F;ENSP00000391127:S127F;ENSP00000391478:S127F;ENSP00000423862:S34F;ENSP00000424104:S127F;ENSP00000426252:S127F	ENSP00000269305:S127F	S	-	2	0	TP53	7519275	1.000000	0.71417	0.890000	0.34922	0.931000	0.56810	9.763000	0.98947	1.448000	0.47680	0.655000	0.94253	TCC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
XPO6	23214	hgsc.bcm.edu	37	16	28118939	28118939	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0714-01	TCGA-13-0714-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr16:28118939C>G	ENST00000304658.5	-	18	2901	c.2401G>C	c.(2401-2403)Ggg>Cgg	p.G801R	XPO6_ENST00000565698.1_Missense_Mutation_p.G787R	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	801					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)	p.G801R(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GTGGACTCCCCCGAGATATTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	16											95.0	96.0	95.0					16																	28118939		1868	4115	5983	28026440	SO:0001583	missense	23214			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.2401G>C	16.37:g.28118939C>G	ENSP00000302790:p.Gly801Arg		28026440	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536988	0.85812	.	.	ENSG00000169180	ENST00000304658	T	0.66099	-0.19	5.62	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.053492	0.85682	D	0.000000	T	0.66607	0.2806	L	0.59436	1.845	0.80722	D	1	P;D	0.53619	0.893;0.961	B;P	0.52758	0.383;0.708	T	0.63440	-0.6637	10	0.20519	T	0.43	-18.5048	13.7191	0.62717	0.1552:0.8448:0.0:0.0	.	801;801	B7ZM10;Q96QU8	.;XPO6_HUMAN	R	801	ENSP00000302790:G801R	ENSP00000302790:G801R	G	-	1	0	XPO6	28026440	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.735000	0.62051	1.361000	0.45981	0.655000	0.94253	GGG		0.488	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195		Missense_Mutation
ZBTB40	9923	hgsc.bcm.edu	37	1	22838463	22838463	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:22838463T>A	ENST00000375647.4	+	11	2504	c.2297T>A	c.(2296-2298)gTg>gAg	p.V766E	ZBTB40_ENST00000374651.4_Missense_Mutation_p.V654E|ZBTB40_ENST00000404138.1_Missense_Mutation_p.V766E	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	766					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V766E(1)		endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AGCAAACAGGTGCAGTGTAAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	73.0	73.0					1																	22838463		2203	4300	6503	22711050	SO:0001583	missense	9923			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2297T>A	1.37:g.22838463T>A	ENSP00000364798:p.Val766Glu		22711050	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.75	3.210393	0.58343	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.28895	1.59;1.59;1.59	5.73	3.37	0.38596	Zinc finger, C2H2-like (1);	0.442338	0.19333	N	0.116846	T	0.23649	0.0572	L	0.45137	1.4	0.31533	N	0.66091	P;B	0.35272	0.493;0.361	B;B	0.29942	0.109;0.081	T	0.17018	-1.0383	10	0.56958	D	0.05	-9.4074	9.504	0.39035	0.0:0.1466:0.0:0.8534	.	654;766	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	E	766;766;654	ENSP00000384527:V766E;ENSP00000364798:V766E;ENSP00000363782:V654E	ENSP00000363782:V654E	V	+	2	0	ZBTB40	22711050	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.235000	0.43044	0.413000	0.25759	0.533000	0.62120	GTG		0.537	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870		Missense_Mutation
ZCCHC11	23318	hgsc.bcm.edu	37	1	52941000	52941000	+	Missense_Mutation	SNP	T	T	C	rs201809575	byFrequency	TCGA-13-0714-01	TCGA-13-0714-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr1:52941000T>C	ENST00000371544.3	-	13	2493	c.2231A>G	c.(2230-2232)aAt>aGt	p.N744S	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.N744S|ZCCHC11_ENST00000371541.1_5'UTR	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	744					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.N744S(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						AATACAACCATTGGTTGCCAT	0.388													T|||	2	0.000399361	0.0	0.0029	5008	,	,		20826	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						T	SER/ASN,SER/ASN	0,4406		0,0,2203	167.0	167.0	167.0		2231,2231	-0.4	0.0	1		167	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ZCCHC11	NM_001009881.2,NM_015269.2	46,46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	744/1646,744/1645	52941000	1,13005	2203	4300	6503	52713588	SO:0001583	missense	23318			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.2231A>G	1.37:g.52941000T>C	ENSP00000360599:p.Asn744Ser		52713588	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	37	CCDS30716.1	SNP	52	Baylor	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	T	0.170	-1.072256	0.01918	0.0	1.16E-4	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.46819	0.86;0.87;0.89;0.87	5.37	-0.42	0.12336	.	0.523696	0.22766	N	0.055884	T	0.15825	0.0381	N	0.12746	0.255	0.09310	N	0.99999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.24870	-1.0148	10	0.06099	T	0.92	.	10.498	0.44789	0.0:0.3173:0.0:0.6827	.	503;744	E9PKX1;Q5TAX3	.;TUT4_HUMAN	S	744;744;673;503	ENSP00000257177:N744S;ENSP00000360599:N744S;ENSP00000433486:N673S;ENSP00000435256:N503S	ENSP00000257177:N744S	N	-	2	0	ZCCHC11	52713588	0.150000	0.22732	0.022000	0.16811	0.002000	0.02628	0.256000	0.18351	0.007000	0.14760	0.455000	0.32223	AAT		0.388	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		Missense_Mutation
ZMYM2	7750	hgsc.bcm.edu	37	13	20638635	20638635	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0714-01	TCGA-13-0714-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0714-01	TCGA-13-0714-10	g.chr13:20638635G>A	ENST00000382874.2	+	20	3272	c.3082G>A	c.(3082-3084)Gtt>Att	p.V1028I	ZMYM2_ENST00000382871.2_Missense_Mutation_p.V1028I|ZMYM2_ENST00000382869.3_Missense_Mutation_p.V1028I	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1028					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.V1026I(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		ATTACCACCTGTTTTTGGCGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											120.0	110.0	113.0					13																	20638635		1822	4087	5909	19536635	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3082G>A	13.37:g.20638635G>A	ENSP00000372327:p.Val1028Ile		19536635	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455595	0.84209	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.18657	2.2	5.52	5.52	0.82312	.	0.107103	0.64402	D	0.000006	T	0.23926	0.0579	N	0.21373	0.66	0.80722	D	1	P	0.49961	0.93	P	0.48627	0.584	T	0.00740	-1.1586	10	0.39692	T	0.17	-17.314	19.8024	0.96513	0.0:0.0:1.0:0.0	.	1028	Q9UBW7	ZMYM2_HUMAN	I	1028;1028;1026;1026;406	ENSP00000372322:V1028I	ENSP00000372322:V1028I	V	+	1	0	ZMYM2	19536635	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.103000	0.77014	2.752000	0.94435	0.655000	0.94253	GTT		0.338	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453		Missense_Mutation
