#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PPL	5493	genome.wustl.edu	37	16	4937135	4937135	+	Splice_Site	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr16:4937135C>T	ENST00000345988.2	-	21	2697		c.e21+1		PPL_ENST00000590782.2_Splice_Site	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.?(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						AGATCAGTTACCTGTCTGAGG	0.438																																																1	Unknown(1)	ovary(1)	16											169.0	175.0	173.0					16																	4937135		2197	4300	6497	4877136	SO:0001630	splice_region_variant	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2607+1G>A	16.37:g.4937135C>T			4877136	O60314|O60454|Q14C98	Splice_Site_SNP	SNP	ENST00000345988.2	37	CCDS10526.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394007	0.83011	.	.	ENSG00000118898	ENST00000345988	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7959	0.96481	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPL	4877136	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.456000	0.80751	2.689000	0.91719	0.655000	0.94253	.		0.438	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	Intron	Splice_Site_SNP
SCNN1G	6340	genome.wustl.edu	37	16	23205520	23205520	+	Missense_Mutation	SNP	C	C	T	rs543639039		TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr16:23205520C>T	ENST00000300061.2	+	5	981	c.838C>T	c.(838-840)Cat>Tat	p.H280Y	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	280					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)	p.H280Y(1)		NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CCACCCGATGCATGGGAATTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	16											113.0	108.0	110.0					16																	23205520		2197	4300	6497	23113021	SO:0001583	missense	6340			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.838C>T	16.37:g.23205520C>T	ENSP00000300061:p.His280Tyr		23113021	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	37	CCDS10608.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	2.417	-0.333984	0.05278	.	.	ENSG00000166828	ENST00000300061	T	0.59502	0.26	5.04	1.33	0.21861	.	0.417145	0.22551	N	0.058594	T	0.18045	0.0433	N	0.00630	-1.315	0.21627	N	0.999613	B	0.02656	0.0	B	0.06405	0.002	T	0.36432	-0.9748	10	0.02654	T	1	-10.1092	7.7872	0.29099	0.0:0.4522:0.0:0.5478	.	280	P51170	SCNNG_HUMAN	Y	280	ENSP00000300061:H280Y	ENSP00000300061:H280Y	H	+	1	0	SCNN1G	23113021	0.990000	0.36364	0.997000	0.53966	0.994000	0.84299	0.190000	0.17057	0.273000	0.22049	0.655000	0.94253	CAT		0.493	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039		Missense_Mutation
GSX1	219409	genome.wustl.edu	37	13	28368002	28368002	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0765-01	TCGA-13-0765-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr13:28368002A>T	ENST00000302945.2	+	2	760	c.712A>T	c.(712-714)Aag>Tag	p.K238*		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	238					adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.K238*(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CTCCTCAGCCAAGTGCTCCGA	0.672																																																1	Substitution - Nonsense(1)	ovary(1)	13											35.0	34.0	34.0					13																	28368002		2203	4300	6503	27266002	SO:0001587	stop_gained	219409			AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.712A>T	13.37:g.28368002A>T	ENSP00000304331:p.Lys238*		27266002	Q9UD62	Nonsense_Mutation	SNP	ENST00000302945.2	37	CCDS9326.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	35	5.557988	0.96514	.	.	ENSG00000169840	ENST00000302945	.	.	.	4.63	4.63	0.57726	.	0.597438	0.17182	N	0.183834	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0042	0.64453	1.0:0.0:0.0:0.0	.	.	.	.	X	238	.	ENSP00000304331:K238X	K	+	1	0	GSX1	27266002	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	3.231000	0.51294	1.708000	0.51301	0.459000	0.35465	AAG		0.672	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044309.2	NM_145657		Nonsense_Mutation
IGKV1OR10-1	642424	genome.wustl.edu	37	10	42680948	42680948	+	IGR	SNP	G	G	C			TCGA-13-0765-01	TCGA-13-0765-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr10:42680948G>C								None (None upstream) : AL031601.1 (49402 downstream)																							TCAGGTGCCAGATGTGACATC	0.463																																																0			10																																								42000954	SO:0001628	intergenic_variant																																10.37:g.42680948G>C			42000954		Missense_Mutation	SNP		37		SNP	33	WashU																																																																																			0	0.463									Missense_Mutation
DNAJC14	85406	genome.wustl.edu	37	12	56222202	56222202	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0765-01	TCGA-13-0765-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr12:56222202G>A	ENST00000357606.3	-	3	530	c.241C>T	c.(241-243)Cca>Tca	p.P81S	RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317269.3_Missense_Mutation_p.P81S|TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317287.5_Missense_Mutation_p.P81S			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	81					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P81S(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						GGTGGTCCTGGACCCCCTGGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	12											159.0	161.0	160.0					12																	56222202		2203	4300	6503	54508469	SO:0001583	missense	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.241C>T	12.37:g.56222202G>A	ENSP00000350223:p.Pro81Ser		54508469	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579235	0.65878	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287;ENST00000547445	T;T;T	0.58940	0.3;0.3;0.3	5.65	4.74	0.60224	.	0.245579	0.32593	N	0.005891	T	0.44519	0.1297	N	0.24115	0.695	0.32259	N	0.570353	P;P	0.37061	0.58;0.58	B;B	0.37601	0.254;0.254	T	0.57785	-0.7751	10	0.45353	T	0.12	-4.0035	12.7358	0.57222	0.0:0.1651:0.8349:0.0	.	81;81	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	S	81	ENSP00000350223:P81S;ENSP00000316240:P81S;ENSP00000317500:P81S	ENSP00000316240:P81S	P	-	1	0	DNAJC14	54508469	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.641000	0.61375	1.495000	0.48549	0.650000	0.86243	CCA		0.557	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364		Missense_Mutation
ZNF479	90827	genome.wustl.edu	37	7	57187711	57187711	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr7:57187711C>T	ENST00000331162.4	-	5	1681	c.1411G>A	c.(1411-1413)Ggc>Agc	p.G471S		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	471					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G471S(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			AAGGCTTTGCCACATTCTTCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											43.0	43.0	43.0					7																	57187711		2068	4224	6292	57191653	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1411G>A	7.37:g.57187711C>T	ENSP00000333776:p.Gly471Ser		57191653		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	c	13.62	2.291611	0.40494	.	.	ENSG00000185177	ENST00000331162	T	0.07216	3.21	0.955	-0.325	0.12702	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09158	0.0226	L	0.28649	0.875	0.22762	N	0.998764	P	0.39060	0.657	P	0.47206	0.541	T	0.32161	-0.9917	9	0.66056	D	0.02	.	5.4604	0.16614	0.0:0.769:0.0:0.231	.	471	Q96JC4	ZN479_HUMAN	S	471	ENSP00000333776:G471S	ENSP00000333776:G471S	G	-	1	0	ZNF479	57191653	0.980000	0.34600	0.016000	0.15963	0.015000	0.08874	2.002000	0.40835	-0.569000	0.06030	-0.573000	0.04149	GGC		0.413	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		Missense_Mutation
RARRES3	5920	genome.wustl.edu	37	11	63306999	63306999	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0765-01	TCGA-13-0765-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr11:63306999G>T	ENST00000255688.3	+	2	69	c.21G>T	c.(19-21)gaG>gaT	p.E7D	RARRES3_ENST00000354445.2_Splice_Site_p.K7N|RARRES3_ENST00000537871.1_Intron|RARRES3_ENST00000439013.2_Missense_Mutation_p.E7D	NM_004585.3	NP_004576.2	Q9UL19	HRSL4_HUMAN	retinoic acid receptor responder (tazarotene induced) 3	7					lipid catabolic process (GO:0016042)|negative regulation of cell proliferation (GO:0008285)|phospholipid metabolic process (GO:0006644)	integral component of membrane (GO:0016021)	phospholipase A2 activity (GO:0004623)	p.E7D(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	6						CACACCAAGAGCCCAAACCTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											108.0	115.0	113.0					11																	63306999		2196	4298	6494	63063575	SO:0001583	missense	5920				CCDS41662.1	11q23	2008-05-02			ENSG00000133321	ENSG00000133321			9869	protein-coding gene	gene with protein product		605092				9270552	Standard	NM_004585		Approved	TIG3, HRASLS4	uc001nxf.4	Q9UL19	OTTHUMG00000167850	ENST00000255688.3:c.21G>T	11.37:g.63306999G>T	ENSP00000255688:p.Glu7Asp		63063575	B2R599|B4DDW2|E7ENZ7|O95200	Missense_Mutation	SNP	ENST00000255688.3	37	CCDS41662.1	SNP	34	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.74|11.74	1.729540|1.729540	0.30684|0.30684	.|.	.|.	ENSG00000133321|ENSG00000133321	ENST00000439013;ENST00000255688|ENST00000354445	T;T|T	0.23147|0.23754	1.92;1.92|1.89	4.35|4.35	-8.71|-8.71	0.00848|0.00848	.|.	0.153629|.	0.41605|.	U|.	0.000851|.	T|T	0.14013|0.14013	0.0339|0.0339	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	D|.	0.52996|.	0.957|.	D|.	0.74348|.	0.983|.	T|T	0.20338|0.20338	-1.0278|-1.0278	10|7	0.62326|0.41790	D|T	0.03|0.15	.|.	1.6153|1.6153	0.02702|0.02702	0.4536:0.095:0.1655:0.2859|0.4536:0.095:0.1655:0.2859	.|.	7|.	Q9UL19|.	TIG3_HUMAN|.	D|N	7|7	ENSP00000402943:E7D;ENSP00000255688:E7D|ENSP00000346431:K7N	ENSP00000255688:E7D|ENSP00000346431:K7N	E|K	+|+	3|3	2|2	RARRES3|RARRES3	63063575|63063575	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-2.003000|-2.003000	0.01463|0.01463	-2.363000|-2.363000	0.00608|0.00608	0.563000|0.563000	0.77884|0.77884	GAG|AAG		0.557	RARRES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396629.1			Missense_Mutation
GLG1	2734	genome.wustl.edu	37	16	74485996	74485996	+	3'UTR	SNP	T	T	G			TCGA-13-0765-01	TCGA-13-0765-10	T	T	G	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr16:74485996T>G	ENST00000422840.2	-	0	4608				RP11-252A24.7_ENST00000566788.1_lincRNA|GLG1_ENST00000205061.5_Missense_Mutation_p.K1190N|GLG1_ENST00000447066.2_Missense_Mutation_p.K1179N	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1						blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.K1190N(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						ACACTAAACCTTTATAAGCCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	16											140.0	115.0	123.0					16																	74485996		2198	4300	6498	73043497	SO:0001624	3_prime_UTR_variant	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.*1069A>C	16.37:g.74485996T>G			73043497	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	15.49	2.849236	0.51270	.	.	ENSG00000090863	ENST00000205061;ENST00000447066	.	.	.	4.71	1.11	0.20524	.	0.560844	0.14679	N	0.304858	T	0.27063	0.0663	.	.	.	0.09310	N	1	B;B	0.22146	0.065;0.039	B;B	0.18871	0.023;0.01	T	0.17501	-1.0367	8	0.49607	T	0.09	-17.4149	4.4212	0.11481	0.0:0.181:0.1685:0.6505	.	1190;1179	Q92896-2;B7Z8Y4	.;.	N	1190;1179	.	ENSP00000205061:K1190N	K	-	3	2	GLG1	73043497	0.003000	0.15002	0.002000	0.10522	0.980000	0.70556	0.377000	0.20552	-0.019000	0.14055	0.533000	0.62120	AAA		0.502	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		Missense_Mutation
LIMK1	3984	genome.wustl.edu	37	7	73520519	73520519	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0765-01	TCGA-13-0765-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr7:73520519C>A	ENST00000336180.2	+	7	878	c.827C>A	c.(826-828)cCg>cAg	p.P276Q	LIMK1_ENST00000538333.3_Missense_Mutation_p.P242Q|LIMK1_ENST00000418310.1_Missense_Mutation_p.P306Q	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	276					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P276Q(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CTGAGCTCTCCGGCTTATACT	0.637																																																1	Substitution - Missense(1)	ovary(1)	7											94.0	110.0	105.0					7																	73520519		2203	4300	6503	73158455	SO:0001583	missense	3984			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.827C>A	7.37:g.73520519C>A	ENSP00000336740:p.Pro276Gln		73158455	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	ENST00000336180.2	37	CCDS5563.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270295	0.40194	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.75260	-0.89;-0.88;-0.92	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.82990	0.5157	M	0.65498	2.005	0.49687	D	0.999814	D;D;D	0.63880	0.983;0.985;0.993	P;P;P	0.62184	0.579;0.796;0.899	D	0.84137	0.0415	10	0.51188	T	0.08	-20.6067	15.5083	0.75760	0.0:1.0:0.0:0.0	.	171;242;276	Q59FA3;B7Z6I8;P53667	.;.;LIMK1_HUMAN	Q	306;276;276;242	ENSP00000409717:P306Q;ENSP00000336740:P276Q;ENSP00000444452:P242Q	ENSP00000336740:P276Q	P	+	2	0	LIMK1	73158455	0.741000	0.28217	0.913000	0.36048	0.020000	0.10135	2.671000	0.46842	2.264000	0.75181	0.555000	0.69702	CCG		0.637	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314		Missense_Mutation
PI15	51050	genome.wustl.edu	37	8	75756233	75756233	+	Silent	SNP	T	T	A			TCGA-13-0765-01	TCGA-13-0765-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr8:75756233T>A	ENST00000260113.2	+	3	470	c.291T>A	c.(289-291)ctT>ctA	p.L97L	PI15_ENST00000523773.1_Silent_p.L97L|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000522914.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	97	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.L97L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			ATGAAAATCTTGCAAAATCGG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	8											103.0	105.0	104.0					8																	75756233		2203	4300	6503	75918788	SO:0001819	synonymous_variant	51050			D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.291T>A	8.37:g.75756233T>A			75918788	Q68CY1	Silent	SNP	ENST00000260113.2	37	CCDS6218.1	SNP	63	WashU																																																																																				0.403	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886		Silent
CYLC1	1538	genome.wustl.edu	37	X	83128902	83128902	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0765-01	TCGA-13-0765-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chrX:83128902A>C	ENST00000329312.4	+	4	1223	c.1186A>C	c.(1186-1188)Aag>Cag	p.K396Q		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	396					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K395Q(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAATGATGACAAGAAAAAGGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	X											30.0	25.0	26.0					X																	83128902		2195	4289	6484	83015558	SO:0001583	missense	1538			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1186A>C	X.37:g.83128902A>C	ENSP00000331556:p.Lys396Gln		83015558	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	a	5.796	0.331108	0.10956	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.26660	1.72	3.85	3.85	0.44370	.	.	.	.	.	T	0.38161	0.1030	L	0.47190	1.495	0.09310	N	1	D;D	0.76494	0.999;0.998	D;D	0.69479	0.964;0.943	T	0.09640	-1.0665	9	0.31617	T	0.26	2.0408	8.2041	0.31443	1.0:0.0:0.0:0.0	.	396;396	P35663;F5H4V5	CYLC1_HUMAN;.	Q	396	ENSP00000331556:K396Q	ENSP00000331556:K396Q	K	+	1	0	CYLC1	83015558	0.836000	0.29430	0.023000	0.16930	0.030000	0.12068	2.038000	0.41184	1.526000	0.49068	0.486000	0.48141	AAG		0.343	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		Missense_Mutation
ZNF592	9640	genome.wustl.edu	37	15	85327688	85327688	+	Silent	SNP	C	C	T	rs138523629		TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr15:85327688C>T	ENST00000560079.2	+	4	2070	c.1782C>T	c.(1780-1782)gaC>gaT	p.D594D	ZNF592_ENST00000299927.3_Silent_p.D594D	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	594					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D594D(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGTGTGGAGACGCATTTGCCT	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19326	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15						C		1,4405	2.1+/-5.4	0,1,2202	114.0	111.0	112.0		1782	-5.2	0.7	15	dbSNP_134	112	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	ZNF592	NM_014630.2		0,2,6500	TT,TC,CC		0.0116,0.0227,0.0154		594/1268	85327688	2,13002	2203	4299	6502	83128692	SO:0001819	synonymous_variant	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1782C>T	15.37:g.85327688C>T			83128692	Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	37	CCDS32317.1	SNP	19	WashU																																																																																				0.612	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		Silent
CDC14B	8555	genome.wustl.edu	37	9	99266068	99266068	+	Silent	SNP	G	G	A			TCGA-13-0765-01	TCGA-13-0765-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr9:99266068G>A	ENST00000375241.1	-	14	1915	c.1464C>T	c.(1462-1464)ctC>ctT	p.L488L	CDC14B_ENST00000265659.2_Intron|CDC14B_ENST00000375242.3_Silent_p.L451L|CDC14B_ENST00000463569.1_3'UTR|CDC14B_ENST00000375240.3_Silent_p.L449L	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	488					activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L449L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				TTGAAATGGAGAGACTACAGG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	9											77.0	75.0	75.0					9																	99266068		2203	4300	6503	98305889	SO:0001819	synonymous_variant	8555			AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1464C>T	9.37:g.99266068G>A			98305889	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Silent	SNP	ENST00000375241.1	37	CCDS6722.1	SNP	33	WashU																																																																																				0.398	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331		Silent
ARMCX5	64860	genome.wustl.edu	37	X	101858100	101858100	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chrX:101858100C>G	ENST00000604957.1	+	1	3653	c.1031C>G	c.(1030-1032)aCt>aGt	p.T344S	ARMCX5_ENST00000541409.1_Missense_Mutation_p.T344S|ARMCX5_ENST00000372742.1_Missense_Mutation_p.T344S|RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000536530.1_Missense_Mutation_p.T344S|ARMCX5_ENST00000537008.1_Missense_Mutation_p.T344S|ARMCX5_ENST00000246174.2_Missense_Mutation_p.T344S|RP4-769N13.6_ENST00000476910.2_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	344								p.T344S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TATCCATTTACTCAAGATATA	0.348																																																1	Substitution - Missense(1)	ovary(1)	X											95.0	93.0	94.0					X																	101858100		2203	4300	6503	101744756	SO:0001583	missense	64860				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1031C>G	X.37:g.101858100C>G	ENSP00000474720:p.Thr344Ser		101744756	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	11.49	1.654616	0.29425	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	3.66	3.66	0.41972	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.40728	N	0.001039	T	0.40247	0.1109	L	0.43152	1.355	0.26636	N	0.972376	D	0.76494	0.999	D	0.81914	0.995	T	0.14200	-1.0481	10	0.14656	T	0.56	-9.2117	9.9289	0.41510	0.0:1.0:0.0:0.0	.	344	Q6P1M9	ARMX5_HUMAN	S	344	ENSP00000246174:T344S;ENSP00000439001:T344S;ENSP00000446385:T344S;ENSP00000445851:T344S;ENSP00000361827:T344S	ENSP00000246174:T344S	T	+	2	0	ARMCX5	101744756	0.934000	0.31675	0.985000	0.45067	0.983000	0.72400	1.651000	0.37302	2.092000	0.63282	0.600000	0.82982	ACT		0.348	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838		Missense_Mutation
TDG	6996	genome.wustl.edu	37	12	104379399	104379399	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr12:104379399C>T	ENST00000392872.3	+	9	1217	c.983C>T	c.(982-984)gCt>gTt	p.A328V	TDG_ENST00000544861.1_Missense_Mutation_p.A185V|TDG_ENST00000266775.9_Missense_Mutation_p.A324V|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Missense_Mutation_p.A124V	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	328					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)	p.A328V(1)		large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		AAGAAGATGGCTGTTAAGGAA	0.363								Base excision repair (BER), DNA glycosylases																																								1	Substitution - Missense(1)	ovary(1)	12											148.0	132.0	138.0					12																	104379399		2203	4300	6503	102903529	SO:0001583	missense	6996			U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.983C>T	12.37:g.104379399C>T	ENSP00000376611:p.Ala328Val		102903529	Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	ENST00000392872.3	37	CCDS9095.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270826	0.80469	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	T;T;T;T	0.26810	1.98;1.98;2.03;1.71	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.29749	0.0743	L	0.61218	1.895	0.80722	D	1	B;B;B	0.30482	0.281;0.013;0.013	B;B;B	0.16289	0.015;0.005;0.005	T	0.03325	-1.1048	10	0.44086	T	0.13	-8.8684	20.1166	0.97939	0.0:1.0:0.0:0.0	.	124;328;328	B4DI29;B2R848;Q13569	.;.;TDG_HUMAN	V	328;324;185;124	ENSP00000376611:A328V;ENSP00000266775:A324V;ENSP00000445899:A185V;ENSP00000439054:A124V	ENSP00000266775:A324V	A	+	2	0	TDG	102903529	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.806000	0.86020	2.758000	0.94735	0.655000	0.94253	GCT		0.363	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2			Missense_Mutation
LPAR1	1902	genome.wustl.edu	37	9	113704270	113704270	+	Missense_Mutation	SNP	T	T	C	rs371341035		TCGA-13-0765-01	TCGA-13-0765-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr9:113704270T>C	ENST00000374431.3	-	4	607	c.224A>G	c.(223-225)tAt>tGt	p.Y75C	LPAR1_ENST00000374430.2_Missense_Mutation_p.Y75C|LPAR1_ENST00000358883.4_Missense_Mutation_p.Y75C|LPAR1_ENST00000538760.1_Missense_Mutation_p.Y76C|LPAR1_ENST00000541779.1_Missense_Mutation_p.Y76C	NM_057159.2	NP_476500.1	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	75					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|bleb assembly (GO:0032060)|cellular response to oxygen levels (GO:0071453)|G-protein coupled receptor signaling pathway (GO:0007186)|myelination (GO:0042552)|negative regulation of neuron projection development (GO:0010977)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.Y75C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(6)|skin(1)	21						GCGGTTGACATAGATTGCCAC	0.458																																					NSCLC(115;661 2323 9836 34256)											1	Substitution - Missense(1)	ovary(1)	9						T	CYS/TYR,CYS/TYR	0,4406		0,0,2203	87.0	86.0	86.0		224,224	5.4	1.0	9		86	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LPAR1	NM_001401.3,NM_057159.2	194,194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging	75/365,75/365	113704270	1,13005	2203	4300	6503	112744091	SO:0001583	missense	1902			U80811	CCDS6777.1	9q	2012-08-08	2008-04-11	2008-04-11	ENSG00000198121	ENSG00000198121		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3166	protein-coding gene	gene with protein product		602282	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2"""	EDG2		8922387, 9070858	Standard	NM_001401		Approved	edg-2, rec.1.3, vzg-1, Gpcr26, Mrec1.3, LPA1, GPR26	uc004bfc.3	Q92633	OTTHUMG00000020486	ENST00000374431.3:c.224A>G	9.37:g.113704270T>C	ENSP00000363553:p.Tyr75Cys		112744091	B4DK36|O00656|O00722|P78351	Missense_Mutation	SNP	ENST00000374431.3	37	CCDS6777.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	18.76	3.693733	0.68386	0.0	1.16E-4	ENSG00000198121	ENST00000374431;ENST00000541779;ENST00000374430;ENST00000358883;ENST00000449490;ENST00000538760;ENST00000441240	T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	L	0.28400	0.85	0.80722	D	1	D;D;D	0.61697	0.99;0.99;0.99	D;D;D	0.67231	0.95;0.95;0.95	T	0.46679	-0.9174	10	0.56958	D	0.05	.	14.5418	0.67999	0.0:0.0:0.0:1.0	.	76;76;75	B4DQ18;B4DK36;Q92633	.;.;LPAR1_HUMAN	C	75;76;75;75;57;76;75	ENSP00000363553:Y75C;ENSP00000445697:Y76C;ENSP00000363552:Y75C;ENSP00000351755:Y75C;ENSP00000440201:Y76C;ENSP00000401810:Y75C	ENSP00000351755:Y75C	Y	-	2	0	LPAR1	112744091	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.996000	0.88334	2.049000	0.60858	0.533000	0.62120	TAT		0.458	LPAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053631.1	NM_057159		Missense_Mutation
ATRNL1	26033	genome.wustl.edu	37	10	117154169	117154169	+	Splice_Site	SNP	C	C	G			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr10:117154169C>G	ENST00000355044.3	+	20	3302	c.3176C>G	c.(3175-3177)gCt>gGt	p.A1059G	ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Splice_Site_p.A110G	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1059	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.A1059G(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGACTTACAGCTTGTACATGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	10											136.0	123.0	127.0					10																	117154169		2203	4300	6503	117144159	SO:0001630	splice_region_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3176-1C>G	10.37:g.117154169C>G			117144159	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	SNP	28	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.54|19.54	3.846834|3.846834	0.71603|0.71603	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.63255|.	-0.03;1.8|.	5.61|5.61	5.61|5.61	0.85477|0.85477	EGF-like, laminin (2);|.	0.097167|.	0.64402|.	D|.	0.000001|.	T|T	0.75803|0.75803	0.3899|0.3899	M|M	0.77820|0.77820	2.39|2.39	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.997|.	D;D|.	0.75020|.	0.985;0.985|.	T|T	0.76094|0.76094	-0.3085|-0.3085	9|5	.|.	.|.	.|.	.|.	15.1377|15.1377	0.72583|0.72583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	110;1059|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	G|R	1059;110|142	ENSP00000347152:A1059G;ENSP00000409624:A110G|.	.|.	A|S	+|+	2|3	0|2	ATRNL1|ATRNL1	117144159|117144159	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	4.442000|4.442000	0.59988|0.59988	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GCT|AGC		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	Missense_Mutation	Missense_Mutation
PTPRN2	5799	genome.wustl.edu	37	7	157387981	157387981	+	Silent	SNP	C	C	T	rs139538258		TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr7:157387981C>T	ENST00000389418.4	-	17	2454	c.2445G>A	c.(2443-2445)gcG>gcA	p.A815A	PTPRN2_ENST00000409483.1_Silent_p.A777A|PTPRN2_ENST00000389416.4_Silent_p.A798A|PTPRN2_ENST00000389413.3_Silent_p.A786A|PTPRN2_ENST00000404321.2_Silent_p.A838A	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	815	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A815A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TGGCGATGTACGCGGGGTTCC	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		17316	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7							,,	5,4401	9.9+/-24.2	0,5,2198	60.0	66.0	64.0		2445,2394,2358	-10.2	0.5	7	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	,,	0,6,6497	TT,TC,CC		0.0116,0.1135,0.0461	,,	815/1016,798/999,786/987	157387981	6,13000	2203	4300	6503	157080742	SO:0001819	synonymous_variant	5799			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2445G>A	7.37:g.157387981C>T			157080742	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	37	CCDS5947.1	SNP	19	WashU																																																																																				0.522	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			Silent
ILDR2	387597	genome.wustl.edu	37	1	166905934	166905934	+	Silent	SNP	G	G	A			TCGA-13-0765-01	TCGA-13-0765-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr1:166905934G>A	ENST00000271417.3	-	5	652	c.597C>T	c.(595-597)ctC>ctT	p.L199L	ILDR2_ENST00000528703.1_Silent_p.L199L|ILDR2_ENST00000529071.1_Silent_p.L180L|ILDR2_ENST00000526687.1_Intron|ILDR2_ENST00000525740.1_Intron|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000469934.2_Silent_p.L199L	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	199					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L199L(1)		NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GGACGAAGAAGAGGAAGACGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											70.0	74.0	72.0					1																	166905934		2203	4300	6503	165172558	SO:0001819	synonymous_variant	387597			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.597C>T	1.37:g.166905934G>A			165172558		Silent	SNP	ENST00000271417.3	37	CCDS1256.1	SNP	33	WashU																																																																																				0.617	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351		Silent
ASTN1	460	genome.wustl.edu	37	1	176992701	176992701	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr1:176992701C>A	ENST00000367654.3	-	7	1488	c.1277G>T	c.(1276-1278)cGc>cTc	p.R426L	ASTN1_ENST00000367657.3_Missense_Mutation_p.R426L|ASTN1_ENST00000361833.2_Missense_Mutation_p.R426L|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.R426L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	426					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R426L(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CAAGATGAAGCGGCTCCCTGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	37.0	38.0					1																	176992701		2203	4300	6503	175259324	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1277G>T	1.37:g.176992701C>A	ENSP00000356626:p.Arg426Leu		175259324	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431005	0.83776	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16597	2.33;2.75;2.75;2.34	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	N	0.24115	0.695	0.58432	D	0.999999	P;B;B	0.35107	0.484;0.102;0.113	B;B;B	0.29077	0.098;0.058;0.04	T	0.03576	-1.1023	10	0.66056	D	0.02	-32.0951	19.5786	0.95455	0.0:1.0:0.0:0.0	.	426;426;426	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	L	426	ENSP00000356629:R426L;ENSP00000354536:R426L;ENSP00000356626:R426L;ENSP00000395041:R426L	ENSP00000354536:R426L	R	-	2	0	ASTN1	175259324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.750000	0.68712	2.726000	0.93360	0.655000	0.94253	CGC		0.567	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		Missense_Mutation
HMCN1	83872	genome.wustl.edu	37	1	186092234	186092234	+	Silent	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr1:186092234C>T	ENST00000271588.4	+	81	12610	c.12381C>T	c.(12379-12381)gtC>gtT	p.V4127V	HMCN1_ENST00000367492.2_Silent_p.V4127V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4127	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.V4127V(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCCAGCGCGTCCTCAGCTCTG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	1											98.0	76.0	83.0					1																	186092234		2203	4300	6503	184358857	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12381C>T	1.37:g.186092234C>T			184358857	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	30	WashU																																																																																				0.537	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Silent
MAP1LC3C	440738	genome.wustl.edu	37	1	242159668	242159668	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr1:242159668C>T	ENST00000357246.3	-	4	305	c.241G>A	c.(241-243)Gcc>Acc	p.A81T		NM_001004343.2	NP_001004343.1	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3 gamma	81					autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|microtubule (GO:0005874)|organelle membrane (GO:0031090)		p.A81T(1)		endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GCTTCCGTGGCTCTCAGGACC	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	112.0	117.0					1																	242159668		2203	4300	6503	240226291	SO:0001583	missense	440738			AF276659	CCDS31074.1	1q43	2014-02-12			ENSG00000197769	ENSG00000197769			13353	protein-coding gene	gene with protein product		609605				12740394	Standard	NM_001004343		Approved	ATG8J	uc001hzk.2	Q9BXW4	OTTHUMG00000039865	ENST00000357246.3:c.241G>A	1.37:g.242159668C>T	ENSP00000349785:p.Ala81Thr		240226291	A0PJY8|A2RUP0	Missense_Mutation	SNP	ENST00000357246.3	37	CCDS31074.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	7.652	0.683081	0.14907	.	.	ENSG00000197769	ENST00000357246	T	0.47528	0.84	4.18	2.26	0.28386	.	0.115203	0.64402	N	0.000014	T	0.45518	0.1346	M	0.79258	2.445	0.09310	N	1	B	0.11235	0.004	B	0.20767	0.031	T	0.48958	-0.8988	10	0.87932	D	0	.	5.9007	0.18965	0.1552:0.6742:0.0:0.1705	.	81	Q9BXW4	MLP3C_HUMAN	T	81	ENSP00000349785:A81T	ENSP00000349785:A81T	A	-	1	0	MAP1LC3C	240226291	0.651000	0.27340	0.003000	0.11579	0.266000	0.26442	0.975000	0.29449	0.388000	0.25054	0.643000	0.83706	GCC		0.562	MAP1LC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096185.1	NM_001004343		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577146	7577147	+	In_Frame_Ins	INS	-	-	AGATTACCACTACTC			TCGA-13-0765-01	TCGA-13-0765-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr17:7577146_7577147insAGATTACCACTACTC	ENST00000269305.4	-	8	980_981	c.791_792insGAGTAGTGGTAATCT	c.(790-792)cta>ctGAGTAGTGGTAATCTa	p.264_264L>LSSGNL	TP53_ENST00000359597.4_In_Frame_Ins_p.264_264L>LSSGNL|TP53_ENST00000445888.2_In_Frame_Ins_p.264_264L>LSSGNL|TP53_ENST00000420246.2_In_Frame_Ins_p.264_264L>LSSGNL|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_In_Frame_Ins_p.264_264L>LSSGNL|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	264	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> I (in sporadic cancers; somatic mutation).|L -> P (in a sporadic cancer; somatic mutation).|L -> Q (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L264del(4)|p.?(4)|p.G262_F270delGNLLGRNSF(2)|p.L265del(2)|p.G262_S269delGNLLGRNS(2)|p.S261_L264>R(1)|p.N263fs*5(1)|p.264_265insSSGNL(1)|p.L264R(1)|p.E258fs*71(1)|p.L265fs*81(1)|p.G262fs*2(1)|p.L264fs*81(1)|p.L264P(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCGTCCCAGTAGATTACCACT	0.52		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Deletion - In frame(10)|Whole gene deletion(8)|Unknown(4)|Deletion - Frameshift(4)|Substitution - Missense(2)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	ovary(5)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|central_nervous_system(2)|lung(2)|eye(1)|kidney(1)|urinary_tract(1)|liver(1)|skin(1)|stomach(1)|breast(1)	17																																								7517872	SO:0001652	inframe_insertion	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.791_792insGAGTAGTGGTAATCT	17.37:g.7577146_7577147insAGATTACCACTACTC	ENSP00000269305:p.SerSerGlyAsnLeu264dup		7517871	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	57	WashU																																																																																				0.520	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		In_Frame_Ins
CPZ	8532	genome.wustl.edu	37	4	8609121	8609123	+	In_Frame_Del	DEL	AGA	AGA	-	rs147815913	byFrequency	TCGA-13-0765-01	TCGA-13-0765-10	AGA	AGA	AGA	-	AGA	AGA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr4:8609121_8609123delAGA	ENST00000360986.4	+	7	1370_1372	c.1196_1198delAGA	c.(1195-1200)gagaag>gag	p.K400del	CPZ_ENST00000382480.2_In_Frame_Del_p.K263del|CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_In_Frame_Del_p.K389del	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	400					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.K400del(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCCCAGGAGGAGAAGATGTTTTC	0.621											OREG0016100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - In frame(1)	ovary(1)	4																																								8660023	SO:0001651	inframe_deletion	8532			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1196_1198delAGA	4.37:g.8609124_8609126delAGA	ENSP00000354255:p.Lys400del	650	8660021	O00520|Q96MX2	In_Frame_Del	DEL	ENST00000360986.4	37	CCDS33953.1	DEL	11	WashU																																																																																				0.621	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652		In_Frame_Del
OR51I2	390064	genome.wustl.edu	37	11	5475451	5475451	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0765-01	TCGA-13-0765-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr11:5475451A>G	ENST00000341449.2	+	1	814	c.733A>G	c.(733-735)Atc>Gtc	p.I245V	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	245					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I245V(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGTCACATATCCTGGCTGT	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											262.0	220.0	234.0					11																	5475451		2201	4297	6498	5432027	SO:0001583	missense	390064			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.733A>G	11.37:g.5475451A>G	ENSP00000341987:p.Ile245Val		5432027	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	4.644	0.119713	0.08881	.	.	ENSG00000187918	ENST00000341449	T	0.37058	1.22	5.58	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.184247	0.38492	N	0.001662	T	0.27419	0.0673	L	0.49640	1.575	0.27786	N	0.942972	B	0.27823	0.19	B	0.27262	0.078	T	0.21965	-1.0230	10	0.44086	T	0.13	.	3.4334	0.07437	0.6456:0.1433:0.0741:0.137	.	245	Q9H344	O51I2_HUMAN	V	245	ENSP00000341987:I245V	ENSP00000341987:I245V	I	+	1	0	OR51I2	5432027	0.000000	0.05858	0.341000	0.25589	0.040000	0.13550	-0.208000	0.09371	0.509000	0.28195	-0.316000	0.08728	ATC		0.478	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754		Missense_Mutation
RP11-754I20.1	0	genome.wustl.edu	37	14	19118280	19118280	+	RNA	SNP	C	C	T			TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr14:19118280C>T	ENST00000553170.1	+	0	291				RNU6-458P_ENST00000384179.1_RNA																							GATTGCAGAACGTTATGCTGT	0.373																																																0			14																																								18188280																																		14.37:g.19118280C>T			18188280		Missense_Mutation	SNP	ENST00000553170.1	37		SNP	19	WashU																																																																																				0.373	RP11-754I20.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000408394.1			Missense_Mutation
SLC39A11	201266	genome.wustl.edu	37	17	71084828	71084829	+	Missense_Mutation	DNP	CC	CC	AG	rs375622892		TCGA-13-0765-01	TCGA-13-0765-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr17:71084828_71084829CC>AG	ENST00000542342.2	-	2	163_164	c.75_76GG>CT	c.(73-78)ggGGca>ggCTca	p.A26S	SLC39A11_ENST00000579732.1_Missense_Mutation_p.A26S|SLC39A11_ENST00000255559.3_Missense_Mutation_p.A26S	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	26					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						ACGAGAGCTGCCCCAGCTGCTG	0.579																																					NSCLC(95;736 1527 12296 39625 41839)											0			17																																								68596424	SO:0001583	missense	201266			AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.75_76delinsAG	17.37:g.71084828_71084829delinsAG	ENSP00000445829:p.Ala26Ser		68596423	B2R8H7|Q8WZ81	Missense	DNP	ENST00000542342.2	37	CCDS54160.1	DNP	26	WashU																																																																																				0.579	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1			Missense
C6	729	genome.wustl.edu	37	5	41149516	41149516	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0765-01	TCGA-13-0765-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0765-01	TCGA-13-0765-10	g.chr5:41149516T>C	ENST00000263413.3	-	17	2714	c.2450A>G	c.(2449-2451)aAg>aGg	p.K817R	C6_ENST00000337836.5_Missense_Mutation_p.K817R	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	817	C5b-binding domain.|Factor I module (FIM) 1.|Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.K817R(1)|p.K817T(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AGCCAAAAACTTACAAGCGGG	0.423																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											126.0	134.0	131.0					5																	41149516		2203	4300	6503	41185273	SO:0001583	missense	729			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2450A>G	5.37:g.41149516T>C	ENSP00000263413:p.Lys817Arg		41185273		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	9.740	1.164674	0.21538	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.04454	3.62;3.62	5.97	3.47	0.39725	Proteinase inhibitor I1, Kazal (1);Factor I / membrane attack complex (1);Protease inhibitor, Kazal-type (1);	0.511596	0.22714	N	0.056534	T	0.07188	0.0182	M	0.72894	2.215	0.09310	N	0.999997	P	0.40731	0.728	B	0.37833	0.259	T	0.19778	-1.0295	10	0.37606	T	0.19	-3.3395	9.2544	0.37575	0.1224:0.0:0.1285:0.7492	.	817	P13671	CO6_HUMAN	R	817	ENSP00000338861:K817R;ENSP00000263413:K817R	ENSP00000263413:K817R	K	-	2	0	C6	41185273	0.987000	0.35691	0.202000	0.23494	0.238000	0.25445	1.215000	0.32431	0.445000	0.26639	0.533000	0.62120	AAG		0.423	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			Missense_Mutation
