#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DIP2C	22982	genome.wustl.edu	37	10	468810	468810	+	Silent	SNP	G	G	A	rs566293462	byFrequency	TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr10:468810G>A	ENST00000280886.6	-	5	645	c.558C>T	c.(556-558)agC>agT	p.S186S	DIP2C_ENST00000381496.3_Silent_p.S79S	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	186						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S186S(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GGGCAGCCCCGCTGCCCCCGC	0.622													G|||	8	0.00159744	0.0	0.0	5008	,	,		17099	0.0		0.0	False		,,,				2504	0.0082															1	Substitution - coding silent(1)	ovary(1)	10											75.0	80.0	78.0					10																	468810		2203	4300	6503	458810	SO:0001819	synonymous_variant	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.558C>T	10.37:g.468810G>A			458810	B4DPI5|Q5SS78	Silent	SNP	ENST00000280886.6	37	CCDS7054.1	SNP	38	WashU																																																																																				0.622	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974		Silent
FAM86A	196483	genome.wustl.edu	37	16	5140488	5140488	+	Missense_Mutation	SNP	C	C	T	rs200021489	byFrequency	TCGA-13-0723-01	TCGA-13-0723-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr16:5140488C>T	ENST00000427587.4	-	5	489	c.421G>A	c.(421-423)Gcc>Acc	p.A141T	FAM86A_ENST00000458008.4_Missense_Mutation_p.A107T|FAM86A_ENST00000587133.1_Missense_Mutation_p.A80T	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	141						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TAGAGGGCGGCGTCCCATGTG	0.642																																																0			16											90.0	88.0	89.0					16																	5140488		2197	4300	6497	5080489	SO:0001583	missense	196483			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.421G>A	16.37:g.5140488C>T	ENSP00000398502:p.Ala141Thr		5080489	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	CCDS10529.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	c	20.2	3.953061	0.73902	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.14266	2.52;2.52	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	H	0.97077	3.935	0.80722	D	1	D;D	0.67145	0.996;0.987	P;P	0.60886	0.88;0.78	T	0.66101	-0.6007	10	0.72032	D	0.01	.	15.221	0.73310	0.0:1.0:0.0:0.0	.	107;141	Q96G04-2;Q96G04	.;FA86A_HUMAN	T	107;141	ENSP00000389710:A107T;ENSP00000398502:A141T	ENSP00000398502:A141T	A	-	1	0	FAM86A	5080489	1.000000	0.71417	0.506000	0.27664	0.137000	0.21094	6.686000	0.74548	2.620000	0.88729	0.450000	0.29827	GCC		0.642	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400		Missense_Mutation
ASGR2	433	genome.wustl.edu	37	17	7005424	7005424	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr17:7005424T>C	ENST00000380952.2	-	8	1019	c.755A>G	c.(754-756)tAt>tGt	p.Y252C	ASGR2_ENST00000254850.7_Missense_Mutation_p.Y228C|ASGR2_ENST00000355035.5_Missense_Mutation_p.Y252C|ASGR2_ENST00000446679.2_Missense_Mutation_p.Y233C	NM_001181.4|NM_001201352.1|NM_080912.3	NP_001172|NP_001188281.1|NP_550434	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2	252	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				bone mineralization (GO:0030282)|cell surface receptor signaling pathway (GO:0007166)|glycoprotein metabolic process (GO:0009100)|lipid homeostasis (GO:0055088)|receptor-mediated endocytosis (GO:0006898)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)	p.Y252C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|skin(3)|stomach(4)	18					Antihemophilic Factor(DB00025)	GTTGTGCCTATAGTCTGTGCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											347.0	327.0	334.0					17																	7005424		2203	4300	6503	6946148	SO:0001583	missense	433			M11025	CCDS11088.1, CCDS32544.1, CCDS45598.1	17p	2011-08-30			ENSG00000161944	ENSG00000161944		"""C-type lectin domain containing"""	743	protein-coding gene	gene with protein product		108361				3863106	Standard	NM_080912		Approved	CLEC4H2	uc002ger.3	P07307	OTTHUMG00000102158	ENST00000380952.2:c.755A>G	17.37:g.7005424T>C	ENSP00000370339:p.Tyr252Cys		6946148	A6NLV8|A8MT12|D3DTM9|D3DTN0|O00448|Q03969	Missense_Mutation	SNP	ENST00000380952.2	37	CCDS32544.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	14.52	2.559845	0.45590	.	.	ENSG00000161944	ENST00000355035;ENST00000254850;ENST00000380952;ENST00000446679	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	4.41	4.41	0.53225	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.40222	N	0.001146	T	0.44074	0.1276	M	0.86805	2.84	0.09310	N	1	D;D;D;D;D	0.89917	0.996;1.0;0.999;0.999;1.0	D;D;D;D;D	0.79108	0.917;0.992;0.982;0.979;0.992	T	0.36720	-0.9736	10	0.87932	D	0	.	10.3776	0.44092	0.0:0.0:0.0:1.0	.	228;252;247;233;252	P07307-3;P07307;Q7Z4G9;P07307-2;D3DTN0	.;ASGR2_HUMAN;.;.;.	C	252;228;252;233	ENSP00000347140:Y252C;ENSP00000254850:Y228C;ENSP00000370339:Y252C;ENSP00000405844:Y233C	ENSP00000254850:Y228C	Y	-	2	0	ASGR2	6946148	0.960000	0.32886	0.024000	0.17045	0.072000	0.16883	3.965000	0.56788	2.222000	0.72286	0.529000	0.55759	TAT		0.498	ASGR2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000220003.1	NM_080914		Missense_Mutation
KLRC3	3823	genome.wustl.edu	37	12	10587934	10587934	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:10587934A>G	ENST00000539033.1	-	2	277	c.263T>C	c.(262-264)tTa>tCa	p.L88S	KLRC2_ENST00000536833.2_Missense_Mutation_p.L29S|KLRC2_ENST00000381901.1_Missense_Mutation_p.L88S|KLRC2_ENST00000381902.2_Missense_Mutation_p.L88S																							TATTGTTTTTAACACAGTGGC	0.408																																																0			12											78.0	95.0	89.0					12																	10587934		2201	4290	6491	10479201	SO:0001583	missense	3822																														ENST00000539033.1:c.263T>C	12.37:g.10587934A>G	ENSP00000437563:p.Leu88Ser		10479201		Missense_Mutation	SNP	ENST00000539033.1	37		SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	11.36	1.614576	0.28712	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901;ENST00000536833	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	2.99	0.636	0.17729	C-type lectin fold (1);	1.269400	0.05545	N	0.566504	T	0.13970	0.0338	L	0.59436	1.845	0.09310	N	1	B;B;P	0.40553	0.446;0.241;0.721	B;B;B	0.42030	0.15;0.266;0.373	T	0.30794	-0.9966	10	0.87932	D	0	.	4.2976	0.10910	0.6763:0.0:0.3237:0.0	.	74;88;88	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	S	88;88;88;29	ENSP00000437563:L88S;ENSP00000371327:L88S;ENSP00000371326:L88S;ENSP00000444754:L29S	ENSP00000371326:L88S	L	-	2	0	KLRC2;RP11-277P12.6	10479201	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.621000	0.24418	0.351000	0.24027	0.414000	0.27820	TTA		0.408	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1			Missense_Mutation
PDE3A	5139	genome.wustl.edu	37	12	20803391	20803391	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:20803391G>T	ENST00000359062.3	+	14	2822	c.2782G>T	c.(2782-2784)Gtt>Ttt	p.V928F	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	928	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.V928F(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AAATGATGATGTTGGAATAGA	0.299																																																1	Substitution - Missense(1)	ovary(1)	12											138.0	136.0	137.0					12																	20803391		2203	4300	6503	20694658	SO:0001583	missense	5139				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2782G>T	12.37:g.20803391G>T	ENSP00000351957:p.Val928Phe		20694658	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	17.33	3.363008	0.61403	.	.	ENSG00000172572	ENST00000359062	T	0.81247	-1.47	5.78	5.78	0.91487	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.543564	0.18655	N	0.134884	D	0.83101	0.5181	N	0.20685	0.6	0.23070	N	0.998346	D	0.71674	0.998	D	0.65874	0.939	T	0.76334	-0.2997	10	0.38643	T	0.18	.	20.0203	0.97492	0.0:0.0:1.0:0.0	.	928	Q14432	PDE3A_HUMAN	F	928	ENSP00000351957:V928F	ENSP00000351957:V928F	V	+	1	0	PDE3A	20694658	0.461000	0.25783	0.973000	0.42090	0.957000	0.61999	3.546000	0.53656	2.730000	0.93505	0.655000	0.94253	GTT		0.299	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			Missense_Mutation
CABIN1	23523	genome.wustl.edu	37	22	24530285	24530285	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr22:24530285G>A	ENST00000398319.2	+	29	5034	c.4649G>A	c.(4648-4650)cGc>cAc	p.R1550H	CABIN1_ENST00000405822.2_Missense_Mutation_p.R1471H|CABIN1_ENST00000263119.5_Missense_Mutation_p.R1550H	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1550					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.R1550H(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CAGTGGGCCCGCGACGTGTTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	22											55.0	48.0	50.0					22																	24530285		2203	4300	6503	22860285	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4649G>A	22.37:g.24530285G>A	ENSP00000381364:p.Arg1550His		22860285	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.085707	0.94100	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.70164	-0.12;-0.46;-0.12	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.82287	-0.0532	10	0.72032	D	0.01	.	16.2606	0.82541	0.0:0.0:1.0:0.0	.	1471;1550	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	H	1550;1471;1550	ENSP00000263119:R1550H;ENSP00000384694:R1471H;ENSP00000381364:R1550H	ENSP00000263119:R1550H	R	+	2	0	CABIN1	22860285	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.457000	0.97630	2.522000	0.85027	0.460000	0.39030	CGC		0.592	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295		Missense_Mutation
HIST1H2BC	8347	genome.wustl.edu	37	6	26124115	26124115	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr6:26124115C>A	ENST00000314332.5	-	1	23	c.18G>T	c.(16-18)aaG>aaT	p.K6N	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.K6N|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2AC_ENST00000377791.2_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	6					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K6N(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						CGGGAGCAGACTTGGCTGGCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	86.0	86.0					6																	26124115		2203	4300	6503	26232094	SO:0001583	missense	8347			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.18G>T	6.37:g.26124115C>A	ENSP00000321744:p.Lys6Asn		26232094	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	37	CCDS4584.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	.	16.32	3.091168	0.55968	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.19669	2.13;2.13	5.76	-0.484	0.12071	Histone-fold (2);	.	.	.	.	T	0.05502	0.0145	.	.	.	0.29303	N	0.86853	B	0.02656	0.0	B	0.01281	0.0	T	0.38023	-0.9680	8	0.87932	D	0	.	7.0603	0.25121	0.0:0.5492:0.1126:0.3382	.	6	P62807	H2B1C_HUMAN	N	6	ENSP00000321744:K6N;ENSP00000380180:K6N	ENSP00000321744:K6N	K	-	3	2	HIST1H2BC	26232094	0.010000	0.17322	0.988000	0.46212	0.860000	0.49131	-0.947000	0.03901	0.150000	0.19136	0.650000	0.86243	AAG		0.507	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526		Missense_Mutation
PRSS16	10279	genome.wustl.edu	37	6	27216899	27216899	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr6:27216899C>T	ENST00000230582.3	+	4	373	c.358C>T	c.(358-360)Cca>Tca	p.P120S	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	120					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.P120S(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						AGCCTTGGCCCCAGCCTGGGG	0.582																																					NSCLC(178;1118 2105 17078 23587 44429)											1	Substitution - Missense(1)	ovary(1)	6											53.0	58.0	57.0					6																	27216899		2203	4300	6503	27324878	SO:0001583	missense	10279			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.358C>T	6.37:g.27216899C>T	ENSP00000230582:p.Pro120Ser		27324878	O75416	Missense_Mutation	SNP	ENST00000230582.3	37	CCDS4623.1	SNP	22	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.53|14.53	2.563224|2.563224	0.45694|0.45694	.|.	.|.	ENSG00000112812|ENSG00000112812	ENST00000485993;ENST00000475106|ENST00000230582;ENST00000343467;ENST00000348953	.|T	.|0.20200	.|2.09	4.04|4.04	4.04|4.04	0.47022|0.47022	.|.	0.519246|0.519246	0.19397|0.19397	N|N	0.115276|0.115276	T|T	0.25195|0.25195	0.0612|0.0612	L|L	0.53561|0.53561	1.675|1.675	0.32971|0.32971	D|D	0.522397|0.522397	.|D;D;P	.|0.59767	.|0.972;0.986;0.877	.|P;P;B	.|0.61328	.|0.85;0.887;0.372	T|T	0.01549|0.01549	-1.1327|-1.1327	6|10	.|0.35671	.|T	.|0.21	-20.1907|-20.1907	14.0762|14.0762	0.64891|0.64891	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|11;120;120	.|Q7Z5N6;C9JI59;Q9NQE7	.|.;.;TSSP_HUMAN	L|S	11|120	.|ENSP00000230582:P120S	.|ENSP00000230582:P120S	P|P	+|+	2|1	0|0	PRSS16|PRSS16	27324878|27324878	0.733000|0.733000	0.28132|0.28132	0.995000|0.995000	0.50966|0.50966	0.064000|0.064000	0.16182|0.16182	1.336000|1.336000	0.33850|0.33850	2.249000|2.249000	0.74217|0.74217	0.557000|0.557000	0.71058|0.71058	CCC|CCA		0.582	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2			Missense_Mutation
KRT18P36	442406	genome.wustl.edu	37	9	30800374	30800374	+	IGR	SNP	T	T	C			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr9:30800374T>C								AL590726.1 (26057 upstream) : RP11-271O3.1 (571234 downstream)																							GTAATGGCTCTAGTCTCTGAC	0.512																																																0			9																																								30790374	SO:0001628	intergenic_variant																																9.37:g.30800374T>C			30790374		Splice_Site_SNP	SNP		37		SNP	53	WashU																																																																																			0	0.512									Splice_Site_SNP
BPIFB3	359710	genome.wustl.edu	37	20	31659911	31659911	+	Splice_Site	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr20:31659911G>A	ENST00000375494.3	+	13	1262	c.1262G>A	c.(1261-1263)gGa>gAa	p.G421E		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	421					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.G421E(1)									CTGTTGCAGGGATCGCGTTTA	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											183.0	126.0	145.0					20																	31659911		2203	4300	6503	31123572	SO:0001630	splice_region_variant	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1261-1G>A	20.37:g.31659911G>A			31123572	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	4.974	0.180896	0.09443	.	.	ENSG00000186190	ENST00000375494	T	0.08102	3.13	4.32	-1.51	0.08664	.	0.729658	0.12172	N	0.492896	T	0.01730	0.0055	N	0.00621	-1.32	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43540	-0.9385	10	0.27785	T	0.31	-2.379	0.4444	0.00491	0.1908:0.3071:0.1685:0.3336	.	421	P59826	BPIB3_HUMAN	E	421	ENSP00000364643:G421E	ENSP00000364643:G421E	G	+	2	0	BPIFB3	31123572	0.003000	0.15002	0.058000	0.19502	0.000000	0.00434	-0.476000	0.06591	-0.130000	0.11599	-2.241000	0.00287	GGA		0.577	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	Missense_Mutation	Missense_Mutation
NEUROD6	63974	genome.wustl.edu	37	7	31377934	31377934	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr7:31377934C>T	ENST00000297142.3	-	2	1271	c.949G>A	c.(949-951)Gac>Aac	p.D317N		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	317					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.D317N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						AGATGTAAGTCGTAAGGGAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	7											82.0	80.0	81.0					7																	31377934		2203	4300	6503	31344459	SO:0001583	missense	63974			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.949G>A	7.37:g.31377934C>T	ENSP00000297142:p.Asp317Asn		31344459	Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	37	CCDS5434.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255293	0.80135	.	.	ENSG00000164600	ENST00000297142	D	0.97209	-4.29	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.96306	0.8795	M	0.78637	2.42	0.80722	D	1	P	0.46952	0.887	B	0.38378	0.272	D	0.97184	0.9853	10	0.87932	D	0	-15.0027	18.5931	0.91222	0.0:1.0:0.0:0.0	.	317	Q96NK8	NDF6_HUMAN	N	317	ENSP00000297142:D317N	ENSP00000297142:D317N	D	-	1	0	NEUROD6	31344459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.440000	0.80464	2.386000	0.81285	0.650000	0.86243	GAC		0.453	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728		Missense_Mutation
GBA2	57704	genome.wustl.edu	37	9	35740010	35740010	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr9:35740010G>A	ENST00000378103.3	-	8	1917	c.1394C>T	c.(1393-1395)cCg>cTg	p.P465L	GBA2_ENST00000378094.4_Missense_Mutation_p.P465L|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000545786.1_Missense_Mutation_p.P471L	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	465					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.P465L(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATCCAATACCGGGCTCTGCCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	9											67.0	55.0	59.0					9																	35740010		2203	4300	6503	35730010	SO:0001583	missense	57704			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1394C>T	9.37:g.35740010G>A	ENSP00000367343:p.Pro465Leu		35730010	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	25.3	4.620900	0.87460	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.6	5.6	0.85130	Six-hairpin glycosidase-like (1);	0.114916	0.64402	D	0.000013	D	0.84911	0.5577	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.944;0.998	D	0.86528	0.1820	9	0.59425	D	0.04	-13.1326	17.7697	0.88487	0.0:0.0:1.0:0.0	.	471;465;465	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	L	465;465;471	.	ENSP00000367334:P465L	P	-	2	0	GBA2	35730010	1.000000	0.71417	0.971000	0.41717	0.951000	0.60555	9.038000	0.93771	2.798000	0.96311	0.650000	0.86243	CCG		0.562	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944		Missense_Mutation
THRAP3	9967	genome.wustl.edu	37	1	36754874	36754874	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:36754874T>G	ENST00000354618.5	+	5	1478	c.1254T>G	c.(1252-1254)ttT>ttG	p.F418L	THRAP3_ENST00000469141.2_Missense_Mutation_p.F418L	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	418	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.F418L(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGATGACTTTGAGAAGAAGA	0.418			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	1	Substitution - Missense(1)	ovary(1)	1											80.0	79.0	79.0					1																	36754874		2203	4300	6503	36527461	SO:0001583	missense	9967			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1254T>G	1.37:g.36754874T>G	ENSP00000346634:p.Phe418Leu		36527461	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	10.83	1.460688	0.26248	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.15718	2.4;2.4	5.84	5.84	0.93424	.	0.069378	0.64402	D	0.000008	T	0.12987	0.0315	L	0.31926	0.97	0.38009	D	0.934466	B	0.29136	0.234	B	0.31337	0.128	T	0.13282	-1.0515	10	0.09843	T	0.71	-12.7798	11.4	0.49864	0.0:0.0:0.151:0.849	.	418	Q9Y2W1	TR150_HUMAN	L	418	ENSP00000346634:F418L;ENSP00000433825:F418L	ENSP00000346634:F418L	F	+	3	2	THRAP3	36527461	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.494000	0.53273	2.232000	0.73038	0.533000	0.62120	TTT		0.418	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119		Missense_Mutation
FREM2	341640	genome.wustl.edu	37	13	39430279	39430279	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0723-01	TCGA-13-0723-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr13:39430279A>T	ENST00000280481.7	+	12	7158	c.6942A>T	c.(6940-6942)gaA>gaT	p.E2314D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2314	Calx-beta 5.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2314D(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGTTTAAGGAAGGGGAAACCC	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											70.0	71.0	71.0					13																	39430279		2203	4300	6503	38328279	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6942A>T	13.37:g.39430279A>T	ENSP00000280481:p.Glu2314Asp		38328279	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307342	0.60305	.	.	ENSG00000150893	ENST00000280481	T	0.29655	1.56	5.98	-2.17	0.07059	Na-Ca exchanger/integrin-beta4 (2);	0.111469	0.64402	D	0.000013	T	0.33818	0.0876	L	0.49571	1.57	0.48341	D	0.999635	P;P	0.48764	0.915;0.775	P;P	0.49999	0.628;0.524	T	0.23226	-1.0194	10	0.48119	T	0.1	.	13.9809	0.64304	0.4776:0.0:0.5224:0.0	.	2314;2314	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	D	2314	ENSP00000280481:E2314D	ENSP00000280481:E2314D	E	+	3	2	FREM2	38328279	0.767000	0.28508	0.992000	0.48379	0.923000	0.55619	-0.031000	0.12287	-0.283000	0.09115	-0.256000	0.11100	GAA		0.338	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
DSCR4	10281	genome.wustl.edu	37	21	39426984	39426984	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr21:39426984T>C	ENST00000328264.3	-	3	426	c.322A>G	c.(322-324)Agg>Ggg	p.R108G	DSCR4_ENST00000398948.1_Intron	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	108								p.R108G(1)		large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						TGCTTGTCCCTTCTCCCATCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	21											337.0	254.0	282.0					21																	39426984		2203	4300	6503	38348854	SO:0001583	missense	10281			AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.322A>G	21.37:g.39426984T>C	ENSP00000328676:p.Arg108Gly		38348854	Q4VB31	Missense_Mutation	SNP	ENST00000328264.3	37	CCDS33554.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	6.817	0.519914	0.13005	.	.	ENSG00000184029	ENST00000328264	.	.	.	3.5	-0.364	0.12553	.	.	.	.	.	T	0.27205	0.0667	.	.	.	0.09310	N	1	B	0.24576	0.106	B	0.22753	0.041	T	0.27706	-1.0066	7	0.87932	D	0	.	3.3689	0.07213	0.0:0.2303:0.2054:0.5643	.	108	P56555	DSCR4_HUMAN	G	108	.	ENSP00000328676:R108G	R	-	1	2	DSCR4	38348854	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.180000	0.09754	-0.069000	0.12931	0.460000	0.39030	AGG		0.483	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000194834.1	NM_005867		Missense_Mutation
CCNYL2	414194	genome.wustl.edu	37	10	42965595	42965595	+	RNA	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr10:42965595A>G	ENST00000483242.3	-	0	557					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)			p.V20A(1)		breast(2)|endometrium(1)|lung(3)|ovary(1)	7						AAAGGCTGAGACATTGTTGGT	0.453																																																1	Substitution - Missense(1)	ovary(1)	10																																								42285601			414194			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42965595A>G			42285601		Missense_Mutation	SNP	ENST00000483242.3	37		SNP	10	WashU																																																																																				0.453	CCNYL2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047670.5	XM_936368		Missense_Mutation
ARHGEF1	9138	genome.wustl.edu	37	19	42398330	42398330	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr19:42398330G>A	ENST00000354532.3	+	9	843	c.695G>A	c.(694-696)cGg>cAg	p.R232Q	ARHGEF1_ENST00000347545.4_Missense_Mutation_p.R199Q|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.R247Q|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.R232Q|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.R214Q	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	232	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R247Q(1)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CTTGGGGTGCGGACCAAGAGT	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											102.0	66.0	78.0					19																	42398330		2203	4299	6502	47090170	SO:0001583	missense	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.695G>A	19.37:g.42398330G>A	ENSP00000346532:p.Arg232Gln		47090170	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	ENST00000354532.3	37	CCDS12591.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606890	0.66558	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	3.95	3.95	0.45737	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.161221	0.42821	D	0.000641	T	0.76863	0.4047	L	0.52573	1.65	0.31066	N	0.713528	P;B;P;B;D	0.64830	0.604;0.313;0.489;0.363;0.994	B;B;B;B;B	0.43194	0.103;0.024;0.199;0.041;0.411	T	0.80016	-0.1559	10	0.72032	D	0.01	-22.2261	7.7148	0.28698	0.1159:0.0:0.8841:0.0	.	214;247;199;232;292	Q6NX52;Q92888-3;Q92888-2;Q92888;Q8NF33	.;.;.;ARHG1_HUMAN;.	Q	232;199;268;247;214	ENSP00000346532:R232Q;ENSP00000344429:R199Q;ENSP00000337261:R247Q;ENSP00000367394:R214Q	ENSP00000323044:R268Q	R	+	2	0	ARHGEF1	47090170	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.086000	0.41643	2.206000	0.71126	0.492000	0.49549	CGG		0.582	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002		Missense_Mutation
PPP1R21	129285	genome.wustl.edu	37	2	48687278	48687278	+	Silent	SNP	T	T	G			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr2:48687278T>G	ENST00000294952.8	+	6	742	c.585T>G	c.(583-585)ctT>ctG	p.L195L	PPP1R21_ENST00000449090.2_Silent_p.L195L|PPP1R21_ENST00000281394.4_Silent_p.L195L	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	195						membrane (GO:0016020)	phosphatase binding (GO:0019902)	p.L195L(1)		endometrium(2)|kidney(4)|lung(9)	15						AATGTCGACTTCGAACGGAAG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	2											87.0	81.0	83.0					2																	48687278		2203	4300	6503	48540782	SO:0001819	synonymous_variant	129285			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.585T>G	2.37:g.48687278T>G			48540782	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Silent	SNP	ENST00000294952.8	37	CCDS46278.1	SNP	62	WashU																																																																																				0.428	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994		Silent
AMT	275	genome.wustl.edu	37	3	49456462	49456462	+	Silent	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr3:49456462A>G	ENST00000273588.3	-	7	1121	c.819T>C	c.(817-819)taT>taC	p.Y273Y	AMT_ENST00000458307.2_Silent_p.Y229Y|AMT_ENST00000538581.1_Silent_p.Y217Y|AMT_ENST00000395338.2_Silent_p.Y273Y|AMT_ENST00000476226.1_5'UTR|AMT_ENST00000546031.1_Silent_p.Y176Y	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	273					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)	p.Y273Y(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	TGTCATTCCCATACAGGCAGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	3											64.0	63.0	63.0					3																	49456462		2203	4300	6503	49431466	SO:0001819	synonymous_variant	275			D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.819T>C	3.37:g.49456462A>G			49431466	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Silent	SNP	ENST00000273588.3	37	CCDS2797.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	7.252	0.603463	0.14002	.	.	ENSG00000145020	ENST00000427987	.	.	.	5.28	-1.39	0.08997	.	.	.	.	.	T	0.55353	0.1915	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50759	-0.8790	4	.	.	.	-11.7138	10.0805	0.42386	0.6928:0.0:0.3072:0.0	.	.	.	.	R	271	.	.	W	-	1	0	AMT	49431466	0.927000	0.31430	0.982000	0.44146	0.926000	0.56050	0.191000	0.17076	-0.228000	0.09869	-1.215000	0.01618	TGG		0.582	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481		Silent
KRT72	140807	genome.wustl.edu	37	12	52981485	52981485	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:52981485C>T	ENST00000537672.2	-	7	1250	c.1240G>A	c.(1240-1242)Gtg>Atg	p.V414M	KRT72_ENST00000354310.4_Missense_Mutation_p.V372M|KRT72_ENST00000293745.2_Missense_Mutation_p.V414M|KRT72_ENST00000398066.3_Missense_Mutation_p.V226M	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	414	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.V414M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		TTCAGGCTCACGAGCTCCTGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	12											116.0	106.0	109.0					12																	52981485		2203	4300	6503	51267752	SO:0001583	missense	140807			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1240G>A	12.37:g.52981485C>T	ENSP00000441160:p.Val414Met		51267752	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	2.780	-0.253734	0.05829	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	4.92	-4.68	0.03309	Filament (1);	0.571235	0.16550	N	0.209542	T	0.31358	0.0794	N	0.00003	-3.475	0.20764	N	0.999854	B;B	0.06786	0.001;0.001	B;B	0.08055	0.0;0.003	T	0.65389	-0.6180	10	0.02654	T	1	.	4.1478	0.10224	0.1866:0.0619:0.3968:0.3547	.	372;414	B4DEI8;Q14CN4	.;K2C72_HUMAN	M	414;414;372;226	ENSP00000441160:V414M;ENSP00000293745:V414M;ENSP00000346269:V372M;ENSP00000446151:V226M	ENSP00000293745:V414M	V	-	1	0	KRT72	51267752	0.000000	0.05858	0.003000	0.11579	0.994000	0.84299	-0.257000	0.08745	-0.937000	0.03719	-0.295000	0.09555	GTG		0.652	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747		Missense_Mutation
EHD2	30846	genome.wustl.edu	37	19	48244158	48244158	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr19:48244158C>G	ENST00000263277.3	+	6	1352	c.1101C>G	c.(1099-1101)gaC>gaG	p.D367E	EHD2_ENST00000540884.1_3'UTR|EHD2_ENST00000538399.1_Missense_Mutation_p.D231E	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	367					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.D367E(1)		endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		TGGCGCACGACTTCACCAAGT	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											36.0	30.0	32.0					19																	48244158		2203	4300	6503	52935970	SO:0001583	missense	30846			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.1101C>G	19.37:g.48244158C>G	ENSP00000263277:p.Asp367Glu		52935970	B2RDH9|B4DNU6|Q96CB6	Missense_Mutation	SNP	ENST00000263277.3	37	CCDS12704.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765825	0.69878	.	.	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364;ENST00000538399;ENST00000454483;ENST00000540884	T;T	0.26660	2.05;1.72	3.99	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.36248	0.0960	M	0.84156	2.68	0.58432	D	0.999995	P	0.51791	0.948	P	0.46885	0.53	T	0.44298	-0.9337	10	0.66056	D	0.02	-40.8872	10.2318	0.43260	0.0:0.8903:0.0:0.1097	.	367	Q9NZN4	EHD2_HUMAN	E	367;367;357;231;50;50	ENSP00000263277:D367E;ENSP00000439036:D231E	ENSP00000263277:D367E	D	+	3	2	EHD2	52935970	0.997000	0.39634	1.000000	0.80357	0.951000	0.60555	0.533000	0.23082	1.930000	0.55929	0.561000	0.74099	GAC		0.622	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1			Missense_Mutation
GLI1	2735	genome.wustl.edu	37	12	57864433	57864433	+	Missense_Mutation	SNP	G	G	A	rs538595523		TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:57864433G>A	ENST00000228682.2	+	12	2001	c.1910G>A	c.(1909-1911)cGg>cAg	p.R637Q	GLI1_ENST00000546141.1_Missense_Mutation_p.R596Q|GLI1_ENST00000543426.1_Missense_Mutation_p.R509Q	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	637					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.R637Q(2)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GGGGTCACCCGGAGGGCCAGT	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		17217	0.0		0.001	False		,,,				2504	0.0				Pancreas(157;841 1936 10503 41495 50368)											2	Substitution - Missense(2)	ovary(1)|endometrium(1)	12											38.0	39.0	39.0					12																	57864433		2203	4300	6503	56150700	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1910G>A	12.37:g.57864433G>A	ENSP00000228682:p.Arg637Gln		56150700	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012751	0.75161	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.56275	0.47;0.53;0.51;0.51	4.39	4.39	0.52855	.	0.000000	0.41823	D	0.000808	T	0.68174	0.2972	M	0.67569	2.06	0.53005	D	0.999967	D	0.89917	1.0	P	0.62382	0.901	T	0.73065	-0.4100	10	0.87932	D	0	.	16.266	0.82579	0.0:0.0:1.0:0.0	.	637	P08151	GLI1_HUMAN	Q	509;637;596;596	ENSP00000437607:R509Q;ENSP00000228682:R637Q;ENSP00000441006:R596Q;ENSP00000434408:R596Q	ENSP00000228682:R637Q	R	+	2	0	GLI1	56150700	0.993000	0.37304	1.000000	0.80357	0.975000	0.68041	6.230000	0.72301	2.436000	0.82500	0.491000	0.48974	CGG		0.617	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		Missense_Mutation
USP1	7398	genome.wustl.edu	37	1	62916019	62916019	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:62916019C>G	ENST00000339950.4	+	9	2540	c.1725C>G	c.(1723-1725)agC>agG	p.S575R	USP1_ENST00000371146.1_Missense_Mutation_p.S575R	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	575	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S575R(1)		breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		CTAACGACAGCTATGGATTAT	0.393																																					Ovarian(122;1846 2315 3982 19504)											1	Substitution - Missense(1)	ovary(1)	1											147.0	129.0	135.0					1																	62916019		2203	4300	6503	62688607	SO:0001583	missense	7398				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1725C>G	1.37:g.62916019C>G	ENSP00000343526:p.Ser575Arg		62688607	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	CCDS621.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	8.235	0.805614	0.16467	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.29917	1.55;1.55	5.65	5.65	0.86999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.463283	0.28171	N	0.016327	T	0.16128	0.0388	N	0.05554	-0.025	0.42561	D	0.993147	B	0.14438	0.01	B	0.15052	0.012	T	0.14448	-1.0472	10	0.15952	T	0.53	-5.1204	13.1248	0.59349	0.0:0.9278:0.0:0.0721	.	575	O94782	UBP1_HUMAN	R	575	ENSP00000360188:S575R;ENSP00000343526:S575R	ENSP00000343526:S575R	S	+	3	2	USP1	62688607	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.846000	0.48262	2.941000	0.99782	0.655000	0.94253	AGC		0.393	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415		Missense_Mutation
FRMD4B	23150	genome.wustl.edu	37	3	69230516	69230516	+	Silent	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr3:69230516C>T	ENST00000398540.3	-	21	2468	c.2385G>A	c.(2383-2385)aaG>aaA	p.K795K	FRMD4B_ENST00000478263.1_Silent_p.K447K|FRMD4B_ENST00000542259.1_Silent_p.K741K	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	795					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)		p.K741K(1)		NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		GCTCCTGACTCTTTGAGTAAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	3											76.0	74.0	75.0					3																	69230516		1930	4132	6062	69313206	SO:0001819	synonymous_variant	23150			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2385G>A	3.37:g.69230516C>T			69313206	Q8TAI3	Silent	SNP	ENST00000398540.3	37	CCDS46863.1	SNP	32	WashU																																																																																				0.438	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1			Silent
NFATC1	4772	genome.wustl.edu	37	18	77193581	77193581	+	Missense_Mutation	SNP	C	C	T	rs201990048		TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr18:77193581C>T	ENST00000427363.2	+	3	1229	c.1229C>T	c.(1228-1230)cCg>cTg	p.P410L	NFATC1_ENST00000586434.1_Missense_Mutation_p.P397L|NFATC1_ENST00000592223.1_Missense_Mutation_p.P397L|NFATC1_ENST00000397790.2_5'UTR|NFATC1_ENST00000587635.1_Missense_Mutation_p.P410L|NFATC1_ENST00000542384.1_Missense_Mutation_p.P410L|NFATC1_ENST00000591814.1_Missense_Mutation_p.P410L|NFATC1_ENST00000545796.1_5'UTR|NFATC1_ENST00000253506.5_Missense_Mutation_p.P410L|NFATC1_ENST00000329101.4_Missense_Mutation_p.P397L|NFATC1_ENST00000318065.5_Missense_Mutation_p.P397L			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	410	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P397L(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	CCTTCCAGCCCGACCCTGCCC	0.667																																					GBM(151;1210 2593 28719 45011)											1	Substitution - Missense(1)	ovary(1)	18											80.0	84.0	82.0					18																	77193581		2203	4300	6503	75294569	SO:0001583	missense	4772			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1229C>T	18.37:g.77193581C>T	ENSP00000389377:p.Pro410Leu		75294569	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	ENST00000427363.2	37		SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909603	0.33721	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000542384;ENST00000329101;ENST00000427363;ENST00000397794	T;T;T	0.14266	2.92;2.52;2.72	4.6	4.6	0.57074	Rel homology (1);	0.111065	0.64402	D	0.000007	T	0.11367	0.0277	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B;B;B	0.31859	0.311;0.311;0.049;0.181;0.181;0.343;0.049	B;B;B;B;B;B;B	0.18871	0.015;0.015;0.016;0.018;0.018;0.023;0.016	T	0.08310	-1.0728	10	0.62326	D	0.03	-24.2885	17.4139	0.87494	0.0:1.0:0.0:0.0	.	397;397;410;410;410;397;410	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M4;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.;.	L	410;410;410;397;397;374	ENSP00000253506:P410L;ENSP00000442435:P410L;ENSP00000327850:P397L	ENSP00000253506:P410L	P	+	2	0	NFATC1	75294569	1.000000	0.71417	0.920000	0.36463	0.096000	0.18686	5.508000	0.67006	2.097000	0.63578	0.561000	0.74099	CCG		0.667	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390		Missense_Mutation
GPR98	84059	genome.wustl.edu	37	5	89938502	89938502	+	Silent	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr5:89938502C>T	ENST00000405460.2	+	12	2386	c.2290C>T	c.(2290-2292)Cta>Tta	p.L764L		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	764	Calx-beta 6. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.L764L(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAGCCGTGACCTAATTATTTT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	5											110.0	113.0	112.0					5																	89938502		1798	4069	5867	89974258	SO:0001819	synonymous_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2290C>T	5.37:g.89938502C>T			89974258	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	9.127	1.010418	0.19277	.	.	ENSG00000164199	ENST00000504142	.	.	.	5.09	-0.561	0.11785	.	.	.	.	.	T	0.50514	0.1620	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40156	-0.9578	4	.	.	.	.	5.42	0.16396	0.1814:0.5068:0.0:0.3118	.	.	.	.	L	352	.	.	P	+	2	0	GPR98	89974258	0.999000	0.42202	0.989000	0.46669	0.907000	0.53573	1.057000	0.30492	0.125000	0.18397	0.460000	0.39030	CCT		0.403	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Silent
MRPL42	28977	genome.wustl.edu	37	12	93881354	93881354	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:93881354G>T	ENST00000549982.1	+	5	462	c.301G>T	c.(301-303)Gaa>Taa	p.E101*	MRPL42_ENST00000547098.1_Nonsense_Mutation_p.E101*|MRPL42_ENST00000361630.2_Nonsense_Mutation_p.E101*|MRPL42_ENST00000548545.1_Nonsense_Mutation_p.E101*|MRPL42_ENST00000552217.1_Nonsense_Mutation_p.E101*|MRPL42_ENST00000393128.4_Nonsense_Mutation_p.E101*	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	101					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.E101*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						AGAAAAAGTTGAACACCTTGA	0.383																																																1	Substitution - Nonsense(1)	ovary(1)	12											140.0	127.0	131.0					12																	93881354		2203	4300	6503	92405485	SO:0001587	stop_gained	28977			AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.301G>T	12.37:g.93881354G>T	ENSP00000449884:p.Glu101*		92405485	Q6FID1|Q96Q48|Q9P0S1	Nonsense_Mutation	SNP	ENST00000549982.1	37	CCDS9045.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	8.796	0.931728	0.18131	.	.	ENSG00000198015	ENST00000549982;ENST00000361630;ENST00000552217;ENST00000393128	.	.	.	4.84	1.3	0.21679	.	1.372640	0.04681	N	0.412341	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3081	4.7694	0.13148	0.3108:0.4311:0.2581:0.0	.	.	.	.	X	101	.	ENSP00000355202:E101X	E	+	1	0	MRPL42	92405485	0.853000	0.29707	0.001000	0.08648	0.007000	0.05969	1.683000	0.37638	0.509000	0.28195	0.591000	0.81541	GAA		0.383	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407715.1	NM_014050		Nonsense_Mutation
TDRD7	23424	genome.wustl.edu	37	9	100237743	100237743	+	Nonsense_Mutation	SNP	C	C	T	rs375523180		TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr9:100237743C>T	ENST00000355295.4	+	12	2453	c.2158C>T	c.(2158-2160)Cga>Tga	p.R720*	TDRD7_ENST00000422139.2_Nonsense_Mutation_p.R646*|TDRD7_ENST00000540902.1_Intron	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	720	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)	p.R720*(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				AAAATGGTTACGAGTAGAGGT	0.323																																																1	Substitution - Nonsense(1)	ovary(1)	9						C	stop/ARG	0,4406		0,0,2203	98.0	86.0	90.0		2158	4.2	1.0	9		90	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	TDRD7	NM_014290.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		720/1099	100237743	1,13005	2203	4300	6503	99277564	SO:0001587	stop_gained	23424			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2158C>T	9.37:g.100237743C>T	ENSP00000347444:p.Arg720*		99277564	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Nonsense_Mutation	SNP	ENST00000355295.4	37	CCDS6725.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	40	8.102932	0.98654	0.0	1.16E-4	ENSG00000196116	ENST00000355295;ENST00000422139	.	.	.	5.11	4.2	0.49525	.	0.056207	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9519	12.445	0.55645	0.1679:0.8321:0.0:0.0	.	.	.	.	X	720;646	.	ENSP00000347444:R720X	R	+	1	2	TDRD7	99277564	0.992000	0.36948	0.992000	0.48379	0.994000	0.84299	2.867000	0.48428	1.512000	0.48834	-0.182000	0.12963	CGA		0.323	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290		Nonsense_Mutation
GAL3ST4	79690	genome.wustl.edu	37	7	99757778	99757778	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr7:99757778C>A	ENST00000360039.4	-	4	1626	c.1234G>T	c.(1234-1236)Gag>Tag	p.E412*	GAL3ST4_ENST00000413800.1_Nonsense_Mutation_p.E412*|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000426974.2_Nonsense_Mutation_p.E350*|GAL3ST4_ENST00000411994.1_3'UTR|GAL3ST4_ENST00000423751.1_3'UTR|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000457641.1_5'Flank	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	412					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.E412*(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAGAAGCCTCACCCCCTACC	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	7											72.0	71.0	71.0					7																	99757778		2203	4300	6503	99595714	SO:0001587	stop_gained	79690			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1234G>T	7.37:g.99757778C>A	ENSP00000353142:p.Glu412*		99595714	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Nonsense_Mutation	SNP	ENST00000360039.4	37	CCDS5688.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231327	0.79688	.	.	ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974	.	.	.	5.71	0.549	0.17213	.	0.529435	0.18937	U	0.127050	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-13.8055	2.481	0.04587	0.1318:0.5151:0.1282:0.225	.	.	.	.	X	412;412;350	.	ENSP00000353142:E412X	E	-	1	0	GAL3ST4	99595714	0.059000	0.20769	0.979000	0.43373	0.644000	0.38419	0.154000	0.16343	0.078000	0.16900	-0.254000	0.11334	GAG		0.592	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		Nonsense_Mutation
CBLB	868	genome.wustl.edu	37	3	105438963	105438963	+	Silent	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr3:105438963C>T	ENST00000264122.4	-	10	1656	c.1335G>A	c.(1333-1335)ccG>ccA	p.P445P	CBLB_ENST00000405772.1_Silent_p.P445P|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000403724.1_Silent_p.P445P|CBLB_ENST00000394027.3_Silent_p.P467P	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	445					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P445P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						AGTCTAGCATCGGCATGCCAA	0.463			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	1	Substitution - coding silent(1)	ovary(1)	3											117.0	99.0	105.0					3																	105438963		2203	4300	6503	106921653	SO:0001819	synonymous_variant	868			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1335G>A	3.37:g.105438963C>T			106921653	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	ENST00000264122.4	37	CCDS2948.1	SNP	31	WashU																																																																																				0.463	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662		Silent
ARHGEF7	8874	genome.wustl.edu	37	13	111938519	111938519	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr13:111938519T>G	ENST00000375741.2	+	18	2289	c.2039T>G	c.(2038-2040)aTg>aGg	p.M680R	ARHGEF7_ENST00000375736.4_Missense_Mutation_p.M502R|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.M424R|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.M587R|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.M502R|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.M502R|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.M630R|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.M502R|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.M577R|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.M659R	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	680					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.M659R(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCTAAGACCATGAAAAAGCTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	13											87.0	83.0	84.0					13																	111938519		2203	4300	6503	110736520	SO:0001583	missense	8874			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.2039T>G	13.37:g.111938519T>G	ENSP00000364893:p.Met680Arg		110736520	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	37	CCDS45068.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	20.9	4.063935	0.76187	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T	0.63255	0.57;0.56;0.56;0.62;0.56;0.63;0.63;0.66;0.52;-0.03	4.6	4.6	0.57074	.	0.046249	0.85682	D	0.000000	T	0.67011	0.2848	L	0.44542	1.39	0.80722	D	1	P;P;D;D;P;D	0.55800	0.57;0.57;0.973;0.973;0.955;0.973	B;B;P;P;P;P	0.61800	0.339;0.317;0.894;0.735;0.786;0.848	T	0.61950	-0.6957	10	0.14252	T	0.57	.	14.0037	0.64449	0.0:0.0:0.0:1.0	.	424;577;502;630;680;659	E9PDQ5;B7Z6G2;Q14155-6;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	R	659;680;630;587;657;502;502;502;577;502;424	ENSP00000325994:M659R;ENSP00000364893:M680R;ENSP00000364891:M630R;ENSP00000359657:M587R;ENSP00000218789:M502R;ENSP00000364888:M502R;ENSP00000397068:M502R;ENSP00000364889:M577R;ENSP00000364875:M502R;ENSP00000417596:M424R	ENSP00000218789:M502R	M	+	2	0	ARHGEF7	110736520	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.244000	0.78228	1.707000	0.51288	0.459000	0.35465	ATG		0.488	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511		Missense_Mutation
TBX5	6910	genome.wustl.edu	37	12	114793647	114793647	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr12:114793647T>A	ENST00000310346.4	-	9	1913	c.1247A>T	c.(1246-1248)cAg>cTg	p.Q416L	TBX5_ENST00000405440.2_Missense_Mutation_p.Q416L|TBX5_ENST00000349716.5_Missense_Mutation_p.Q366L	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	416					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q416L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GTCCATGGGCTGCACGGTGGT	0.657																																					NSCLC(152;1358 1980 4050 23898 40356)											1	Substitution - Missense(1)	ovary(1)	12											45.0	39.0	41.0					12																	114793647		2202	4300	6502	113278030	SO:0001583	missense	6910			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1247A>T	12.37:g.114793647T>A	ENSP00000309913:p.Gln416Leu		113278030	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	CCDS9173.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	20.2	3.948817	0.73787	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	T;T;T	0.48836	0.8;0.8;0.8	4.99	4.99	0.66335	.	0.059699	0.64402	D	0.000002	T	0.43523	0.1251	M	0.72894	2.215	0.80722	D	1	P	0.38922	0.651	B	0.24974	0.057	T	0.51356	-0.8716	10	0.49607	T	0.09	.	14.7159	0.69269	0.0:0.0:0.0:1.0	.	416	Q99593	TBX5_HUMAN	L	366;416;313;416	ENSP00000337723:Q366L;ENSP00000309913:Q416L;ENSP00000384152:Q416L	ENSP00000309913:Q416L	Q	-	2	0	TBX5	113278030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.625000	0.61262	1.883000	0.54544	0.533000	0.62120	CAG		0.657	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717		Missense_Mutation
CNTNAP5	129684	genome.wustl.edu	37	2	124999868	124999868	+	Silent	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr2:124999868G>A	ENST00000431078.1	+	3	643	c.279G>A	c.(277-279)acG>acA	p.T93T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	93	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T93T(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CAGTGGCCACGCAGGGAAGAT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	2											71.0	75.0	74.0					2																	124999868		2048	4200	6248	124716338	SO:0001819	synonymous_variant	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.279G>A	2.37:g.124999868G>A			124716338	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1	SNP	38	WashU																																																																																				0.522	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			Silent
UROC1	131669	genome.wustl.edu	37	3	126220718	126220718	+	Intron	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr3:126220718A>G	ENST00000290868.2	-	10	956				UROC1_ENST00000383579.3_Missense_Mutation_p.S326P	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1						cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		ACAAAGCAGGAAAGGACACAC	0.617																																																0			3											69.0	73.0	72.0					3																	126220718		1568	3582	5150	127703408	SO:0001627	intron_variant	131669			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.903-595T>C	3.37:g.126220718A>G			127703408	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	CCDS3038.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	2.680	-0.275548	0.05679	.	.	ENSG00000159650	ENST00000383579	T	0.58506	0.33	1.12	-1.63	0.08345	.	5.642740	0.00567	N	0.000282	T	0.34337	0.0894	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.09684	-1.0663	10	0.28530	T	0.3	.	4.3354	0.11083	0.5024:0.0:0.4976:0.0	.	326	E9PE13	.	P	326	ENSP00000373073:S326P	ENSP00000373073:S326P	S	-	1	0	UROC1	127703408	0.000000	0.05858	0.008000	0.14137	0.025000	0.11179	-0.759000	0.04761	-0.565000	0.06061	-0.483000	0.04790	TCC		0.617	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639		Missense_Mutation
L3MBTL3	84456	genome.wustl.edu	37	6	130413937	130413937	+	Silent	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr6:130413937A>G	ENST00000529410.1	+	19	2045	c.1566A>G	c.(1564-1566)gcA>gcG	p.A522A	L3MBTL3_ENST00000361794.2_Silent_p.A522A|L3MBTL3_ENST00000526019.1_Silent_p.A497A|L3MBTL3_ENST00000533560.1_Silent_p.A497A|L3MBTL3_ENST00000368139.2_Silent_p.A497A|L3MBTL3_ENST00000368136.2_Silent_p.A522A			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	522					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A522A(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GGATAGATGCAGATTCTCCTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	6											159.0	147.0	151.0					6																	130413937		2203	4300	6503	130455630	SO:0001819	synonymous_variant	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1566A>G	6.37:g.130413937A>G			130455630	Q4VXE1|Q5VUM9|Q6P9B5	Silent	SNP	ENST00000529410.1	37	CCDS34537.1	SNP	7	WashU																																																																																				0.398	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074		Silent
TUBBP5	643224	genome.wustl.edu	37	9	141071195	141071195	+	RNA	SNP	C	C	T	rs185655233	byFrequency	TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	T	C	T	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr9:141071195C>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.P272S(2)									TGGCTTTGCCCCACTGACCAG	0.622																																																2	Substitution - Missense(2)	endometrium(2)	9																																								140191016						AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071195C>T			140191016		Missense_Mutation	SNP	ENST00000503395.1	37		SNP	22	WashU																																																																																				0.622	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		Missense_Mutation
OR2F2	135948	genome.wustl.edu	37	7	143632549	143632549	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr7:143632549C>G	ENST00000408955.2	+	1	291	c.224C>G	c.(223-225)aCa>aGa	p.T75R		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T75R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					TCCTATGCCACAAGCGTAGTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											234.0	229.0	231.0					7																	143632549		2203	4300	6503	143263482	SO:0001583	missense	135948				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.224C>G	7.37:g.143632549C>G	ENSP00000386222:p.Thr75Arg		143263482	A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	CCDS43666.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	13.34	2.206605	0.39003	.	.	ENSG00000221910	ENST00000408955	T	0.02032	4.49	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.120635	0.37715	N	0.001965	T	0.13586	0.0329	M	0.91717	3.235	0.44685	D	0.997675	D	0.62365	0.991	P	0.61800	0.894	T	0.01834	-1.1264	10	0.87932	D	0	-14.9566	12.8566	0.57888	0.0:1.0:0.0:0.0	.	75	O95006	OR2F2_HUMAN	R	75	ENSP00000386222:T75R	ENSP00000386222:T75R	T	+	2	0	OR2F2	143263482	0.718000	0.27976	1.000000	0.80357	0.042000	0.13812	5.774000	0.68906	1.937000	0.56155	0.491000	0.48974	ACA		0.507	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			Missense_Mutation
TCHH	7062	genome.wustl.edu	37	1	152080310	152080310	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0723-01	TCGA-13-0723-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:152080310T>C	ENST00000368804.1	-	2	5382	c.5383A>G	c.(5383-5385)Aga>Gga	p.R1795G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1795	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R1795G(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGAATTTTCTGTCAGACTCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	78.0	77.0					1																	152080310		1938	4146	6084	150346934	SO:0001583	missense	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5383A>G	1.37:g.152080310T>C	ENSP00000357794:p.Arg1795Gly		150346934	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	10.66	1.411381	0.25465	.	.	ENSG00000159450	ENST00000368804	T	0.06142	3.34	4.44	3.26	0.37387	.	.	.	.	.	T	0.03095	0.0091	N	0.20574	0.59	0.09310	N	1	D	0.64830	0.994	P	0.56865	0.808	T	0.46331	-0.9199	9	0.25106	T	0.35	0.0502	9.1723	0.37089	0.0:0.0:0.184:0.816	.	1795	Q07283	TRHY_HUMAN	G	1795	ENSP00000357794:R1795G	ENSP00000357794:R1795G	R	-	1	2	TCHH	150346934	0.001000	0.12720	0.182000	0.23118	0.199000	0.23934	-0.137000	0.10389	0.533000	0.28675	0.383000	0.25322	AGA		0.607	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		Missense_Mutation
MAP3K4	4216	genome.wustl.edu	37	6	161513105	161513105	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr6:161513105A>G	ENST00000392142.4	+	13	3347	c.3199A>G	c.(3199-3201)Ata>Gta	p.I1067V	MAP3K4_ENST00000366920.2_Missense_Mutation_p.I1067V|MAP3K4_ENST00000348824.7_Missense_Mutation_p.I1067V|MAP3K4_ENST00000366919.2_Missense_Mutation_p.I1067V	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1067					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.I1067V(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGACAAATATATAAGCTTTGC	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											197.0	209.0	205.0					6																	161513105		2203	4300	6503	161433095	SO:0001583	missense	4216			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3199A>G	6.37:g.161513105A>G	ENSP00000375986:p.Ile1067Val		161433095	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	17.06	3.293208	0.60086	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71698	-0.56;-0.43;-0.53;-0.59	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.68155	0.2970	L	0.33485	1.01	0.80722	D	1	B;B;P;D	0.65815	0.342;0.032;0.948;0.995	B;B;D;D	0.72338	0.239;0.019;0.949;0.977	T	0.64863	-0.6307	10	0.16420	T	0.52	-35.5656	16.5764	0.84681	1.0:0.0:0.0:0.0	.	1067;57;1067;1067	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	V	1067	ENSP00000355886:I1067V;ENSP00000375986:I1067V;ENSP00000355887:I1067V;ENSP00000297332:I1067V	ENSP00000297332:I1067V	I	+	1	0	MAP3K4	161433095	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	8.910000	0.92685	2.371000	0.80710	0.533000	0.62120	ATA		0.373	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			Missense_Mutation
SI	6476	genome.wustl.edu	37	3	164737512	164737512	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0723-01	TCGA-13-0723-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr3:164737512G>T	ENST00000264382.3	-	28	3363	c.3301C>A	c.(3301-3303)Caa>Aaa	p.Q1101K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1101	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.Q1101K(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTCGATATTTGAATGAACTGG	0.373										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											83.0	83.0	83.0					3																	164737512		2203	4299	6502	166220206	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3301C>A	3.37:g.164737512G>T	ENSP00000264382:p.Gln1101Lys		166220206	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674693	0.47781	.	.	ENSG00000090402	ENST00000264382	D	0.82711	-1.64	4.46	4.46	0.54185	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.87795	0.6267	M	0.92970	3.365	0.58432	D	0.999991	B	0.21147	0.052	B	0.24848	0.056	D	0.87885	0.2680	10	0.59425	D	0.04	.	17.305	0.87192	0.0:0.0:1.0:0.0	.	1101	P14410	SUIS_HUMAN	K	1101	ENSP00000264382:Q1101K	ENSP00000264382:Q1101K	Q	-	1	0	SI	166220206	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	8.963000	0.93385	2.293000	0.77203	0.591000	0.81541	CAA		0.373	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
TNR	7143	genome.wustl.edu	37	1	175293628	175293628	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0723-01	TCGA-13-0723-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:175293628C>A	ENST00000367674.2	-	22	4529	c.3821G>T	c.(3820-3822)cGc>cTc	p.R1274L	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.R1274L			Q92752	TENR_HUMAN	tenascin R	1274	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.R1274L(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGAGAAAGGGCGTCCTTGATG	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											235.0	196.0	209.0					1																	175293628		2203	4300	6503	173560251	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3821G>T	1.37:g.175293628C>A	ENSP00000356646:p.Arg1274Leu		173560251	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.439926	0.96168	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.77229	-1.08;-1.08	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	L	0.60845	1.875	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86801	0.1992	10	0.59425	D	0.04	.	19.3551	0.94408	0.0:1.0:0.0:0.0	.	1274	Q92752	TENR_HUMAN	L	1274;1274;1184	ENSP00000356646:R1274L;ENSP00000263525:R1274L	ENSP00000263525:R1274L	R	-	2	0	TNR	173560251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.711000	0.84669	2.666000	0.90696	0.655000	0.94253	CGC		0.478	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		Missense_Mutation
CEP350	9857	genome.wustl.edu	37	1	180023593	180023593	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0723-01	TCGA-13-0723-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:180023593C>T	ENST00000367607.3	+	25	5636	c.5218C>T	c.(5218-5220)Cgg>Tgg	p.R1740W		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1740					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R1740W(3)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GCCCCCGCTCCGGAAGAAACA	0.398																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	1											47.0	42.0	44.0					1																	180023593		2203	4299	6502	178290216	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5218C>T	1.37:g.180023593C>T	ENSP00000356579:p.Arg1740Trp		178290216	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383145	0.82792	.	.	ENSG00000135837	ENST00000367607	T	0.66460	-0.21	5.95	5.95	0.96441	.	0.000000	0.44483	D	0.000442	T	0.70859	0.3272	L	0.27053	0.805	0.49582	D	0.999809	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67914	-0.5547	9	.	.	.	.	13.5137	0.61528	0.2676:0.7323:0.0:0.0	.	1740;1740	E7EU22;Q5VT06	.;CE350_HUMAN	W	1740	ENSP00000356579:R1740W	.	R	+	1	2	CEP350	178290216	0.925000	0.31364	0.999000	0.59377	0.997000	0.91878	1.870000	0.39529	2.827000	0.97445	0.650000	0.86243	CGG		0.398	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		Missense_Mutation
TRIML1	339976	genome.wustl.edu	37	4	189068452	189068452	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0723-01	TCGA-13-0723-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr4:189068452T>A	ENST00000332517.3	+	6	1473	c.1333T>A	c.(1333-1335)Ttt>Att	p.F445I	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	445	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.F445I(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CAGGCCTATCTTTTCCCCCTG	0.557																																					Melanoma(31;213 1036 16579 23968 32372)											1	Substitution - Missense(1)	ovary(1)	4											72.0	74.0	73.0					4																	189068452		2203	4300	6503	189305446	SO:0001583	missense	339976			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1333T>A	4.37:g.189068452T>A	ENSP00000327738:p.Phe445Ile		189305446	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	CCDS3851.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	t	13.84	2.358000	0.41801	.	.	ENSG00000184108	ENST00000332517	T	0.78003	-1.14	5.05	2.55	0.30701	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.53938	D	0.000060	T	0.77184	0.4093	M	0.90814	3.15	0.37341	D	0.910394	B	0.18968	0.032	B	0.23419	0.046	T	0.74349	-0.3694	10	0.87932	D	0	-17.6387	2.128	0.03743	0.161:0.0847:0.1686:0.5857	.	445	Q8N9V2	TRIML_HUMAN	I	445	ENSP00000327738:F445I	ENSP00000327738:F445I	F	+	1	0	TRIML1	189305446	1.000000	0.71417	0.509000	0.27700	0.004000	0.04260	3.590000	0.53979	0.475000	0.27415	-0.330000	0.08379	TTT		0.557	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556		Missense_Mutation
GRHL2	79977	genome.wustl.edu	37	8	102570843	102570844	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-0723-01	TCGA-13-0723-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr8:102570843_102570844insT	ENST00000251808.3	+	4	819_820	c.481_482insT	c.(481-483)gaafs	p.E161fs	GRHL2_ENST00000395927.1_Frame_Shift_Ins_p.E145fs	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	161					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E161fs*28(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			GGTGAAAGCTGAAGATTTCACA	0.53																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								102640020	SO:0001589	frameshift_variant	79977			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	Exception_encountered	8.37:g.102570843_102570844insT	ENSP00000251808:p.Glu161fs		102640019	A1L303|Q6NT03|Q9H8B8	Frame_Shift_Ins	INS	ENST00000251808.3	37	CCDS34931.1	INS	45	WashU																																																																																				0.530	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	NM_024915		Frame_Shift_Ins
MKNK1	8569	genome.wustl.edu	37	1	47051647	47051647	+	Intron	SNP	C	C	G			TCGA-13-0723-01	TCGA-13-0723-10	C	C	G	C	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr1:47051647C>G	ENST00000371946.4	-	3	198				MKNK1_ENST00000465783.1_Intron|MKNK1_ENST00000545730.1_Intron|MKNK1_ENST00000341183.5_Intron|MKNK1_ENST00000525888.1_Splice_Site|MKNK1_ENST00000428112.2_Intron|MKNK1_ENST00000371944.4_5'Flank|MKNK1_ENST00000371945.4_Intron	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					GTTTCTGAAACTAGGAAGGAA	0.428																																																0			1																																								46824234	SO:0001627	intron_variant	8569			AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.35-2646G>C	1.37:g.47051647C>G			46824234	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Splice_Site_SNP	SNP	ENST00000371946.4	37	CCDS538.1	SNP	20	WashU																																																																																				0.428	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684		Splice_Site_SNP
OR5T2	219464	genome.wustl.edu	37	11	56000395	56000395	+	Silent	SNP	A	A	G			TCGA-13-0723-01	TCGA-13-0723-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr11:56000395A>G	ENST00000313264.4	-	1	342	c.267T>C	c.(265-267)atT>atC	p.I89I		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I89I(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					GGGAATCCCTAATGACCACTA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	11											76.0	72.0	73.0					11																	56000395		2201	4296	6497	55756971	SO:0001819	synonymous_variant	219464			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.267T>C	11.37:g.56000395A>G			55756971	B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	37	CCDS31523.1	SNP	13	WashU																																																																																				0.403	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		Silent
GPR142	350383	genome.wustl.edu	37	17	72368575	72368575	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr17:72368575G>A	ENST00000335666.4	+	4	1273	c.1225G>A	c.(1225-1227)Gcc>Acc	p.A409T		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	409						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A409T(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCACACGGCAGCCAACTTCGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											95.0	79.0	85.0					17																	72368575		2203	4300	6503	69880170	SO:0001583	missense	350383			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1225G>A	17.37:g.72368575G>A	ENSP00000335158:p.Ala409Thr		69880170	A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	9.548	1.115150	0.20795	.	.	ENSG00000257008	ENST00000335666	T	0.37752	1.18	4.55	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.293110	0.32970	N	0.005432	T	0.19406	0.0466	N	0.08118	0	0.22266	N	0.999241	B;P	0.47545	0.042;0.897	B;P	0.45946	0.061;0.498	T	0.07443	-1.0772	10	0.66056	D	0.02	-22.1444	5.0452	0.14480	0.0826:0.334:0.4537:0.1297	.	409;1371	Q7Z601;Q8NGB0	GP142_HUMAN;.	T	409	ENSP00000335158:A409T	ENSP00000335158:A409T	A	+	1	0	GPR142	69880170	0.026000	0.19158	0.514000	0.27761	0.021000	0.10359	0.238000	0.18004	0.578000	0.29487	0.556000	0.70494	GCC		0.602	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		Missense_Mutation
ATP6V1F	9296	genome.wustl.edu	37	7	128505510	128505510	+	Missense_Mutation	SNP	G	G	A	rs73459264	byFrequency	TCGA-13-0723-01	TCGA-13-0723-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0723-01	TCGA-13-0723-10	g.chr7:128505510G>A	ENST00000249289.4	+	2	317	c.238G>A	c.(238-240)Gcc>Acc	p.A80T	ATP6V1F_ENST00000492758.1_Missense_Mutation_p.A108T|RP11-309L24.4_ENST00000461420.1_lincRNA|RP11-309L24.2_ENST00000469965.1_RNA	NM_004231.3	NP_004222.2	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F	80					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, uncoupled (GO:0042624)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.A80T(1)		lung(1)|ovary(1)|prostate(1)	3						TGCCCTGGACGCCCACCAGCA	0.592													G|||	21	0.00419329	0.0151	0.0014	5008	,	,		21143	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7						G	THR/ALA,THR/ALA	68,4338	61.7+/-98.7	0,68,2135	68.0	62.0	64.0		322,238	4.1	1.0	7	dbSNP_130	64	0,8600		0,0,4300	yes	missense,missense	ATP6V1F	NM_001198909.1,NM_004231.3	58,58	0,68,6435	AA,AG,GG		0.0,1.5433,0.5228	benign,benign	108/148,80/120	128505510	68,12938	2203	4300	6503	128292746	SO:0001583	missense	9296			D49400	CCDS5807.1, CCDS56511.1	7q32.1	2010-04-21	2002-08-29		ENSG00000128524	ENSG00000128524	3.6.3.14	"""ATPases / V-type"""	16832	protein-coding gene	gene with protein product		607160				8581736, 8621738	Standard	NM_004231		Approved	ATP6S14, VATF, Vma7	uc022all.1	Q16864	OTTHUMG00000158365	ENST00000249289.4:c.238G>A	7.37:g.128505510G>A	ENSP00000249289:p.Ala80Thr		128292746	C9J2K4|Q6IBA8	Missense_Mutation	SNP	ENST00000249289.4	37	CCDS5807.1	SNP	38	WashU	4	0.0018315018315018315	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	0	0.0	G	15.58	2.876064	0.51695	0.015433	0.0	ENSG00000128524	ENST00000249289;ENST00000492758	T;T	0.41758	0.99;0.99	5.02	4.1	0.47936	.	0.228496	0.43260	N	0.000597	T	0.18257	0.0438	L	0.41236	1.265	0.58432	D	0.999999	B	0.10296	0.003	B	0.18561	0.022	T	0.05435	-1.0885	10	0.13470	T	0.59	-16.0931	13.6632	0.62378	0.0:0.0:0.8446:0.1554	.	80	Q16864	VATF_HUMAN	T	80;108	ENSP00000249289:A80T;ENSP00000417378:A108T	ENSP00000249289:A80T	A	+	1	0	ATP6V1F	128292746	1.000000	0.71417	0.989000	0.46669	0.973000	0.67179	6.049000	0.71053	2.331000	0.79229	0.591000	0.81541	GCC		0.592	ATP6V1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350800.1	NM_004231		Missense_Mutation
