#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACOT11	26027	hgsc.bcm.edu	37	1	55059671	55059671	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:55059671A>T	ENST00000371316.3	+	5	512	c.430A>T	c.(430-432)Aag>Tag	p.K144*	ACOT11_ENST00000343744.2_Nonsense_Mutation_p.K144*|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	144	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)	p.K144*(1)		NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GAATGTGTGCAAGGCCTTGGC	0.607																																					Ovarian(148;1440 1861 22015 32453 51933)											1	Substitution - Nonsense(1)	ovary(1)	1											91.0	84.0	87.0					1																	55059671		2203	4300	6503	54832259	SO:0001587	stop_gained	26027			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.430A>T	1.37:g.55059671A>T	ENSP00000360366:p.Lys144*		54832259	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Nonsense_Mutation	SNP	ENST00000371316.3	37	CCDS592.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	37	6.018673	0.97205	.	.	ENSG00000162390	ENST00000343744;ENST00000371316	.	.	.	5.05	5.05	0.67936	.	0.200555	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-15.7356	9.361	0.38195	0.92:0.0:0.08:0.0	.	.	.	.	X	144	.	ENSP00000340260:K144X	K	+	1	0	ACOT11	54832259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.582000	0.60957	1.895000	0.54865	0.459000	0.35465	AAG		0.607	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547		Nonsense_Mutation
ACTR3B	57180	hgsc.bcm.edu	37	7	152549270	152549270	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr7:152549270G>T	ENST00000256001.8	+	10	1145	c.1011G>T	c.(1009-1011)agG>agT	p.R337S	ACTR3B_ENST00000537264.1_Missense_Mutation_p.R249S|ACTR3B_ENST00000397282.2_Missense_Mutation_p.R249S|ACTR3B_ENST00000377776.3_Intron	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	337						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GACTGCAGAGGGATTTGAAGA	0.597																																																0			7											116.0	109.0	112.0					7																	152549270		2203	4300	6503	152180203	SO:0001583	missense	57180				CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.1011G>T	7.37:g.152549270G>T	ENSP00000256001:p.Arg337Ser		152180203	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Missense_Mutation	SNP	ENST00000256001.8	37	CCDS5934.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353659	0.41700	.	.	ENSG00000133627	ENST00000256001;ENST00000397282;ENST00000537264	D;D;D	0.94330	-3.4;-3.4;-3.4	5.14	2.63	0.31362	.	0.000000	0.64402	U	0.000004	D	0.95345	0.8489	M	0.75615	2.305	0.42186	D	0.991701	D	0.89917	1.0	D	0.97110	1.0	D	0.93648	0.6970	10	0.87932	D	0	-8.3553	7.194	0.25841	0.6502:0.0:0.3498:0.0	.	337	Q9P1U1	ARP3B_HUMAN	S	337;249;249	ENSP00000256001:R337S;ENSP00000380452:R249S;ENSP00000446157:R249S	ENSP00000256001:R337S	R	+	3	2	ACTR3B	152180203	0.997000	0.39634	0.995000	0.50966	0.131000	0.20780	0.540000	0.23191	0.294000	0.22547	-0.455000	0.05494	AGG		0.597	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445		Missense_Mutation
ADAMTS16	170690	hgsc.bcm.edu	37	5	5319202	5319202	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:5319202A>T	ENST00000274181.7	+	23	3764	c.3626A>T	c.(3625-3627)aAg>aTg	p.K1209M		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1209	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K1209M(1)|p.K1209R(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TGCAGCCACAAGTTCTACGGC	0.522																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											49.0	51.0	50.0					5																	5319202		2018	4182	6200	5372202	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3626A>T	5.37:g.5319202A>T	ENSP00000274181:p.Lys1209Met		5372202	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458093	0.63401	.	.	ENSG00000145536	ENST00000274181	T	0.52057	0.68	4.54	-5.19	0.02832	PLAC (2);	0.457730	0.21722	N	0.070120	T	0.44685	0.1305	L	0.52573	1.65	0.34882	D	0.744689	D	0.55172	0.97	P	0.57548	0.823	T	0.53837	-0.8382	10	0.31617	T	0.26	.	5.5384	0.17023	0.3497:0.2716:0.3787:0.0	.	1209	Q8TE57	ATS16_HUMAN	M	1209	ENSP00000274181:K1209M	ENSP00000274181:K1209M	K	+	2	0	ADAMTS16	5372202	0.996000	0.38824	0.002000	0.10522	0.884000	0.51177	1.172000	0.31908	-1.055000	0.03209	0.383000	0.25322	AAG		0.522	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		Missense_Mutation
AIM1	202	hgsc.bcm.edu	37	6	106967752	106967752	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr6:106967752T>C	ENST00000369066.3	+	2	1932	c.1445T>C	c.(1444-1446)gTt>gCt	p.V482A		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GACACATGTGTTCAATCACCC	0.463																																																0			6											91.0	95.0	94.0					6																	106967752		2203	4300	6503	107074445	SO:0001583	missense	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1445T>C	6.37:g.106967752T>C	ENSP00000358062:p.Val482Ala		107074445	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.58	1.389641	0.25118	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.71103	-0.54	6.17	0.346	0.16017	.	1.216240	0.06067	N	0.659324	T	0.25680	0.0625	L	0.28115	0.83	0.09310	N	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.10823	-1.0613	10	0.07813	T	0.8	.	3.5493	0.07840	0.1857:0.314:0.0:0.5003	.	482	Q9Y4K1	AIM1_HUMAN	A	890;482	ENSP00000358062:V482A	ENSP00000285105:V890A	V	+	2	0	AIM1	107074445	0.002000	0.14202	0.005000	0.12908	0.009000	0.06853	-0.194000	0.09559	0.374000	0.24650	0.533000	0.62120	GTT		0.463	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			Missense_Mutation
AP3B2	8120	hgsc.bcm.edu	37	15	83333172	83333172	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr15:83333172C>A	ENST00000261722.3	-	18	2358	c.2151G>T	c.(2149-2151)gaG>gaT	p.E717D	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Missense_Mutation_p.E736D|AP3B2_ENST00000535348.1_Missense_Mutation_p.E685D	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	717	Glu/Ser-rich.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.E716D(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CATTGTCGGACTCACTGCTGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											103.0	113.0	110.0					15																	83333172		2064	4205	6269	81130227	SO:0001583	missense	8120			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2151G>T	15.37:g.83333172C>A	ENSP00000261722:p.Glu717Asp		81130227	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	CCDS45331.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.30	2.492959	0.44352	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.19669	2.13;2.13;2.13	5.48	3.53	0.40419	.	0.280055	0.39687	N	0.001281	T	0.12135	0.0295	N	0.20986	0.625	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.11108	-1.0601	10	0.17832	T	0.49	-28.7893	8.7309	0.34498	0.1494:0.7698:0.0:0.0808	.	685;736;717	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	D	717;685;736	ENSP00000261722:E717D;ENSP00000438721:E685D;ENSP00000440984:E736D	ENSP00000261722:E717D	E	-	3	2	AP3B2	81130227	0.998000	0.40836	0.989000	0.46669	0.718000	0.41266	0.358000	0.20216	1.316000	0.45131	0.557000	0.71058	GAG		0.572	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			Missense_Mutation
ATP1B4	23439	hgsc.bcm.edu	37	X	119496025	119496025	+	Start_Codon_SNP	SNP	T	T	G			TCGA-13-0792-01	TCGA-13-0792-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:119496025T>G	ENST00000218008.3	+	1	59	c.2T>G	c.(1-3)aTg>aGg	p.M1R	ATP1B4_ENST00000539306.1_Start_Codon_SNP_p.M1R|ATP1B4_ENST00000361319.3_Start_Codon_SNP_p.M1R	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	1					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.M1R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						TGAACAGCCATGAGAAGGCAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											192.0	160.0	171.0					X																	119496025		2203	4300	6503	119380053	SO:0001582	initiator_codon_variant	23439			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.2T>G	X.37:g.119496025T>G	ENSP00000218008:p.Met1Arg		119380053	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	t	15.59	2.879718	0.51801	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.27720	1.87;1.87;1.65	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000014	T	0.53384	0.1793	.	.	.	0.80722	D	1	P;P;P;D	0.53462	0.932;0.932;0.932;0.96	D;P;D;D	0.69142	0.917;0.88;0.917;0.962	T	0.57688	-0.7768	9	0.87932	D	0	-4.1915	11.0965	0.48147	0.0:0.0:0.0:1.0	.	1;1;1;1	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	R	1	ENSP00000218008:M1R;ENSP00000355346:M1R;ENSP00000443334:M1R	ENSP00000218008:M1R	M	+	2	0	ATP1B4	119380053	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.632000	0.54287	1.892000	0.54788	0.424000	0.28305	ATG		0.557	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	Missense_Mutation	Missense_Mutation
ATP11C	286410	hgsc.bcm.edu	37	X	138844133	138844133	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0792-01	TCGA-13-0792-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:138844133T>A	ENST00000327569.3	-	22	2734	c.2636A>T	c.(2635-2637)tAc>tTc	p.Y879F	ATP11C_ENST00000361648.2_Missense_Mutation_p.Y879F|ATP11C_ENST00000359686.2_Missense_Mutation_p.Y879F|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000370557.1_Missense_Mutation_p.Y873F|ATP11C_ENST00000370543.1_Missense_Mutation_p.Y879F	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	879					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Y879F(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					ATAGAAGAAGTACTGTACAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	X											95.0	85.0	88.0					X																	138844133		2203	4300	6503	138671799	SO:0001583	missense	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2636A>T	X.37:g.138844133T>A	ENSP00000332756:p.Tyr879Phe		138671799	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079125	0.76528	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.93644	0.7970	M	0.75085	2.285	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71656	0.974;0.941;0.974	D	0.93843	0.7138	10	0.54805	T	0.06	.	14.1997	0.65693	0.0:0.0:0.0:1.0	.	879;879;879	Q8NB49-3;Q8NB49;Q8NB49-2	.;AT11C_HUMAN;.	F	873;879;879;879;879	ENSP00000359588:Y873F;ENSP00000355165:Y879F;ENSP00000332756:Y879F;ENSP00000359574:Y879F;ENSP00000352715:Y879F	ENSP00000332756:Y879F	Y	-	2	0	ATP11C	138671799	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	1.952000	0.56665	0.441000	0.28932	TAC		0.318	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		Missense_Mutation
BAMBI	25805	hgsc.bcm.edu	37	10	28971114	28971114	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr10:28971114G>C	ENST00000375533.3	+	3	1123	c.567G>C	c.(565-567)caG>caC	p.Q189H		NM_012342.2	NP_036474.1	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	189					cell migration (GO:0016477)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell shape (GO:0008360)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|type II transforming growth factor beta receptor binding (GO:0005114)	p.Q189H(1)		central_nervous_system(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	17						AGCGGCAACAGATGCTCTCCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	10											120.0	105.0	110.0					10																	28971114		2203	4300	6503	29011120	SO:0001583	missense	25805			U23070	CCDS7162.1	10p12.3-p11.2	2013-07-23	2013-07-23		ENSG00000095739	ENSG00000095739			30251	protein-coding gene	gene with protein product		604444	"""BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)"""			8621228, 19758997	Standard	NM_012342		Approved	NMA	uc001iuj.1	Q13145	OTTHUMG00000017874	ENST00000375533.3:c.567G>C	10.37:g.28971114G>C	ENSP00000364683:p.Gln189His		29011120		Missense_Mutation	SNP	ENST00000375533.3	37	CCDS7162.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.29	3.353122	0.61293	.	.	ENSG00000095739	ENST00000375533;ENST00000542444	.	.	.	5.86	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.52141	0.1716	L	0.47716	1.5	0.58432	D	0.999998	D	0.54397	0.966	P	0.50440	0.641	T	0.53121	-0.8483	9	0.72032	D	0.01	.	8.7925	0.34859	0.2811:0.0:0.7189:0.0	.	189	Q13145	BAMBI_HUMAN	H	189;176	.	ENSP00000364683:Q189H	Q	+	3	2	BAMBI	29011120	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.456000	0.66665	0.825000	0.34637	0.655000	0.94253	CAG		0.517	BAMBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047374.1	NM_012342		Missense_Mutation
BPTF	2186	hgsc.bcm.edu	37	17	65907943	65907943	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr17:65907943delA	ENST00000321892.4	+	13	4382	c.4321delA	c.(4321-4323)attfs	p.I1441fs	BPTF_ENST00000335221.5_Frame_Shift_Del_p.I1441fs|BPTF_ENST00000306378.6_Frame_Shift_Del_p.I1315fs|BPTF_ENST00000424123.3_Frame_Shift_Del_p.I1302fs			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1441					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.I1315fs*18(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CAATGAAAGCATTTCTGAACA	0.403																																																1	Deletion - Frameshift(1)	ovary(1)	17											89.0	89.0	89.0					17																	65907943		2203	4300	6503	63338405	SO:0001589	frameshift_variant	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.4321delA	17.37:g.65907943delA	ENSP00000315454:p.Ile1441fs		63338405	Q6NX67|Q7Z7D6|Q9UIG2	Frame_Shift_Del	DEL	ENST00000321892.4	37		DEL	8	Baylor																																																																																				0.403	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459		Frame_Shift_Del
BTBD3	22903	hgsc.bcm.edu	37	20	11903653	11903653	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr20:11903653C>A	ENST00000405977.1	+	5	1533	c.908C>A	c.(907-909)gCg>gAg	p.A303E	BTBD3_ENST00000254977.3_Missense_Mutation_p.A242E|BTBD3_ENST00000378226.2_Missense_Mutation_p.A303E|BTBD3_ENST00000399006.2_Missense_Mutation_p.A242E	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	303					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.A303E(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						CAAGATCTGGCGTTGAGCATT	0.453																																																1	Substitution - Missense(1)	ovary(1)	20											105.0	105.0	105.0					20																	11903653		2203	4300	6503	11851653	SO:0001583	missense	22903			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.908C>A	20.37:g.11903653C>A	ENSP00000384545:p.Ala303Glu		11851653	D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	37	CCDS13113.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.486	0.649750	0.14516	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226	T;T;T;T	0.78003	-1.13;-1.13;-1.14;-1.14	6.16	6.16	0.99307	BTB/Kelch-associated (1);	0.393509	0.31427	N	0.007663	T	0.57873	0.2083	N	0.04203	-0.255	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.18555	-1.0333	10	0.05436	T	0.98	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	303	Q9Y2F9	BTBD3_HUMAN	E	242;242;303;303	ENSP00000254977:A242E;ENSP00000381971:A242E;ENSP00000384545:A303E;ENSP00000367471:A303E	ENSP00000254977:A242E	A	+	2	0	BTBD3	11851653	0.952000	0.32445	0.949000	0.38748	0.645000	0.38454	3.804000	0.55568	2.937000	0.99478	0.650000	0.86243	GCG		0.453	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			Missense_Mutation
C11orf30	56946	hgsc.bcm.edu	37	11	76174958	76174958	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:76174958A>T	ENST00000529032.1	+	6	665	c.665A>T	c.(664-666)aAg>aTg	p.K222M	C11orf30_ENST00000525038.1_Missense_Mutation_p.K237M|C11orf30_ENST00000334736.3_Missense_Mutation_p.K222M|C11orf30_ENST00000533248.1_Missense_Mutation_p.K236M|C11orf30_ENST00000525919.1_Missense_Mutation_p.K223M|C11orf30_ENST00000524490.1_Missense_Mutation_p.K223M|C11orf30_ENST00000524767.1_Missense_Mutation_p.K237M|C11orf30_ENST00000343878.3_Missense_Mutation_p.K222M			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	222	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.K222M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						GAAGTTCCAAAGGCCGTTGTT	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											184.0	182.0	183.0					11																	76174958		2200	4292	6492	75852606	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.665A>T	11.37:g.76174958A>T	ENSP00000432327:p.Lys222Met		75852606	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.69	3.452871	0.63290	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	T;T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.62	4.5	0.54988	.	0.044831	0.85682	D	0.000000	T	0.49966	0.1588	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.996;0.998;0.998;0.999;1.0;0.998;0.998;0.998	P;P;P;D;D;D;P;D	0.77557	0.819;0.888;0.888;0.99;0.964;0.977;0.888;0.977	T	0.47971	-0.9075	10	0.51188	T	0.08	-4.0501	11.2765	0.49170	0.929:0.0:0.071:0.0	.	236;237;237;222;172;223;223;222	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;.;EMSY_HUMAN	M	223;222;222;172;237;236;223;237;222	ENSP00000431166:K223M;ENSP00000334130:K222M;ENSP00000344688:K222M;ENSP00000433205:K237M;ENSP00000433634:K236M;ENSP00000432010:K223M;ENSP00000436968:K237M;ENSP00000432327:K222M	ENSP00000334130:K222M	K	+	2	0	C11orf30	75852606	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.173000	0.77612	0.972000	0.38314	0.460000	0.39030	AAG		0.483	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		Missense_Mutation
C17orf75	64149	hgsc.bcm.edu	37	17	30658938	30658938	+	Nonsense_Mutation	SNP	A	A	C			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr17:30658938A>C	ENST00000577809.1	-	10	1084	c.1035T>G	c.(1033-1035)taT>taG	p.Y345*	C17orf75_ENST00000225805.4_Nonsense_Mutation_p.Y345*|RP11-227G15.3_ENST00000581915.1_RNA|RP11-227G15.2_ENST00000580360.1_lincRNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	345								p.Y345*(1)		ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TAAACAAAGCATAATGATTCA	0.328																																																1	Substitution - Nonsense(1)	ovary(1)	17											120.0	116.0	117.0					17																	30658938		1816	4080	5896	27683051	SO:0001587	stop_gained	64149			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.1035T>G	17.37:g.30658938A>C	ENSP00000464275:p.Tyr345*		27683051	Q7Z2H4	Nonsense_Mutation	SNP	ENST00000577809.1	37	CCDS58537.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425737	0.83667	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.89	-0.148	0.13424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.0731	11.0079	0.47646	0.5889:0.0:0.4111:0.0	.	.	.	.	X	345	.	ENSP00000225805:Y345X	Y	-	3	2	C17orf75	27683051	0.363000	0.24989	0.993000	0.49108	0.990000	0.78478	-0.181000	0.09740	-0.320000	0.08640	-0.379000	0.06801	TAT		0.328	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447204.1	NM_022344		Nonsense_Mutation
OSCP1	127700	hgsc.bcm.edu	37	1	36888393	36888393	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:36888393C>T	ENST00000356637.5	-	7	818	c.755G>A	c.(754-756)cGa>cAa	p.R252Q	OSCP1_ENST00000315643.9_Missense_Mutation_p.R252Q|OSCP1_ENST00000495222.1_5'UTR|OSCP1_ENST00000433045.2_Missense_Mutation_p.R197Q|OSCP1_ENST00000235532.5_Missense_Mutation_p.R242Q			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	252					transport (GO:0006810)	plasma membrane (GO:0005886)		p.R252Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						TTTCAGGACTCGGTCTCCATA	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											124.0	116.0	119.0					1																	36888393		2203	4300	6503	36660980	SO:0001583	missense	127700				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.755G>A	1.37:g.36888393C>T	ENSP00000349052:p.Arg252Gln		36660980	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	ENST00000356637.5	37		SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	35	5.495610	0.96355	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045;ENST00000445843;ENST00000315643	T;T;T;T;T	0.36878	1.63;1.67;1.23;1.25;1.56	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.61476	0.2350	M	0.72894	2.215	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.974	T	0.62172	-0.6910	10	0.59425	D	0.04	.	18.6261	0.91340	0.0:1.0:0.0:0.0	.	242;252	Q8WVF1-3;Q8WVF1	.;OSCP1_HUMAN	Q	242;252;197;212;252	ENSP00000235532:R242Q;ENSP00000349052:R252Q;ENSP00000390820:R197Q;ENSP00000396417:R212Q;ENSP00000314541:R252Q	ENSP00000235532:R242Q	R	-	2	0	OSCP1	36660980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.027000	0.76463	2.657000	0.90304	0.655000	0.94253	CGA		0.388	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000389759.1	NM_145047		Missense_Mutation
CDH17	1015	hgsc.bcm.edu	37	8	95206875	95206875	+	Silent	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr8:95206875A>T	ENST00000027335.3	-	2	163	c.39T>A	c.(37-39)ctT>ctA	p.L13L	CDH17_ENST00000441892.2_Silent_p.L13L|CDH17_ENST00000450165.2_Silent_p.L13L	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	13					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.L13L(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AATAAAGCATAAGAAGACACA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	8											112.0	105.0	107.0					8																	95206875		2203	4300	6503	95276051	SO:0001819	synonymous_variant	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.39T>A	8.37:g.95206875A>T			95276051	Q15336|Q2M2E0	Silent	SNP	ENST00000027335.3	37	CCDS6260.1	SNP	13	Baylor																																																																																				0.368	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		Silent
CENPP	401541	hgsc.bcm.edu	37	9	95142143	95142143	+	Splice_Site	SNP	T	T	A			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr9:95142143T>A	ENST00000375587.3	+	5	1079		c.e5+2			NM_001012267.1	NP_001012267.1	Q6IPU0	CENPP_HUMAN	centromere protein P						CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(1)	16						CATCTCAAGGTAAAGTCTGAA	0.338																																																1	Unknown(1)	ovary(1)	9											118.0	116.0	117.0					9																	95142143		2203	4300	6503	94181964	SO:0001630	splice_region_variant	401541			AK091247	CCDS35063.1, CCDS69618.1	9q22.31	2013-11-05			ENSG00000188312	ENSG00000188312			32933	protein-coding gene	gene with protein product		611505				16622419, 16622420	Standard	NM_001286969		Approved	RP11-19J3.3, CENP-P	uc004arz.3	Q6IPU0	OTTHUMG00000020228	ENST00000375587.3:c.564+2T>A	9.37:g.95142143T>A			94181964	B3KRA5|B3KS17|Q5T9F8|Q5T9F9	Splice_Site_SNP	SNP	ENST00000375587.3	37	CCDS35063.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.17	3.321613	0.60634	.	.	ENSG00000188312	ENST00000375587;ENST00000402724	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8734	0.70478	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CENPP	94181964	1.000000	0.71417	0.994000	0.49952	0.579000	0.36224	6.083000	0.71326	1.980000	0.57719	0.460000	0.39030	.		0.338	CENPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053098.1	NM_001012267	Intron	Splice_Site_SNP
CHMP4A	29082	hgsc.bcm.edu	37	14	24679121	24679121	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr14:24679121C>T	ENST00000609024.1	-	6	679	c.631G>A	c.(631-633)Gaa>Aaa	p.E211K	CHMP4A_ENST00000347519.6_Missense_Mutation_p.E254K|CHMP4A_ENST00000542700.2_5'UTR|TM9SF1_ENST00000556387.1_Intron|CHMP4A_ENST00000530996.1_Missense_Mutation_p.E106K|TM9SF1_ENST00000530611.1_Intron|AL136419.6_ENST00000565988.1_RNA			Q9BY43	CHM4A_HUMAN	charged multivesicular body protein 4A	211	Intramolecular interaction with N- terminus. {ECO:0000250}.				endosomal transport (GO:0016197)|membrane budding (GO:0006900)|membrane organization (GO:0061024)|membrane tubulation (GO:0097320)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)	p.E254K(1)		NS(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9				GBM - Glioblastoma multiforme(265;0.0181)		AGTGCTTCTTCATCTTCATCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	14											231.0	199.0	210.0					14																	24679121		2203	4300	6503	23748961	SO:0001583	missense	29082			AF212243	CCDS9619.1	14q12	2012-10-04	2011-09-21	2005-04-04	ENSG00000254505	ENSG00000254505		"""Charged multivesicular body proteins"""	20274	protein-coding gene	gene with protein product		610051	"""chromosome 14 open reading frame 123"", ""chromatin modifying protein 4A"""	C14orf123			Standard	NM_014169		Approved	HSPC134, VPS32A		Q9BY43	OTTHUMG00000167036	ENST00000609024.1:c.631G>A	14.37:g.24679121C>T	ENSP00000476412:p.Glu211Lys		23748961	Q14D22|Q32Q79|Q86SZ8|Q96QJ9|Q9P026	Missense_Mutation	SNP	ENST00000609024.1	37		SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569070	0.45798	.	.	ENSG00000254505	ENST00000347519	T	0.61627	0.09	4.24	2.33	0.28932	.	1.004860	0.08018	N	0.991581	T	0.45377	0.1339	L	0.28400	0.85	0.23776	N	0.996879	B	0.30584	0.286	B	0.32677	0.15	T	0.42531	-0.9446	10	0.56958	D	0.05	0.6511	6.0941	0.20010	0.0:0.7065:0.1894:0.1041	.	254	Q14D22	.	K	254	ENSP00000324205:E254K	ENSP00000324205:E254K	E	-	1	0	AL096870.1	23748961	0.000000	0.05858	0.711000	0.30485	0.994000	0.84299	0.123000	0.15708	0.683000	0.31428	0.561000	0.74099	GAA		0.453	CHMP4A-012	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471846.1	NM_014169		Missense_Mutation
CIITA	4261	hgsc.bcm.edu	37	16	11001421	11001421	+	Missense_Mutation	SNP	C	C	A	rs78108426	byFrequency	TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr16:11001421C>A	ENST00000324288.8	+	11	2205	c.2072C>A	c.(2071-2073)gCc>gAc	p.A691D	CIITA_ENST00000381835.5_Intron|CIITA_ENST00000537380.1_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	691	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.A691D(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						TGGGCGATGGCCAAAGGCTTA	0.652			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								C|||	224	0.0447284	0.0212	0.0159	5008	,	,		16545	0.127		0.0159	False		,,,				2504	0.0419						Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	1	Substitution - Missense(1)	ovary(1)	16						C	ASP/ALA	84,4310	71.4+/-109.4	0,84,2113	51.0	54.0	53.0		2072	3.3	0.4	16	dbSNP_131	53	52,8548	32.3+/-84.9	0,52,4248	yes	missense	CIITA	NM_000246.3	126	0,136,6361	AA,AC,CC		0.6047,1.9117,1.0466	possibly-damaging	691/1131	11001421	136,12858	2197	4300	6497	10908922	SO:0001583	missense	4261			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2072C>A	16.37:g.11001421C>A	ENSP00000316328:p.Ala691Asp		10908922	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	SNP	26	Baylor	99	0.04532967032967033	11	0.022357723577235773	6	0.016574585635359115	72	0.1258741258741259	10	0.013192612137203167	C	10.34	1.322464	0.23994	0.019117	0.006047	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.73363	-0.74	5.3	3.26	0.37387	NACHT nucleoside triphosphatase (1);	0.502966	0.18160	N	0.149803	T	0.01800	0.0057	M	0.66939	2.045	0.58432	P	1.0000000000287557E-6	B;B;B;D	0.55800	0.105;0.049;0.168;0.973	B;B;B;P	0.47346	0.05;0.027;0.108;0.544	T	0.46261	-0.9204	9	0.41790	T	0.15	.	4.735	0.12984	0.1496:0.621:0.1454:0.084	.	691;691;643;691	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	D	691;643	ENSP00000316328:A691D	ENSP00000316328:A691D	A	+	2	0	CIITA	10908922	0.502000	0.26107	0.376000	0.26042	0.123000	0.20343	1.023000	0.30065	1.231000	0.43661	0.655000	0.94253	GCC		0.652	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246		Missense_Mutation
CNTN2	6900	hgsc.bcm.edu	37	1	205039084	205039084	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:205039084G>C	ENST00000331830.4	+	18	2610	c.2326G>C	c.(2326-2328)Gag>Cag	p.E776Q		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	776	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.E776Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTACAGCAACGAGAGCGTCCG	0.652																																					Melanoma(183;2548 2817 37099 41192)											1	Substitution - Missense(1)	ovary(1)	1											66.0	70.0	69.0					1																	205039084		2203	4300	6503	203305707	SO:0001583	missense	6900			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2326G>C	1.37:g.205039084G>C	ENSP00000330633:p.Glu776Gln		203305707	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	CCDS1449.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521667	0.85600	.	.	ENSG00000184144	ENST00000331830	T	0.57595	0.39	5.07	4.13	0.48395	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.363581	0.22891	N	0.054398	T	0.63165	0.2488	L	0.60067	1.865	0.34947	D	0.750884	P;P	0.46064	0.653;0.872	P;P	0.55545	0.677;0.778	T	0.70741	-0.4789	10	0.33940	T	0.23	.	14.9717	0.71238	0.0:0.1439:0.8561:0.0	.	776;667	Q02246;Q68DA2	CNTN2_HUMAN;.	Q	776	ENSP00000330633:E776Q	ENSP00000330633:E776Q	E	+	1	0	CNTN2	203305707	1.000000	0.71417	0.185000	0.23176	0.988000	0.76386	4.526000	0.60566	1.091000	0.41335	0.467000	0.42956	GAG		0.652	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		Missense_Mutation
CTNND2	1501	hgsc.bcm.edu	37	5	11159781	11159781	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:11159781G>T	ENST00000304623.8	-	12	2255	c.2066C>A	c.(2065-2067)cCc>cAc	p.P689H	CTNND2_ENST00000511377.1_Missense_Mutation_p.P598H|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.P256H|CTNND2_ENST00000359640.2_Missense_Mutation_p.P689H|CTNND2_ENST00000503622.1_Missense_Mutation_p.P352H	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	689					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P689H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCCTGAGTGGGGGATAATCAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											192.0	169.0	177.0					5																	11159781		2203	4300	6503	11212781	SO:0001583	missense	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2066C>A	5.37:g.11159781G>T	ENSP00000307134:p.Pro689His		11212781	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917770	0.92249	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	6.16	6.16	0.99307	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89591	0.6759	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.89311	0.3633	10	0.87932	D	0	-26.8118	20.8598	0.99761	0.0:0.0:1.0:0.0	.	352;256;689	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	H	689;689;598;256;352	ENSP00000307134:P689H;ENSP00000352661:P689H;ENSP00000426510:P598H;ENSP00000391155:P256H;ENSP00000426887:P352H	ENSP00000307134:P689H	P	-	2	0	CTNND2	11212781	1.000000	0.71417	0.984000	0.44739	0.925000	0.55904	9.383000	0.97214	2.937000	0.99478	0.650000	0.86243	CCC		0.527	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		Missense_Mutation
DCC	1630	hgsc.bcm.edu	37	18	50734186	50734186	+	Splice_Site	SNP	C	C	T	rs144792181	byFrequency	TCGA-13-0792-01	TCGA-13-0792-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr18:50734186C>T	ENST00000442544.2	+	11	2476	c.1860C>T	c.(1858-1860)gaC>gaT	p.D620D	DCC_ENST00000412726.1_Splice_Site_p.D468D|DCC_ENST00000581580.1_Splice_Site_p.D275D	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	620	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.D620D(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CACTTTCTGACGGTAAGTTAA	0.338													C|||	2	0.000399361	0.0	0.0	5008	,	,		18869	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	18						C		1,4405	2.1+/-5.4	0,1,2202	116.0	120.0	118.0		1860	1.8	1.0	18	dbSNP_134	118	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous-near-splice	DCC	NM_005215.3		0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384		620/1448	50734186	5,13001	2203	4300	6503	48988184	SO:0001630	splice_region_variant	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1861+1C>T	18.37:g.50734186C>T			48988184		Silent	SNP	ENST00000442544.2	37	CCDS11952.1	SNP	19	Baylor																																																																																				0.338	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	Silent	Silent
DCHS1	8642	hgsc.bcm.edu	37	11	6652624	6652624	+	Silent	SNP	C	C	G			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:6652624C>G	ENST00000299441.3	-	8	4101	c.3690G>C	c.(3688-3690)gtG>gtC	p.V1230V	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1230	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCCCGGAGGCACGCGGTCTG	0.552																																																0			11											153.0	129.0	137.0					11																	6652624		2201	4296	6497	6609200	SO:0001819	synonymous_variant	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3690G>C	11.37:g.6652624C>G			6609200	O15098	Silent	SNP	ENST00000299441.3	37	CCDS7771.1	SNP	25	Baylor																																																																																				0.552	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Silent
DCHS1	8642	hgsc.bcm.edu	37	11	6661596	6661596	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:6661596delG	ENST00000299441.3	-	2	1660	c.1249delC	c.(1249-1251)caafs	p.Q417fs		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	417	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q417fs*24(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACGCTGTCTTGGGTGCTTAGG	0.562																																																1	Deletion - Frameshift(1)	ovary(1)	11											53.0	48.0	50.0					11																	6661596		2201	4296	6497	6618172	SO:0001589	frameshift_variant	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.1249delC	11.37:g.6661596delG	ENSP00000299441:p.Gln417fs		6618172	O15098	Frame_Shift_Del	DEL	ENST00000299441.3	37	CCDS7771.1	DEL	47	Baylor																																																																																				0.562	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Frame_Shift_Del
DLG1	1739	hgsc.bcm.edu	37	3	196863492	196863492	+	Missense_Mutation	SNP	C	C	T	rs147695740		TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr3:196863492C>T	ENST00000419354.1	-	11	1326	c.1040G>A	c.(1039-1041)aGc>aAc	p.S347N	DLG1_ENST00000392382.2_Missense_Mutation_p.S314N|DLG1_ENST00000422288.1_Missense_Mutation_p.S296N|DLG1_ENST00000448528.2_Missense_Mutation_p.S347N|DLG1_ENST00000357674.4_Missense_Mutation_p.S314N|DLG1_ENST00000443183.1_Missense_Mutation_p.S231N|DLG1_ENST00000346964.2_Missense_Mutation_p.S347N|DLG1_ENST00000452595.1_Missense_Mutation_p.S231N|DLG1_ENST00000314062.3_Missense_Mutation_p.S296N|DLG1_ENST00000450955.1_Missense_Mutation_p.S314N			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	347	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.S347N(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TACATAGATGCTATTATCCCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	3						C	ASN/SER,ASN/SER,ASN/SER,ASN/SER,ASN/SER	0,4406		0,0,2203	159.0	145.0	150.0		1040,941,692,692,1040	5.4	1.0	3	dbSNP_134	150	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	DLG1	NM_001098424.1,NM_001204386.1,NM_001204387.1,NM_001204388.1,NM_004087.2	46,46,46,46,46	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign,benign,benign	347/905,314/893,231/801,231/789,347/927	196863492	2,13004	2203	4300	6503	198347889	SO:0001583	missense	1739			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1040G>A	3.37:g.196863492C>T	ENSP00000407531:p.Ser347Asn		198347889	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631430	0.67015	0.0	2.33E-4	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955;ENST00000447466	T;T;T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.41	5.41	0.78517	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.36082	0.0954	M	0.62209	1.925	0.80722	D	1	B;B;B;B;B;B;B	0.27498	0.011;0.042;0.033;0.033;0.027;0.087;0.18	B;B;B;B;B;B;B	0.29440	0.02;0.058;0.051;0.051;0.051;0.102;0.073	T	0.09079	-1.0691	10	0.33940	T	0.23	.	18.5365	0.91013	0.0:1.0:0.0:0.0	.	314;231;231;231;314;347;347	Q12959-4;E9PG21;E7EWL7;B4DGU1;Q12959-3;Q12959;Q12959-2	.;.;.;.;.;DLG1_HUMAN;.	N	347;347;314;347;296;347;231;296;347;231;314;314;156	ENSP00000345731:S347N;ENSP00000350303:S314N;ENSP00000321087:S296N;ENSP00000407531:S347N;ENSP00000398939:S231N;ENSP00000413238:S296N;ENSP00000391732:S347N;ENSP00000396658:S231N;ENSP00000376187:S314N;ENSP00000411278:S314N;ENSP00000398702:S156N	ENSP00000321087:S296N	S	-	2	0	DLG1	198347889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.426000	0.80270	2.695000	0.91970	0.655000	0.94253	AGC		0.368	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087		Missense_Mutation
DPYSL3	1809	hgsc.bcm.edu	37	5	146777313	146777313	+	Silent	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:146777313C>T	ENST00000398514.3	-	12	1748	c.1377G>A	c.(1375-1377)ctG>ctA	p.L459L	DPYSL3_ENST00000534907.1_Silent_p.L85L|DPYSL3_ENST00000343218.5_Silent_p.L573L	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	459					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)	p.L459L(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTCACGTGCAGGTTGCCAT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	5											70.0	76.0	74.0					5																	146777313		2051	4209	6260	146757506	SO:0001819	synonymous_variant	1809			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1377G>A	5.37:g.146777313C>T			146757506	B3SXQ8|Q93012	Silent	SNP	ENST00000398514.3	37	CCDS43381.1	SNP	25	Baylor																																																																																				0.562	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387		Silent
DRG2	1819	hgsc.bcm.edu	37	17	18003901	18003901	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr17:18003901A>G	ENST00000225729.3	+	7	697	c.559A>G	c.(559-561)Atc>Gtc	p.I187V	DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Missense_Mutation_p.I187V	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	187	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					AGGTGGTGGCATCTCCTTTAA	0.557																																																0			17											95.0	83.0	87.0					17																	18003901		2203	4300	6503	17944626	SO:0001583	missense	1819			X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.559A>G	17.37:g.18003901A>G	ENSP00000225729:p.Ile187Val		17944626	B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	37	CCDS11191.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274854	0.23307	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.27720	1.65;1.65	5.29	4.22	0.49857	Small GTP-binding protein domain (1);	0.099706	0.64402	N	0.000002	T	0.16938	0.0407	N	0.12746	0.255	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.05131	-1.0904	10	0.25106	T	0.35	-16.4157	10.9929	0.47559	0.9265:0.0:0.0735:0.0	.	187;187	A8MZF9;P55039	.;DRG2_HUMAN	V	187	ENSP00000379076:I187V;ENSP00000225729:I187V	ENSP00000225729:I187V	I	+	1	0	DRG2	17944626	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	4.628000	0.61282	0.865000	0.35603	0.379000	0.24179	ATC		0.557	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388		Missense_Mutation
EYA1	2138	hgsc.bcm.edu	37	8	72128997	72128997	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr8:72128997C>A	ENST00000340726.3	-	14	1929	c.1290G>T	c.(1288-1290)tgG>tgT	p.W430C	EYA1_ENST00000388743.2_Missense_Mutation_p.W429C|EYA1_ENST00000388740.3_Missense_Mutation_p.W397C|EYA1_ENST00000303824.7_Missense_Mutation_p.W424C|EYA1_ENST00000388742.4_Missense_Mutation_p.W430C|EYA1_ENST00000419131.1_Missense_Mutation_p.W395C|EYA1_ENST00000388741.2_Missense_Mutation_p.W396C	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	430					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.W430C(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			ACTTTCTCATCCAGTCCACAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	8											182.0	159.0	167.0					8																	72128997		2203	4300	6503	72291551	SO:0001583	missense	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1290G>T	8.37:g.72128997C>A	ENSP00000342626:p.Trp430Cys		72291551	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193460	0.78902	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.44	5.44	0.79542	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.92014	0.7470	M	0.83312	2.635	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.81914	0.949;0.99;0.99;0.949;0.995	D	0.92498	0.6006	10	0.87932	D	0	-6.5452	19.4568	0.94895	0.0:1.0:0.0:0.0	.	424;357;397;430;395	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	C	430;430;398;397;424;396;429;395	ENSP00000373394:W430C;ENSP00000342626:W430C;ENSP00000373392:W397C;ENSP00000303221:W424C;ENSP00000373393:W396C;ENSP00000373395:W429C;ENSP00000410176:W395C	ENSP00000303221:W424C	W	-	3	0	EYA1	72291551	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.604000	0.82830	2.832000	0.97577	0.655000	0.94253	TGG		0.453	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		Missense_Mutation
FSIP1	161835	hgsc.bcm.edu	37	15	39910272	39910272	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr15:39910272C>A	ENST00000350221.3	-	11	1572	c.1363G>T	c.(1363-1365)Gaa>Taa	p.E455*		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	455								p.E455*(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		GTTTCTGATTCATTTAGCAAT	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	15											121.0	115.0	117.0					15																	39910272		2200	4297	6497	37697564	SO:0001587	stop_gained	161835			BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.1363G>T	15.37:g.39910272C>A	ENSP00000280236:p.Glu455*		37697564	Q6X2C8|Q86Y89	Nonsense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335268	0.60853	.	.	ENSG00000150667	ENST00000350221	.	.	.	4.94	0.917	0.19380	.	1.257900	0.05641	N	0.583369	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	2.0845	5.2901	0.15721	0.1416:0.6331:0.0:0.2253	.	.	.	.	X	455	.	.	E	-	1	0	FSIP1	37697564	0.001000	0.12720	0.000000	0.03702	0.057000	0.15508	0.942000	0.29017	0.087000	0.17167	0.655000	0.94253	GAA		0.393	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597		Nonsense_Mutation
G6PD	2539	hgsc.bcm.edu	37	X	153760229	153760229	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:153760229G>A	ENST00000393564.2	-	13	1646	c.1534C>T	c.(1534-1536)Ccc>Tcc	p.P512S	G6PD_ENST00000393562.2_Missense_Mutation_p.P542S|G6PD_ENST00000369620.2_Missense_Mutation_p.P558S	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	512					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.P512S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCTTGTGGGGGTTCACCCAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	X											58.0	38.0	45.0					X																	153760229		2203	4298	6501	153413423	SO:0001583	missense	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.1534C>T	X.37:g.153760229G>A	ENSP00000377194:p.Pro512Ser		153413423	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030172	0.54790	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620	D;D;D	0.98777	-5.13;-5.13;-5.13	5.33	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.96889	0.8984	L	0.55743	1.74	0.80722	D	1	B;B	0.16802	0.004;0.019	B;B	0.21151	0.009;0.033	D	0.94622	0.7814	10	0.44086	T	0.13	.	10.851	0.46769	0.0942:0.0:0.9057:0.0	.	512;542	P11413;P11413-3	G6PD_HUMAN;.	S	542;512;512;558	ENSP00000377192:P542S;ENSP00000377194:P512S;ENSP00000358633:P558S	ENSP00000291567:P512S	P	-	1	0	G6PD	153413423	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.721000	0.91446	1.018000	0.39521	-0.195000	0.12781	CCC		0.667	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402		Missense_Mutation
G6PD	2539	hgsc.bcm.edu	37	X	153760260	153760260	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:153760260G>C	ENST00000393564.2	-	13	1615	c.1503C>G	c.(1501-1503)ttC>ttG	p.F501L	G6PD_ENST00000393562.2_Missense_Mutation_p.F531L|G6PD_ENST00000369620.2_Missense_Mutation_p.F547L	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	501					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.F501L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCTCATACTGGAAACCCACTC	0.672																																																1	Substitution - Missense(1)	ovary(1)	X											65.0	41.0	49.0					X																	153760260		2203	4299	6502	153413454	SO:0001583	missense	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.1503C>G	X.37:g.153760260G>C	ENSP00000377194:p.Phe501Leu		153413454	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.30	3.802007	0.70682	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620	D;D;D	0.98178	-4.77;-4.77;-4.77	5.33	5.33	0.75918	Glucose-6-phosphate dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98723	0.9571	M	0.76433	2.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.976	D	0.99761	1.1021	10	0.62326	D	0.03	.	15.3073	0.74001	0.0:0.0:1.0:0.0	.	501;531	P11413;P11413-3	G6PD_HUMAN;.	L	531;501;501;547	ENSP00000377192:F531L;ENSP00000377194:F501L;ENSP00000358633:F547L	ENSP00000291567:F501L	F	-	3	2	G6PD	153413454	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	4.423000	0.59861	2.205000	0.71048	0.597000	0.82753	TTC		0.672	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402		Missense_Mutation
GAB2	9846	hgsc.bcm.edu	37	11	77930447	77930447	+	Silent	SNP	G	G	C	rs61749244	byFrequency	TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:77930447G>C	ENST00000361507.4	-	10	1987	c.1902C>G	c.(1900-1902)tcC>tcG	p.S634S	GAB2_ENST00000340149.2_Silent_p.S596S	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	634					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.S634S(1)	INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CAGAGGTGACGGATGAAGTAG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	11											121.0	98.0	106.0					11																	77930447		2200	4292	6492	77608095	SO:0001819	synonymous_variant	9846			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1902C>G	11.37:g.77930447G>C			77608095	A2RRM2|A6NEW9|A7MD36|O60317	Silent	SNP	ENST00000361507.4	37	CCDS8259.1	SNP	39	Baylor																																																																																				0.567	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		Silent
GOLGA1	2800	hgsc.bcm.edu	37	9	127644214	127644214	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr9:127644214T>C	ENST00000373555.4	-	21	2318	c.1985A>G	c.(1984-1986)gAg>gGg	p.E662G		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	662					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)		p.E662G(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TTCGAAGAGCTCATTATCGGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	9											110.0	107.0	108.0					9																	127644214		2203	4300	6503	126684035	SO:0001583	missense	2800			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1985A>G	9.37:g.127644214T>C	ENSP00000362656:p.Glu662Gly		126684035	Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	CCDS6860.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937736	0.73557	.	.	ENSG00000136935	ENST00000373555	T	0.27104	1.69	5.81	5.81	0.92471	.	0.142200	0.31747	N	0.007140	T	0.29190	0.0726	L	0.46157	1.445	0.58432	D	0.999997	P	0.46395	0.877	B	0.43360	0.417	T	0.03473	-1.1033	10	0.66056	D	0.02	-19.6737	15.333	0.74229	0.0:0.0:0.0:1.0	.	662	Q92805	GOGA1_HUMAN	G	662	ENSP00000362656:E662G	ENSP00000362656:E662G	E	-	2	0	GOLGA1	126684035	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.476000	0.66793	2.216000	0.71823	0.533000	0.62120	GAG		0.507	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077		Missense_Mutation
GP2	2813	hgsc.bcm.edu	37	16	20335522	20335522	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr16:20335522G>C	ENST00000381362.4	-	3	227	c.151C>G	c.(151-153)Cct>Gct	p.P51A	GP2_ENST00000381360.5_Intron|GP2_ENST00000341642.5_Intron|GP2_ENST00000573897.1_5'Flank|GP2_ENST00000302555.5_Missense_Mutation_p.P51A	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	51					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)	p.P51A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GGGGTGCCAGGAGCTCCGCAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											50.0	48.0	49.0					16																	20335522		2203	4300	6503	20243023	SO:0001583	missense	2813			U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.151C>G	16.37:g.20335522G>C	ENSP00000370767:p.Pro51Ala		20243023	A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	37	CCDS42128.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654267	0.14580	.	.	ENSG00000169347	ENST00000302555;ENST00000381362	D;D	0.99548	-6.14;-6.14	4.44	-0.13	0.13498	.	.	.	.	.	D	0.97732	0.9256	L	0.46157	1.445	0.09310	N	1	B;B	0.25272	0.122;0.017	B;B	0.28305	0.088;0.012	D	0.95857	0.8880	9	0.15066	T	0.55	-0.2723	3.0479	0.06160	0.302:0.0:0.3827:0.3152	.	51;51	P55259-3;P55259	.;GP2_HUMAN	A	51	ENSP00000304044:P51A;ENSP00000370767:P51A	ENSP00000304044:P51A	P	-	1	0	GP2	20243023	0.003000	0.15002	0.002000	0.10522	0.006000	0.05464	0.527000	0.22987	0.082000	0.17018	-1.217000	0.01609	CCT		0.552	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		Missense_Mutation
GPRASP1	9737	hgsc.bcm.edu	37	X	101911422	101911423	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-13-0792-01	TCGA-13-0792-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:101911422_101911423delGG	ENST00000361600.5	+	5	3382_3383	c.2581_2582delGG	c.(2581-2583)ggcfs	p.G861fs	GPRASP1_ENST00000415986.1_Frame_Shift_Del_p.G861fs|GPRASP1_ENST00000537097.1_Frame_Shift_Del_p.G861fs|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Frame_Shift_Del_p.G861fs	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	861	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.G861fs*2(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGCAGGAGTCGGCTTTGAGTCA	0.525																																																1	Deletion - Frameshift(1)	ovary(1)	X																																								101798079	SO:0001589	frameshift_variant	9737			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2581_2582delGG	X.37:g.101911422_101911423delGG	ENSP00000355146:p.Gly861fs		101798078	O43168|Q96LA1	Frame_Shift_Del	DEL	ENST00000361600.5	37	CCDS35352.1	DEL	39	Baylor																																																																																				0.525	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		Frame_Shift_Del
HMCN2	256158	hgsc.bcm.edu	37	9	133226873	133226873	+	IGR	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr9:133226873C>T								NCS1 (227290 upstream) : HMCN2 (32962 downstream)																							TCAGGATCACCGGCAGTCACG	0.647																																																0			9																																								132216694	SO:0001628	intergenic_variant	256158																															9.37:g.133226873C>T			132216694		Silent	SNP		37		SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.568	0.105525	0.08780	.	.	ENSG00000148357	ENST00000420499	.	.	.	5.17	3.11	0.35812	.	.	.	.	.	T	0.39937	0.1097	.	.	.	.	.	.	.	.	.	.	.	.	T	0.44862	-0.9300	3	.	.	.	.	6.107	0.20079	0.275:0.6316:0.0:0.0934	.	.	.	.	L	157	.	.	P	+	2	0	HMCN2	132216694	0.243000	0.23878	0.997000	0.53966	0.481000	0.33189	1.206000	0.32321	2.393000	0.81446	0.650000	0.86243	CCG	0	0.647									Silent
KIAA2022	340533	hgsc.bcm.edu	37	X	73959309	73959309	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:73959309delT	ENST00000055682.6	-	4	5093	c.4482delA	c.(4480-4482)aaafs	p.K1494fs		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1494					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.A1495fs>22(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTGTTTCTGCTTTTAGGAGAT	0.358																																																1	Deletion - Frameshift(1)	ovary(1)	X											61.0	55.0	57.0					X																	73959309		2202	4300	6502	73876034	SO:0001589	frameshift_variant	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4482delA	X.37:g.73959309delT	ENSP00000055682:p.Lys1494fs		73876034	A7YY87|Q5JUX9|Q8IVE9	Frame_Shift_Del	DEL	ENST00000055682.6	37	CCDS35337.1	DEL	56	Baylor																																																																																				0.358	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Frame_Shift_Del
LAIR1	3903	hgsc.bcm.edu	37	19	54868159	54868159	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr19:54868159A>T	ENST00000391742.2	-	6	676	c.524T>A	c.(523-525)cTc>cAc	p.L175H	LAIR1_ENST00000391743.3_Missense_Mutation_p.L157H|LAIR1_ENST00000474878.1_Missense_Mutation_p.L157H|LAIR1_ENST00000313038.6_Missense_Mutation_p.L168H|LAIR1_ENST00000348231.4_Missense_Mutation_p.L158H|LAIR1_ENST00000434277.2_Missense_Mutation_p.L174H|LAIR1_ENST00000463489.1_5'UTR			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	175					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L175H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		GAGACAGAAGAGGAAGACCAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	19											128.0	132.0	131.0					19																	54868159		2203	4300	6503	59559971	SO:0001583	missense	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.524T>A	19.37:g.54868159A>T	ENSP00000375622:p.Leu175His		59559971		Missense_Mutation	SNP	ENST00000391742.2	37	CCDS12891.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	.	16.03	3.006563	0.54361	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878	T;T;T;T;T;T	0.00574	6.47;6.61;6.6;6.75;6.54;6.74	4.39	4.39	0.52855	.	0.389132	0.19030	N	0.124584	T	0.02083	0.0065	M	0.66939	2.045	0.09310	N	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.81914	0.995;0.988;0.995;0.96;0.992;0.988	T	0.35325	-0.9793	10	0.87932	D	0	.	10.286	0.43566	1.0:0.0:0.0:0.0	.	175;157;157;174;158;175	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	H	157;175;174;158;168;157	ENSP00000375623:L157H;ENSP00000375622:L175H;ENSP00000391003:L174H;ENSP00000301193:L158H;ENSP00000319204:L168H;ENSP00000418998:L157H	ENSP00000319204:L168H	L	-	2	0	LAIR1	59559971	0.166000	0.22962	0.076000	0.20297	0.072000	0.16883	2.135000	0.42112	2.202000	0.70862	0.528000	0.53228	CTC		0.532	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1			Missense_Mutation
LIPK	643414	hgsc.bcm.edu	37	10	90492016	90492016	+	Silent	SNP	C	C	T	rs377155159		TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr10:90492016C>T	ENST00000404190.1	+	4	504	c.504C>T	c.(502-504)taC>taT	p.Y168Y		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	168					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)	p.Y168Y(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		GACTCTACTACGTGGGCCACT	0.428																																																1	Substitution - coding silent(1)	ovary(1)	10						C		0,4016		0,0,2008	106.0	110.0	109.0		504	-7.2	0.8	10		109	1,8493		0,1,4246	no	coding-synonymous	LIPK	NM_001080518.1		0,1,6254	TT,TC,CC		0.0118,0.0,0.0080		168/400	90492016	1,12509	2008	4247	6255	90481996	SO:0001819	synonymous_variant	643414				CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.504C>T	10.37:g.90492016C>T			90481996	A7KIH8	Silent	SNP	ENST00000404190.1	37	CCDS44455.1	SNP	19	Baylor																																																																																				0.428	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049253.2	XM_061222		Silent
MAGI1	9223	hgsc.bcm.edu	37	3	65342580	65342580	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr3:65342580T>C	ENST00000402939.2	-	23	3861	c.3862A>G	c.(3862-3864)Aaa>Gaa	p.K1288E	RP11-88H12.2_ENST00000602316.1_RNA|MAGI1_ENST00000330909.8_3'UTR	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1317					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.K1288E(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CTGTCGGGTTTCCTCGAAGTC	0.662																																																1	Substitution - Missense(1)	ovary(1)	3											115.0	110.0	112.0					3																	65342580		2203	4300	6503	65317620	SO:0001583	missense	9223			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3862A>G	3.37:g.65342580T>C	ENSP00000385450:p.Lys1288Glu		65317620	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000402939.2	37	CCDS33780.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	2.666	-0.278710	0.05679	.	.	ENSG00000151276	ENST00000402939	T	0.11930	2.73	4.7	3.47	0.39725	.	0.791339	0.11914	N	0.517366	T	0.07413	0.0187	N	0.19112	0.55	0.34636	D	0.720112	B	0.15473	0.013	B	0.19391	0.025	T	0.17198	-1.0377	10	0.02654	T	1	-2.0052	7.5917	0.28025	0.0:0.0775:0.1406:0.7819	.	1288	Q96QZ7-2	.	E	1288	ENSP00000385450:K1288E	ENSP00000385450:K1288E	K	-	1	0	MAGI1	65317620	0.128000	0.22383	0.565000	0.28409	0.009000	0.06853	1.493000	0.35605	1.743000	0.51761	0.459000	0.35465	AAA		0.662	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742		Missense_Mutation
MCM2	4171	hgsc.bcm.edu	37	3	127323825	127323825	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr3:127323825A>G	ENST00000265056.7	+	4	743	c.499A>G	c.(499-501)Atg>Gtg	p.M167V		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	167	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)	p.M167V(1)		ovary(3)|skin(2)|stomach(1)	6						GGACGAGGAGATGATCGAGAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	3											64.0	60.0	61.0					3																	127323825		2203	4300	6503	128806515	SO:0001583	missense	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.499A>G	3.37:g.127323825A>G	ENSP00000265056:p.Met167Val		128806515	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.02	2.113347	0.37339	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	T	0.21932	1.98	5.29	5.29	0.74685	.	0.206891	0.64402	D	0.000020	T	0.28599	0.0708	L	0.41124	1.26	0.80722	D	1	P;B;B	0.39576	0.679;0.323;0.16	P;B;B	0.50791	0.65;0.267;0.038	T	0.02713	-1.1120	10	0.15952	T	0.53	-48.5668	15.2415	0.73474	1.0:0.0:0.0:0.0	.	148;37;167	F5H1E9;B4DSV5;P49736	.;.;MCM2_HUMAN	V	167;71;148	ENSP00000265056:M167V	ENSP00000265056:M167V	M	+	1	0	MCM2	128806515	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.124000	0.94394	1.997000	0.58415	0.482000	0.46254	ATG		0.667	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1			Missense_Mutation
LRRC15	131578	hgsc.bcm.edu	37	3	194080860	194080860	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr3:194080860T>C	ENST00000347624.3	-	2	998	c.913A>G	c.(913-915)Atc>Gtc	p.I305V	LRRC15_ENST00000428839.1_Missense_Mutation_p.I311V|LRRC15_ENST00000439944.2_Missense_Mutation_p.I311V	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	305					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.I305V(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		AGAGAAGAGATGTGGTTGTCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											58.0	63.0	61.0					3																	194080860		2203	4300	6503	195562155	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.913A>G	3.37:g.194080860T>C	ENSP00000306276:p.Ile305Val		195562155	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	7.574	0.667302	0.14710	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.60920	0.15;0.15;0.15	4.99	2.48	0.30137	.	0.323485	0.25386	N	0.031054	T	0.57592	0.2064	M	0.69523	2.12	0.20821	N	0.999848	B;B	0.26744	0.123;0.158	B;B	0.30179	0.112;0.068	T	0.55386	-0.8149	10	0.72032	D	0.01	.	12.9155	0.58203	0.0:0.0:0.6087:0.3913	.	305;311	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	V	305;311;311	ENSP00000306276:I305V;ENSP00000389128:I311V;ENSP00000413707:I311V	ENSP00000306276:I305V	I	-	1	0	LRRC15	195562155	1.000000	0.71417	0.836000	0.33094	0.471000	0.32888	0.831000	0.27476	0.263000	0.21812	0.533000	0.62120	ATC		0.547	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			Missense_Mutation
MED24	9862	hgsc.bcm.edu	37	17	38209850	38209850	+	Start_Codon_SNP	SNP	A	A	T			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr17:38209850A>T	ENST00000394128.2	-	2	83	c.2T>A	c.(1-3)aTg>aAg	p.M1K	MED24_ENST00000394126.1_Missense_Mutation_p.M26K|MED24_ENST00000356271.3_Start_Codon_SNP_p.M1K|MED24_ENST00000501516.3_Start_Codon_SNP_p.M1K|MED24_ENST00000479829.1_5'UTR|MED24_ENST00000394127.2_Start_Codon_SNP_p.M1K	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	1					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GACCACCTTCATTATTTCACT	0.483																																																0			17											94.0	95.0	95.0					17																	38209850		2203	4300	6503	35463376	SO:0001582	initiator_codon_variant	9862			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2T>A	17.37:g.38209850A>T	ENSP00000377686:p.Met1Lys		35463376	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.45	2.837752	0.50951	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000394127;ENST00000536318;ENST00000428757	T;T;T;T;T	0.43688	0.98;1.03;1.03;1.03;0.94	5.88	5.88	0.94601	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	.	.	.	0.80722	D	1	D;D;D;D	0.64830	0.994;0.981;0.985;0.992	D;D;D;D	0.75020	0.985;0.962;0.977;0.974	T	0.70428	-0.4874	9	0.87932	D	0	-28.216	15.9494	0.79820	1.0:0.0:0.0:0.0	.	1;1;1;1	B9TX65;O75448-2;O75448;F5H0K1	.;.;MED24_HUMAN;.	K	1	ENSP00000377684:M1K;ENSP00000348610:M1K;ENSP00000377686:M1K;ENSP00000377685:M1K;ENSP00000392276:M1K	ENSP00000348610:M1K	M	-	2	0	MED24	35463376	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	9.206000	0.95056	2.242000	0.73789	0.533000	0.62120	ATG		0.483	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	Missense_Mutation	Missense_Mutation
MKL1	57591	hgsc.bcm.edu	37	22	40816954	40816954	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr22:40816954C>G	ENST00000355630.3	-	10	1368	c.778G>C	c.(778-780)Gcc>Ccc	p.A260P	MKL1_ENST00000407029.1_Missense_Mutation_p.A260P|MKL1_ENST00000396617.3_Missense_Mutation_p.A260P|MKL1_ENST00000402042.1_Missense_Mutation_p.A210P	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	260					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.A260fs*77(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						AGGATCTTGGCGTAGGATGAG	0.612			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Deletion - Frameshift(1)	ovary(1)	22											84.0	78.0	80.0					22																	40816954		2203	4300	6503	39146900	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.778G>C	22.37:g.40816954C>G	ENSP00000347847:p.Ala260Pro		39146900	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Indel	Indel	ENST00000355630.3	37	CCDS14003.1	Indel	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636655	0.87760	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.56444	0.55;0.52;0.46;0.55	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74665	0.3746	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	T	0.77945	-0.2397	10	0.72032	D	0.01	-13.2793	18.8656	0.92290	0.0:1.0:0.0:0.0	.	210;260;260	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	P	260;260;210;260	ENSP00000347847:A260P;ENSP00000379861:A260P;ENSP00000385584:A210P;ENSP00000385835:A260P	ENSP00000347847:A260P	A	-	1	0	MKL1	39146900	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	5.877000	0.69675	2.464000	0.83262	0.462000	0.41574	GCC		0.612	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831		Indel
MYH11	4629	hgsc.bcm.edu	37	16	15854405	15854405	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr16:15854405T>C	ENST00000300036.5	-	11	1349	c.1240A>G	c.(1240-1242)Aaa>Gaa	p.K414E	MYH11_ENST00000396324.3_Missense_Mutation_p.K421E|MYH11_ENST00000452625.2_Missense_Mutation_p.K421E|MYH11_ENST00000576790.2_Missense_Mutation_p.K414E	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	414	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.K414E(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						ACCTGTTCTTTTGTCTGAGCT	0.433			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Substitution - Missense(1)	ovary(1)	16											437.0	338.0	372.0					16																	15854405		2197	4300	6497	15761906	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1240A>G	16.37:g.15854405T>C	ENSP00000300036:p.Lys414Glu		15761906	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.5	4.299059	0.81025	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.0	5.0	0.66597	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.75817	0.3901	M	0.81497	2.545	0.80722	D	1	B;B;B;B;B;B	0.29085	0.049;0.232;0.232;0.232;0.232;0.232	B;B;B;B;B;B	0.37015	0.239;0.239;0.239;0.239;0.239;0.239	T	0.77728	-0.2479	10	0.66056	D	0.02	.	13.9242	0.63952	0.0:0.0:0.0:1.0	.	421;414;414;421;414;421	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	E	414;414;421;421;421	ENSP00000300036:K414E;ENSP00000345136:K414E;ENSP00000379616:K421E;ENSP00000407821:K421E	ENSP00000300036:K414E	K	-	1	0	MYH11	15761906	1.000000	0.71417	0.994000	0.49952	0.824000	0.46624	6.201000	0.72124	1.891000	0.54761	0.254000	0.18369	AAA		0.433	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Missense_Mutation
NDUFS4	4724	hgsc.bcm.edu	37	5	52856548	52856548	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:52856548C>G	ENST00000296684.5	+	1	84	c.56C>G	c.(55-57)gCa>gGa	p.A19G		NM_002495.2	NP_002486.1	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase)	19					brain development (GO:0007420)|cAMP-mediated signaling (GO:0019933)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|positive regulation of fibroblast proliferation (GO:0048146)|reactive oxygen species metabolic process (GO:0072593)|regulation of protein phosphorylation (GO:0001932)|respiratory electron transport chain (GO:0022904)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(3)	10		Lung NSC(810;8.27e-05)|Breast(144;0.0848)				CGGAGAAGGGCAGTGGCTGTA	0.537																																																0			5											130.0	112.0	118.0					5																	52856548		2203	4300	6503	52892305	SO:0001583	missense	4724			AF020351	CCDS3960.1	5q11.1	2011-07-04	2002-08-29		ENSG00000164258	ENSG00000164258		"""Mitochondrial respiratory chain complex / Complex I"""	7711	protein-coding gene	gene with protein product	"""complex I 18kDa subunit"""	602694	"""NADH dehydrogenase (ubiquinone) Fe-S protein 4 (18kD) (NADH-coenzyme Q reductase)"""			9463323, 9763677	Standard	NM_002495		Approved	AQDQ, CI-18	uc003jpe.2	O43181	OTTHUMG00000096987	ENST00000296684.5:c.56C>G	5.37:g.52856548C>G	ENSP00000296684:p.Ala19Gly		52892305	Q9BS69	Missense_Mutation	SNP	ENST00000296684.5	37	CCDS3960.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.205	1.029583	0.19512	.	.	ENSG00000164258	ENST00000296684;ENST00000506765	T	0.66995	-0.24	5.58	3.81	0.43845	.	0.402501	0.27976	N	0.017081	T	0.56499	0.1989	L	0.40543	1.245	0.23751	N	0.996943	B	0.26635	0.155	B	0.28232	0.087	T	0.44544	-0.9321	10	0.33141	T	0.24	.	11.2723	0.49147	0.0:0.8416:0.0:0.1584	.	19	O43181	NDUS4_HUMAN	G	19;15	ENSP00000296684:A19G	ENSP00000296684:A19G	A	+	2	0	NDUFS4	52892305	0.980000	0.34600	0.501000	0.27601	0.023000	0.10783	1.430000	0.34914	0.482000	0.27582	-0.797000	0.03246	GCA		0.537	NDUFS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214062.2	NM_002495		Missense_Mutation
NPC1	4864	hgsc.bcm.edu	37	18	21127975	21127975	+	Silent	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr18:21127975T>C	ENST00000269228.5	-	11	2306	c.1752A>G	c.(1750-1752)gaA>gaG	p.E584E	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Intron	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	584					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTCACTCTTTTTCCCAGGCCT	0.438																																																0			18											162.0	156.0	158.0					18																	21127975		2203	4300	6503	19381973	SO:0001819	synonymous_variant	4864			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1752A>G	18.37:g.21127975T>C			19381973	B4DET3|Q9P130	Silent	SNP	ENST00000269228.5	37	CCDS11878.1	SNP	64	Baylor																																																																																				0.438	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271		Silent
NPHS1	4868	hgsc.bcm.edu	37	19	36333388	36333388	+	Missense_Mutation	SNP	C	C	T	rs146400394		TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr19:36333388C>T	ENST00000378910.5	-	18	2398	c.2399G>A	c.(2398-2400)cGc>cAc	p.R800H	NPHS1_ENST00000353632.6_Missense_Mutation_p.R800H	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	800	Ig-like C2-type 7.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.R800H(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AATCCGCAGGCGCCCCGTTGG	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17530	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	90.0	92.0		2399	3.4	0.2	19	dbSNP_134	92	0,8600		0,0,4300	no	missense	NPHS1	NM_004646.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	800/1242	36333388	1,13005	2203	4300	6503	41025228	SO:0001583	missense	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2399G>A	19.37:g.36333388C>T	ENSP00000368190:p.Arg800His		41025228	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	SNP	27	Baylor	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	0.629	-0.818010	0.02776	2.27E-4	0.0	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.78707	-1.2;-1.2	4.46	3.43	0.39272	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.340502	0.29791	N	0.011187	T	0.76912	0.4054	M	0.65498	2.005	0.09310	N	0.999992	D	0.55385	0.971	P	0.49597	0.616	T	0.65990	-0.6034	10	0.25751	T	0.34	-1.0032	8.212	0.31488	0.0:0.8912:0.0:0.1088	.	800	O60500	NPHN_HUMAN	H	800	ENSP00000368190:R800H;ENSP00000343634:R800H	ENSP00000343634:R800H	R	-	2	0	NPHS1	41025228	0.000000	0.05858	0.179000	0.23059	0.016000	0.09150	0.127000	0.15790	1.117000	0.41842	0.558000	0.71614	CGC		0.607	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			Missense_Mutation
P2RY10	27334	hgsc.bcm.edu	37	X	78216070	78216070	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chrX:78216070C>G	ENST00000171757.2	+	4	333	c.53C>G	c.(52-54)aCc>aGc	p.T18S	P2RY10_ENST00000544091.1_Missense_Mutation_p.T18S|P2RY10_ENST00000475374.1_3'UTR	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.T18S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						AGCAACAGTACCAGCACTGCT	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											142.0	110.0	121.0					X																	78216070		2203	4300	6503	78102726	SO:0001583	missense	27334			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.53C>G	X.37:g.78216070C>G	ENSP00000171757:p.Thr18Ser		78102726	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	CCDS14442.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.777	-0.763801	0.02996	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.36878	1.23;1.23	5.0	4.12	0.48240	.	0.360780	0.26620	N	0.023365	T	0.32406	0.0828	L	0.61218	1.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29640	-1.0005	10	0.09338	T	0.73	.	12.4502	0.55673	0.1688:0.8312:0.0:0.0	.	18	O00398	P2Y10_HUMAN	S	18	ENSP00000443138:T18S;ENSP00000171757:T18S	ENSP00000171757:T18S	T	+	2	0	P2RY10	78102726	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-0.214000	0.09292	1.067000	0.40740	0.417000	0.27973	ACC		0.383	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			Missense_Mutation
PCDHB5	26167	hgsc.bcm.edu	37	5	140517381	140517381	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:140517381C>T	ENST00000231134.5	+	1	2582	c.2365C>T	c.(2365-2367)Cgg>Tgg	p.R789W		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	789					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R789W(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCTGCCTTCCGGAATAGCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	97.0	91.0					5																	140517381		2191	4293	6484	140497565	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2365C>T	5.37:g.140517381C>T	ENSP00000231134:p.Arg789Trp		140497565	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.86	1.766120	0.31228	.	.	ENSG00000113209	ENST00000231134	T	0.53423	0.62	4.69	-2.92	0.05615	.	.	.	.	.	T	0.61375	0.2342	M	0.91818	3.245	0.09310	N	1	D	0.65815	0.995	P	0.55455	0.776	T	0.55250	-0.8170	9	0.87932	D	0	.	4.1645	0.10300	0.4754:0.2554:0.1951:0.0741	.	789	Q9Y5E4	PCDB5_HUMAN	W	789	ENSP00000231134:R789W	ENSP00000231134:R789W	R	+	1	2	PCDHB5	140497565	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.415000	0.07106	-0.442000	0.07190	-0.314000	0.08810	CGG		0.473	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		Missense_Mutation
PCDHGC4	56098	hgsc.bcm.edu	37	5	140866490	140866490	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr5:140866490G>C	ENST00000306593.1	+	1	1750	c.1750G>C	c.(1750-1752)Gtt>Ctt	p.V584L	PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V584L(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCCATCAGTTGGTGCTGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	5											78.0	74.0	75.0					5																	140866490		2203	4300	6503	140846674	SO:0001583	missense	56098			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.1750G>C	5.37:g.140866490G>C	ENSP00000306918:p.Val584Leu		140846674	Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	37	CCDS4262.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090922	0.36855	.	.	ENSG00000242419	ENST00000306593	T	0.59502	0.26	5.57	4.69	0.59074	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.48786	0.1519	L	0.27053	0.805	0.09310	N	1	B;B	0.34200	0.079;0.441	B;B	0.42995	0.069;0.404	T	0.48547	-0.9026	9	0.72032	D	0.01	.	4.9525	0.14021	0.2029:0.0:0.6361:0.1609	.	584;584	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	L	584	ENSP00000306918:V584L	ENSP00000306918:V584L	V	+	1	0	PCDHGC4	140846674	0.161000	0.22892	0.972000	0.41901	0.989000	0.77384	2.609000	0.46317	1.323000	0.45263	0.591000	0.81541	GTT		0.552	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928		Missense_Mutation
PCGF1	84759	hgsc.bcm.edu	37	2	74732316	74732316	+	Splice_Site	SNP	G	G	A	rs77847000	byFrequency	TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr2:74732316G>A	ENST00000233630.6	-	9	1645	c.734C>T	c.(733-735)cCa>cTa	p.P245L	LBX2-AS1_ENST00000603175.1_RNA|PCGF1_ENST00000480844.2_5'UTR|LBX2_ENST00000460508.3_5'Flank|LBX2_ENST00000550249.1_5'Flank|LBX2-AS1_ENST00000548978.2_RNA|RP11-523H20.3_ENST00000606287.1_RNA|LBX2_ENST00000341396.2_5'Flank	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	245	Required for repressor activity.|Sufficient for interaction with BCOR and BCORL1.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						CAAAGGGGATGGCTAAGGAGA	0.507																																																0			2											40.0	43.0	42.0					2																	74732316		2200	4300	6500	74585824	SO:0001630	splice_region_variant	84759			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.733-1C>T	2.37:g.74732316G>A			74585824	Q7Z506	Missense_Mutation	SNP	ENST00000233630.6	37	CCDS1946.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386121	0.42308	.	.	ENSG00000115289	ENST00000233630	T	0.22743	1.94	4.54	4.54	0.55810	.	0.139716	0.48286	D	0.000184	T	0.17577	0.0422	L	0.40543	1.245	0.50039	D	0.99984	B	0.22003	0.063	B	0.14023	0.01	T	0.03221	-1.1059	10	0.29301	T	0.29	-5.8841	13.0327	0.58851	0.0:0.0:1.0:0.0	.	245	Q9BSM1	PCGF1_HUMAN	L	245	ENSP00000233630:P245L	ENSP00000233630:P245L	P	-	2	0	PCGF1	74585824	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.239000	0.65371	2.527000	0.85204	0.555000	0.69702	CCA		0.507	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252216.1	NM_032673	Missense_Mutation	Missense_Mutation
PFKP	5214	hgsc.bcm.edu	37	10	3178690	3178690	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr10:3178690G>A	ENST00000381125.4	+	22	2350	c.2274G>A	c.(2272-2274)atG>atA	p.M758I	PFKP_ENST00000381072.1_Missense_Mutation_p.M176I|PFKP_ENST00000381075.2_Missense_Mutation_p.M750I|PITRM1_ENST00000464395.1_5'Flank	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	758	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)	p.M758I(1)		breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GGCCCCTCATGAAAATCCTGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											58.0	47.0	50.0					10																	3178690		2203	4300	6503	3168690	SO:0001583	missense	5214			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.2274G>A	10.37:g.3178690G>A	ENSP00000370517:p.Met758Ile		3168690	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	CCDS7059.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	g	16.40	3.111715	0.56398	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000381072	T;T;T	0.79653	-1.29;-1.29;-1.29	5.14	5.14	0.70334	Phosphofructokinase domain (1);	0.000000	0.85682	D	0.000000	T	0.81616	0.4860	M	0.76574	2.34	0.54753	D	0.999986	P;P;B	0.38582	0.638;0.638;0.382	B;B;B	0.36666	0.23;0.23;0.146	D	0.84657	0.0704	10	0.72032	D	0.01	.	18.6308	0.91359	0.0:0.0:1.0:0.0	.	750;750;758	B3KS15;Q5VSR7;Q01813	.;.;K6PP_HUMAN	I	758;747;750;176	ENSP00000370517:M758I;ENSP00000370465:M750I;ENSP00000370462:M176I	ENSP00000370462:M176I	M	+	3	0	PFKP	3168690	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.470000	0.80973	2.396000	0.81511	0.462000	0.41574	ATG		0.582	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627		Missense_Mutation
PHC1	1911	hgsc.bcm.edu	37	12	9073656	9073656	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr12:9073656G>A	ENST00000543824.1	+	5	633	c.301G>A	c.(301-303)Gcc>Acc	p.A101T	PHC1_ENST00000544916.1_Missense_Mutation_p.A101T|PHC1_ENST00000433847.2_3'UTR|PHC1_ENST00000433083.2_Missense_Mutation_p.A64T|PHC1_ENST00000536844.1_5'UTR			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	101					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A101T(1)		breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						CACCACCCAGGCCTCGGTGAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											81.0	82.0	81.0					12																	9073656		2203	4300	6503	8964923	SO:0001583	missense	1911			U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.301G>A	12.37:g.9073656G>A	ENSP00000440674:p.Ala101Thr		8964923	D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	ENST00000543824.1	37	CCDS8597.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726086	0.69074	.	.	ENSG00000111752	ENST00000538657;ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000544539;ENST00000539063;ENST00000541181	T;T;T;T	0.22945	1.94;1.94;1.93;1.94	5.59	5.59	0.84812	.	0.084314	0.49916	D	0.000123	T	0.29882	0.0747	N	0.05441	-0.05	0.80722	D	1	D;P;P	0.61697	0.99;0.684;0.684	P;B;B	0.60682	0.878;0.365;0.365	T	0.24119	-1.0169	10	0.37606	T	0.19	-4.083	19.1944	0.93681	0.0:0.0:1.0:0.0	.	101;101;101	B4DF21;P78364;B2RXH1	.;PHC1_HUMAN;.	T	101;101;101;64;101;101;101;118	ENSP00000440674:A101T;ENSP00000251757:A101T;ENSP00000399194:A64T;ENSP00000437659:A101T	ENSP00000251757:A101T	A	+	1	0	PHC1	8964923	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	2.843000	0.48238	2.628000	0.89032	0.655000	0.94253	GCC		0.532	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399115.1	NM_004426		Missense_Mutation
PHF21A	51317	hgsc.bcm.edu	37	11	45967431	45967431	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:45967431G>T	ENST00000418153.2	-	14	1608	c.1409C>A	c.(1408-1410)cCt>cAt	p.P470H	PHF21A_ENST00000527753.1_Intron|PHF21A_ENST00000257821.4_Missense_Mutation_p.P471H|PHF21A_ENST00000323180.6_Intron			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	470					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						AGGCTGAACAGGTGCAGGGAA	0.512																																																0			11											95.0	114.0	107.0					11																	45967431		2160	4267	6427	45924007	SO:0001583	missense	51317			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1409C>A	11.37:g.45967431G>T	ENSP00000398824:p.Pro470His		45924007	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	ENST00000418153.2	37	CCDS44578.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224285	0.58668	.	.	ENSG00000135365	ENST00000257821;ENST00000418153	D;D	0.92965	-3.14;-3.14	5.94	5.94	0.96194	.	0.292000	0.39615	N	0.001304	D	0.87188	0.6115	N	0.08118	0	0.34741	D	0.730812	B;P	0.41848	0.027;0.763	B;P	0.46479	0.01;0.518	D	0.90478	0.4458	10	0.42905	T	0.14	-0.4547	15.81	0.78552	0.0:0.1352:0.8648:0.0	.	470;471	Q96BD5;Q96BD5-3	PF21A_HUMAN;.	H	471;470	ENSP00000257821:P471H;ENSP00000398824:P470H	ENSP00000257821:P471H	P	-	2	0	PHF21A	45924007	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.161000	0.77505	2.820000	0.97059	0.650000	0.86243	CCT		0.512	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621		Missense_Mutation
PIGZ	80235	hgsc.bcm.edu	37	3	196675226	196675226	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0792-01	TCGA-13-0792-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr3:196675226T>A	ENST00000412723.1	-	3	688	c.542A>T	c.(541-543)gAg>gTg	p.E181V	PIGZ_ENST00000443835.1_Missense_Mutation_p.R78W	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	181					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)	p.E181V(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GAGGAGTCCCTCAATGGTGTT	0.652																																																1	Substitution - Missense(1)	ovary(1)	3											121.0	100.0	107.0					3																	196675226		2203	4300	6503	198159623	SO:0001583	missense	80235			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.542A>T	3.37:g.196675226T>A	ENSP00000413405:p.Glu181Val		198159623	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	37	CCDS3324.1	SNP	54	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.73|18.73	3.686414|3.686414	0.68157|0.68157	.|.	.|.	ENSG00000119227|ENSG00000119227	ENST00000412723|ENST00000443835	T|.	0.70869|.	-0.52|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.124148|.	0.36740|.	N|.	0.002429|.	T|T	0.80722|0.80722	0.4677|0.4677	H|H	0.94264|0.94264	3.515|3.515	0.33093|0.33093	D|D	0.538175|0.538175	D|.	0.60160|.	0.987|.	D|.	0.63597|.	0.916|.	D|D	0.89356|0.89356	0.3664|0.3664	10|6	0.87932|0.72032	D|D	0|0.01	-13.1555|-13.1555	14.5191|14.5191	0.67840|0.67840	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	181|.	Q86VD9|.	PIGZ_HUMAN|.	V|W	181|78	ENSP00000413405:E181V|.	ENSP00000413405:E181V|ENSP00000389327:R78W	E|R	-|-	2|1	0|2	PIGZ|PIGZ	198159623|198159623	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.839000|0.839000	0.47603|0.47603	5.165000|5.165000	0.64959|0.64959	2.100000|2.100000	0.63781|0.63781	0.444000|0.444000	0.29173|0.29173	GAG|AGG		0.652	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163		Missense_Mutation
PIK3CG	5294	hgsc.bcm.edu	37	7	106509339	106509339	+	Missense_Mutation	SNP	G	G	T	rs150482982		TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr7:106509339G>T	ENST00000359195.3	+	2	1643	c.1333G>T	c.(1333-1335)Gcc>Tcc	p.A445S	PIK3CG_ENST00000496166.1_Missense_Mutation_p.A445S|PIK3CG_ENST00000440650.2_Missense_Mutation_p.A445S	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	445	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A445S(1)|p.A445T(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GTCCAGCAAGGCCTCTGCAGA	0.522																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	7											64.0	67.0	66.0					7																	106509339		2203	4300	6503	106296575	SO:0001583	missense	5294				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1333G>T	7.37:g.106509339G>T	ENSP00000352121:p.Ala445Ser		106296575	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.378511	0.01204	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.75704	-0.96;-0.96;-0.96	5.29	3.48	0.39840	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.512326	0.22051	N	0.065314	T	0.47820	0.1466	N	0.13235	0.315	0.22457	N	0.999082	B	0.06786	0.001	B	0.06405	0.002	T	0.36163	-0.9759	10	0.02654	T	1	-9.294	4.9363	0.13943	0.2482:0.0:0.6032:0.1486	.	445	P48736	PK3CG_HUMAN	S	445	ENSP00000392258:A445S;ENSP00000419260:A445S;ENSP00000352121:A445S	ENSP00000352121:A445S	A	+	1	0	PIK3CG	106296575	0.988000	0.35896	0.659000	0.29680	0.100000	0.18952	1.722000	0.38042	0.620000	0.30215	0.655000	0.94253	GCC		0.522	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			Missense_Mutation
PRKCZ	5590	hgsc.bcm.edu	37	1	2082293	2082293	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:2082293A>C	ENST00000400921.2	+	6	886	c.203A>C	c.(202-204)gAc>gCc	p.D68A	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.D68A	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	251	OPR.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.D251A(1)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	GGGCTGCAGGACTTTGACCTA	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	79.0	79.0					1																	2082293		2203	4300	6503	2072153	SO:0001583	missense	5590			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.203A>C	1.37:g.2082293A>C	ENSP00000383712:p.Asp68Ala		2072153	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	ENST00000400921.2	37	CCDS41229.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.7	4.324928	0.81580	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000470596;ENST00000496325;ENST00000482686;ENST00000400920;ENST00000486681;ENST00000470986;ENST00000470511;ENST00000497183	T;T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.85;1.7;3.01;3.01;3.01	4.8	4.8	0.61643	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.30103	0.0754	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.998	P;D;D	0.73708	0.895;0.981;0.975	T	0.37957	-0.9683	10	0.87932	D	0	.	13.6712	0.62427	1.0:0.0:0.0:0.0	.	147;75;251	E9PCW2;B3KUN5;Q05513	.;.;KPCZ_HUMAN	A	251;68;147;68;68;68;68;64;68;68;64	ENSP00000367830:D251A;ENSP00000383712:D68A;ENSP00000426412:D147A;ENSP00000424228:D68A;ENSP00000383711:D68A;ENSP00000424763:D64A;ENSP00000421219:D68A;ENSP00000422764:D64A	ENSP00000367830:D251A	D	+	2	0	PRKCZ	2072153	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.493000	0.90474	2.016000	0.59253	0.482000	0.46254	GAC		0.517	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744		Missense_Mutation
PRKDC	5591	hgsc.bcm.edu	37	8	48772284	48772284	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr8:48772284G>A	ENST00000314191.2	-	47	6148	c.6092C>T	c.(6091-6093)gCa>gTa	p.A2031V	PRKDC_ENST00000338368.3_Missense_Mutation_p.A2031V|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2032					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.A2031V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GGTACTGTCTGCCAAATATGA	0.388								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											68.0	65.0	66.0					8																	48772284		1849	4102	5951	48934837	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.6092C>T	8.37:g.48772284G>A	ENSP00000313420:p.Ala2031Val		48934837	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.42	2.531578	0.45073	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.27256	1.68;1.68	5.9	1.93	0.25924	NUC194 (1);Armadillo-type fold (1);	0.459334	0.23296	N	0.049733	T	0.24431	0.0592	L	0.52759	1.655	0.29878	N	0.826258	B;B	0.33044	0.395;0.234	B;B	0.39771	0.309;0.178	T	0.15122	-1.0448	10	0.49607	T	0.09	.	5.8897	0.18904	0.0729:0.1411:0.5732:0.2128	.	2031;2032	E7EUY0;P78527	.;PRKDC_HUMAN	V	2031	ENSP00000313420:A2031V;ENSP00000345182:A2031V	ENSP00000313420:A2031V	A	-	2	0	PRKDC	48934837	1.000000	0.71417	0.109000	0.21407	0.841000	0.47740	2.945000	0.49043	0.073000	0.16731	0.561000	0.74099	GCA		0.388	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		Missense_Mutation
PYGM	5837	hgsc.bcm.edu	37	11	64522773	64522773	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:64522773A>G	ENST00000164139.3	-	7	1225	c.827T>C	c.(826-828)aTc>aCc	p.I276T	PYGM_ENST00000377432.3_Missense_Mutation_p.I188T	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	276					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)	p.I276T(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GACACGAGAGATGTTCTCCGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											125.0	121.0	123.0					11																	64522773		2201	4296	6497	64279349	SO:0001583	missense	5837				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.827T>C	11.37:g.64522773A>G	ENSP00000164139:p.Ile276Thr		64279349	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638176	0.87760	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.95821	-3.48;-3.82	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000007	D	0.98607	0.9534	H	0.98155	4.16	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.97110	0.998;1.0	D	0.99552	1.0966	10	0.87932	D	0	-26.458	13.7929	0.63152	1.0:0.0:0.0:0.0	.	188;276	A6NDY6;P11217	.;PYGM_HUMAN	T	188;276;257	ENSP00000366650:I188T;ENSP00000164139:I276T	ENSP00000164139:I276T	I	-	2	0	PYGM	64279349	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.339000	0.96797	2.153000	0.67306	0.533000	0.62120	ATC		0.612	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609		Missense_Mutation
SIKE1	80143	hgsc.bcm.edu	37	1	115323057	115323057	+	Intron	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:115323057C>A	ENST00000060969.5	-	1	229				SIKE1_ENST00000369528.5_Splice_Site|SIKE1_ENST00000506320.1_Intron			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1						innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						TGGACTCCTACCCTCTGCCTG	0.662																																																0			1											38.0	45.0	43.0					1																	115323057		2203	4300	6503	115124580	SO:0001627	intron_variant	80143			AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.159+12G>T	1.37:g.115323057C>A			115124580	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	Splice_Site_SNP	SNP	ENST00000060969.5	37	CCDS878.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036532	0.54896	.	.	ENSG00000052723	ENST00000369528	.	.	.	5.06	1.66	0.24008	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3754	0.60736	0.0:0.41:0.59:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIKE1	115124580	0.001000	0.12720	0.101000	0.21167	0.699000	0.40488	0.206000	0.17375	0.674000	0.31244	0.655000	0.94253	.		0.662	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033401.1	NM_025073		Splice_Site_SNP
RXFP4	339403	hgsc.bcm.edu	37	1	155912014	155912021	+	Frame_Shift_Del	DEL	GTGACGGT	GTGACGGT	-			TCGA-13-0792-01	TCGA-13-0792-10	GTGACGGT	GTGACGGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:155912014_155912021delGTGACGGT	ENST00000368318.3	+	1	535_542	c.514_521delGTGACGGT	c.(514-522)gtgacggtgfs	p.VTV172fs		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)	p.V172fs*10(1)		endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGCTGCCCTGGTGACGGTGCCCACAGCT	0.678																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								154178645	SO:0001589	frameshift_variant	339403			AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.514_521delGTGACGGT	1.37:g.155912014_155912021delGTGACGGT	ENSP00000357301:p.Val172fs		154178638	B0M0L4|Q3MJB1|Q8NGZ8	Frame_Shift_Del	DEL	ENST00000368318.3	37	CCDS1124.1	DEL	44	Baylor																																																																																				0.678	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885		Frame_Shift_Del
SCUBE2	57758	hgsc.bcm.edu	37	11	9055246	9055246	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0792-01	TCGA-13-0792-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:9055246A>C	ENST00000309263.3	-	16	2085	c.2013T>G	c.(2011-2013)tgT>tgG	p.C671W	SCUBE2_ENST00000520467.1_Intron|SCUBE2_ENST00000457346.2_Missense_Mutation_p.C700W|SCUBE2_ENST00000450649.2_Missense_Mutation_p.C545W|RP11-467K18.2_ENST00000531592.1_RNA			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	671						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.C671W(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		GGCATGGTTCACAAGTCATTT	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											186.0	178.0	181.0					11																	9055246		2201	4296	6497	9011822	SO:0001583	missense	57758			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2013T>G	11.37:g.9055246A>C	ENSP00000310658:p.Cys671Trp		9011822	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338212	0.60963	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649	D;D;D	0.86956	-2.19;-2.19;-2.19	5.68	-0.729	0.11158	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.94218	0.8144	H	0.95611	3.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.92849	0.6295	10	0.87932	D	0	.	10.9371	0.47251	0.5731:0.0:0.4269:0.0	.	545;671	Q9NQ36-3;Q9NQ36	.;SCUB2_HUMAN	W	700;671;545	ENSP00000390481:C700W;ENSP00000310658:C671W;ENSP00000415187:C545W	ENSP00000310658:C671W	C	-	3	2	SCUBE2	9011822	1.000000	0.71417	0.950000	0.38849	0.905000	0.53344	1.337000	0.33862	-0.385000	0.07833	0.533000	0.62120	TGT		0.478	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974		Missense_Mutation
SCN2B	6327	hgsc.bcm.edu	37	11	118039458	118039458	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:118039458C>T	ENST00000278947.5	-	2	320	c.79G>A	c.(79-81)Gga>Aga	p.G27R		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	27					cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGCTCCGTCCTGGTGGCACT	0.617																																																0			11											125.0	118.0	120.0					11																	118039458		2200	4296	6496	117544668	SO:0001583	missense	6327			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.79G>A	11.37:g.118039458C>T	ENSP00000278947:p.Gly27Arg		117544668	O75302|Q9UNN3	Missense_Mutation	SNP	ENST00000278947.5	37	CCDS8390.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351810	0.24512	.	.	ENSG00000149575	ENST00000278947	D	0.97256	-4.31	4.65	3.74	0.42951	Immunoglobulin-like (1);	0.404254	0.24370	N	0.039109	D	0.91650	0.7361	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.81801	-0.0766	10	0.23891	T	0.37	-21.9286	7.255	0.26171	0.0:0.8036:0.0:0.1964	.	27	O60939	SCN2B_HUMAN	R	27	ENSP00000278947:G27R	ENSP00000278947:G27R	G	-	1	0	SCN2B	117544668	0.006000	0.16342	0.896000	0.35187	0.389000	0.30415	2.002000	0.40835	1.296000	0.44742	0.655000	0.94253	GGA		0.617	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588		Missense_Mutation
SERPINA4	5267	hgsc.bcm.edu	37	14	95030260	95030260	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr14:95030260C>A	ENST00000557004.1	+	2	862	c.441C>A	c.(439-441)caC>caA	p.H147Q	SERPINA4_ENST00000298841.5_Missense_Mutation_p.H147Q|SERPINA4_ENST00000555095.1_Missense_Mutation_p.H147Q|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	147					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.H147Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		TCCTGAGCCACAACCTGAAGT	0.552																																																1	Substitution - Missense(1)	ovary(1)	14											139.0	123.0	128.0					14																	95030260		2203	4300	6503	94100013	SO:0001583	missense	5267			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.441C>A	14.37:g.95030260C>A	ENSP00000450838:p.His147Gln		94100013	Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	CCDS9927.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	1.098	-0.662082	0.03454	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	T;T;T	0.81415	-1.49;-1.49;-1.49	4.3	-4.79	0.03200	Serpin domain (3);	0.690715	0.12579	N	0.456604	T	0.39200	0.1069	N	0.00493	-1.44	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.06405	0.001;0.002	T	0.42258	-0.9462	10	0.31617	T	0.26	.	0.6596	0.00840	0.3423:0.1076:0.2424:0.3076	.	147;147	B2R815;P29622	.;KAIN_HUMAN	Q	147	ENSP00000450838:H147Q;ENSP00000451172:H147Q;ENSP00000298841:H147Q	ENSP00000298841:H147Q	H	+	3	2	SERPINA4	94100013	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.006000	0.00160	-0.873000	0.04032	-1.087000	0.02190	CAC		0.552	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		Missense_Mutation
SERPINA4	5267	hgsc.bcm.edu	37	14	95030398	95030398	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr14:95030398G>C	ENST00000557004.1	+	2	1000	c.579G>C	c.(577-579)aaG>aaC	p.K193N	SERPINA4_ENST00000298841.5_Missense_Mutation_p.K193N|SERPINA4_ENST00000555095.1_Missense_Mutation_p.K193N|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	193					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.K193N(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		CTCGAGGGAAGATTGTGGATT	0.453																																																1	Substitution - Missense(1)	ovary(1)	14											169.0	159.0	162.0					14																	95030398		2203	4300	6503	94100151	SO:0001583	missense	5267			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.579G>C	14.37:g.95030398G>C	ENSP00000450838:p.Lys193Asn		94100151	Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	CCDS9927.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953242	0.53293	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.86627	-2.15;-2.15;-2.15	4.41	1.52	0.23074	Serpin domain (3);	0.097010	0.42053	D	0.000765	D	0.92577	0.7642	M	0.90198	3.095	0.80722	D	1	D;D	0.71674	0.995;0.998	P;D	0.69142	0.893;0.962	D	0.90816	0.4705	10	0.87932	D	0	.	7.0883	0.25270	0.4645:0.0:0.5355:0.0	.	193;193	B2R815;P29622	.;KAIN_HUMAN	N	193	ENSP00000450838:K193N;ENSP00000451172:K193N;ENSP00000298841:K193N	ENSP00000298841:K193N	K	+	3	2	SERPINA4	94100151	0.906000	0.30813	0.822000	0.32727	0.107000	0.19398	-0.023000	0.12456	0.431000	0.26258	-0.137000	0.14449	AAG		0.453	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		Missense_Mutation
SCAF11	9169	hgsc.bcm.edu	37	12	46342315	46342315	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr12:46342315T>A	ENST00000369367.3	-	5	536	c.303A>T	c.(301-303)caA>caT	p.Q101H	SCAF11_ENST00000419565.2_Missense_Mutation_p.Q101H	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	101					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q101H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GTTTTTTTACTTGAACCTATG	0.294																																																1	Substitution - Missense(1)	ovary(1)	12											118.0	101.0	106.0					12																	46342315		1796	4065	5861	44628582	SO:0001583	missense	9169			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.303A>T	12.37:g.46342315T>A	ENSP00000358374:p.Gln101His		44628582	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.63	2.890830	0.52014	.	.	ENSG00000139218	ENST00000369367;ENST00000419565;ENST00000547018;ENST00000266589	T;T;T;T	0.48201	0.94;0.94;0.94;0.82	5.76	-1.39	0.08997	.	0.160620	0.28933	U	0.013678	T	0.29028	0.0721	L	0.34521	1.04	0.29124	N	0.880066	B	0.16396	0.017	B	0.12837	0.008	T	0.11251	-1.0595	10	0.54805	T	0.06	-5.8712	4.8467	0.13517	0.0:0.24:0.2818:0.4782	.	101	Q99590	SCAFB_HUMAN	H	101;101;41;117	ENSP00000358374:Q101H;ENSP00000413036:Q101H;ENSP00000446746:Q41H;ENSP00000266589:Q117H	ENSP00000266589:Q117H	Q	-	3	2	SCAF11	44628582	0.997000	0.39634	0.991000	0.47740	0.787000	0.44495	0.118000	0.15605	0.083000	0.17047	0.460000	0.39030	CAA		0.294	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719		Missense_Mutation
SH2B1	25970	hgsc.bcm.edu	37	16	28884009	28884009	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr16:28884009C>T	ENST00000322610.8	+	10	2319	c.1880C>T	c.(1879-1881)tCc>tTc	p.S627F	SH2B1_ENST00000545570.1_Missense_Mutation_p.S317F|SH2B1_ENST00000395532.4_Missense_Mutation_p.S627F|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000337120.5_Missense_Mutation_p.S627F|SH2B1_ENST00000359285.5_Missense_Mutation_p.S627F|SH2B1_ENST00000538342.1_Missense_Mutation_p.S291F			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	627					blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.S627F(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						TATGTCCCATCCTCCCAGCGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	16											84.0	73.0	77.0					16																	28884009		2197	4300	6497	28791510	SO:0001583	missense	25970			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1880C>T	16.37:g.28884009C>T	ENSP00000321221:p.Ser627Phe		28791510	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	c	8.375	0.836297	0.16891	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	D;D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05;-4.05	3.95	2.99	0.34606	.	0.077063	0.48286	D	0.000181	D	0.91081	0.7193	N	0.12182	0.205	0.32812	D	0.501555	B;P;B;P;P	0.44816	0.001;0.844;0.014;0.744;0.834	B;B;B;B;B	0.43838	0.001;0.433;0.012;0.341;0.099	D	0.91202	0.4992	10	0.44086	T	0.13	.	10.5987	0.45354	0.0:0.902:0.0:0.098	.	291;317;627;627;627	B4DLN5;F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;.;SH2B1_HUMAN	F	627;317;627;291;627;627	ENSP00000321221:S627F;ENSP00000440354:S317F;ENSP00000352232:S627F;ENSP00000438784:S291F;ENSP00000378903:S627F;ENSP00000337163:S627F	ENSP00000321221:S627F	S	+	2	0	SH2B1	28791510	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.787000	0.47798	0.654000	0.30846	-0.251000	0.11542	TCC		0.597	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		Missense_Mutation
SLC22A10	387775	hgsc.bcm.edu	37	11	63064806	63064806	+	Silent	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:63064806T>C	ENST00000332793.6	+	3	540	c.538T>C	c.(538-540)Ttg>Ctg	p.L180L	SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.L25L|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000535888.1_5'UTR	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	180						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.L180L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CAGATGGTGTTTGCTCCAGCT	0.418																																																1	Substitution - coding silent(1)	ovary(1)	11											170.0	170.0	170.0					11																	63064806		2074	4240	6314	62821382	SO:0001819	synonymous_variant	387775			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.538T>C	11.37:g.63064806T>C			62821382	Q68CJ0	Silent	SNP	ENST00000332793.6	37	CCDS41661.1	SNP	64	Baylor																																																																																				0.418	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752		Silent
SUPT5H	6829	hgsc.bcm.edu	37	19	39955515	39955515	+	Missense_Mutation	SNP	C	C	A	rs2304216	byFrequency	TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr19:39955515C>A	ENST00000599117.1	+	12	1069	c.702C>A	c.(700-702)caC>caA	p.H234Q	SUPT5H_ENST00000402194.2_Missense_Mutation_p.H230Q|SUPT5H_ENST00000432763.2_Missense_Mutation_p.H234Q|SUPT5H_ENST00000598725.1_Missense_Mutation_p.H234Q|SUPT5H_ENST00000359191.6_Missense_Mutation_p.H230Q			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	234	Interaction with SUPT4H1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGCAGACCCACGTGAAGCAGG	0.587																																																0			19											103.0	88.0	93.0					19																	39955515		2203	4300	6503	44647355	SO:0001583	missense	6829			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.702C>A	19.37:g.39955515C>A	ENSP00000470252:p.His234Gln		44647355	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	c	17.37	3.372543	0.61624	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.62	-9.1	0.00714	Transcription antitermination protein, NusG, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68146	0.2969	M	0.78637	2.42	0.09310	P	0.999999886546	D;D	0.67145	0.995;0.996	D;D	0.76575	0.979;0.988	T	0.79325	-0.1850	7	.	.	.	-25.1679	15.2837	0.73810	0.0:0.3844:0.0:0.6156	.	230;234	O00267-2;O00267	.;SPT5H_HUMAN	Q	234;230;212;234	.	.	H	+	3	2	SUPT5H	44647355	0.007000	0.16637	0.496000	0.27539	0.864000	0.49448	-0.961000	0.03845	-1.680000	0.01450	-2.740000	0.00127	CAC		0.587	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169		Missense_Mutation
TARBP1	6894	hgsc.bcm.edu	37	1	234553916	234553916	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr1:234553916T>C	ENST00000040877.1	-	22	3618	c.3619A>G	c.(3619-3621)Ata>Gta	p.I1207V		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1207					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AAATATTTTATGGATGCTTGA	0.289																																																0			1											26.0	30.0	29.0					1																	234553916		2186	4266	6452	232620539	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3619A>G	1.37:g.234553916T>C	ENSP00000040877:p.Ile1207Val		232620539	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	1.305	-0.603777	0.03717	.	.	ENSG00000059588	ENST00000040877	T	0.32515	1.45	4.88	3.75	0.43078	Armadillo-type fold (1);	0.116057	0.56097	D	0.000032	T	0.11750	0.0286	N	0.10945	0.07	0.39163	D	0.962457	B	0.17038	0.02	B	0.14023	0.01	T	0.17289	-1.0374	10	0.02654	T	1	-20.3338	5.4586	0.16604	0.0:0.3338:0.0:0.6662	.	1207	Q13395	TARB1_HUMAN	V	1207	ENSP00000040877:I1207V	ENSP00000040877:I1207V	I	-	1	0	TARBP1	232620539	0.926000	0.31397	0.999000	0.59377	0.962000	0.63368	1.119000	0.31258	0.883000	0.36040	0.383000	0.25322	ATA		0.289	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		Missense_Mutation
TET3	200424	hgsc.bcm.edu	37	2	74326701	74326703	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-13-0792-01	TCGA-13-0792-10	AGG	AGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr2:74326701_74326703delAGG	ENST00000409262.3	+	8	3161_3163	c.3161_3163delAGG	c.(3160-3165)caggag>cag	p.E1055del		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1055					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.E332delE(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGATCAAGCAGGAGGCCCTGGA	0.631																																																1	Deletion - In frame(1)	ovary(1)	2																																								74180211	SO:0001651	inframe_deletion	200424				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.3161_3163delAGG	2.37:g.74326704_74326706delAGG	ENSP00000386869:p.Glu1055del		74180209	A6NEI3|Q86Z24|Q8TBM9	In_Frame_Del	DEL	ENST00000409262.3	37	CCDS46339.1	DEL	7	Baylor																																																																																				0.631	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			In_Frame_Del
THAP10	56906	hgsc.bcm.edu	37	15	71174913	71174913	+	Silent	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr15:71174913T>C	ENST00000249861.4	-	3	1166	c.654A>G	c.(652-654)agA>agG	p.R218R	LRRC49_ENST00000544974.2_Intron	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	218							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R218R(1)		NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GAGAGGAAGTTCTAGACCACA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	15											162.0	155.0	157.0					15																	71174913		2199	4297	6496	68961967	SO:0001819	synonymous_variant	56906			AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.654A>G	15.37:g.71174913T>C			68961967	B2R8R0	Silent	SNP	ENST00000249861.4	37	CCDS10237.1	SNP	62	Baylor																																																																																				0.393	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257242.2	NM_020147		Silent
TMEM126B	55863	hgsc.bcm.edu	37	11	85347228	85347228	+	Silent	SNP	T	T	C			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:85347228T>C	ENST00000358867.6	+	5	671	c.648T>C	c.(646-648)taT>taC	p.Y216Y	TMEM126B_ENST00000534341.1_3'UTR|TMEM126B_ENST00000393375.1_Silent_p.Y186Y	NM_018480.4	NP_060950.3	Q8IUX1	T126B_HUMAN	transmembrane protein 126B	216						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				kidney(1)|large_intestine(2)|lung(3)|prostate(1)	7		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				TATACCATTATGCAGTATTTG	0.318																																																0			11											62.0	57.0	58.0					11																	85347228		2203	4298	6501	85024876	SO:0001819	synonymous_variant	55863				CCDS8267.1, CCDS8267.2, CCDS53686.1	11q14.1	2013-05-24				ENSG00000171204		"""Mitochondrial respiratory chain complex assembly factors"""	30883	protein-coding gene	gene with protein product		615533				22982022	Standard	NM_018480		Approved	HT007	uc001pap.4	Q8IUX1		ENST00000358867.6:c.648T>C	11.37:g.85347228T>C			85024876	A8K535|A8MSS0|Q32Q09|Q8WVU3|Q96EP3|Q9NZ29	Silent	SNP	ENST00000358867.6	37	CCDS8267.2	SNP	51	Baylor																																																																																				0.318	TMEM126B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392164.1	NM_018480		Silent
TMEM136	219902	hgsc.bcm.edu	37	11	120198134	120198134	+	Intron	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:120198134G>A	ENST00000375095.2	+	2	240				TMEM136_ENST00000529187.1_Nonsense_Mutation_p.W17*|TMEM136_ENST00000314475.2_Nonsense_Mutation_p.W17*|TMEM136_ENST00000531346.1_Intron	NM_001198671.1|NM_001198672.1|NM_001198673.1|NM_001198674.1|NM_001198675.1	NP_001185600.1|NP_001185601.1|NP_001185602.1|NP_001185603.1|NP_001185604.1	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral component of membrane (GO:0016021)		p.W17*(1)		endometrium(1)|lung(2)|ovary(1)	4		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		TTCTGGTTTTGGTCTTTTCAT	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	11											178.0	165.0	169.0					11																	120198134		2203	4299	6502	119703344	SO:0001627	intron_variant	219902			BC015232	CCDS8432.1, CCDS55792.1, CCDS55793.1	11q23.3	2006-11-24				ENSG00000181264			28280	protein-coding gene	gene with protein product						12477932	Standard	NM_174926		Approved	MGC17839	uc001pxj.3	Q6ZRR5		ENST00000375095.2:c.-1-16G>A	11.37:g.120198134G>A			119703344	B4DGQ4|B4E230|Q8IZ79	Nonsense_Mutation	SNP	ENST00000375095.2	37	CCDS55793.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	37	6.011973	0.97200	.	.	ENSG00000181264	ENST00000314475;ENST00000529187	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7709	0.29008	0.0808:0.0:0.7133:0.2059	.	.	.	.	X	17	.	ENSP00000312672:W17X	W	+	2	0	TMEM136	119703344	0.999000	0.42202	0.998000	0.56505	0.994000	0.84299	2.756000	0.47549	2.629000	0.89072	0.655000	0.94253	TGG		0.413	TMEM136-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388045.1	NM_174926		Nonsense_Mutation
TMX1	81542	hgsc.bcm.edu	37	14	51707029	51707029	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0792-01	TCGA-13-0792-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr14:51707029C>G	ENST00000457354.2	+	1	144	c.19C>G	c.(19-21)Ctt>Gtt	p.L7V		NM_030755.4	NP_110382.3	Q9H3N1	TMX1_HUMAN	thioredoxin-related transmembrane protein 1	7					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide isomerase activity (GO:0003756)			endometrium(2)|large_intestine(2)|urinary_tract(1)	5						CTCCGGGAGTCTTGCAGTTCC	0.677																																																0			14											52.0	59.0	57.0					14																	51707029		2002	4155	6157	50776779	SO:0001583	missense	81542			AB048246	CCDS41953.1	14q22.1	2011-10-19	2009-02-23	2009-02-23				"""Protein disulfide isomerases"""	15487	protein-coding gene	gene with protein product	"""thioredoxin-related transmembrane protein"", ""protein disulfide isomerase family A, member 11"""	610527	"""thioredoxin domain-containing"", ""thioredoxin domain containing"", ""thioredoxin domain containing 1"""	TXNDC, TXNDC1		11152479	Standard	NM_030755		Approved	TMX, PDIA11	uc001wza.4	Q9H3N1		ENST00000457354.2:c.19C>G	14.37:g.51707029C>G	ENSP00000393316:p.Leu7Val		50776779	B2R7A4|Q8N487|Q8NBN5|Q9Y4T6	Missense_Mutation	SNP	ENST00000457354.2	37	CCDS41953.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.462	0.085568	0.08583	.	.	ENSG00000139921	ENST00000457354	T	0.15256	2.44	5.76	3.92	0.45320	Thioredoxin-like fold (1);	0.998866	0.08103	N	0.997408	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.33904	-0.9850	10	0.33940	T	0.23	2.3833	6.3878	0.21569	0.0:0.6884:0.1517:0.1599	.	7;7	B7Z7R5;Q9H3N1	.;TMX1_HUMAN	V	7	ENSP00000393316:L7V	ENSP00000393316:L7V	L	+	1	0	TMX1	50776779	0.002000	0.14202	0.003000	0.11579	0.035000	0.12851	0.648000	0.24828	0.870000	0.35726	0.655000	0.94253	CTT		0.677	TMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411206.1	NM_030755		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7577566	7577567	+	Frame_Shift_Ins	INS	-	-	A	rs193920789		TCGA-13-0792-01	TCGA-13-0792-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr17:7577566_7577567insA	ENST00000269305.4	-	7	903_904	c.714_715insT	c.(712-717)tgtaacfs	p.N239fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Ins_p.N239fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.N239fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239D(33)|p.N239fs*25(12)|p.0?(8)|p.N239Y(6)|p.N239fs*1(5)|p.?(5)|p.M237_N239delMCN(4)|p.C238*(4)|p.N239_C242delNSSC(3)|p.N239fs*8(2)|p.C238W(2)|p.N239_S240delNS(2)|p.N239fs*26(1)|p.N146D(1)|p.N146fs*1(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.C238fs*21(1)|p.C238C(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGAACTGTTACACATGTAGT	0.574		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	103	Substitution - Missense(42)|Insertion - Frameshift(18)|Deletion - In frame(15)|Whole gene deletion(8)|Deletion - Frameshift(7)|Substitution - Nonsense(5)|Unknown(5)|Complex - frameshift(1)|Substitution - coding silent(1)|Insertion - In frame(1)	ovary(14)|haematopoietic_and_lymphoid_tissue(11)|oesophagus(11)|central_nervous_system(9)|lung(8)|biliary_tract(7)|large_intestine(7)|upper_aerodigestive_tract(6)|breast(6)|endometrium(5)|urinary_tract(5)|bone(5)|stomach(4)|prostate(2)|liver(1)|skin(1)|pancreas(1)	17																																								7518292	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.715dupT	17.37:g.7577567_7577567dupA	ENSP00000269305:p.Asn239fs		7518291	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	61	Baylor																																																																																				0.574	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Ins
UNC5C	8633	hgsc.bcm.edu	37	4	96140248	96140248	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr4:96140248G>A	ENST00000453304.1	-	9	1865	c.1517C>T	c.(1516-1518)aCc>aTc	p.T506I	UNC5C_ENST00000506749.1_Missense_Mutation_p.T525I	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	506					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.T506I(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAACGACTGGGTCATCTGAGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	4											165.0	139.0	148.0					4																	96140248		2203	4300	6503	96359271	SO:0001583	missense	8633			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1517C>T	4.37:g.96140248G>A	ENSP00000406022:p.Thr506Ile		96359271	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596332	0.46318	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.58506	0.63;0.33;0.37	5.45	4.59	0.56863	.	0.265513	0.43416	D	0.000566	T	0.46268	0.1384	N	0.25647	0.755	0.80722	D	1	B;P;P	0.49961	0.399;0.93;0.93	B;B;B	0.41571	0.147;0.36;0.36	T	0.42189	-0.9466	10	0.35671	T	0.21	.	15.9412	0.79756	0.0:0.1354:0.8646:0.0	.	506;525;506	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	I	506;465;525;525	ENSP00000406022:T506I;ENSP00000426924:T525I;ENSP00000426153:T525I	ENSP00000328673:T465I	T	-	2	0	UNC5C	96359271	1.000000	0.71417	0.995000	0.50966	0.891000	0.51852	5.786000	0.69006	1.246000	0.43901	0.655000	0.94253	ACC		0.527	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		Missense_Mutation
VIPR2	7434	hgsc.bcm.edu	37	7	158935206	158935206	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0792-01	TCGA-13-0792-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr7:158935206T>A	ENST00000262178.2	-	2	268	c.83A>T	c.(82-84)cAt>cTt	p.H28L	VIPR2_ENST00000421760.2_Missense_Mutation_p.H28L|VIPR2_ENST00000402066.1_Missense_Mutation_p.H169L	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	28					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)	p.H28L(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		TATTTCCAGATGAAATCGGCA	0.388																																					Pancreas(154;1876 1931 2329 17914 20079)											1	Substitution - Missense(1)	ovary(1)	7											193.0	182.0	186.0					7																	158935206		2203	4298	6501	158627967	SO:0001583	missense	7434			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.83A>T	7.37:g.158935206T>A	ENSP00000262178:p.His28Leu		158627967	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	ENST00000262178.2	37	CCDS5950.1	SNP	51	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.538|8.538	0.872562|0.872562	0.17322|0.17322	.|.	.|.	ENSG00000106018|ENSG00000106018	ENST00000262178;ENST00000402066;ENST00000421760|ENST00000418475	T;T;T|.	0.51071|.	0.85;0.85;0.72|.	5.09|5.09	3.94|3.94	0.45596|0.45596	.|.	0.000000|.	0.50627|.	D|.	0.000120|.	T|T	0.51924|0.51924	0.1703|0.1703	L|L	0.41079|0.41079	1.255|1.255	0.44275|0.44275	D|D	0.997131|0.997131	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.43343|0.43343	-0.9397|-0.9397	9|5	.|.	.|.	.|.	.|.	7.4608|7.4608	0.27294|0.27294	0.0:0.0988:0.0:0.9012|0.0:0.0988:0.0:0.9012	.|.	28|.	P41587|.	VIPR2_HUMAN|.	L|F	28;169;28|23	ENSP00000262178:H28L;ENSP00000384497:H169L;ENSP00000402690:H28L|.	.|.	H|I	-|-	2|1	0|0	VIPR2|VIPR2	158627967|158627967	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.991000|0.991000	0.79684|0.79684	3.463000|3.463000	0.53050|0.53050	0.906000|0.906000	0.36621|0.36621	0.482000|0.482000	0.46254|0.46254	CAT|ATC		0.388	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382		Missense_Mutation
ZDHHC24	254359	hgsc.bcm.edu	37	11	66311275	66311275	+	Silent	SNP	G	G	T			TCGA-13-0792-01	TCGA-13-0792-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0792-01	TCGA-13-0792-10	g.chr11:66311275G>T	ENST00000310442.3	-	2	693	c.459C>A	c.(457-459)gtC>gtA	p.V153V	ZDHHC24_ENST00000525925.1_5'UTR|ACTN3_ENST00000502692.1_RNA|ZDHHC24_ENST00000526986.1_Silent_p.V153V	NM_207340.1	NP_997223.1	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	153	Leu-rich.					integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.V153V(1)		endometrium(1)|large_intestine(3)|ovary(1)|prostate(1)|skin(1)	7						GCAGCACAGAGACGTGGAGCA	0.692											OREG0021110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	11											34.0	35.0	35.0					11																	66311275		2195	4292	6487	66067851	SO:0001819	synonymous_variant	254359			BC005015	CCDS8143.1	11q13.2	2008-05-02				ENSG00000174165		"""Zinc fingers, DHHC-type"""	27387	protein-coding gene	gene with protein product							Standard	NM_207340		Approved		uc001oin.1	Q6UX98		ENST00000310442.3:c.459C>A	11.37:g.66311275G>T		1090	66067851	Q6PEW7|Q9BSJ0	Silent	SNP	ENST00000310442.3	37	CCDS8143.1	SNP	33	Baylor																																																																																				0.692	ZDHHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393089.1	NM_207340		Silent
