#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACTL6A	86	hgsc.bcm.edu	37	3	179287948	179287948	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr3:179287948C>T	ENST00000429709.2	+	3	409	c.196C>T	c.(196-198)Ccc>Tcc	p.P66S	ACTL6A_ENST00000450518.2_Missense_Mutation_p.P24S|ACTL6A_ENST00000392662.1_Missense_Mutation_p.P24S	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	66					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)	p.P66S(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			ACAAGGCGGTCCCACCTACTA	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											193.0	177.0	182.0					3																	179287948		2203	4300	6503	180770642	SO:0001583	missense	86			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.196C>T	3.37:g.179287948C>T	ENSP00000397552:p.Pro66Ser		180770642	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	ENST00000429709.2	37	CCDS3231.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024921	0.54683	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662;ENST00000490364	D;D;D	0.97089	-4.24;-4.19;-4.19	5.7	5.7	0.88788	.	0.051642	0.85682	D	0.000000	D	0.93314	0.7869	N	0.05330	-0.07	0.48236	D	0.999612	B	0.21225	0.053	B	0.28465	0.09	D	0.88981	0.3408	10	0.51188	T	0.08	.	19.8407	0.96681	0.0:1.0:0.0:0.0	.	66	O96019	ACL6A_HUMAN	S	66;24;24;24	ENSP00000397552:P66S;ENSP00000394014:P24S;ENSP00000376430:P24S	ENSP00000376430:P24S	P	+	1	0	ACTL6A	180770642	0.995000	0.38212	0.985000	0.45067	0.977000	0.68977	3.812000	0.55628	2.677000	0.91161	0.650000	0.86243	CCC		0.443	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301		Missense_Mutation
ARSF	416	hgsc.bcm.edu	37	X	3019221	3019221	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chrX:3019221G>A	ENST00000381127.1	+	8	1282	c.1061G>A	c.(1060-1062)cGa>cAa	p.R354Q	ARSF_ENST00000537104.1_Missense_Mutation_p.R354Q|ARSF_ENST00000359361.2_Missense_Mutation_p.R354Q	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	354					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R354Q(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAAGCTAGGCGAGGGCATGCC	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											145.0	122.0	130.0					X																	3019221		2203	4299	6502	3029221	SO:0001583	missense	416			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1061G>A	X.37:g.3019221G>A	ENSP00000370519:p.Arg354Gln		3029221	Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	CCDS14123.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.839	0.339043	0.11069	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.93906	-3.31;-3.31;-3.31	2.81	-5.62	0.02481	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	2.429870	0.03186	U	0.172680	T	0.81418	0.4818	N	0.13235	0.315	0.09310	N	1	B	0.30326	0.276	B	0.20184	0.028	T	0.75357	-0.3346	10	0.13108	T	0.6	.	4.1265	0.10129	0.5358:0.0:0.2697:0.1945	.	354	P54793	ARSF_HUMAN	Q	354	ENSP00000370519:R354Q;ENSP00000445594:R354Q;ENSP00000352319:R354Q	ENSP00000352319:R354Q	R	+	2	0	ARSF	3029221	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.794000	0.04584	-0.781000	0.04548	-0.369000	0.07265	CGA		0.438	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			Missense_Mutation
B4GALNT3	283358	hgsc.bcm.edu	37	12	644350	644350	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0727-01	TCGA-13-0727-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr12:644350A>G	ENST00000266383.5	+	2	201	c.188A>G	c.(187-189)gAa>gGa	p.E63G		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	63					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			AGCTGGAGAGAACTGGCCAAG	0.562																																																0			12											49.0	45.0	47.0					12																	644350		2203	4300	6503	514611	SO:0001583	missense	283358			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.188A>G	12.37:g.644350A>G	ENSP00000266383:p.Glu63Gly		514611	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177389	0.57692	.	.	ENSG00000139044	ENST00000266383	T	0.06528	3.29	5.47	5.47	0.80525	.	0.163843	0.45867	D	0.000330	T	0.15869	0.0382	L	0.46157	1.445	0.49687	D	0.999819	D	0.62365	0.991	P	0.58331	0.837	T	0.00273	-1.1858	10	0.66056	D	0.02	-20.4711	14.3822	0.66919	1.0:0.0:0.0:0.0	.	63	Q6L9W6	B4GN3_HUMAN	G	63	ENSP00000266383:E63G	ENSP00000266383:E63G	E	+	2	0	B4GALNT3	514611	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	4.031000	0.57267	2.060000	0.61445	0.460000	0.39030	GAA		0.562	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593		Missense_Mutation
MIS18BP1	55320	hgsc.bcm.edu	37	14	45716019	45716019	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr14:45716019delT	ENST00000310806.4	-	2	929	c.471delA	c.(469-471)aaafs	p.K157fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	157					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K157fs*24(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TATGCTGCAATTTTTTTTTTT	0.358																																																1	Deletion - Frameshift(1)	ovary(1)	14								6,4258		1,4,2127	185.0	165.0	172.0			0.9	0.2	14		175	19,8235		0,19,4108	no	frameshift	MIS18BP1	NM_018353.4		1,23,6235	A1A1,A1R,RR		0.2302,0.1407,0.1997			45716019	25,12493	2203	4300	6503	44785769	SO:0001589	frameshift_variant	55320			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.471delA	14.37:g.45716019delT	ENSP00000309790:p.Lys157fs		44785769	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	ENST00000310806.4	37	CCDS9684.1	DEL	52	Baylor																																																																																				0.358	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2			Frame_Shift_Del
CDH24	64403	hgsc.bcm.edu	37	14	23519039	23519039	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr14:23519039G>T	ENST00000267383.5	-	9	1683	c.1591C>A	c.(1591-1593)Cct>Act	p.P531T	CDH24_ENST00000554034.1_Missense_Mutation_p.P493T|CDH24_ENST00000397359.3_Missense_Mutation_p.P531T|CDH24_ENST00000487137.2_Missense_Mutation_p.P493T|CDH24_ENST00000485922.1_5'UTR			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	531	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)	p.P493T(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		ACCTGGCCAGGAGCTGCAGAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											62.0	52.0	55.0					14																	23519039		2203	4300	6503	22588879	SO:0001583	missense	64403			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1591C>A	14.37:g.23519039G>T	ENSP00000267383:p.Pro531Thr		22588879	D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	ENST00000267383.5	37	CCDS9585.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699757	0.48307	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000554034;ENST00000267383	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	4.86	4.86	0.63082	Cadherin (2);Cadherin-like (1);	0.570237	0.16463	N	0.213323	T	0.23649	0.0572	L	0.45470	1.425	0.47862	D	0.999534	P;B	0.35011	0.48;0.397	B;B	0.34652	0.187;0.135	T	0.05716	-1.0868	10	0.56958	D	0.05	.	16.9005	0.86112	0.0:0.0:1.0:0.0	.	493;531	Q86UP0-2;Q86UP0	.;CAD24_HUMAN	T	531;493;493;531	ENSP00000380517:P531T;ENSP00000434821:P493T;ENSP00000452493:P493T;ENSP00000267383:P531T	ENSP00000267383:P531T	P	-	1	0	CDH24	22588879	0.990000	0.36364	1.000000	0.80357	0.978000	0.69477	2.317000	0.43770	2.533000	0.85409	0.561000	0.74099	CCT		0.597	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478		Missense_Mutation
CDKN2A	1029	hgsc.bcm.edu	37	9	21970980	21970980	+	Silent	SNP	G	G	T			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr9:21970980G>T	ENST00000304494.5	-	2	648	c.378C>A	c.(376-378)gtC>gtA	p.V126V	CDKN2A_ENST00000578845.2_Silent_p.V75V|CDKN2A_ENST00000494262.1_Silent_p.V75V|CDKN2A_ENST00000530628.2_3'UTR|CDKN2A_ENST00000497750.1_Silent_p.V75V|CDKN2A_ENST00000579122.1_Silent_p.V126V|CDKN2A_ENST00000579755.1_3'UTR|CDKN2A_ENST00000446177.1_Silent_p.V126V|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498124.1_Silent_p.V126V|CDKN2A_ENST00000361570.3_3'UTR|CDKN2A_ENST00000498628.2_Silent_p.V75V|CDKN2A_ENST00000479692.2_Silent_p.V75V	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	126			V -> D (in CMM2; impairs the function). {ECO:0000269|PubMed:11506491, ECO:0000269|PubMed:7987387}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(13)|p.V126V(2)|p.A118fs*10(1)|p.0(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GGTACCGTGCGACATCGCGAT	0.701		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																						1332	Whole gene deletion(1316)|Unknown(13)|Substitution - coding silent(2)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(278)|skin(168)|central_nervous_system(164)|lung(143)|urinary_tract(91)|bone(73)|soft_tissue(57)|pleura(51)|oesophagus(48)|upper_aerodigestive_tract(47)|ovary(34)|kidney(30)|breast(30)|pancreas(29)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	9											28.0	31.0	30.0					9																	21970980		2202	4298	6500	21960980	SO:0001819	synonymous_variant	1029			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.378C>A	9.37:g.21970980G>T			21960980	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Silent	SNP	ENST00000304494.5	37	CCDS6510.1	SNP	37	Baylor																																																																																				0.701	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077		Silent
DOCK6	57572	hgsc.bcm.edu	37	19	11353933	11353933	+	Splice_Site	SNP	C	C	A			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr19:11353933C>A	ENST00000294618.7	-	12	1398		c.e12+1			NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GGGTAGGACACCTGCTTAAAG	0.667											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Unknown(1)	ovary(1)	19											27.0	33.0	31.0					19																	11353933		1984	4155	6139	11214933	SO:0001630	splice_region_variant	57572				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1386+1G>T	19.37:g.11353933C>A		671	11214933	A6H8X5|Q7Z7P4|Q9P2F2	Splice_Site_SNP	SNP	ENST00000294618.7	37	CCDS45975.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144610	0.57044	.	.	ENSG00000130158	ENST00000294618	.	.	.	4.15	4.15	0.48705	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2295	0.73374	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK6	11214933	1.000000	0.71417	0.997000	0.53966	0.519000	0.34347	7.068000	0.76748	1.861000	0.53984	0.462000	0.41574	.		0.667	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	Intron	Splice_Site_SNP
AGO2	27161	hgsc.bcm.edu	37	8	141549468	141549468	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0727-01	TCGA-13-0727-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr8:141549468A>C	ENST00000220592.5	-	16	2232	c.2120T>G	c.(2119-2121)gTg>gGg	p.V707G	AGO2_ENST00000519980.1_Missense_Mutation_p.V707G	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	707	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										CCTCTTCTGCACCACGATGAA	0.597																																																0			8											93.0	85.0	88.0					8																	141549468		2203	4300	6503	141618650	SO:0001583	missense	27161			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2120T>G	8.37:g.141549468A>C	ENSP00000220592:p.Val707Gly		141618650	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.2	4.616386	0.87359	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.37058	1.22;1.22	5.09	5.09	0.68999	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.74207	0.3686	H	0.98218	4.175	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.995;0.999	D	0.84850	0.0813	10	0.87932	D	0	-50.785	15.1618	0.72791	1.0:0.0:0.0:0.0	.	707;707	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	G	707	ENSP00000220592:V707G;ENSP00000430176:V707G	ENSP00000220592:V707G	V	-	2	0	EIF2C2	141618650	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.262000	0.95591	2.032000	0.59987	0.533000	0.62120	GTG		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			Missense_Mutation
GAPVD1	26130	hgsc.bcm.edu	37	9	128103502	128103502	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr9:128103502G>T	ENST00000495955.1	+	18	3214	c.2924G>T	c.(2923-2925)aGa>aTa	p.R975I	GAPVD1_ENST00000470056.1_Missense_Mutation_p.R975I|GAPVD1_ENST00000394104.2_Missense_Mutation_p.R975I|GAPVD1_ENST00000265956.4_Missense_Mutation_p.R949I|GAPVD1_ENST00000394105.2_Missense_Mutation_p.R1002I|GAPVD1_ENST00000297933.6_Missense_Mutation_p.R975I|GAPVD1_ENST00000312123.9_Missense_Mutation_p.R954I|GAPVD1_ENST00000394083.2_Missense_Mutation_p.R954I			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	975					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1002I(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GACAGGAACAGACCTTGGTGG	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											106.0	107.0	106.0					9																	128103502		2203	4300	6503	127143323	SO:0001583	missense	26130				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2924G>T	9.37:g.128103502G>T	ENSP00000419063:p.Arg975Ile		127143323	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		SNP	33	Baylor	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.57|18.57|18.57	3.652618|3.652618|3.652618	0.67472|0.67472|0.67472	.|.|.	.|.|.	ENSG00000165219|ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000436712|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|.|.	.|.|.	.|.|.	5.92|5.92|5.92	4.85|4.85|4.85	0.62838|0.62838|0.62838	.|.|.	.|.|0.121467	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.35537|0.35537|0.35537	0.0935|0.0935|0.0935	N|N|N	0.19112|0.19112|0.19112	0.55|0.55|0.55	0.58432|0.58432|0.58432	D|D|D	0.999999|0.999999|0.999999	.|.|B;B;B;B;B;B	.|.|0.33857	.|.|0.226;0.145;0.226;0.226;0.226;0.429	.|.|B;B;B;B;B;B	.|.|0.34590	.|.|0.134;0.063;0.074;0.134;0.134;0.186	T|T|T	0.25012|0.25012|0.25012	-1.0144|-1.0144|-1.0144	5|5|9	.|.|0.54805	.|.|T	.|.|0.06	.|.|.	7.6578|7.6578|7.6578	0.28386|0.28386|0.28386	0.2062:0.0:0.7938:0.0|0.2062:0.0:0.7938:0.0|0.2062:0.0:0.7938:0.0	.|.|.	.|.|949;975;975;954;975;1002	.|.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	.|.|.;GAPD1_HUMAN;.;.;.;.	Y|H|I	812|811|975;1002;975;949;954;975;975;975;954	.|.|.	.|.|ENSP00000265956:R949I	D|Q|R	+|+|+	1|3|2	0|2|0	GAPVD1|GAPVD1|GAPVD1	127143323|127143323|127143323	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	4.471000|4.471000|4.471000	0.60182|0.60182|0.60182	2.810000|2.810000|2.810000	0.96702|0.96702|0.96702	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAC|CAG|AGA		0.373	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1			Missense_Mutation
GLB1	2720	hgsc.bcm.edu	37	3	33099607	33099607	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0727-01	TCGA-13-0727-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr3:33099607A>T	ENST00000399402.3	-	6	748	c.617T>A	c.(616-618)cTc>cAc	p.L206H	GLB1_ENST00000445488.2_Missense_Mutation_p.L284H|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Missense_Mutation_p.L236H	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	236					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CGTGGTGTAGAGGCCCTGCAG	0.488																																																0			3											43.0	45.0	44.0					3																	33099607		1862	4089	5951	33074611	SO:0001583	missense	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.617T>A	3.37:g.33099607A>T	ENSP00000382333:p.Leu206His		33074611	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	ENST00000399402.3	37	CCDS43062.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730852	0.89390	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000415454;ENST00000440656	D;D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77;-4.77	5.37	5.37	0.77165	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98994	0.9657	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.99764	1.1022	10	0.87932	D	0	-29.1487	15.3189	0.74105	1.0:0.0:0.0:0.0	.	236;236;284	Q53G40;P16278;B7Z6Q5	.;BGAL_HUMAN;.	H	206;236;284;77;105	ENSP00000382333:L206H;ENSP00000306920:L236H;ENSP00000393377:L284H;ENSP00000411813:L77H;ENSP00000411769:L105H	ENSP00000306920:L236H	L	-	2	0	GLB1	33074611	1.000000	0.71417	0.994000	0.49952	0.927000	0.56198	6.902000	0.75699	2.150000	0.67090	0.482000	0.46254	CTC		0.488	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404		Missense_Mutation
ARHGAP35	2909	hgsc.bcm.edu	37	19	47424860	47424860	+	Silent	SNP	G	G	A	rs372055367		TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr19:47424860G>A	ENST00000404338.3	+	1	2928	c.2928G>A	c.(2926-2928)ccG>ccA	p.P976P		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	976					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.P976P(1)									CAGGATCACCGCTCTGCAACT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	19						G		0,3866		0,0,1933	52.0	52.0	52.0		2928	-11.7	0.0	19		52	3,8261		0,3,4129	no	coding-synonymous	ARHGAP35	NM_004491.4		0,3,6062	AA,AG,GG		0.0363,0.0,0.0247		976/1500	47424860	3,12127	1933	4132	6065	52116700	SO:0001819	synonymous_variant	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2928G>A	19.37:g.47424860G>A			52116700	A7E2A4|Q14452|Q9C0E1	Silent	SNP	ENST00000404338.3	37	CCDS46127.1	SNP	38	Baylor																																																																																				0.483	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		Silent
HEG1	57493	hgsc.bcm.edu	37	3	124738301	124738301	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr3:124738301T>C	ENST00000311127.4	-	5	1460	c.1393A>G	c.(1393-1395)Aca>Gca	p.T465A	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	465	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TCTGCAGATGTTGTGCTGTTG	0.498																																																0			3											252.0	244.0	247.0					3																	124738301		2094	4236	6330	126220991	SO:0001583	missense	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1393A>G	3.37:g.124738301T>C	ENSP00000311502:p.Thr465Ala		126220991	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.320	1.057886	0.19987	.	.	ENSG00000173706	ENST00000311127	D	0.89552	-2.53	5.07	1.48	0.22813	.	.	.	.	.	D	0.83857	0.5345	L	0.56769	1.78	0.09310	N	1	B;B	0.16396	0.017;0.01	B;B	0.21151	0.033;0.015	T	0.72060	-0.4404	9	0.42905	T	0.14	.	3.5783	0.07942	0.0:0.2416:0.2159:0.5425	.	465;465	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	A	465	ENSP00000311502:T465A	ENSP00000311502:T465A	T	-	1	0	HEG1	126220991	0.001000	0.12720	0.001000	0.08648	0.028000	0.11728	0.434000	0.21494	0.489000	0.27749	0.528000	0.53228	ACA		0.498	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		Missense_Mutation
HIP1R	9026	hgsc.bcm.edu	37	12	123340855	123340855	+	Silent	SNP	T	T	C			TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr12:123340855T>C	ENST00000253083.4	+	15	1490	c.1365T>C	c.(1363-1365)agT>agC	p.S455S		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	455					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)	p.S455S(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		AAAAGCACAGTGAGCTCGTCC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	12											112.0	104.0	106.0					12																	123340855		2203	4300	6503	121906808	SO:0001819	synonymous_variant	9026			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.1365T>C	12.37:g.123340855T>C			121906808	A6NHQ6|Q6NXG8|Q9UED9	Silent	SNP	ENST00000253083.4	37	CCDS31922.1	SNP	59	Baylor																																																																																				0.657	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959		Silent
IL11RA	3590	hgsc.bcm.edu	37	9	34655232	34655232	+	Silent	SNP	A	A	T			TCGA-13-0727-01	TCGA-13-0727-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr9:34655232A>T	ENST00000555003.1	+	2	1374	c.18A>T	c.(16-18)tcA>tcT	p.S6S	IL11RA_ENST00000478802.2_3'UTR|IL11RA_ENST00000441545.2_Silent_p.S6S|IL11RA_ENST00000318041.9_Silent_p.S6S|IL11RA_ENST00000378817.4_Silent_p.S6S|IL11RA_ENST00000602473.1_Silent_p.S6S|GALT_ENST00000556278.1_Silent_p.S150S			Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha	6					developmental process (GO:0032502)|embryo implantation (GO:0007566)|head development (GO:0060322)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	GCAGCTGCTCAGGGCTGAGCA	0.637																																																0			9											31.0	28.0	29.0					9																	34655232		2203	4300	6503	34645232	SO:0001819	synonymous_variant	3590			Z38102	CCDS6567.1	9p13	2014-05-22			ENSG00000137070	ENSG00000137070		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5967	protein-coding gene	gene with protein product		600939				7670098	Standard	NM_001142784		Approved		uc011loq.3	Q14626	OTTHUMG00000019837	ENST00000555003.1:c.18A>T	9.37:g.34655232A>T			34645232	Q16542|Q5VZ80|Q7KYJ7	Silent	SNP	ENST00000555003.1	37	CCDS6567.1	SNP	7	Baylor																																																																																				0.637	IL11RA-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410625.1	NM_001142784		Silent
KIF2B	84643	hgsc.bcm.edu	37	17	51902304	51902304	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr17:51902304G>T	ENST00000268919.4	+	1	2066	c.1910G>T	c.(1909-1911)tGc>tTc	p.C637F		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	637					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C637F(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATTGATTTTTGCATTGCCCGG	0.448																																																1	Substitution - Missense(1)	ovary(1)	17											162.0	148.0	153.0					17																	51902304		2203	4300	6503	49257303	SO:0001583	missense	84643			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1910G>T	17.37:g.51902304G>T	ENSP00000268919:p.Cys637Phe		49257303	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.601090	0.00849	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.73047	-0.71	5.65	5.65	0.86999	.	0.162163	0.29995	N	0.010663	T	0.52386	0.1731	N	0.24115	0.695	0.32598	N	0.526239	B	0.12013	0.005	B	0.11329	0.006	T	0.53648	-0.8409	10	0.14656	T	0.56	.	9.1247	0.36807	0.1543:0.0:0.8457:0.0	.	637	Q8N4N8	KIF2B_HUMAN	F	637;525	ENSP00000268919:C637F	ENSP00000268919:C637F	C	+	2	0	KIF2B	49257303	0.936000	0.31750	0.996000	0.52242	0.009000	0.06853	2.012000	0.40932	2.824000	0.97209	0.655000	0.94253	TGC		0.448	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		Missense_Mutation
LRSAM1	90678	hgsc.bcm.edu	37	9	130230081	130230081	+	Silent	SNP	T	T	G			TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr9:130230081T>G	ENST00000323301.4	+	9	1195	c.591T>G	c.(589-591)acT>acG	p.T197T	LRSAM1_ENST00000373322.1_Silent_p.T197T|LRSAM1_ENST00000373324.4_Silent_p.T197T|LRSAM1_ENST00000300417.6_Silent_p.T197T	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	197					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T197T(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GTGCCGGCACTGCGGCCATCT	0.622																																																2	Substitution - coding silent(2)	ovary(2)	9											67.0	51.0	56.0					9																	130230081		2203	4300	6503	129269902	SO:0001819	synonymous_variant	90678			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.591T>G	9.37:g.130230081T>G			129269902	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Silent	SNP	ENST00000323301.4	37	CCDS6873.1	SNP	55	Baylor																																																																																				0.622	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054164.1	NM_138361		Silent
NFRKB	4798	hgsc.bcm.edu	37	11	129746634	129746634	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr11:129746634C>T	ENST00000446488.3	-	16	1832	c.1729G>A	c.(1729-1731)Gtc>Atc	p.V577I	NFRKB_ENST00000304521.5_Missense_Mutation_p.V577I|NFRKB_ENST00000524746.1_Missense_Mutation_p.V577I|NFRKB_ENST00000524794.1_Missense_Mutation_p.V602I	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	577					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)	p.V602I(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		AGAATGGTGACGTAGGCAGGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											95.0	82.0	86.0					11																	129746634		2201	4297	6498	129251844	SO:0001583	missense	4798				CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.1729G>A	11.37:g.129746634C>T	ENSP00000400476:p.Val577Ile		129251844	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	CCDS44770.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460957	0.84317	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.83505	0.5269	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.78314	0.979;0.979;0.991;0.991	D	0.83852	0.0263	9	0.87932	D	0	-28.9108	20.6439	0.99570	0.0:1.0:0.0:0.0	.	587;577;577;602	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	I	577;577;602;577;587	.	ENSP00000303800:V577I	V	-	1	0	NFRKB	129251844	1.000000	0.71417	0.998000	0.56505	0.772000	0.43724	7.487000	0.81328	2.884000	0.98904	0.655000	0.94253	GTC		0.567	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165		Missense_Mutation
NTM	50863	hgsc.bcm.edu	37	11	132016268	132016268	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr11:132016268G>A	ENST00000374786.1	+	2	739	c.260G>A	c.(259-261)cGc>cAc	p.R87H	NTM_ENST00000539799.1_Missense_Mutation_p.R87H|NTM_ENST00000374791.3_Missense_Mutation_p.R87H|NTM_ENST00000427481.2_Missense_Mutation_p.R78H|NTM_ENST00000374784.1_Missense_Mutation_p.R87H|NTM_ENST00000425719.2_Missense_Mutation_p.R87H	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	87	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R87H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CTGGATCCTCGCGTGGTCCTT	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											186.0	133.0	151.0					11																	132016268		2201	4297	6498	131521478	SO:0001583	missense	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.260G>A	11.37:g.132016268G>A	ENSP00000363918:p.Arg87His		131521478	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	36	5.756763	0.96898	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.69	5.69	0.88448	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76111	0.3942	H	0.94345	3.525	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.999;1.0	T	0.82669	-0.0343	10	0.87932	D	0	-11.5868	19.819	0.96583	0.0:0.0:1.0:0.0	.	87;78;87;87;87;87	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	H	87;87;78;78;87;87;87	ENSP00000363923:R87H;ENSP00000437668:R87H;ENSP00000448104:R78H;ENSP00000416320:R78H;ENSP00000363918:R87H;ENSP00000396722:R87H;ENSP00000363916:R87H	ENSP00000363916:R87H	R	+	2	0	NTM	131521478	1.000000	0.71417	0.983000	0.44433	0.985000	0.73830	9.852000	0.99516	2.691000	0.91804	0.655000	0.94253	CGC		0.577	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		Missense_Mutation
PDE6B	5158	hgsc.bcm.edu	37	4	650768	650770	+	In_Frame_Del	DEL	AAA	AAA	-	rs371134814		TCGA-13-0727-01	TCGA-13-0727-10	AAA	AAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr4:650768_650770delAAA	ENST00000496514.1	+	9	1234_1236	c.1213_1215delAAA	c.(1213-1215)aaadel	p.K405del	PDE6B_ENST00000255622.6_In_Frame_Del_p.K405del|PDE6B_ENST00000429163.2_In_Frame_Del_p.K126del|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	405	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.K405delK(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	TTACAACAGGAAAGACGGGAAGC	0.591																																					GBM(71;463 1194 9848 25922 46834)											1	Deletion - In frame(1)	ovary(1)	4																																								640770	SO:0001651	inframe_deletion	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1213_1215delAAA	4.37:g.650768_650770delAAA	ENSP00000420295:p.Lys405del		640768	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	In_Frame_Del	DEL	ENST00000496514.1	37	CCDS33932.1	DEL	9	Baylor																																																																																				0.591	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		In_Frame_Del
RAD51AP2	729475	hgsc.bcm.edu	37	2	17692185	17692185	+	Silent	SNP	C	C	T			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr2:17692185C>T	ENST00000399080.2	-	3	3389	c.3366G>A	c.(3364-3366)ccG>ccA	p.P1122P		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1122	Interaction with RAD51.							p.P1122P(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATGTCTTAAGCGGTCGTACTC	0.328																																																1	Substitution - coding silent(1)	ovary(1)	2											117.0	104.0	108.0					2																	17692185		1834	4086	5920	17555666	SO:0001819	synonymous_variant	729475			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.3366G>A	2.37:g.17692185C>T			17555666		Silent	SNP	ENST00000399080.2	37	CCDS42656.1	SNP	27	Baylor																																																																																				0.328	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218		Silent
RTN2	6253	hgsc.bcm.edu	37	19	45992156	45992156	+	Missense_Mutation	SNP	T	T	C	rs112295269		TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr19:45992156T>C	ENST00000245923.4	-	7	1565	c.1330A>G	c.(1330-1332)Acg>Gcg	p.T444A	RTN2_ENST00000430715.2_Missense_Mutation_p.T104A|RTN2_ENST00000590526.1_Missense_Mutation_p.T170A|PPM1N_ENST00000401705.1_5'UTR|RTN2_ENST00000344680.4_Missense_Mutation_p.T371A	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	444	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		CGCAGCTGCGTGGCCGCCGAG	0.632																																																0			19											29.0	27.0	28.0					19																	45992156		2202	4300	6502	50683996	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1330A>G	19.37:g.45992156T>C	ENSP00000245923:p.Thr444Ala		50683996	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.141	1.013915	0.19277	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.41065	1.01;1.01;1.01	5.57	5.57	0.84162	.	0.798219	0.12127	N	0.497157	T	0.29652	0.0740	N	0.22421	0.69	0.19300	N	0.99998	B;B	0.33549	0.417;0.22	B;B	0.28011	0.085;0.055	T	0.15235	-1.0444	10	0.39692	T	0.17	0.2417	12.1816	0.54216	0.0:0.0:0.0:1.0	.	371;444	O75298-2;O75298	.;RTN2_HUMAN	A	371;444;104	ENSP00000345127:T371A;ENSP00000245923:T444A;ENSP00000398178:T104A	ENSP00000245923:T444A	T	-	1	0	RTN2	50683996	0.012000	0.17670	0.527000	0.27925	0.160000	0.22226	0.530000	0.23036	2.137000	0.66172	0.524000	0.50904	ACG		0.632	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		Missense_Mutation
SHANK2	22941	hgsc.bcm.edu	37	11	70331795	70331795	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr11:70331795C>A	ENST00000423696.2	-	15	3502	c.3466G>T	c.(3466-3468)Gat>Tat	p.D1156Y	SHANK2_ENST00000449833.2_Missense_Mutation_p.D940Y|SHANK2_ENST00000409161.1_Missense_Mutation_p.D939Y|SHANK2_ENST00000338508.4_Missense_Mutation_p.D1536Y			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1156					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.D940Y(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCTTGCCCATCTGCATAGACT	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											139.0	122.0	128.0					11																	70331795		2200	4294	6494	70009443	SO:0001583	missense	22941			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3466G>T	11.37:g.70331795C>A	ENSP00000394536:p.Asp1156Tyr		70009443	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791367	0.70452	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03	5.42	5.42	0.78866	.	0.136685	0.64402	D	0.000004	T	0.52901	0.1763	M	0.84326	2.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.58640	-0.7601	10	0.87932	D	0	.	19.2305	0.93836	0.0:1.0:0.0:0.0	.	1156;1535;940	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	Y	940;939;814;1536;1156;1174;1159	ENSP00000399423:D940Y;ENSP00000386491:D939Y;ENSP00000402944:D814Y;ENSP00000345193:D1536Y;ENSP00000394536:D1156Y;ENSP00000294018:D1159Y	ENSP00000294018:D1159Y	D	-	1	0	SHANK2	70009443	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.254000	0.78329	2.549000	0.85964	0.655000	0.94253	GAT		0.507	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		Missense_Mutation
SIAH3	283514	hgsc.bcm.edu	37	13	46357913	46357913	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr13:46357913C>T	ENST00000400405.2	-	2	521	c.415G>A	c.(415-417)Gcc>Acc	p.A139T		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	139					multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A139T(1)		large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						ACGATCTCGGCTCCCTGGAGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	13											64.0	72.0	69.0					13																	46357913		2096	4211	6307	45255914	SO:0001583	missense	283514				CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.415G>A	13.37:g.46357913C>T	ENSP00000383256:p.Ala139Thr		45255914	B7ZBP0|Q8N8M6	Missense_Mutation	SNP	ENST00000400405.2	37	CCDS41883.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759814	0.49468	.	.	ENSG00000215475	ENST00000400405	T	0.25250	1.81	5.19	3.44	0.39384	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.394859	0.24388	U	0.038959	T	0.14270	0.0345	L	0.28274	0.84	0.31557	N	0.658054	B	0.06786	0.001	B	0.11329	0.006	T	0.28902	-1.0029	10	0.07482	T	0.82	-9.7821	8.2284	0.31584	0.0:0.7539:0.0:0.2461	.	139	Q8IW03	SIAH3_HUMAN	T	139	ENSP00000383256:A139T	ENSP00000383256:A139T	A	-	1	0	SIAH3	45255914	0.999000	0.42202	0.305000	0.25099	0.955000	0.61496	4.030000	0.57260	0.572000	0.29383	0.561000	0.74099	GCC		0.622	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044788.2	NM_198849		Missense_Mutation
SLC19A3	80704	hgsc.bcm.edu	37	2	228563705	228563705	+	Silent	SNP	C	C	A			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr2:228563705C>A	ENST00000258403.3	-	3	797	c.726G>T	c.(724-726)ggG>ggT	p.G242G	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Silent_p.G238G	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	242					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.G242G(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	TATTCAGCTTCCCTGAAGTGC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	2											146.0	128.0	134.0					2																	228563705		2203	4300	6503	228271949	SO:0001819	synonymous_variant	80704			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.726G>T	2.37:g.228563705C>A			228271949		Silent	SNP	ENST00000258403.3	37	CCDS2468.1	SNP	30	Baylor																																																																																				0.473	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1			Silent
SLU7	10569	hgsc.bcm.edu	37	5	159841380	159841380	+	Silent	SNP	T	T	C			TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr5:159841380T>C	ENST00000297151.4	-	3	657	c.270A>G	c.(268-270)gaA>gaG	p.E90E		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	90					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)	p.E90E(1)		endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTTTTGTTTTTCTGGTTGTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	5											297.0	288.0	291.0					5																	159841380		2203	4300	6503	159773958	SO:0001819	synonymous_variant	10569			AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.270A>G	5.37:g.159841380T>C			159773958	D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Silent	SNP	ENST00000297151.4	37	CCDS4352.1	SNP	64	Baylor																																																																																				0.398	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252673.1	NM_006425		Silent
SPRR1B	6699	hgsc.bcm.edu	37	1	153004926	153004926	+	Silent	SNP	C	C	T	rs17880894	byFrequency	TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr1:153004926C>T	ENST00000307098.4	+	2	170	c.105C>T	c.(103-105)ccC>ccT	p.P35P	SPRR1B_ENST00000392661.3_Silent_p.P35P	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	35	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.P35P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATGCATCCCCAAAACCAAGG	0.642																																																1	Substitution - coding silent(1)	ovary(1)	1											148.0	146.0	147.0					1																	153004926		2203	4300	6503	151271550	SO:0001819	synonymous_variant	6699			M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.105C>T	1.37:g.153004926C>T			151271550	B2R5H7|P22529|P22530|Q5T524	Silent	SNP	ENST00000307098.4	37	CCDS30863.1	SNP	21	Baylor																																																																																				0.642	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038906.1	NM_003125		Silent
STK11IP	114790	hgsc.bcm.edu	37	2	220462835	220462835	+	De_novo_Start_InFrame	SNP	C	C	A			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr2:220462835C>A	ENST00000456909.1	+	0	84				STK11IP_ENST00000295641.10_Silent_p.P9P			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein						protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.P9P(1)|p.P6P(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCAGCGTCCCGTGGCCATGA	0.692																																																2	Substitution - coding silent(2)	ovary(2)	2											16.0	18.0	17.0					2																	220462835		1878	4083	5961	220171079			114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239		2.37:g.220462835C>A			220171079	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37		SNP	23	Baylor																																																																																				0.692	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		Silent
TAF2	6873	hgsc.bcm.edu	37	8	120814095	120814095	+	Missense_Mutation	SNP	G	G	A	rs367888265		TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr8:120814095G>A	ENST00000378164.2	-	6	1029	c.731C>T	c.(730-732)gCg>gTg	p.A244V		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	244					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A244V(1)		NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GATATTTGACGCTGCTGTAGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	8						G	VAL/ALA	0,4406		0,0,2203	168.0	145.0	153.0		731	5.8	1.0	8		153	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAF2	NM_003184.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	244/1200	120814095	1,13005	2203	4300	6503	120883276	SO:0001583	missense	6873			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.731C>T	8.37:g.120814095G>A	ENSP00000367406:p.Ala244Val		120883276	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.113732	0.94339	0.0	1.16E-4	ENSG00000064313	ENST00000378164	T	0.05025	3.51	5.78	5.78	0.91487	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00092	-1.2083	10	0.54805	T	0.06	-8.241	19.9991	0.97403	0.0:0.0:1.0:0.0	.	244	Q6P1X5	TAF2_HUMAN	V	244	ENSP00000367406:A244V	ENSP00000367406:A244V	A	-	2	0	TAF2	120883276	1.000000	0.71417	0.954000	0.39281	0.703000	0.40648	9.814000	0.99346	2.724000	0.93272	0.655000	0.94253	GCG		0.433	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184		Missense_Mutation
TP53BP1	7158	hgsc.bcm.edu	37	15	43720335	43720335	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr15:43720335G>A	ENST00000263801.3	-	18	3944	c.3692C>T	c.(3691-3693)cCa>cTa	p.P1231L	TP53BP1_ENST00000450115.2_Missense_Mutation_p.P1236L|TP53BP1_ENST00000382039.3_Missense_Mutation_p.P1236L|TP53BP1_ENST00000382044.4_Missense_Mutation_p.P1236L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1231					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.P1231L(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ATGGCCATGTGGAGGCTGAGG	0.433								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	15											203.0	176.0	185.0					15																	43720335		2201	4298	6499	41507627	SO:0001583	missense	7158			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3692C>T	15.37:g.43720335G>A	ENSP00000263801:p.Pro1231Leu		41507627	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925890	0.92319	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.09911	2.93;2.93;3.08;3.17	5.51	5.51	0.81932	.	0.159174	0.45126	D	0.000383	T	0.24275	0.0588	L	0.27053	0.805	0.58432	D	0.999999	D;P;P;P	0.89917	1.0;0.911;0.946;0.946	D;P;P;P	0.85130	0.997;0.532;0.723;0.723	T	0.01334	-1.1382	10	0.66056	D	0.02	-9.5829	19.7689	0.96353	0.0:0.0:1.0:0.0	.	1236;1231;1236;1236	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	L	1231;1236;1236;1236	ENSP00000263801:P1231L;ENSP00000371475:P1236L;ENSP00000371470:P1236L;ENSP00000393497:P1236L	ENSP00000263801:P1231L	P	-	2	0	TP53BP1	41507627	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	4.639000	0.61361	2.747000	0.94245	0.650000	0.86243	CCA		0.433	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			Missense_Mutation
UGT2A1	10941	hgsc.bcm.edu	37	4	70505199	70505199	+	Intron	SNP	G	G	A			TCGA-13-0727-01	TCGA-13-0727-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr4:70505199G>A	ENST00000503640.1	-	1	771				UGT2A1_ENST00000286604.4_Intron|UGT2A2_ENST00000457664.2_Nonsense_Mutation_p.Q54*|UGT2A1_ENST00000514019.1_Nonsense_Mutation_p.Q255*|UGT2A1_ENST00000512704.1_Intron	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus						cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TGATTTCTTTGAATCAACTCT	0.368																																																0			4											117.0	116.0	117.0					4																	70505199		1844	4088	5932	70539788	SO:0001627	intron_variant	574537			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.715+7448C>T	4.37:g.70505199G>A			70539788	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Nonsense_Mutation	SNP	ENST00000503640.1	37	CCDS3529.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	36	5.713347	0.96830	.	.	ENSG00000173610	ENST00000457664;ENST00000514019	.	.	.	5.85	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	12.8669	0.57944	0.0:0.0:0.7034:0.2966	.	.	.	.	X	54;255	.	ENSP00000387888:Q54X	Q	-	1	0	UGT2A1	70539788	0.000000	0.05858	0.911000	0.35937	0.981000	0.71138	0.093000	0.15086	0.738000	0.32606	0.585000	0.79938	CAA		0.368	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798		Nonsense_Mutation
USP35	57558	hgsc.bcm.edu	37	11	77920863	77920864	+	Frame_Shift_Ins	INS	-	-	A	rs2512527	byFrequency	TCGA-13-0727-01	TCGA-13-0727-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr11:77920863_77920864insA	ENST00000529308.1	+	10	2223_2224	c.1962_1963insA	c.(1963-1965)accfs	p.T655fs	USP35_ENST00000441408.2_Frame_Shift_Ins_p.T241fs|USP35_ENST00000530535.1_3'UTR|USP35_ENST00000526425.1_Frame_Shift_Ins_p.T386fs|USP35_ENST00000530267.1_Frame_Shift_Ins_p.T223fs	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	655	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.T655fs*74(1)|p.T411fs*74(1)|p.T655P(1)|p.T411P(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			ACACCCCCCCCACCAGCCTGTA	0.614																																																4	Substitution - Missense(2)|Insertion - Frameshift(2)	ovary(2)|prostate(2)	11																																								77598512	SO:0001589	frameshift_variant	57558			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1963dupA	11.37:g.77920864_77920864dupA	ENSP00000431876:p.Thr655fs		77598511		Frame_Shift_Ins	INS	ENST00000529308.1	37	CCDS41693.1	INS	21	Baylor																																																																																				0.614	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527		Frame_Shift_Ins
ZBTB21	49854	hgsc.bcm.edu	37	21	43411551	43411551	+	Missense_Mutation	SNP	T	T	G	rs377515144|rs140397626|rs199778808	byFrequency	TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr21:43411551T>G	ENST00000310826.5	-	3	2837	c.2654A>C	c.(2653-2655)gAg>gCg	p.E885A	ZBTB21_ENST00000398505.3_Missense_Mutation_p.E684A|ZBTB21_ENST00000398511.3_Missense_Mutation_p.E885A|ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398499.1_Missense_Mutation_p.E885A	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	885					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.E885A(2)									TTCTTCAGCCTCCTCCACAGG	0.532																																																2	Substitution - Missense(2)	ovary(2)	21											58.0	63.0	61.0					21																	43411551		2200	4298	6498	42284620	SO:0001583	missense	49854			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2654A>C	21.37:g.43411551T>G	ENSP00000308759:p.Glu885Ala		42284620	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.56	1.976130	0.34848	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.09163	3.31;3.01;3.01;3.01	5.86	4.71	0.59529	.	0.138874	0.47455	D	0.000237	T	0.13415	0.0325	L	0.50333	1.59	0.42072	D	0.991218	P;P	0.49559	0.925;0.829	B;B	0.44163	0.443;0.325	T	0.02411	-1.1163	10	0.41790	T	0.15	-11.1205	12.0707	0.53616	0.0:0.0672:0.0:0.9327	.	684;885	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	A	684;885;885;885	ENSP00000381517:E684A;ENSP00000308759:E885A;ENSP00000381512:E885A;ENSP00000381523:E885A	ENSP00000308759:E885A	E	-	2	0	ZNF295	42284620	1.000000	0.71417	0.314000	0.25224	0.344000	0.29017	4.545000	0.60698	1.039000	0.40074	0.528000	0.53228	GAG		0.532	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727		Missense_Mutation
ZNF41	7592	hgsc.bcm.edu	37	X	47307997	47307997	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0727-01	TCGA-13-0727-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chrX:47307997C>A	ENST00000377065.4	-	5	1811	c.1172G>T	c.(1171-1173)gGc>gTc	p.G391V	ZNF41_ENST00000313116.7_Missense_Mutation_p.G391V|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.G401V	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G391V(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				CTGGGAGAAGCCTTTTCCACA	0.398																																																1	Substitution - Missense(1)	ovary(1)	X											76.0	69.0	72.0					X																	47307997		2203	4300	6503	47192941	SO:0001583	missense	7592			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1172G>T	X.37:g.47307997C>A	ENSP00000366265:p.Gly391Val		47192941	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	CCDS14279.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145488	0.37825	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.35789	1.29;1.29;1.29	3.57	1.67	0.24075	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.216000	0.23583	N	0.046638	T	0.13756	0.0333	N	0.01505	-0.83	0.38763	D	0.954373	B;B;P;B;B	0.47910	0.386;0.386;0.902;0.386;0.44	B;B;B;B;B	0.40864	0.165;0.232;0.339;0.232;0.342	T	0.17899	-1.0354	10	0.49607	T	0.09	.	10.5207	0.44918	0.0:0.6296:0.3703:0.0	.	391;393;401;425;433	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	V	391;391;401	ENSP00000315173:G391V;ENSP00000366265:G391V;ENSP00000380243:G401V	ENSP00000315173:G391V	G	-	2	0	ZNF41	47192941	0.000000	0.05858	0.990000	0.47175	0.983000	0.72400	-0.314000	0.08092	0.315000	0.23110	-0.237000	0.12165	GGC		0.398	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380		Missense_Mutation
ZNF445	353274	hgsc.bcm.edu	37	3	44492426	44492426	+	Silent	SNP	A	A	G			TCGA-13-0727-01	TCGA-13-0727-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr3:44492426A>G	ENST00000396077.2	-	5	974	c.627T>C	c.(625-627)ctT>ctC	p.L209L	ZNF445_ENST00000425708.2_Silent_p.L209L	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	209					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L209L(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CTCTCGGGAAAAGGGCAGGCA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	3											61.0	55.0	57.0					3																	44492426		2203	4300	6503	44467430	SO:0001819	synonymous_variant	353274			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.627T>C	3.37:g.44492426A>G			44467430	Q3MJD1	Silent	SNP	ENST00000396077.2	37	CCDS2713.1	SNP	1	Baylor																																																																																				0.592	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489		Silent
ZNF99	7652	hgsc.bcm.edu	37	19	22942281	22942281	+	Missense_Mutation	SNP	T	T	C	rs564678369	byFrequency	TCGA-13-0727-01	TCGA-13-0727-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0727-01	TCGA-13-0727-10	g.chr19:22942281T>C	ENST00000596209.1	-	4	520	c.430A>G	c.(430-432)Ata>Gta	p.I144V	ZNF99_ENST00000397104.3_Missense_Mutation_p.I165V	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I165V(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CACTGAAATATTTTTCCCTGG	0.284																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	66.0	67.0					19																	22942281		1851	4100	5951	22734121	SO:0001583	missense	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.430A>G	19.37:g.22942281T>C	ENSP00000472969:p.Ile144Val		22734121	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	N	0.136	-1.107660	0.01813	.	.	ENSG00000213973	ENST00000397104	T	0.27557	1.66	1.65	1.65	0.23941	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25568	0.0622	M	0.62723	1.935	0.09310	N	1	B	0.21381	0.055	B	0.20577	0.03	T	0.27773	-1.0064	9	0.16896	T	0.51	.	5.2797	0.15668	0.0:0.0:0.0:1.0	.	165	A8MXY4	ZNF99_HUMAN	V	165	ENSP00000380293:I165V	ENSP00000380293:I165V	I	-	1	0	ZNF99	22734121	0.000000	0.05858	0.003000	0.11579	0.020000	0.10135	-0.177000	0.09796	0.760000	0.33108	0.325000	0.21440	ATA		0.284	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		Missense_Mutation
