#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAMTS4	9507	hgsc.bcm.edu	37	1	161161089	161161089	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:161161089C>A	ENST00000367996.5	-	9	2781	c.2353G>T	c.(2353-2355)Gtc>Ttc	p.V785F	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	785	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.V785L(1)|p.V785F(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GCCACTAGGACTTGCAGTGTC	0.657																																																2	Substitution - Missense(2)	ovary(2)	1											62.0	49.0	54.0					1																	161161089		2203	4300	6503	159427713	SO:0001583	missense	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.2353G>T	1.37:g.161161089C>A	ENSP00000356975:p.Val785Phe		159427713	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	CCDS1223.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478971	0.84747	.	.	ENSG00000158859	ENST00000367996	T	0.59906	0.23	4.42	4.42	0.53409	ADAM-TS Spacer 1 (1);	0.282688	0.26297	N	0.025200	T	0.70570	0.3239	M	0.83223	2.63	0.80722	D	1	P	0.44260	0.83	P	0.58013	0.831	T	0.75739	-0.3212	10	0.87932	D	0	.	16.3084	0.82859	0.0:1.0:0.0:0.0	.	785	O75173	ATS4_HUMAN	F	785	ENSP00000356975:V785F	ENSP00000356975:V785F	V	-	1	0	ADAMTS4	159427713	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.577000	0.67444	2.438000	0.82558	0.561000	0.74099	GTC		0.657	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099		Missense_Mutation
ANKAR	150709	hgsc.bcm.edu	37	2	190608163	190608163	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:190608163C>G	ENST00000520309.1	+	21	4061	c.3973C>G	c.(3973-3975)Caa>Gaa	p.Q1325E	ANKAR_ENST00000313581.4_Missense_Mutation_p.Q1325E|ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000431575.2_Missense_Mutation_p.Q1254E|ANKAR_ENST00000438402.2_3'UTR	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1325						integral component of membrane (GO:0016021)		p.Q1254E(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			AAAGGAATTTCAAATGCAACA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											70.0	71.0	71.0					2																	190608163		2203	4300	6503	190316408	SO:0001583	missense	150709			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.3973C>G	2.37:g.190608163C>G	ENSP00000427882:p.Gln1325Glu		190316408	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	ENST00000520309.1	37	CCDS33351.2	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.743	0.919445	0.17982	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575	T;T;T	0.24151	1.87;1.87;1.87	5.59	-0.00906	0.14002	.	0.944014	0.08792	N	0.893136	T	0.27419	0.0673	L	0.41236	1.265	0.51233	D	0.999915	.	.	.	.	.	.	T	0.14896	-1.0456	8	0.30854	T	0.27	-1.7599	10.0426	0.42166	0.4958:0.2842:0.22:0.0	.	.	.	.	E	1325;1325;1254	ENSP00000427882:Q1325E;ENSP00000313513:Q1325E;ENSP00000393043:Q1254E	ENSP00000313513:Q1325E	Q	+	1	0	ANKAR	190316408	0.926000	0.31397	0.347000	0.25668	0.992000	0.81027	-0.234000	0.09028	-0.018000	0.14079	0.557000	0.71058	CAA		0.348	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708		Missense_Mutation
ANKRD55	79722	hgsc.bcm.edu	37	5	55455707	55455707	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr5:55455707G>T	ENST00000341048.4	-	6	587	c.436C>A	c.(436-438)Ctg>Atg	p.L146M	ANKRD55_ENST00000513241.2_Missense_Mutation_p.L117M|ANKRD55_ENST00000505970.2_5'UTR|ANKRD55_ENST00000504958.2_Missense_Mutation_p.L146M	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	146										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TGTTGCAACAGGACCGTGAGG	0.448																																																0			5											128.0	114.0	119.0					5																	55455707		2203	4300	6503	55491464	SO:0001583	missense	79722			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.436C>A	5.37:g.55455707G>T	ENSP00000342295:p.Leu146Met		55491464	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023613	0.54683	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000513241;ENST00000519586	T;T;T	0.66995	1.33;-0.24;-0.24	5.33	4.34	0.51931	.	0.000000	0.64402	D	0.000004	T	0.82213	0.4988	M	0.88775	2.98	0.40530	D	0.98092	D	0.76494	0.999	D	0.87578	0.998	D	0.84093	0.0391	10	0.87932	D	0	.	8.8775	0.35354	0.1202:0.0:0.8798:0.0	.	146	B3KVT8	.	M	146;146;146;117;146	ENSP00000342295:L146M;ENSP00000424230:L146M;ENSP00000423507:L117M	ENSP00000342295:L146M	L	-	1	2	ANKRD55	55491464	1.000000	0.71417	0.995000	0.50966	0.583000	0.36354	2.418000	0.44662	1.108000	0.41662	0.650000	0.86243	CTG		0.448	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		Missense_Mutation
APC	324	hgsc.bcm.edu	37	5	112173846	112173846	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr5:112173846T>C	ENST00000457016.1	+	16	2935	c.2555T>C	c.(2554-2556)tTg>tCg	p.L852S	APC_ENST00000257430.4_Missense_Mutation_p.L852S|APC_ENST00000508376.2_Missense_Mutation_p.L852S|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	852	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R850fs*59(1)|p.L852*(1)|p.L852S(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GATAGAAGTTTGGAGAGAGAA	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	4	Substitution - Nonsense(1)|Unknown(1)|Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(2)|ovary(1)|skin(1)	5	GRCh37	CM083586	APC	M							64.0	65.0	65.0					5																	112173846		2202	4300	6502	112201745	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2555T>C	5.37:g.112173846T>C	ENSP00000413133:p.Leu852Ser		112201745	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.82	2.051722	0.36181	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.94417	-2.67;-3.42;-2.67;-2.67;-2.86	6.16	6.16	0.99307	.	0.000000	0.53938	D	0.000045	D	0.90724	0.7089	L	0.45581	1.43	0.41159	D	0.98608	B;B	0.20164	0.01;0.042	B;B	0.17722	0.01;0.019	D	0.85982	0.1483	10	0.05833	T	0.94	-6.1256	15.3771	0.74615	0.0:0.0:0.0:1.0	.	854;852	Q4LE70;P25054	.;APC_HUMAN	S	852;834;852;852;852	ENSP00000413133:L852S;ENSP00000423224:L834S;ENSP00000257430:L852S;ENSP00000427089:L852S;ENSP00000423828:L852S	ENSP00000257430:L852S	L	+	2	0	APC	112201745	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.971000	0.56831	2.367000	0.80283	0.528000	0.53228	TTG		0.443	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
BAZ1A	11177	hgsc.bcm.edu	37	14	35263993	35263993	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr14:35263993A>G	ENST00000382422.2	-	10	1652	c.1325T>C	c.(1324-1326)tTt>tCt	p.F442S	BAZ1A_ENST00000360310.1_Missense_Mutation_p.F442S|BAZ1A_ENST00000358716.4_Missense_Mutation_p.F442S			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	442	DDT. {ECO:0000255|PROSITE- ProRule:PRU00063}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)	p.F442S(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTGAAGATCAAAAAGTTCCCC	0.378																																																1	Substitution - Missense(1)	ovary(1)	14											97.0	93.0	94.0					14																	35263993		2203	4300	6503	34333744	SO:0001583	missense	11177			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.1325T>C	14.37:g.35263993A>G	ENSP00000371859:p.Phe442Ser		34333744	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872418	0.91587	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	D;D;D	0.89196	-2.48;-2.48;-2.48	5.92	5.92	0.95590	DDT domain superfamily (1);DDT domain, subgroup (1);DDT domain (1);	0.049917	0.85682	D	0.000000	D	0.93184	0.7829	L	0.60455	1.87	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.951;0.979	D	0.93775	0.7078	10	0.87932	D	0	.	16.3593	0.83251	1.0:0.0:0.0:0.0	.	442;442	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	S	442;442;442;126	ENSP00000351555:F442S;ENSP00000371859:F442S;ENSP00000353458:F442S	ENSP00000351555:F442S	F	-	2	0	BAZ1A	34333744	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.282000	0.95840	2.267000	0.75376	0.383000	0.25322	TTT		0.378	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			Missense_Mutation
BCAT2	587	hgsc.bcm.edu	37	19	49309972	49309972	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:49309972delA	ENST00000316273.6	-	3	114	c.102delT	c.(100-102)gctfs	p.A35fs	BCAT2_ENST00000545387.2_Intron|BCAT2_ENST00000402551.1_5'UTR|BCAT2_ENST00000597011.1_5'UTR|BCAT2_ENST00000599246.1_Intron|BCAT2_ENST00000598162.1_Frame_Shift_Del_p.A35fs|BCAT2_ENST00000601496.1_5'Flank	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	35					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)	p.A35fs*7(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	GCAGGTCTGCAGCCTGAGGAA	0.547																																																1	Deletion - Frameshift(1)	ovary(1)	19											53.0	54.0	54.0					19																	49309972		2203	4300	6503	54001784	SO:0001589	frameshift_variant	587			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.102delT	19.37:g.49309972delA	ENSP00000322991:p.Ala35fs		54001784	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Frame_Shift_Del	DEL	ENST00000316273.6	37	CCDS12735.1	DEL	7	Baylor																																																																																				0.547	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466202.1			Frame_Shift_Del
BRD8	10902	hgsc.bcm.edu	37	5	137501705	137501705	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr5:137501705T>A	ENST00000254900.5	-	11	1461	c.1090A>T	c.(1090-1092)Atc>Ttc	p.I364F	BRD8_ENST00000230901.5_Missense_Mutation_p.I437F|BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000411594.2_Missense_Mutation_p.I367F|BRD8_ENST00000455658.2_Missense_Mutation_p.I323F|BRD8_ENST00000402931.1_Missense_Mutation_p.I364F	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	364					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.I364F(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATAGAATTGATGATCATGGAT	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											149.0	143.0	145.0					5																	137501705		2203	4300	6503	137529604	SO:0001583	missense	10902			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1090A>T	5.37:g.137501705T>A	ENSP00000254900:p.Ile364Phe		137529604	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.23	3.576995	0.65878	.	.	ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824	T;T;T;T;T;T;T	0.37058	1.62;1.25;1.22;1.28;1.4;1.22;1.38	5.65	4.43	0.53597	.	0.218155	0.47093	D	0.000247	T	0.40767	0.1130	N	0.14661	0.345	0.50171	D	0.999854	D;D;D;D;B;B;D;D	0.89917	1.0;0.999;0.998;0.998;0.2;0.347;0.999;0.999	D;D;D;D;B;B;D;D	0.85130	0.997;0.993;0.986;0.986;0.034;0.069;0.994;0.993	T	0.39165	-0.9627	10	0.59425	D	0.04	-11.4674	11.5961	0.50975	0.1325:0.0:0.0:0.8675	.	323;348;143;437;367;258;437;364	F8W820;B4DN43;B4DMS9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9	.;.;.;.;.;.;.;BRD8_HUMAN	F	364;393;362;437;364;367;258;323;182	ENSP00000254900:I364F;ENSP00000398067:I393F;ENSP00000398873:I362F;ENSP00000230901:I437F;ENSP00000384845:I364F;ENSP00000394330:I367F;ENSP00000408396:I323F	ENSP00000230901:I437F	I	-	1	0	BRD8	137529604	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.073000	0.57570	2.371000	0.80710	0.533000	0.62120	ATC		0.473	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696		Missense_Mutation
FAM188A	80013	hgsc.bcm.edu	37	10	15876568	15876568	+	Silent	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr10:15876568C>T	ENST00000277632.3	-	7	844	c.624G>A	c.(622-624)ttG>ttA	p.L208L	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	208					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L208L(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						CAGGATCTATCAAGGGTTCAC	0.308																																					Pancreas(159;946 1953 2111 4475 22008)											1	Substitution - coding silent(1)	ovary(1)	10											187.0	175.0	179.0					10																	15876568		2203	4300	6503	15916574	SO:0001819	synonymous_variant	80013			AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.624G>A	10.37:g.15876568C>T			15916574	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Silent	SNP	ENST00000277632.3	37	CCDS7110.1	SNP	29	Baylor																																																																																				0.308	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948		Silent
C10orf12	26148	hgsc.bcm.edu	37	10	98742724	98742724	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr10:98742724C>A	ENST00000286067.2	+	1	1684	c.1577C>A	c.(1576-1578)tCa>tAa	p.S526*		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	526								p.S526*(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AATCAGAGTTCAGATTCTTCC	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	10											73.0	81.0	78.0					10																	98742724		2202	4300	6502	98732714	SO:0001587	stop_gained	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1577C>A	10.37:g.98742724C>A	ENSP00000286067:p.Ser526*		98732714	Q9H945|Q9Y457	Nonsense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154901	0.78114	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	.	.	.	5.65	2.76	0.32466	.	1.534790	0.04737	U	0.422082	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1581	8.7775	0.34771	0.0:0.7633:0.0:0.2367	.	.	.	.	X	526;360	.	ENSP00000286067:S526X	S	+	2	0	C10orf12	98732714	0.148000	0.22702	0.954000	0.39281	0.082000	0.17680	1.074000	0.30703	0.319000	0.23209	0.561000	0.74099	TCA		0.423	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		Nonsense_Mutation
C9orf171	389799	hgsc.bcm.edu	37	9	135374837	135374837	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr9:135374837G>A	ENST00000343036.2	+	4	530	c.482G>A	c.(481-483)cGc>cAc	p.R161H	C9orf171_ENST00000393216.2_Missense_Mutation_p.R125H|C9orf171_ENST00000393215.3_Missense_Mutation_p.R125H	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	161								p.R161H(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GCAATGAACCGCGGGGCGGTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	9											71.0	73.0	72.0					9																	135374837		2203	4300	6503	134364658	SO:0001583	missense	389799			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.482G>A	9.37:g.135374837G>A	ENSP00000343290:p.Arg161His		134364658	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989235	0.53934	.	.	ENSG00000188523	ENST00000393215;ENST00000343036;ENST00000393216	T;T;T	0.28895	1.59;1.59;1.59	5.26	4.35	0.52113	.	0.144779	0.41500	D	0.000868	T	0.48003	0.1476	L	0.55990	1.75	0.36580	D	0.873509	D;D	0.89917	1.0;1.0	D;D	0.70016	0.95;0.967	T	0.56141	-0.8028	10	0.66056	D	0.02	.	12.7147	0.57109	0.0797:0.0:0.9202:0.0	.	125;161	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	H	125;161;125	ENSP00000376908:R125H;ENSP00000343290:R161H;ENSP00000376909:R125H	ENSP00000343290:R161H	R	+	2	0	C9orf171	134364658	0.999000	0.42202	0.934000	0.37439	0.027000	0.11550	3.858000	0.55979	2.618000	0.88619	0.561000	0.74099	CGC		0.617	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		Missense_Mutation
CASP8AP2	9994	hgsc.bcm.edu	37	6	90572022	90572022	+	RNA	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:90572022G>A	ENST00000551025.1	+	0	2031									caspase 8 associated protein 2									p.L198L(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TGCCAAATCTGGAAAAGGAAG	0.373																																					Colon(187;1656 2025 17045 31481 39901)											1	Substitution - coding silent(1)	ovary(1)	6											203.0	188.0	193.0					6																	90572022		1892	4114	6006	90628743			9994			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90572022G>A			90628743		Silent	SNP	ENST00000551025.1	37		SNP	47	Baylor																																																																																				0.373	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		Silent
CD163	9332	hgsc.bcm.edu	37	12	7636010	7636010	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr12:7636010C>T	ENST00000359156.4	-	12	3243	c.3041G>A	c.(3040-3042)gGc>gAc	p.G1014D	CD163_ENST00000432237.2_Missense_Mutation_p.G1014D|CD163_ENST00000541972.1_Missense_Mutation_p.G1002D|CD163_ENST00000396620.3_Missense_Mutation_p.G1047D|CD163_ENST00000539632.1_5'UTR	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	1014	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.G1014D(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CTCACTATGGCCCCAGCGTCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											111.0	97.0	102.0					12																	7636010		2203	4300	6503	7527277	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.3041G>A	12.37:g.7636010C>T	ENSP00000352071:p.Gly1014Asp		7527277	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	SNP	26	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.80|18.80	3.700059|3.700059	0.68501|0.68501	.|.	.|.	ENSG00000177575|ENSG00000177575	ENST00000537626|ENST00000359156;ENST00000542280;ENST00000541972;ENST00000396620;ENST00000432237	.|T;T;T;T;T	.|0.53206	.|0.63;0.63;0.63;0.63;0.63	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.|0.371003	.|0.25854	.|N	.|0.027878	T|T	0.67785|0.67785	0.2930|0.2930	M|M	0.85041|0.85041	2.73|2.73	0.34179|0.34179	D|D	0.670747|0.670747	.|D;D;D	.|0.71674	.|0.998;0.998;0.998	.|D;D;D	.|0.70935	.|0.971;0.939;0.942	T|T	0.75915|0.75915	-0.3149|-0.3149	5|10	.|0.35671	.|T	.|0.21	.|.	10.4935|10.4935	0.44764|0.44764	0.0:0.9112:0.0:0.0887|0.0:0.9112:0.0:0.0887	.|.	.|1047;1014;1014	.|C9JHR8;Q86VB7-3;Q86VB7	.|.;.;C163A_HUMAN	T|D	27|1014;54;1002;1047;1014	.|ENSP00000352071:G1014D;ENSP00000445438:G54D;ENSP00000444071:G1002D;ENSP00000379863:G1047D;ENSP00000403885:G1014D	.|ENSP00000352071:G1014D	A|G	-|-	1|2	0|0	CD163|CD163	7527277|7527277	0.039000|0.039000	0.19947|0.19947	0.997000|0.997000	0.53966|0.53966	0.871000|0.871000	0.50021|0.50021	0.833000|0.833000	0.27504|0.27504	2.707000|2.707000	0.92482|0.92482	0.555000|0.555000	0.69702|0.69702	GCC|GGC		0.532	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		Missense_Mutation
CLCN4	1183	hgsc.bcm.edu	37	X	10166092	10166092	+	Silent	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chrX:10166092C>A	ENST00000380833.4	+	6	937	c.546C>A	c.(544-546)ggC>ggA	p.G182G	CLCN4_ENST00000380829.1_Silent_p.G182G|CLCN4_ENST00000421085.2_Silent_p.G88G	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	182					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.G182G(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GTGGCTCTGGCATACCAGAGG	0.433																																					Melanoma(74;1050 1296 1576 30544 38374)											1	Substitution - coding silent(1)	ovary(1)	X											174.0	144.0	154.0					X																	10166092		2203	4300	6503	10126092	SO:0001819	synonymous_variant	1183			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.546C>A	X.37:g.10166092C>A			10126092	A1L3U1|B7Z5Z4|Q9UBU1	Silent	SNP	ENST00000380833.4	37	CCDS14137.1	SNP	25	Baylor																																																																																				0.433	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1			Silent
CLP1	10978	hgsc.bcm.edu	37	11	57427143	57427143	+	Silent	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr11:57427143T>A	ENST00000302731.4	+	2	315	c.195T>A	c.(193-195)gtT>gtA	p.V65V	CLP1_ENST00000525602.1_Silent_p.V65V|CLP1_ENST00000533682.1_Silent_p.V65V|CLP1_ENST00000529430.1_Silent_p.V76V	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.V65V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						AGGTGGCTGTTTTCACTTGGC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	11											96.0	89.0	91.0					11																	57427143		2201	4296	6497	57183719	SO:0001819	synonymous_variant	10978			BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.195T>A	11.37:g.57427143T>A			57183719	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000302731.4	37	CCDS44600.1	SNP	64	Baylor																																																																																				0.507	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831		Silent
CNTNAP4	85445	hgsc.bcm.edu	37	16	76513417	76513417	+	Silent	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr16:76513417C>T	ENST00000476707.1	+	11	2012	c.1873C>T	c.(1873-1875)Cta>Tta	p.L625L	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Silent_p.L549L|CNTNAP4_ENST00000377504.4_Silent_p.L573L|CNTNAP4_ENST00000307431.8_Silent_p.L621L			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	622	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						ACCATTTCTTCTATATTGCAA	0.338																																																0			16											98.0	103.0	101.0					16																	76513417		2198	4298	6496	75070918	SO:0001819	synonymous_variant	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1873C>T	16.37:g.76513417C>T			75070918	E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37		SNP	32	Baylor																																																																																				0.338	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		Silent
COPB1	1315	hgsc.bcm.edu	37	11	14498516	14498516	+	Silent	SNP	G	G	C			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr11:14498516G>C	ENST00000249923.3	-	12	1704	c.1404C>G	c.(1402-1404)acC>acG	p.T468T	COPB1_ENST00000526191.1_5'Flank|RNU7-49P_ENST00000516182.1_RNA|COPB1_ENST00000439561.2_Silent_p.T468T	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	468					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.T468T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TGTCTTCCTTGGTACTACAGT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	11											180.0	165.0	170.0					11																	14498516		2200	4294	6494	14455092	SO:0001819	synonymous_variant	1315			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1404C>G	11.37:g.14498516G>C			14455092	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Silent	SNP	ENST00000249923.3	37	CCDS7815.1	SNP	47	Baylor																																																																																				0.393	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451		Silent
CPA5	93979	hgsc.bcm.edu	37	7	129989834	129989834	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr7:129989834C>T	ENST00000485477.1	+	4	1346	c.217C>T	c.(217-219)Cca>Tca	p.P73S	CPA5_ENST00000393213.3_Missense_Mutation_p.P73S|CPA5_ENST00000461828.1_Missense_Mutation_p.P73S|CPA5_ENST00000431780.2_Missense_Mutation_p.P73S|CPA5_ENST00000474905.1_Missense_Mutation_p.P73S|CPA5_ENST00000355388.3_Missense_Mutation_p.P73S|CPA5_ENST00000466363.2_Missense_Mutation_p.P73S			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	73						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P73S(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					CTGGCGTGGCCCAGCCAGGCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											126.0	130.0	129.0					7																	129989834		2203	4300	6503	129777070	SO:0001583	missense	93979			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.217C>T	7.37:g.129989834C>T	ENSP00000420237:p.Pro73Ser		129777070	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942783	0.73672	.	.	ENSG00000158525	ENST00000355388;ENST00000463587;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37;2.37;2.37	5.76	5.76	0.90799	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.109437	0.41396	D	0.000900	T	0.51652	0.1687	M	0.92317	3.295	0.40812	D	0.983433	D;D	0.89917	0.999;1.0	D;D	0.74674	0.973;0.984	T	0.62987	-0.6737	9	.	.	.	.	15.4858	0.75564	0.0:1.0:0.0:0.0	.	73;73	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	S	73	ENSP00000347549:P73S;ENSP00000420060:P73S;ENSP00000418183:P73S;ENSP00000419025:P73S;ENSP00000420237:P73S;ENSP00000393045:P73S;ENSP00000417314:P73S;ENSP00000376907:P73S	.	P	+	1	0	CPA5	129777070	0.950000	0.32346	0.996000	0.52242	0.835000	0.47333	4.387000	0.59626	2.706000	0.92434	0.655000	0.94253	CCA		0.507	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441		Missense_Mutation
DAXX	1616	hgsc.bcm.edu	37	6	33287496	33287496	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:33287496G>T	ENST00000374542.5	-	6	1805	c.1601C>A	c.(1600-1602)tCa>tAa	p.S534*	DAXX_ENST00000414083.2_Nonsense_Mutation_p.S459*|ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000266000.6_Nonsense_Mutation_p.S534*|ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000477162.1_5'UTR	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	534	Asp/Glu-rich (acidic).|Interaction with MAP3K5.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.S534*(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						GGGTTCTTCTGACAGTAACGA	0.512			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	1	Substitution - Nonsense(1)	ovary(1)	6											108.0	96.0	100.0					6																	33287496		2203	4300	6503	33395474	SO:0001587	stop_gained	1616			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1601C>A	6.37:g.33287496G>T	ENSP00000363668:p.Ser534*		33395474	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Nonsense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012293	0.54468	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.69	-2.22	0.06952	.	1.603610	0.04160	N	0.322905	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	1.2301	4.4603	0.11663	0.3949:0.0:0.4435:0.1617	.	.	.	.	X	534;534;459	.	ENSP00000266000:S534X	S	-	2	0	DAXX	33395474	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.040000	0.12104	-0.233000	0.09797	-0.275000	0.10095	TCA		0.512	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1			Nonsense_Mutation
DDO	8528	hgsc.bcm.edu	37	6	110714241	110714241	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:110714241delG	ENST00000368924.3	-	5	862	c.847delC	c.(847-849)cttfs	p.L283fs	DDO_ENST00000368923.3_Frame_Shift_Del_p.L224fs	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	255					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.L283fs*23(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CATCGGGAAAGAATCTCTCTG	0.547																																																1	Deletion - Frameshift(1)	ovary(1)	6											154.0	158.0	157.0					6																	110714241		2203	4300	6503	110820934	SO:0001589	frameshift_variant	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.847delC	6.37:g.110714241delG	ENSP00000357920:p.Leu283fs		110820934	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Frame_Shift_Del	DEL	ENST00000368924.3	37	CCDS5082.1	DEL	33	Baylor																																																																																				0.547	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1			Frame_Shift_Del
DDO	8528	hgsc.bcm.edu	37	6	110714543	110714543	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:110714543A>C	ENST00000368924.3	-	5	560	c.545T>G	c.(544-546)aTa>aGa	p.I182R	DDO_ENST00000368923.3_Missense_Mutation_p.I123R	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	154					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.I182R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		ACTTCCCTTTATCCTACGGAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											81.0	79.0	80.0					6																	110714543		2203	4300	6503	110821236	SO:0001583	missense	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.545T>G	6.37:g.110714543A>C	ENSP00000357920:p.Ile182Arg		110821236	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	37	CCDS5082.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.50	3.140483	0.56936	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	D;T;D	0.81996	-1.56;0.87;-1.56	5.95	5.95	0.96441	.	0.874624	0.10372	N	0.682676	T	0.82171	0.4979	M	0.61703	1.905	0.36139	D	0.846693	P;P	0.47409	0.895;0.797	P;B	0.47705	0.555;0.353	T	0.81980	-0.0684	10	0.56958	D	0.05	0.1284	16.4101	0.83708	1.0:0.0:0.0:0.0	.	123;182	Q99489-4;Q99489-3	.;.	R	182;123;154	ENSP00000357920:I182R;ENSP00000357919:I123R;ENSP00000357921:I154R	ENSP00000357919:I123R	I	-	2	0	DDO	110821236	0.882000	0.30256	0.012000	0.15200	0.005000	0.04900	8.021000	0.88750	2.280000	0.76307	0.460000	0.39030	ATA		0.463	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1			Missense_Mutation
DDOST	1650	hgsc.bcm.edu	37	1	20980730	20980730	+	Silent	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:20980730C>T	ENST00000375048.3	-	7	936	c.831G>A	c.(829-831)gcG>gcA	p.A277A	DDOST_ENST00000602624.2_Silent_p.A260A|DDOST_ENST00000415136.2_Silent_p.A240A|PINK1-AS_ENST00000451424.1_RNA	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	277					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.A277A(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGGAGCCGGGCGCCGCCTTCT	0.622																																																1	Substitution - coding silent(1)	large_intestine(1)	1											16.0	17.0	17.0					1																	20980730		2052	4023	6075	20853317	SO:0001819	synonymous_variant	1650			D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.831G>A	1.37:g.20980730C>T			20853317	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Silent	SNP	ENST00000375048.3	37	CCDS212.1	SNP	27	Baylor																																																																																				0.622	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216		Silent
DNMT3A	1788	hgsc.bcm.edu	37	2	25464500	25464500	+	Silent	SNP	C	C	G			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:25464500C>G	ENST00000264709.3	-	17	2350	c.2013G>C	c.(2011-2013)acG>acC	p.T671T	DNMT3A_ENST00000474887.1_5'UTR|DNMT3A_ENST00000402667.1_Silent_p.T448T|DNMT3A_ENST00000380746.4_Silent_p.T482T|DNMT3A_ENST00000321117.5_Silent_p.T671T	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	671	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATGCCCACCGTGATGGAGT	0.622			"""Mis, F, N, S"""		AML																																		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0			2											152.0	95.0	115.0					2																	25464500		2203	4300	6503	25318004	SO:0001819	synonymous_variant	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2013G>C	2.37:g.25464500C>G			25318004	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	37	CCDS33157.1	SNP	23	Baylor																																																																																				0.622	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552		Silent
DPY19L3	147991	hgsc.bcm.edu	37	19	32945861	32945861	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:32945861G>A	ENST00000342179.5	+	10	1219	c.1004G>A	c.(1003-1005)gGa>gAa	p.G335E	DPY19L3_ENST00000392250.2_Missense_Mutation_p.G335E|DPY19L3_ENST00000586987.1_Missense_Mutation_p.G335E	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	335						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.G335E(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					CTGAAAACTGGAAGCTTCCTT	0.249																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	76.0	74.0					19																	32945861		2192	4290	6482	37637701	SO:0001583	missense	147991				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1004G>A	19.37:g.32945861G>A	ENSP00000344937:p.Gly335Glu		37637701	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475595	0.84640	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.54279	0.58;0.58	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.74258	2.255	0.58432	D	0.999999	P	0.47484	0.896	P	0.46419	0.516	T	0.55761	-0.8090	10	0.16420	T	0.52	-21.1586	18.8014	0.92018	0.0:0.0:1.0:0.0	.	335	Q6ZPD9	D19L3_HUMAN	E	335	ENSP00000376081:G335E;ENSP00000344937:G335E	ENSP00000315672:G335E	G	+	2	0	DPY19L3	37637701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.040000	0.70980	2.882000	0.98803	0.655000	0.94253	GGA		0.249	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325		Missense_Mutation
MECOM	2122	hgsc.bcm.edu	37	3	168819924	168819924	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:168819924T>C	ENST00000464456.1	-	9	3304	c.2104A>G	c.(2104-2106)Atg>Gtg	p.M702V	MECOM_ENST00000460814.1_Missense_Mutation_p.M702V|MECOM_ENST00000392736.3_Missense_Mutation_p.M711V|MECOM_ENST00000494292.1_Missense_Mutation_p.M890V|MECOM_ENST00000468789.1_Missense_Mutation_p.M711V|MECOM_ENST00000472280.1_Missense_Mutation_p.M712V|MECOM_ENST00000433243.2_Missense_Mutation_p.M712V|MECOM_ENST00000264674.3_Missense_Mutation_p.M776V	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M711V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AAGTTGAACATAGAGGGCACT	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	74.0	77.0					3																	168819924		2203	4300	6503	170302618	SO:0001583	missense	2122			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2104A>G	3.37:g.168819924T>C	ENSP00000419770:p.Met702Val		170302618	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	CCDS54669.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	3.726	-0.056465	0.07362	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.05139	3.52;3.52;3.49;3.61;3.49;3.52;3.49;3.61	5.45	5.45	0.79879	.	0.234871	0.38272	N	0.001747	T	0.03739	0.0106	N	0.03608	-0.345	0.44825	D	0.997834	B;B;B;B;B	0.14805	0.011;0.002;0.007;0.003;0.001	B;B;B;B;B	0.10450	0.005;0.002;0.002;0.003;0.002	T	0.52953	-0.8506	10	0.25106	T	0.35	-15.3729	15.8461	0.78890	0.0:0.0:0.0:1.0	.	899;703;890;776;711	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	V	776;711;702;712;890;711;702;712	ENSP00000264674:M776V;ENSP00000376493:M711V;ENSP00000419770:M702V;ENSP00000420048:M712V;ENSP00000417899:M890V;ENSP00000419995:M711V;ENSP00000420466:M702V;ENSP00000394302:M712V	ENSP00000264674:M776V	M	-	1	0	MECOM	170302618	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	3.713000	0.54882	2.205000	0.71048	0.533000	0.62120	ATG		0.502	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991		Missense_Mutation
FAM163A	148753	hgsc.bcm.edu	37	1	179782938	179782938	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:179782938A>G	ENST00000341785.4	+	5	514	c.118A>G	c.(118-120)Acc>Gcc	p.T40A	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	40						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GAAGAGCGGAACCGAGGTTGC	0.627																																																0			1											46.0	42.0	44.0					1																	179782938		2203	4300	6503	178049561	SO:0001583	missense	148753			BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.118A>G	1.37:g.179782938A>G	ENSP00000354891:p.Thr40Ala		178049561	A8K8R7	Missense_Mutation	SNP	ENST00000341785.4	37	CCDS1333.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	6.319	0.426990	0.11987	.	.	ENSG00000143340	ENST00000341785	.	.	.	4.63	0.989	0.19802	.	1.501440	0.04176	N	0.325545	T	0.19046	0.0457	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18587	-1.0332	9	0.37606	T	0.19	0.0588	3.6053	0.08039	0.0914:0.1142:0.4206:0.3738	.	40	Q96GL9	F163A_HUMAN	A	40	.	ENSP00000354891:T40A	T	+	1	0	FAM163A	178049561	0.995000	0.38212	0.000000	0.03702	0.372000	0.29890	1.772000	0.38552	0.471000	0.27319	-0.695000	0.03696	ACC		0.627	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509		Missense_Mutation
FCHSD2	9873	hgsc.bcm.edu	37	11	72712057	72712057	+	Frame_Shift_Del	DEL	A	A	-	rs188531590		TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr11:72712057delA	ENST00000409418.4	-	5	748	c.365delT	c.(364-366)ttafs	p.L122fs	FCHSD2_ENST00000311172.7_Frame_Shift_Del_p.L66fs|FCHSD2_ENST00000409314.1_Frame_Shift_Del_p.L122fs|FCHSD2_ENST00000458644.2_Intron|FCHSD2_ENST00000409853.1_Frame_Shift_Del_p.L66fs	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	122								p.L66fs*1(1)		endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			CTGTTCTTTTAAGCTTCTCAC	0.348																																																1	Deletion - Frameshift(1)	ovary(1)	11											70.0	72.0	71.0					11																	72712057		2200	4293	6493	72389705	SO:0001589	frameshift_variant	9873			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.365delT	11.37:g.72712057delA	ENSP00000386722:p.Leu122fs		72389705	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Frame_Shift_Del	DEL	ENST00000409418.4	37	CCDS8218.2	DEL	13	Baylor																																																																																				0.348	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824		Frame_Shift_Del
FRMD4B	23150	hgsc.bcm.edu	37	3	69267495	69267495	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:69267495C>A	ENST00000398540.3	-	10	850	c.767G>T	c.(766-768)gGt>gTt	p.G256V	FRMD4B_ENST00000542259.1_Missense_Mutation_p.G202V	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	256	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)		p.G202V(1)		NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ATAATGGACACCGTAAGTCGG	0.313																																																1	Substitution - Missense(1)	ovary(1)	3											44.0	43.0	43.0					3																	69267495		1816	4078	5894	69350185	SO:0001583	missense	23150			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.767G>T	3.37:g.69267495C>A	ENSP00000381549:p.Gly256Val		69350185	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073867	0.76415	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000493880	D;D;D	0.96396	-4.0;-4.0;-4.0	5.87	5.87	0.94306	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98523	0.9507	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99208	1.0875	10	0.87932	D	0	-15.953	18.9896	0.92786	0.0:1.0:0.0:0.0	.	100;256	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	V	256;202;147	ENSP00000381549:G256V;ENSP00000437658:G202V;ENSP00000418962:G147V	ENSP00000381549:G256V	G	-	2	0	FRMD4B	69350185	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	6.678000	0.74508	2.785000	0.95823	0.655000	0.94253	GGT		0.313	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1			Missense_Mutation
GALNT14	79623	hgsc.bcm.edu	37	2	31154991	31154991	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:31154991A>C	ENST00000349752.5	-	10	1640	c.1001T>G	c.(1000-1002)gTc>gGc	p.V334G	GALNT14_ENST00000420311.2_Missense_Mutation_p.V299G|GALNT14_ENST00000356174.3_Missense_Mutation_p.V301G|GALNT14_ENST00000324589.5_Missense_Mutation_p.V339G|GALNT14_ENST00000406653.1_Missense_Mutation_p.V314G|GALNT14_ENST00000486564.1_5'UTR	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	334	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTTCCGGAAGACGTGCCCCAC	0.592																																																0			2											97.0	90.0	92.0					2																	31154991		2203	4300	6503	31008495	SO:0001583	missense	79623			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1001T>G	2.37:g.31154991A>C	ENSP00000288988:p.Val334Gly		31008495	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740094	0.89573	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.84316	0.5445	H	0.94925	3.6	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0	D	0.88980	0.3407	10	0.87932	D	0	.	14.6772	0.68989	1.0:0.0:0.0:0.0	.	299;301;339;334;314	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	G	334;339;314;301;299;301	ENSP00000288988:V334G;ENSP00000314500:V339G;ENSP00000385435:V314G;ENSP00000348497:V301G;ENSP00000415514:V299G;ENSP00000406399:V301G	ENSP00000314500:V339G	V	-	2	0	GALNT14	31008495	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	1.877000	0.54381	0.459000	0.35465	GTC		0.592	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		Missense_Mutation
GRB2	2885	hgsc.bcm.edu	37	17	73316548	73316548	+	Silent	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr17:73316548G>A	ENST00000392562.1	-	6	1337	c.555C>T	c.(553-555)gtC>gtT	p.V185V	GRB2_ENST00000392564.1_Silent_p.V185V|GRB2_ENST00000578961.1_Missense_Mutation_p.S129L|GRB2_ENST00000392563.1_Silent_p.V144V|GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000316804.5_Silent_p.V185V|GRB2_ENST00000316615.5_Silent_p.V144V			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	185	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.V185V(1)		breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AGTTATCCATGACATGGATAA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	17											112.0	119.0	116.0					17																	73316548		2203	4300	6503	70828143	SO:0001819	synonymous_variant	2885				CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.555C>T	17.37:g.73316548G>A			70828143	P29354|Q14450|Q63057|Q63059	Silent	SNP	ENST00000392562.1	37	CCDS11721.1	SNP	45	Baylor																																																																																				0.562	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1			Silent
ITPR2	3709	hgsc.bcm.edu	37	12	26835542	26835542	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr12:26835542T>C	ENST00000381340.3	-	12	1629	c.1213A>G	c.(1213-1215)Ata>Gta	p.I405V		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	405	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.I405V(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TCTGTGTCTATGGGGATACTA	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											162.0	145.0	151.0					12																	26835542		1881	4101	5982	26726809	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1213A>G	12.37:g.26835542T>C	ENSP00000370744:p.Ile405Val		26726809	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574573	0.86542	.	.	ENSG00000123104	ENST00000381340	D	0.86769	-2.17	4.64	4.64	0.57946	MIR motif (1);MIR (2);	0.000000	0.85682	D	0.000000	D	0.92573	0.7641	M	0.85542	2.76	0.80722	D	1	P	0.52692	0.955	P	0.61070	0.883	D	0.92050	0.5647	10	0.33141	T	0.24	.	14.2394	0.65948	0.0:0.0:0.0:1.0	.	405	Q14571	ITPR2_HUMAN	V	405	ENSP00000370744:I405V	ENSP00000370744:I405V	I	-	1	0	ITPR2	26726809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.744000	0.85034	1.938000	0.56188	0.455000	0.32223	ATA		0.348	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		Missense_Mutation
JARID2	3720	hgsc.bcm.edu	37	6	15497126	15497126	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:15497126T>G	ENST00000341776.2	+	7	1914	c.1670T>G	c.(1669-1671)aTc>aGc	p.I557S	JARID2_ENST00000397311.3_Missense_Mutation_p.I385S|JARID2_ENST00000541660.1_Missense_Mutation_p.I519S	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	557	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I557S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				ATGGACGAGATCCCCGTCCTC	0.652																																																1	Substitution - Missense(1)	ovary(1)	6											41.0	38.0	39.0					6																	15497126		2203	4300	6503	15605105	SO:0001583	missense	3720			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1670T>G	6.37:g.15497126T>G	ENSP00000341280:p.Ile557Ser		15605105	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.94	2.686221	0.47991	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.89123	-1.85;-1.85;-2.47	5.23	5.23	0.72850	Transcription factor jumonji, JmjN (2);	0.161111	0.56097	D	0.000036	D	0.83031	0.5166	M	0.75447	2.3	0.43830	D	0.996404	B;P;B	0.40144	0.435;0.704;0.294	B;B;B	0.33521	0.086;0.165;0.084	D	0.85069	0.0939	10	0.44086	T	0.13	-12.9692	15.1004	0.72269	0.0:0.0:0.0:1.0	.	519;421;557	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	S	421;557;385;519	ENSP00000341280:I557S;ENSP00000380478:I385S;ENSP00000444623:I519S	ENSP00000341280:I557S	I	+	2	0	JARID2	15605105	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.830000	0.62745	1.967000	0.57214	0.418000	0.28097	ATC		0.652	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		Missense_Mutation
JARID2	3720	hgsc.bcm.edu	37	6	15497130	15497130	+	Silent	SNP	C	C	A	rs376937633		TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:15497130C>A	ENST00000341776.2	+	7	1918	c.1674C>A	c.(1672-1674)ccC>ccA	p.P558P	JARID2_ENST00000397311.3_Silent_p.P386P|JARID2_ENST00000541660.1_Silent_p.P520P	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	558	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				ACGAGATCCCCGTCCTCAGGC	0.667																																																0			6											41.0	38.0	39.0					6																	15497130		2203	4300	6503	15605109	SO:0001819	synonymous_variant	3720			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1674C>A	6.37:g.15497130C>A			15605109	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	37	CCDS4533.1	SNP	23	Baylor																																																																																				0.667	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		Silent
KALRN	8997	hgsc.bcm.edu	37	3	124209720	124209720	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:124209720A>G	ENST00000240874.3	+	30	4727	c.4570A>G	c.(4570-4572)Aac>Gac	p.N1524D	KALRN_ENST00000360013.3_Missense_Mutation_p.N1524D|KALRN_ENST00000460856.1_Missense_Mutation_p.N1515D	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1524	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N1524D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGTTTACAAGAACAAGCTACT	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											47.0	52.0	50.0					3																	124209720		2203	4300	6503	125692410	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4570A>G	3.37:g.124209720A>G	ENSP00000240874:p.Asn1524Asp		125692410	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.77	2.930420	0.52866	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.11930	2.73;2.73;2.73	5.52	5.52	0.82312	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.057462	0.64402	D	0.000002	T	0.33206	0.0855	M	0.70595	2.14	0.80722	D	1	B;P;B	0.45715	0.271;0.865;0.222	B;P;B	0.57620	0.103;0.824;0.209	T	0.01178	-1.1427	10	0.41790	T	0.15	.	15.8108	0.78561	1.0:0.0:0.0:0.0	.	1515;1524;1524	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	D	1515;1524;1524	ENSP00000418611:N1515D;ENSP00000240874:N1524D;ENSP00000353109:N1524D	ENSP00000240874:N1524D	N	+	1	0	KALRN	125692410	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.116000	0.77119	2.320000	0.78422	0.528000	0.53228	AAC		0.502	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947		Missense_Mutation
KCMF1	56888	hgsc.bcm.edu	37	2	85280388	85280388	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:85280388delA	ENST00000409785.4	+	7	1361	c.1002delA	c.(1000-1002)tcafs	p.S336fs		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	336	Poly-Ser.						ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S335fs*19(1)		ovary(3)	3						AAGAGAGCTCATCCTCAGATG	0.483																																																1	Deletion - Frameshift(1)	ovary(1)	2											61.0	66.0	64.0					2																	85280388		1965	4161	6126	85133899	SO:0001589	frameshift_variant	56888			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.1002delA	2.37:g.85280388delA	ENSP00000386738:p.Ser336fs		85133899	Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Frame_Shift_Del	DEL	ENST00000409785.4	37	CCDS46350.1	DEL	8	Baylor																																																																																				0.483	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122		Frame_Shift_Del
KCNC4	3749	hgsc.bcm.edu	37	1	110765612	110765612	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:110765612C>A	ENST00000369787.3	+	2	732	c.705C>A	c.(703-705)ttC>ttA	p.F235L	KCNC4_ENST00000413138.3_Missense_Mutation_p.F235L|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Missense_Mutation_p.F235L	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	235					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.F235L(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTCTCTTCTTCATCCTGGTCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	89.0	91.0					1																	110765612		2203	4300	6503	110567135	SO:0001583	missense	3749			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.705C>A	1.37:g.110765612C>A	ENSP00000358802:p.Phe235Leu		110567135	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	37	CCDS821.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588764	0.46110	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.96940	-4.18;-4.18;-4.18	4.88	2.96	0.34315	.	0.000000	0.85682	D	0.000000	D	0.96185	0.8756	L	0.55103	1.725	0.80722	D	1	B;B;D	0.76494	0.023;0.175;0.999	B;B;D	0.79784	0.074;0.155;0.993	D	0.95840	0.8865	10	0.56958	D	0.05	.	11.4849	0.50348	0.0:0.787:0.0:0.213	.	235;235;235	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	L	235	ENSP00000358802:F235L;ENSP00000388029:F235L;ENSP00000393655:F235L	ENSP00000358802:F235L	F	+	3	2	KCNC4	110567135	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.074000	0.57577	1.189000	0.43028	0.455000	0.32223	TTC		0.587	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574		Missense_Mutation
KHNYN	23351	hgsc.bcm.edu	37	14	24906241	24906241	+	Splice_Site	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr14:24906241G>T	ENST00000251343.5	+	8	1926		c.e8-1		KHNYN_ENST00000553935.1_Splice_Site|KHNYN_ENST00000556842.1_Splice_Site|KHNYN_ENST00000554268.1_Splice_Site			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)	p.?(1)		kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						TTTCTTCCCAGGACACAGGGG	0.507											OREG0022628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Unknown(1)	ovary(1)	14											115.0	123.0	120.0					14																	24906241		2203	4300	6503	23976081	SO:0001630	splice_region_variant	23351			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.1788-1G>T	14.37:g.24906241G>T		775	23976081	Q86TZ6|Q8IUQ2|Q96BA9	Splice_Site_SNP	SNP	ENST00000251343.5	37	CCDS32058.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603067	0.28534	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935;ENST00000554268	.	.	.	4.8	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7818	0.40653	0.0:0.0:0.7947:0.2053	.	.	.	.	.	-1	.	.	.	+	.	.	KHNYN	23976081	1.000000	0.71417	0.835000	0.33067	0.030000	0.12068	2.614000	0.46359	2.655000	0.90218	0.557000	0.71058	.		0.507	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1		Intron	Splice_Site_SNP
CCSER1	401145	hgsc.bcm.edu	37	4	91321222	91321222	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr4:91321222T>A	ENST00000509176.1	+	4	1833	c.1545T>A	c.(1543-1545)gaT>gaA	p.D515E	CCSER1_ENST00000333691.8_Missense_Mutation_p.D515E|CCSER1_ENST00000432775.2_Missense_Mutation_p.D515E	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	515								p.D517E(1)									GTGAACTGGATGAAGATGATC	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											208.0	175.0	185.0					4																	91321222		1851	4111	5962	91540245	SO:0001583	missense	401145				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1545T>A	4.37:g.91321222T>A	ENSP00000425040:p.Asp515Glu		91540245	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878788	0.72294	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.42131	1.42;0.98;1.42	4.59	2.05	0.26809	.	0.136013	0.46145	D	0.000309	T	0.39226	0.1070	N	0.13235	0.315	0.29599	N	0.847794	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.994	T	0.31308	-0.9948	10	0.14656	T	0.56	-23.0461	8.9057	0.35521	0.0:0.164:0.0:0.836	.	515;515	Q9C0I3-2;Q9C0I3	.;F190A_HUMAN	E	515	ENSP00000425040:D515E;ENSP00000389283:D515E;ENSP00000329482:D515E	ENSP00000329482:D515E	D	+	3	2	FAM190A	91540245	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.693000	0.37742	0.326000	0.23384	-0.541000	0.04245	GAT		0.333	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		Missense_Mutation
KLHL22	84861	hgsc.bcm.edu	37	22	20800918	20800918	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr22:20800918T>C	ENST00000328879.4	-	6	1507	c.1351A>G	c.(1351-1353)Acc>Gcc	p.T451A	KLHL22_ENST00000440659.2_Missense_Mutation_p.T308A	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	451					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGCCGCAGGTGATATACATC	0.617																																																0			22											200.0	160.0	174.0					22																	20800918		2203	4300	6503	19130918	SO:0001583	missense	84861				CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.1351A>G	22.37:g.20800918T>C	ENSP00000331682:p.Thr451Ala		19130918	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	ENST00000328879.4	37	CCDS13780.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.09	1.834153	0.32421	.	.	ENSG00000099910	ENST00000328879;ENST00000440659	T;T	0.41400	1.0;1.0	5.67	5.67	0.87782	Kelch-type beta propeller (1);	0.159698	0.56097	D	0.000035	T	0.25680	0.0625	N	0.20304	0.555	0.37285	D	0.908022	B	0.09022	0.002	B	0.10450	0.005	T	0.22243	-1.0222	9	.	.	.	.	8.4251	0.32725	0.0:0.0867:0.0:0.9133	.	451	Q53GT1	KLH22_HUMAN	A	451;308	ENSP00000331682:T451A;ENSP00000405521:T308A	.	T	-	1	0	KLHL22	19130918	0.193000	0.23313	0.846000	0.33378	0.992000	0.81027	0.512000	0.22755	2.169000	0.68431	0.460000	0.39030	ACC		0.617	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320045.2	NM_032775		Missense_Mutation
KLHL29	114818	hgsc.bcm.edu	37	2	23926096	23926097	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-0793-01	TCGA-13-0793-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:23926096_23926097insT	ENST00000486442.1	+	12	2863_2864	c.2146_2147insT	c.(2146-2148)ctgfs	p.L716fs		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	716								p.P496fs*51(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						GGTGGCCCCTCTGCCCAAGGCA	0.619																																																2	Insertion - Frameshift(2)	ovary(2)	2																																								23779601	SO:0001589	frameshift_variant	114818				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.2147dupT	2.37:g.23926097_23926097dupT	ENSP00000420659:p.Leu716fs		23779600	Q8N388|Q96BF0|Q96PW7	Frame_Shift_Ins	INS	ENST00000486442.1	37	CCDS54335.1	INS	32	Baylor																																																																																				0.619	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920		Frame_Shift_Ins
KLK7	5650	hgsc.bcm.edu	37	19	51480921	51480921	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:51480921G>T	ENST00000391807.1	-	6	734	c.633C>A	c.(631-633)tgC>tgA	p.C211*	KLK7_ENST00000595820.1_Nonsense_Mutation_p.C211*|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000336317.4_Nonsense_Mutation_p.C98*|KLK7_ENST00000597707.1_Nonsense_Mutation_p.C139*	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	211	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.C211*(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		GGGTACCTCTGCACACCAACG	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	19											104.0	92.0	96.0					19																	51480921		2203	4300	6503	56172733	SO:0001587	stop_gained	5650			L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.633C>A	19.37:g.51480921G>T	ENSP00000375683:p.Cys211*		56172733	A8K0U5|Q8N5N9|Q8NFV7	Nonsense_Mutation	SNP	ENST00000391807.1	37	CCDS12812.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	g	39	7.731048	0.98459	.	.	ENSG00000169035	ENST00000304045;ENST00000391807;ENST00000336317	.	.	.	4.9	3.84	0.44239	.	0.000000	0.36482	U	0.002575	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8458	0.52383	0.0922:0.0:0.9078:0.0	.	.	.	.	X	211;211;98	.	ENSP00000304791:C211X	C	-	3	2	KLK7	56172733	1.000000	0.71417	0.973000	0.42090	0.970000	0.65996	2.051000	0.41307	2.466000	0.83321	0.448000	0.29417	TGC		0.522	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046		Nonsense_Mutation
LAMA3	3909	hgsc.bcm.edu	37	18	21327948	21327948	+	Silent	SNP	T	T	G			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr18:21327948T>G	ENST00000313654.9	+	3	730	c.489T>G	c.(487-489)tcT>tcG	p.S163S	LAMA3_ENST00000399516.3_Silent_p.S163S	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	163	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TTGCAAATTCTCCTCGCCCTG	0.388																																																0			18											132.0	122.0	125.0					18																	21327948		1845	4091	5936	19581946	SO:0001819	synonymous_variant	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.489T>G	18.37:g.21327948T>G			19581946	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	54	Baylor																																																																																				0.388	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Silent
LAMA4	3910	hgsc.bcm.edu	37	6	112462025	112462025	+	Silent	SNP	A	A	G			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:112462025A>G	ENST00000230538.7	-	22	3310	c.2913T>C	c.(2911-2913)tcT>tcC	p.S971S	LAMA4_ENST00000522006.1_Silent_p.S964S|LAMA4_ENST00000389463.4_Silent_p.S964S|LAMA4_ENST00000424408.2_Silent_p.S964S	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	971	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.S964S(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGTCCAGCAGAGAGTCATCTC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	6											98.0	93.0	95.0					6																	112462025		2203	4300	6503	112568718	SO:0001819	synonymous_variant	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2913T>C	6.37:g.112462025A>G			112568718	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	37	CCDS43491.1	SNP	11	Baylor																																																																																				0.448	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		Silent
LCA5L	150082	hgsc.bcm.edu	37	21	40792723	40792723	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr21:40792723T>C	ENST00000358268.2	-	6	1412	c.884A>G	c.(883-885)cAg>cGg	p.Q295R	LCA5L_ENST00000288350.3_Missense_Mutation_p.Q295R|LCA5L_ENST00000380671.2_Missense_Mutation_p.Q295R			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	295										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				AATAGCCAGCTGCCGGCTAAA	0.398																																																0			21											51.0	53.0	52.0					21																	40792723		2203	4300	6503	39714593	SO:0001583	missense	150082			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.884A>G	21.37:g.40792723T>C	ENSP00000351008:p.Gln295Arg		39714593	D3DSI0|Q3ZCT0	Missense_Mutation	SNP	ENST00000358268.2	37	CCDS13665.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610618	0.66558	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.79033	-1.23;-1.23;-1.23	5.94	5.94	0.96194	.	0.074420	0.56097	D	0.000035	D	0.88213	0.6376	M	0.78049	2.395	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	D	0.88784	0.3273	10	0.54805	T	0.06	-28.4152	16.4075	0.83691	0.0:0.0:0.0:1.0	.	295	O95447	LCA5L_HUMAN	R	295	ENSP00000288350:Q295R;ENSP00000370046:Q295R;ENSP00000351008:Q295R	ENSP00000288350:Q295R	Q	-	2	0	LCA5L	39714593	1.000000	0.71417	0.971000	0.41717	0.309000	0.27889	4.091000	0.57700	2.275000	0.75901	0.528000	0.53228	CAG		0.398	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505		Missense_Mutation
MAGEL2	54551	hgsc.bcm.edu	37	15	23889721	23889721	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr15:23889721C>T	ENST00000532292.1	-	1	1454	c.1360G>A	c.(1360-1362)Gag>Aag	p.E454K		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	337	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TCTAAGCACTCATCTTTATAC	0.448																																																0			15											73.0	69.0	70.0					15																	23889721		1962	4148	6110	21440814	SO:0001583	missense	54551			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1360G>A	15.37:g.23889721C>T	ENSP00000433433:p.Glu454Lys		21440814		Missense_Mutation	SNP	ENST00000532292.1	37		SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741826	0.30865	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.68	3.75	0.43078	.	.	.	.	.	T	0.38026	0.1025	L	0.36672	1.1	0.09310	N	1	.	.	.	.	.	.	T	0.20739	-1.0266	5	.	.	.	.	10.9475	0.47310	0.0:0.8107:0.1893:0.0	.	.	.	.	I	485	.	.	M	-	3	0	MAGEL2	21440814	0.007000	0.16637	0.741000	0.31004	0.781000	0.44180	0.110000	0.15437	1.303000	0.44873	0.591000	0.81541	ATG		0.448	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066		Missense_Mutation
MDGA2	161357	hgsc.bcm.edu	37	14	47530616	47530616	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr14:47530616C>T	ENST00000399232.2	-	7	1518	c.1154G>A	c.(1153-1155)cGg>cAg	p.R385Q	MDGA2_ENST00000426342.1_Missense_Mutation_p.R156Q|MDGA2_ENST00000357362.3_Missense_Mutation_p.R156Q|MDGA2_ENST00000439988.3_Missense_Mutation_p.R454Q	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	385	Ig-like 4.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R156Q(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						AATGACCATCCGCTCAGAACT	0.418																																																1	Substitution - Missense(1)	ovary(1)	14											158.0	142.0	147.0					14																	47530616		1897	4112	6009	46600366	SO:0001583	missense	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1154G>A	14.37:g.47530616C>T	ENSP00000382178:p.Arg385Gln		46600366	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.282825	0.95489	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.64	5.64	0.86602	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47455	U	0.000235	T	0.70928	0.3280	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.73930	-0.3827	10	0.87932	D	0	.	18.2795	0.90094	0.0:1.0:0.0:0.0	.	385	Q7Z553	MDGA2_HUMAN	Q	385;156;454;156	ENSP00000400011:R385Q;ENSP00000405456:R156Q;ENSP00000382178:R454Q;ENSP00000349925:R156Q	ENSP00000349925:R156Q	R	-	2	0	MDGA2	46600366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.658000	0.90341	0.655000	0.94253	CGG		0.418	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		Missense_Mutation
MED29	55588	hgsc.bcm.edu	37	19	39888108	39888108	+	Silent	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:39888108T>C	ENST00000599213.2	+	4	399	c.372T>C	c.(370-372)caT>caC	p.H124H	MED29_ENST00000315588.5_Silent_p.H145H|MED29_ENST00000594368.1_Intron			Q9NX70	MED29_HUMAN	mediator complex subunit 29	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GCCTGGCGCATGAGTGCCTGT	0.642											OREG0025460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											89.0	77.0	81.0					19																	39888108		2203	4300	6503	44579948	SO:0001819	synonymous_variant	55588			AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70		ENST00000599213.2:c.372T>C	19.37:g.39888108T>C		889	44579948	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Silent	SNP	ENST00000599213.2	37		SNP	51	Baylor																																																																																				0.642	MED29-011	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470870.1	XM_290829		Silent
MTCH2	23788	hgsc.bcm.edu	37	11	47660287	47660287	+	Silent	SNP	T	T	C	rs79167377		TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr11:47660287T>C	ENST00000302503.3	-	3	400	c.243A>G	c.(241-243)ggA>ggG	p.G81G	MTCH2_ENST00000542981.1_5'UTR	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	81					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						TTCCAAGGACTCCCGAACACA	0.438																																																0			11											74.0	70.0	71.0					11																	47660287		2201	4298	6499	47616863	SO:0001819	synonymous_variant	23788			AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.243A>G	11.37:g.47660287T>C			47616863	B2R7L8	Silent	SNP	ENST00000302503.3	37	CCDS7943.1	SNP	54	Baylor																																																																																				0.438	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391921.2	NM_014342		Silent
MYO1A	4640	hgsc.bcm.edu	37	12	57431359	57431359	+	Silent	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr12:57431359T>A	ENST00000442789.2	-	20	2315	c.2028A>T	c.(2026-2028)acA>acT	p.T676T	MYO1A_ENST00000300119.3_Silent_p.T676T|MYO1A_ENST00000476795.1_5'Flank|MYO1A_ENST00000544473.1_Silent_p.T514T	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	676	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.T676T(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TGAAGATCTTTGTCTTGCCAA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											274.0	286.0	282.0					12																	57431359		2203	4300	6503	55717626	SO:0001819	synonymous_variant	4640			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.2028A>T	12.37:g.57431359T>A			55717626	Q9UQD7	Silent	SNP	ENST00000442789.2	37	CCDS8929.1	SNP	63	Baylor																																																																																				0.537	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379		Silent
NCOA1	8648	hgsc.bcm.edu	37	2	24928072	24928072	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:24928072C>T	ENST00000406961.1	+	12	1719	c.1067C>T	c.(1066-1068)cCt>cTt	p.P356L	NCOA1_ENST00000407230.1_Missense_Mutation_p.P205L|NCOA1_ENST00000395856.3_Missense_Mutation_p.P356L|NCOA1_ENST00000538539.1_Missense_Mutation_p.P356L|NCOA1_ENST00000405141.1_Missense_Mutation_p.P356L|NCOA1_ENST00000288599.5_Missense_Mutation_p.P356L|NCOA1_ENST00000348332.3_Missense_Mutation_p.P356L			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	356					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.P356L(1)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACATGCAACCTTTCATCATG	0.398			T	PAX3	alveolar rhadomyosarcoma																																		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	1	Substitution - Missense(1)	ovary(1)	2											117.0	112.0	113.0					2																	24928072		2203	4300	6503	24781576	SO:0001583	missense	8648			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1067C>T	2.37:g.24928072C>T	ENSP00000385216:p.Pro356Leu		24781576	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409411	0.83340	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.76	5.76	0.90799	.	0.050122	0.85682	D	0.000000	T	0.46229	0.1382	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	1.0;0.99;0.999;0.998	D;P;D;P	0.91635	0.999;0.618;0.965;0.798	T	0.14282	-1.0478	10	0.52906	T	0.07	.	19.9381	0.97149	0.0:1.0:0.0:0.0	.	356;356;356;205	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	L	356;356;205;356;356;356;356	ENSP00000385216:P356L;ENSP00000385097:P356L;ENSP00000385195:P205L;ENSP00000444039:P356L;ENSP00000320940:P356L;ENSP00000288599:P356L;ENSP00000379197:P356L	ENSP00000288599:P356L	P	+	2	0	NCOA1	24781576	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.909000	0.75735	2.880000	0.98712	0.650000	0.86243	CCT		0.398	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		Missense_Mutation
PBRM1	55193	hgsc.bcm.edu	37	3	52692281	52692281	+	Silent	SNP	T	T	G			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:52692281T>G	ENST00000296302.7	-	5	580	c.579A>C	c.(577-579)atA>atC	p.I193I	PBRM1_ENST00000409114.3_Silent_p.I193I|PBRM1_ENST00000410007.1_Silent_p.I193I|PBRM1_ENST00000409767.1_Silent_p.I193I|PBRM1_ENST00000356770.4_Silent_p.I193I|PBRM1_ENST00000409057.1_Silent_p.I193I|PBRM1_ENST00000394830.3_Silent_p.I193I|PBRM1_ENST00000337303.4_Silent_p.I193I			Q86U86	PB1_HUMAN	polybromo 1	193					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I193I(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAGCTACAACTATGGCTTCAA	0.393			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																		Rec	yes		3	3p21	55193	polybromo 1		E	1	Substitution - coding silent(1)	ovary(1)	3											83.0	80.0	81.0					3																	52692281		2203	4300	6503	52667321	SO:0001819	synonymous_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.579A>C	3.37:g.52692281T>G			52667321	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	ENST00000296302.7	37		SNP	53	Baylor																																																																																				0.393	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165		Silent
PCDHAC1	56135	hgsc.bcm.edu	37	5	140306534	140306534	+	Silent	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr5:140306534G>A	ENST00000253807.2	+	1	57	c.57G>A	c.(55-57)gcG>gcA	p.A19A	PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHAC1_ENST00000409700.3_Silent_p.A19A|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	19	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A19A(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCTGCAGCGGGACAGCTCG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	5											109.0	128.0	121.0					5																	140306534		2203	4300	6503	140286718	SO:0001819	synonymous_variant	56135			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.57G>A	5.37:g.140306534G>A			140286718	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1	SNP	39	Baylor																																																																																				0.637	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898		Silent
PCGF1	84759	hgsc.bcm.edu	37	2	74732316	74732316	+	Splice_Site	SNP	G	G	A	rs77847000	byFrequency	TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr2:74732316G>A	ENST00000233630.6	-	9	1645	c.734C>T	c.(733-735)cCa>cTa	p.P245L	LBX2-AS1_ENST00000548978.2_RNA|LBX2_ENST00000460508.3_5'Flank|RP11-523H20.3_ENST00000606287.1_RNA|LBX2_ENST00000550249.1_5'Flank|LBX2-AS1_ENST00000603175.1_RNA|LBX2_ENST00000341396.2_5'Flank|PCGF1_ENST00000480844.2_5'UTR	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	245	Required for repressor activity.|Sufficient for interaction with BCOR and BCORL1.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						CAAAGGGGATGGCTAAGGAGA	0.507																																																0			2											40.0	43.0	42.0					2																	74732316		2200	4300	6500	74585824	SO:0001630	splice_region_variant	84759			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.733-1C>T	2.37:g.74732316G>A			74585824	Q7Z506	Missense_Mutation	SNP	ENST00000233630.6	37	CCDS1946.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386121	0.42308	.	.	ENSG00000115289	ENST00000233630	T	0.22743	1.94	4.54	4.54	0.55810	.	0.139716	0.48286	D	0.000184	T	0.17577	0.0422	L	0.40543	1.245	0.50039	D	0.99984	B	0.22003	0.063	B	0.14023	0.01	T	0.03221	-1.1059	10	0.29301	T	0.29	-5.8841	13.0327	0.58851	0.0:0.0:1.0:0.0	.	245	Q9BSM1	PCGF1_HUMAN	L	245	ENSP00000233630:P245L	ENSP00000233630:P245L	P	-	2	0	PCGF1	74585824	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.239000	0.65371	2.527000	0.85204	0.555000	0.69702	CCA		0.507	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252216.1	NM_032673	Missense_Mutation	Missense_Mutation
PDE4A	5141	hgsc.bcm.edu	37	19	10572644	10572644	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:10572644T>A	ENST00000352831.6	+	13	1822	c.1712T>A	c.(1711-1713)cTc>cAc	p.L571H	PDE4A_ENST00000592685.1_Missense_Mutation_p.L549H|PDE4A_ENST00000380702.2_Missense_Mutation_p.L549H|PDE4A_ENST00000440014.2_Missense_Mutation_p.L510H|PDE4A_ENST00000293683.5_Missense_Mutation_p.L545H|PDE4A_ENST00000344979.3_Missense_Mutation_p.L332H	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	571	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)	p.L332H(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TCAGGGGTCCTCCTGCTAGAT	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											142.0	114.0	124.0					19																	10572644		2203	4300	6503	10433644	SO:0001583	missense	5141				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1712T>A	19.37:g.10572644T>A	ENSP00000270474:p.Leu571His		10433644	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419877	0.83559	.	.	ENSG00000065989	ENST00000419866;ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	4.49	4.49	0.54785	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	.	.	.	.	D	0.84215	0.5423	M	0.85945	2.785	0.80722	D	1	D;D;D;P;D	0.89917	0.999;1.0;1.0;0.947;0.974	D;D;D;P;P	0.91635	0.942;0.999;0.998;0.695;0.721	D	0.86539	0.1827	9	0.87932	D	0	.	11.729	0.51726	0.0:0.0:0.0:1.0	.	237;332;510;545;571	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	H	13;549;571;545;510;332;237	ENSP00000370078:L549H;ENSP00000270474:L571H;ENSP00000293683:L545H;ENSP00000394754:L510H;ENSP00000341007:L332H	ENSP00000293683:L545H	L	+	2	0	PDE4A	10433644	1.000000	0.71417	0.973000	0.42090	0.861000	0.49209	7.942000	0.87708	1.675000	0.50919	0.397000	0.26171	CTC		0.602	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1			Missense_Mutation
PDIA4	9601	hgsc.bcm.edu	37	7	148716180	148716180	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr7:148716180C>T	ENST00000286091.4	-	3	611	c.379G>A	c.(379-381)Gtg>Atg	p.V127M		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	127	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CTGGCCAGCACAGACGCTGAG	0.493																																																0			7											109.0	98.0	101.0					7																	148716180		2203	4300	6503	148347113	SO:0001583	missense	9601			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.379G>A	7.37:g.148716180C>T	ENSP00000286091:p.Val127Met		148347113	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	c	5.280	0.237116	0.10023	.	.	ENSG00000155660	ENST00000286091	T	0.38722	1.12	5.15	-2.72	0.05968	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.622831	0.16502	N	0.211606	T	0.22513	0.0543	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12451	-1.0547	10	0.45353	T	0.12	.	6.3031	0.21123	0.1921:0.45:0.0:0.3578	.	127	P13667	PDIA4_HUMAN	M	127	ENSP00000286091:V127M	ENSP00000286091:V127M	V	-	1	0	PDIA4	148347113	0.000000	0.05858	0.028000	0.17463	0.091000	0.18340	0.065000	0.14466	-0.137000	0.11455	-0.404000	0.06349	GTG		0.493	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911		Missense_Mutation
PHACTR1	221692	hgsc.bcm.edu	37	6	13228205	13228205	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:13228205G>C	ENST00000379350.1	+	8	1273	c.1144G>C	c.(1144-1146)Gag>Cag	p.E382Q	PHACTR1_ENST00000457702.2_Missense_Mutation_p.E237Q|PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Missense_Mutation_p.E382Q			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	382					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGTGCCTCATGAGTCAGACTA	0.458																																																0			6											153.0	160.0	158.0					6																	13228205		1998	4169	6167	13336184	SO:0001583	missense	221692			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.1144G>C	6.37:g.13228205G>C	ENSP00000368655:p.Glu382Gln		13336184	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	37		SNP	45	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.564410|4.564410	0.86335|0.86335	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702|ENST00000415087	T;T;T|.	0.36157|.	1.27;1.33;1.32|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.045872|.	0.85682|.	D|.	0.000000|.	T|T	0.60650|0.60650	0.2285|0.2285	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	P;P;P|.	0.44816|.	0.587;0.759;0.844|.	B;B;P|.	0.44359|.	0.383;0.261;0.447|.	T|T	0.54234|0.54234	-0.8324|-0.8324	10|5	0.51188|.	T|.	0.08|.	-11.4001|-11.4001	19.3193|19.3193	0.94231|0.94231	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	451;382;382|.	E7ESR5;Q9C0D0;Q9C0D0-2|.	.;PHAR1_HUMAN;.|.	Q|I	382;382;451;237|216	ENSP00000368655:E382Q;ENSP00000329880:E382Q;ENSP00000397669:E237Q|.	ENSP00000329880:E382Q|.	E|M	+|+	1|3	0|0	PHACTR1|PHACTR1	13336184|13336184	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.976000|0.976000	0.68499|0.68499	7.333000|7.333000	0.79214|0.79214	2.871000|2.871000	0.98454|0.98454	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.458	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420		Missense_Mutation
PIGT	51604	hgsc.bcm.edu	37	20	44054403	44054403	+	Silent	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr20:44054403A>C	ENST00000279036.6	+	12	1754	c.1674A>C	c.(1672-1674)acA>acC	p.T558T	PIGT_ENST00000279035.9_Silent_p.T456T|PIGT_ENST00000372689.5_Silent_p.T491T|PIGT_ENST00000535404.1_Silent_p.T403T|PIGT_ENST00000545755.1_Silent_p.T296T|PIGT_ENST00000543458.2_Silent_p.T502T|PIGT_ENST00000341555.5_Silent_p.T364T	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	558					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.T558T(1)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				AGCCCCGCACAGGTGGCCTGG	0.622																																																1	Substitution - coding silent(1)	large_intestine(1)	20											38.0	33.0	34.0					20																	44054403		2203	4300	6503	43487817	SO:0001819	synonymous_variant	51604				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.1674A>C	20.37:g.44054403A>C			43487817	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1	SNP	7	Baylor																																																																																				0.622	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937		Silent
PKIA	5569	hgsc.bcm.edu	37	8	79510670	79510670	+	Silent	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr8:79510670A>C	ENST00000396418.2	+	3	537	c.51A>C	c.(49-51)acA>acC	p.T17T	PKIA_ENST00000352966.5_Silent_p.T17T|PKIA_ENST00000518467.1_Silent_p.T17T	NM_006823.3|NM_181839.2	NP_006814.1|NP_862822.1	P61925	IPKA_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor alpha	17					negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP-dependent protein kinase inhibitor activity (GO:0004862)|protein kinase A catalytic subunit binding (GO:0034236)	p.T17T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6						CAGGAAGAACAGGTAGAAGAA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	8											155.0	144.0	148.0					8																	79510670		2203	4300	6503	79673225	SO:0001819	synonymous_variant	5569			S76965	CCDS6222.1	8q21.13	2014-08-12			ENSG00000171033	ENSG00000171033			9017	protein-coding gene	gene with protein product		606059		PRKACN1		1770951	Standard	NM_006823		Approved		uc003ybb.3	P61925	OTTHUMG00000164618	ENST00000396418.2:c.51A>C	8.37:g.79510670A>C			79673225	P04541|Q6IAV2	Silent	SNP	ENST00000396418.2	37	CCDS6222.1	SNP	7	Baylor																																																																																				0.373	PKIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379420.1			Silent
PPOX	5498	hgsc.bcm.edu	37	1	161137880	161137880	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:161137880C>T	ENST00000367999.4	+	5	700	c.434C>T	c.(433-435)aCt>aTt	p.T145I	PPOX_ENST00000544598.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.T145I|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	145					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCTGATGAGACTGTGCACAGT	0.617																																																0			1											54.0	57.0	56.0					1																	161137880		2203	4300	6503	159404504	SO:0001583	missense	5498			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.434C>T	1.37:g.161137880C>T	ENSP00000356978:p.Thr145Ile		159404504	D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	CCDS1221.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.75	3.886219	0.72410	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.96685	-4.09;-4.09	5.69	4.77	0.60923	Amine oxidase (1);	0.167021	0.52532	D	0.000069	D	0.95056	0.8399	M	0.75085	2.285	0.80722	D	1	P	0.47034	0.889	P	0.46479	0.518	D	0.95069	0.8202	10	0.87932	D	0	-23.8471	13.137	0.59415	0.0:0.6935:0.3065:0.0	.	145	P50336	PPOX_HUMAN	I	145	ENSP00000343943:T145I;ENSP00000356978:T145I	ENSP00000343943:T145I	T	+	2	0	PPOX	159404504	0.979000	0.34478	0.966000	0.40874	0.972000	0.66771	1.475000	0.35409	1.395000	0.46643	0.650000	0.86243	ACT		0.617	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		Missense_Mutation
PSD3	23362	hgsc.bcm.edu	37	8	18430097	18430097	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr8:18430097C>T	ENST00000327040.8	-	14	2827	c.2725G>A	c.(2725-2727)Ggc>Agc	p.G909S	PSD3_ENST00000523619.1_Missense_Mutation_p.G844S|PSD3_ENST00000286485.8_Missense_Mutation_p.G375S|PSD3_ENST00000428502.2_Missense_Mutation_p.G238S|PSD3_ENST00000440756.2_Missense_Mutation_p.G911S	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	910					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.G375S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TTCTGAGAGCCGATTGCTGCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	8											150.0	153.0	152.0					8																	18430097		2203	4300	6503	18474377	SO:0001583	missense	23362			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2725G>A	8.37:g.18430097C>T	ENSP00000324127:p.Gly909Ser		18474377	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962702	0.92791	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	5.71	5.71	0.89125	.	0.286010	0.20603	U	0.089119	T	0.78470	0.4288	L	0.39566	1.225	0.80722	D	1	P;D;D;P	0.56968	0.95;0.978;0.974;0.681	P;P;P;B	0.52386	0.697;0.697;0.697;0.088	T	0.73257	-0.4040	10	0.22109	T	0.4	.	17.7136	0.88328	0.0:1.0:0.0:0.0	.	909;910;375;238	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	S	909;911;375;238;844	ENSP00000324127:G909S;ENSP00000401704:G911S;ENSP00000286485:G375S;ENSP00000393228:G238S;ENSP00000430640:G844S	ENSP00000286485:G375S	G	-	1	0	PSD3	18474377	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.776000	0.85560	2.861000	0.98227	0.650000	0.86243	GGC		0.443	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310		Missense_Mutation
QRICH1	54870	hgsc.bcm.edu	37	3	49095139	49095139	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:49095139T>A	ENST00000395443.2	-	3	966	c.494A>T	c.(493-495)cAa>cTa	p.Q165L	QRICH1_ENST00000424300.1_Missense_Mutation_p.Q165L|QRICH1_ENST00000479449.1_Intron|QRICH1_ENST00000357496.2_Missense_Mutation_p.Q165L	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	165	Gln-rich.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTGAGCTGCTTGCAGCTGCGA	0.617																																																0			3											117.0	112.0	114.0					3																	49095139		2203	4300	6503	49070143	SO:0001583	missense	54870				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.494A>T	3.37:g.49095139T>A	ENSP00000378830:p.Gln165Leu		49070143	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274015	0.40194	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000001	T	0.44393	0.1291	N	0.14661	0.345	0.58432	D	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.36016	-0.9765	9	0.87932	D	0	-2.5864	16.5259	0.84331	0.0:0.0:0.0:1.0	.	165	Q2TAL8	QRIC1_HUMAN	L	165	.	ENSP00000350094:Q165L	Q	-	2	0	QRICH1	49070143	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.139000	0.50577	2.301000	0.77427	0.524000	0.50904	CAA		0.617	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730		Missense_Mutation
SIK3	23387	hgsc.bcm.edu	37	11	116730109	116730109	+	Silent	SNP	G	G	A	rs568332064		TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr11:116730109G>A	ENST00000292055.4	-	19	2354	c.2319C>T	c.(2317-2319)cgC>cgT	p.R773R	SIK3_ENST00000542607.1_Silent_p.R773R|SIK3_ENST00000446921.2_Silent_p.R831R|SIK3_ENST00000434315.2_Silent_p.R672R|SIK3_ENST00000375288.1_Silent_p.R168R|SIK3_ENST00000375300.1_Silent_p.R831R|SIK3_ENST00000488337.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	773	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R879R(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TGGAGATGCCGCGCCCACTGG	0.607											OREG0003491	type=REGULATORY REGION|Gene=AK022302|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	1	0.000199681	0.0	0.0	5008	,	,		19437	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	11											85.0	71.0	76.0					11																	116730109		2201	4296	6497	116235319	SO:0001819	synonymous_variant	23387			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2319C>T	11.37:g.116730109G>A		1475	116235319	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Silent	SNP	ENST00000292055.4	37	CCDS8379.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.657	0.684036	0.14907	.	.	ENSG00000160584	ENST00000445177;ENST00000446921	T	0.73258	-0.73	5.43	2.43	0.29744	.	0.000000	0.38111	U	0.001816	T	0.74145	0.3678	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72067	-0.4402	7	0.87932	D	0	.	7.8491	0.29444	0.0:0.6033:0.3089:0.0878	.	.	.	.	W	873;796	ENSP00000391295:R873W	ENSP00000391295:R873W	R	-	1	2	SIK3	116235319	0.285000	0.24296	0.749000	0.31150	0.815000	0.46073	-0.095000	0.11077	0.209000	0.20645	-0.234000	0.12200	CGG		0.607	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164		Silent
QSOX2	169714	hgsc.bcm.edu	37	9	139100845	139100845	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr9:139100845A>C	ENST00000358701.5	-	12	1863	c.1826T>G	c.(1825-1827)gTc>gGc	p.V609G		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	609					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		AGGTGGACGGACGCTCTGGGT	0.637																																																0			9											75.0	71.0	72.0					9																	139100845		2203	4300	6503	138240666	SO:0001583	missense	169714			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1826T>G	9.37:g.139100845A>C	ENSP00000351536:p.Val609Gly		138240666	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	CCDS35178.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	5.539	0.284408	0.10513	.	.	ENSG00000165661	ENST00000358701	T	0.05025	3.51	4.91	-0.367	0.12541	.	1.324570	0.05378	N	0.536541	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B	0.23185	0.081	B	0.18263	0.021	T	0.44159	-0.9346	10	0.21540	T	0.41	-6.3376	0.5421	0.00647	0.2952:0.138:0.1647:0.4021	.	609	Q6ZRP7	QSOX2_HUMAN	G	609	ENSP00000351536:V609G	ENSP00000351536:V609G	V	-	2	0	QSOX2	138240666	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.315000	0.19451	-0.079000	0.12707	0.416000	0.27883	GTC		0.637	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		Missense_Mutation
RBM12B	389677	hgsc.bcm.edu	37	8	94746629	94746629	+	Silent	SNP	T	T	G			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr8:94746629T>G	ENST00000399300.2	-	3	2223	c.2010A>C	c.(2008-2010)ccA>ccC	p.P670P	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Intron|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	670							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P670P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CCTCCTCAGGTGGCCGCCTGA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	8											78.0	82.0	81.0					8																	94746629		1852	4082	5934	94815805	SO:0001819	synonymous_variant	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2010A>C	8.37:g.94746629T>G			94815805	A8MYB5	Silent	SNP	ENST00000399300.2	37	CCDS43755.1	SNP	59	Baylor																																																																																				0.642	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		Silent
RRAD	6236	hgsc.bcm.edu	37	16	66956063	66956063	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr16:66956063G>T	ENST00000299759.6	-	5	1093	c.843C>A	c.(841-843)ttC>ttA	p.F281L	RRAD_ENST00000420652.1_Missense_Mutation_p.F281L			P55042	RAD_HUMAN	Ras-related associated with diabetes	281	Calmodulin-binding.				small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		TGCGGCCCAAGAAGCGCTTCG	0.622																																																0			16											89.0	72.0	78.0					16																	66956063		2200	4300	6500	65513564	SO:0001583	missense	6236			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.843C>A	16.37:g.66956063G>T	ENSP00000299759:p.Phe281Leu		65513564	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735199	0.69189	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.66638	-0.22;-0.22	5.93	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.75057	0.3798	L	0.46885	1.475	0.58432	D	0.999997	D	0.71674	0.998	D	0.73380	0.98	T	0.76110	-0.3079	10	0.54805	T	0.06	.	12.2611	0.54651	0.1422:0.0:0.8578:0.0	.	281	P55042	RAD_HUMAN	L	281	ENSP00000388744:F281L;ENSP00000299759:F281L	ENSP00000299759:F281L	F	-	3	2	RRAD	65513564	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.961000	0.49168	1.478000	0.48253	0.561000	0.74099	TTC		0.622	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	NM_004165		Missense_Mutation
RTN2	6253	hgsc.bcm.edu	37	19	45992156	45992156	+	Missense_Mutation	SNP	T	T	C	rs112295269		TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:45992156T>C	ENST00000245923.4	-	7	1565	c.1330A>G	c.(1330-1332)Acg>Gcg	p.T444A	RTN2_ENST00000590526.1_Missense_Mutation_p.T170A|PPM1N_ENST00000401705.1_5'UTR|RTN2_ENST00000430715.2_Missense_Mutation_p.T104A|RTN2_ENST00000344680.4_Missense_Mutation_p.T371A	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	444	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		CGCAGCTGCGTGGCCGCCGAG	0.632																																																0			19											29.0	27.0	28.0					19																	45992156		2202	4300	6502	50683996	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1330A>G	19.37:g.45992156T>C	ENSP00000245923:p.Thr444Ala		50683996	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.141	1.013915	0.19277	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.41065	1.01;1.01;1.01	5.57	5.57	0.84162	.	0.798219	0.12127	N	0.497157	T	0.29652	0.0740	N	0.22421	0.69	0.19300	N	0.99998	B;B	0.33549	0.417;0.22	B;B	0.28011	0.085;0.055	T	0.15235	-1.0444	10	0.39692	T	0.17	0.2417	12.1816	0.54216	0.0:0.0:0.0:1.0	.	371;444	O75298-2;O75298	.;RTN2_HUMAN	A	371;444;104	ENSP00000345127:T371A;ENSP00000245923:T444A;ENSP00000398178:T104A	ENSP00000245923:T444A	T	-	1	0	RTN2	50683996	0.012000	0.17670	0.527000	0.27925	0.160000	0.22226	0.530000	0.23036	2.137000	0.66172	0.524000	0.50904	ACG		0.632	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		Missense_Mutation
RUSC1	23623	hgsc.bcm.edu	37	1	155295397	155295397	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:155295397T>G	ENST00000368352.5	+	6	1899	c.1748T>G	c.(1747-1749)gTc>gGc	p.V583G	RUSC1_ENST00000292254.4_Missense_Mutation_p.V114G|RUSC1_ENST00000368354.3_Missense_Mutation_p.V583G|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000368347.4_Missense_Mutation_p.V173G|RUSC1_ENST00000368349.4_Missense_Mutation_p.V114G	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	583	Interaction with TRAF6.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)	p.V114G(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TATAGCCAGGTCAGCCGTCTA	0.647											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											55.0	59.0	58.0					1																	155295397		2203	4300	6503	153562021	SO:0001583	missense	23623			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1748T>G	1.37:g.155295397T>G	ENSP00000357336:p.Val583Gly	1769	153562021	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	37	CCDS41410.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.96	2.987777	0.53934	.	.	ENSG00000160753	ENST00000368354;ENST00000368352;ENST00000368347;ENST00000368349;ENST00000292254	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	4.34	3.19	0.36642	RUN (2);	0.000000	0.49305	D	0.000155	T	0.44414	0.1292	L	0.49126	1.545	0.80722	D	1	P;D;B;D;B;P	0.67145	0.954;0.979;0.005;0.996;0.013;0.954	D;P;B;D;B;D	0.72075	0.94;0.9;0.012;0.976;0.036;0.94	T	0.48139	-0.9061	10	0.87932	D	0	-21.9849	10.9269	0.47195	0.0:0.0:0.1579:0.8421	.	81;114;114;173;188;583	B4DQB8;Q9BVN2-2;B3KWM9;Q5T9V0;Q9BT86;Q9BVN2	.;.;.;.;.;RUSC1_HUMAN	G	583;583;173;114;114	ENSP00000357338:V583G;ENSP00000357336:V583G;ENSP00000357331:V173G;ENSP00000357333:V114G;ENSP00000292254:V114G	ENSP00000292254:V114G	V	+	2	0	RUSC1	153562021	1.000000	0.71417	1.000000	0.80357	0.132000	0.20833	5.384000	0.66225	0.781000	0.33589	-0.313000	0.08912	GTC		0.647	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1			Missense_Mutation
SGSM3	27352	hgsc.bcm.edu	37	22	40801654	40801654	+	Splice_Site	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr22:40801654T>C	ENST00000248929.9	+	8	809	c.620T>C	c.(619-621)gTg>gCg	p.V207A	SGSM3_ENST00000454798.2_Splice_Site_p.V140A	NM_015705.4	NP_056520.2			small G protein signaling modulator 3											cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						CCTGGCCAGGTGGCCGCCTGC	0.592																																																0			22											129.0	142.0	137.0					22																	40801654		2203	4300	6503	39131600	SO:0001630	splice_region_variant	27352			AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.619-1T>C	22.37:g.40801654T>C			39131600		Missense_Mutation	SNP	ENST00000248929.9	37	CCDS14002.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.55	2.866968	0.51588	.	.	ENSG00000100359	ENST00000457767;ENST00000248929;ENST00000545416;ENST00000454798	T;T;T	0.05025	3.51;3.51;3.51	4.67	3.61	0.41365	Rab-GAP/TBC domain (4);	0.061993	0.64402	D	0.000005	T	0.19046	0.0457	M	0.85777	2.775	0.80722	D	1	P;P;P;P;P	0.50528	0.587;0.587;0.936;0.863;0.863	P;P;P;P;P	0.52066	0.489;0.489;0.562;0.689;0.689	T	0.01262	-1.1402	10	0.87932	D	0	.	11.5162	0.50522	0.0:0.0:0.1506:0.8493	.	144;140;207;207;207	B4DVE3;B4DMS2;Q96HU1-2;B9A6J5;Q96HU1	.;.;.;.;SGSM3_HUMAN	A	140;207;150;140	ENSP00000399249:V140A;ENSP00000248929:V207A;ENSP00000390998:V140A	ENSP00000248929:V207A	V	+	2	0	SGSM3	39131600	1.000000	0.71417	0.993000	0.49108	0.145000	0.21501	7.639000	0.83342	0.728000	0.32382	0.260000	0.18958	GTG		0.592	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2	NM_015705	Missense_Mutation	Missense_Mutation
SH3D19	152503	hgsc.bcm.edu	37	4	152086772	152086772	+	Silent	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr4:152086772A>C	ENST00000409252.2	-	7	1478	c.771T>G	c.(769-771)acT>acG	p.T257T	SH3D19_ENST00000427414.2_Intron|SH3D19_ENST00000409598.4_Silent_p.T257T|SH3D19_ENST00000455740.1_Silent_p.T257T|SH3D19_ENST00000304527.4_Silent_p.T257T|SH3D19_ENST00000514152.1_Silent_p.T257T|SH3D19_ENST00000424281.1_Intron			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	257	Pro-rich.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TTCGAATTACAGTGGGCTTCC	0.388																																																0			4											239.0	209.0	219.0					4																	152086772		2203	4300	6503	152306222	SO:0001819	synonymous_variant	152503			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.771T>G	4.37:g.152086772A>C			152306222	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Silent	SNP	ENST00000409252.2	37	CCDS34077.2	SNP	7	Baylor																																																																																				0.388	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555		Silent
SLC1A6	6511	hgsc.bcm.edu	37	19	15075168	15075168	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr19:15075168A>C	ENST00000221742.3	-	4	561	c.554T>G	c.(553-555)aTg>aGg	p.M185R	SLC1A6_ENST00000430939.2_Missense_Mutation_p.M121R|SLC1A6_ENST00000600144.1_Missense_Mutation_p.M185R|SLC1A6_ENST00000598504.1_Missense_Mutation_p.M185R|SLC1A6_ENST00000544886.2_Missense_Mutation_p.M185R	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	185					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						TGGTGGAAACATATTTCTGCA	0.463																																																0			19											222.0	215.0	217.0					19																	15075168		2203	4300	6503	14936168	SO:0001583	missense	6511				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.554T>G	19.37:g.15075168A>C	ENSP00000221742:p.Met185Arg		14936168	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	a	18.60	3.658381	0.67586	.	.	ENSG00000105143	ENST00000430939;ENST00000221742;ENST00000544886;ENST00000542610	T;T;T	0.60040	0.22;0.22;0.22	3.9	3.9	0.45041	.	0.085159	0.85682	D	0.000000	T	0.78892	0.4355	M	0.93197	3.39	0.80722	D	1	D;P;P;B	0.63046	0.992;0.845;0.933;0.224	D;P;P;B	0.65573	0.936;0.857;0.908;0.201	D	0.83462	0.0054	10	0.87932	D	0	-20.454	10.6982	0.45911	1.0:0.0:0.0:0.0	.	121;185;186;185	E7EV13;Q8N753;Q59GB0;P48664	.;.;.;EAA4_HUMAN	R	121;185;185;186	ENSP00000409386:M121R;ENSP00000221742:M185R;ENSP00000446175:M185R	ENSP00000221742:M185R	M	-	2	0	SLC1A6	14936168	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.563000	0.90723	1.630000	0.50440	0.402000	0.26972	ATG		0.463	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		Missense_Mutation
SMC1B	27127	hgsc.bcm.edu	37	22	45798220	45798220	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr22:45798220C>G	ENST00000357450.4	-	5	846	c.847G>C	c.(847-849)Gaa>Caa	p.E283Q	SMC1B_ENST00000404354.3_Missense_Mutation_p.E283Q	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	283					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.E283Q(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CACTTTAATTCTTTTTCTGTT	0.299																																																1	Substitution - Missense(1)	ovary(1)	22											123.0	105.0	110.0					22																	45798220		1811	4068	5879	44176884	SO:0001583	missense	27127			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.847G>C	22.37:g.45798220C>G	ENSP00000350036:p.Glu283Gln		44176884	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539340	0.85917	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.81247	-1.47;3.33	5.9	5.9	0.94986	RecF/RecN/SMC (1);	0.000000	0.64402	D	0.000008	D	0.83468	0.5261	L	0.56199	1.76	0.80722	D	1	B;P;P	0.50617	0.387;0.729;0.937	B;B;P	0.51170	0.18;0.439;0.661	T	0.79172	-0.1913	10	0.23302	T	0.38	.	20.2626	0.98452	0.0:1.0:0.0:0.0	.	283;283;283	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	Q	283	ENSP00000350036:E283Q;ENSP00000385902:E283Q	ENSP00000350036:E283Q	E	-	1	0	SMC1B	44176884	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	4.474000	0.60203	2.802000	0.96397	0.650000	0.86243	GAA		0.299	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674		Missense_Mutation
SMG6	23293	hgsc.bcm.edu	37	17	2203200	2203200	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr17:2203200G>A	ENST00000263073.6	-	2	897	c.847C>T	c.(847-849)Cag>Tag	p.Q283*	SMG6_ENST00000544865.1_Nonsense_Mutation_p.Q252*	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	283	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)	p.Q283*(2)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GTCCTATCCTGTCGGCGGCGG	0.572																																					Melanoma(59;28 1088 11621 25887 46638 50814)											2	Substitution - Nonsense(2)	ovary(2)	17											71.0	63.0	65.0					17																	2203200		2203	4300	6503	2149950	SO:0001587	stop_gained	23293			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.847C>T	17.37:g.2203200G>A	ENSP00000263073:p.Gln283*		2149950	B7Z874|O94837|Q86VH6|Q9UF60	Nonsense_Mutation	SNP	ENST00000263073.6	37	CCDS11016.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	41	8.992726	0.99029	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	.	.	.	5.35	5.35	0.76521	.	0.552442	0.18250	N	0.146998	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-6.836	19.0567	0.93069	0.0:0.0:1.0:0.0	.	.	.	.	X	283;252	.	ENSP00000263073:Q283X	Q	-	1	0	SMG6	2149950	0.984000	0.35163	0.984000	0.44739	0.929000	0.56500	2.028000	0.41088	2.490000	0.84030	0.655000	0.94253	CAG		0.572	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3			Nonsense_Mutation
SND1	27044	hgsc.bcm.edu	37	7	127727067	127727067	+	Silent	SNP	G	G	C			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr7:127727067G>C	ENST00000354725.3	+	21	2576	c.2382G>C	c.(2380-2382)acG>acC	p.T794T		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	794					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.T794T(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CTCAAGCCACGGAGTATGCCT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	7											122.0	91.0	102.0					7																	127727067		2203	4300	6503	127514303	SO:0001819	synonymous_variant	27044				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2382G>C	7.37:g.127727067G>C			127514303	Q13122|Q96AG0	Silent	SNP	ENST00000354725.3	37	CCDS34747.1	SNP	39	Baylor																																																																																				0.597	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390		Silent
STARD8	9754	hgsc.bcm.edu	37	X	67937888	67937888	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chrX:67937888G>A	ENST00000252336.6	+	5	1264	c.892G>A	c.(892-894)Gat>Aat	p.D298N	STARD8_ENST00000374599.3_Missense_Mutation_p.D378N|STARD8_ENST00000374597.3_Missense_Mutation_p.D298N	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	298					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.D298N(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGATGAAGATGATGAGGAGAG	0.582																																																2	Substitution - Missense(2)	ovary(2)	X											61.0	41.0	48.0					X																	67937888		2203	4300	6503	67854613	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.892G>A	X.37:g.67937888G>A	ENSP00000252336:p.Asp298Asn		67854613	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	CCDS14390.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	g	5.356	0.250909	0.10130	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.13538	2.58;2.6;2.58	4.29	1.21	0.21127	.	1.090560	0.06971	N	0.818066	T	0.10208	0.0250	N	0.22421	0.69	0.09310	N	1	B;B	0.24920	0.114;0.028	B;B	0.21546	0.017;0.035	T	0.37798	-0.9690	10	0.48119	T	0.1	.	7.9365	0.29933	0.0:0.3336:0.5146:0.1517	.	378;298	Q92502-2;Q92502	.;STAR8_HUMAN	N	298;378;298	ENSP00000252336:D298N;ENSP00000363727:D378N;ENSP00000363725:D298N	ENSP00000252336:D298N	D	+	1	0	STARD8	67854613	0.077000	0.21312	0.003000	0.11579	0.009000	0.06853	1.203000	0.32284	0.267000	0.21916	0.597000	0.82753	GAT		0.582	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		Missense_Mutation
TEX14	56155	hgsc.bcm.edu	37	17	56699029	56699029	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr17:56699029C>T	ENST00000240361.8	-	5	621	c.536G>A	c.(535-537)tGt>tAt	p.C179Y	TEX14_ENST00000389934.3_Missense_Mutation_p.C179Y|TEX14_ENST00000349033.5_Missense_Mutation_p.C179Y			Q8IWB6	TEX14_HUMAN	testis expressed 14	179					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.C179Y(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAGGCCCCCACACCAGGACGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											57.0	52.0	53.0					17																	56699029		2203	4300	6503	54054028	SO:0001583	missense	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.536G>A	17.37:g.56699029C>T	ENSP00000240361:p.Cys179Tyr		54054028	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.512	0.866665	0.17250	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.78595	-1.19;-1.19;-1.15	5.42	4.35	0.52113	.	0.170612	0.41938	D	0.000784	T	0.59824	0.2222	N	0.08118	0	0.24774	N	0.99286	B;B;B	0.16166	0.001;0.016;0.002	B;B;B	0.23716	0.008;0.048;0.018	T	0.53913	-0.8371	10	0.48119	T	0.1	-10.1348	10.7309	0.46096	0.8396:0.1604:0.0:0.0	.	179;179;179	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	Y	179	ENSP00000240361:C179Y;ENSP00000374584:C179Y;ENSP00000268910:C179Y	ENSP00000240361:C179Y	C	-	2	0	TEX14	54054028	0.889000	0.30405	0.999000	0.59377	0.158000	0.22134	3.678000	0.54627	0.994000	0.38892	-0.375000	0.07067	TGT		0.612	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			Missense_Mutation
TGM2	7052	hgsc.bcm.edu	37	20	36760817	36760817	+	Silent	SNP	G	G	C			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr20:36760817G>C	ENST00000361475.2	-	11	1874	c.1701C>G	c.(1699-1701)ctC>ctG	p.L567L	TGM2_ENST00000536724.1_Silent_p.L507L|TGM2_ENST00000536701.1_Silent_p.L486L	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	567					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CTGGCTCCACGAGGAGGGCCC	0.557																																																0			20											170.0	169.0	169.0					20																	36760817		2203	4300	6503	36194231	SO:0001819	synonymous_variant	7052			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.1701C>G	20.37:g.36760817G>C			36194231	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Silent	SNP	ENST00000361475.2	37	CCDS13302.1	SNP	37	Baylor																																																																																				0.557	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951		Silent
THSD1	55901	hgsc.bcm.edu	37	13	52971791	52971791	+	Silent	SNP	A	A	T			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr13:52971791A>T	ENST00000258613.4	-	3	775	c.597T>A	c.(595-597)ggT>ggA	p.G199G	RNY4P24_ENST00000362735.1_RNA|THSD1_ENST00000544466.1_Intron|THSD1_ENST00000349258.4_Silent_p.G199G	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	199					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.G199G(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CAACCCACTGACCTTGAGCAA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	13											91.0	74.0	80.0					13																	52971791		2203	4300	6503	51869792	SO:0001819	synonymous_variant	55901			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.597T>A	13.37:g.52971791A>T			51869792	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Silent	SNP	ENST00000258613.4	37	CCDS9432.1	SNP	10	Baylor																																																																																				0.512	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3			Silent
TIPARP	25976	hgsc.bcm.edu	37	3	156396019	156396030	+	In_Frame_Del	DEL	TAGACAAAGTCA	TAGACAAAGTCA	-	rs372015234|rs140976569		TCGA-13-0793-01	TCGA-13-0793-10	TAGACAAAGTCA	TAGACAAAGTCA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:156396019_156396030delTAGACAAAGTCA	ENST00000461166.1	+	2	1121_1132	c.533_544delTAGACAAAGTCA	c.(532-546)ttagacaaagtcata>tta	p.DKVI179del	TIPARP_ENST00000295924.7_In_Frame_Del_p.DKVI179del|TIPARP_ENST00000486483.1_In_Frame_Del_p.DKVI179del|TIPARP_ENST00000542783.1_In_Frame_Del_p.DKVI179del	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	179					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.K180_D183delKVID(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CCTGACTGCTTAGACAAAGTCATAGATTATGT	0.439																																					Ovarian(171;276 1987 3319 6837 11197)											1	Deletion - In frame(1)	ovary(1)	3																																								157878724	SO:0001651	inframe_deletion	25976			BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.533_544delTAGACAAAGTCA	3.37:g.156396019_156396030delTAGACAAAGTCA	ENSP00000420612:p.Asp179_Ile182del		157878713	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	In_Frame_Del	DEL	ENST00000461166.1	37	CCDS3177.1	DEL	61	Baylor																																																																																				0.439	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508		In_Frame_Del
TP53	7157	hgsc.bcm.edu	37	17	7579317	7579317	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr17:7579317delA	ENST00000269305.4	-	4	559	c.370delT	c.(370-372)tgcfs	p.C124fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.C124fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.C124fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C124G(4)|p.C124R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124fs*46(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124fs*48(1)|p.C124fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGACCGTGCAAGTCACAGAC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	28	Deletion - Frameshift(9)|Substitution - Missense(8)|Whole gene deletion(8)|Insertion - Frameshift(2)|Deletion - In frame(1)	ovary(5)|upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)	17											66.0	62.0	63.0					17																	7579317		2203	4300	6503	7520042	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.370delT	17.37:g.7579317delA	ENSP00000269305:p.Cys124fs		7520042	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	5	Baylor																																																																																				0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
TRAF1	7185	hgsc.bcm.edu	37	9	123673704	123673704	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr9:123673704A>C	ENST00000373887.3	-	6	3238	c.793T>G	c.(793-795)Ttc>Gtc	p.F265V	TRAF1_ENST00000540010.1_Missense_Mutation_p.F265V|TRAF1_ENST00000546084.1_Missense_Mutation_p.F143V	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	265					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F265V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						GTGCCATCGAAGGAGGCCTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	9											61.0	51.0	55.0					9																	123673704		2203	4300	6503	122713525	SO:0001583	missense	7185			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.793T>G	9.37:g.123673704A>C	ENSP00000362994:p.Phe265Val		122713525	B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	ENST00000373887.3	37	CCDS6825.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646539	0.67358	.	.	ENSG00000056558	ENST00000373887;ENST00000540010;ENST00000546084	T;T;T	0.42900	1.55;1.55;0.96	4.49	4.49	0.54785	TRAF-type (1);TRAF-like (1);	0.695046	0.14069	N	0.343513	T	0.34978	0.0916	L	0.38175	1.15	0.41661	D	0.989184	B	0.23540	0.087	B	0.20184	0.028	T	0.13522	-1.0506	10	0.40728	T	0.16	-13.8145	13.2672	0.60141	1.0:0.0:0.0:0.0	.	265	Q13077	TRAF1_HUMAN	V	265;265;143	ENSP00000362994:F265V;ENSP00000443183:F265V;ENSP00000438583:F143V	ENSP00000362994:F265V	F	-	1	0	TRAF1	122713525	1.000000	0.71417	0.925000	0.36789	0.952000	0.60782	9.187000	0.94912	1.785000	0.52413	0.460000	0.39030	TTC		0.612	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658		Missense_Mutation
TRIM31	11074	hgsc.bcm.edu	37	6	30080570	30080570	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0793-01	TCGA-13-0793-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:30080570G>T	ENST00000376734.3	-	2	138	c.13C>A	c.(13-15)Cag>Aag	p.Q5K	TRIM31_ENST00000540829.1_Missense_Mutation_p.Q5K|TRIM31_ENST00000485864.1_5'Flank|TRIM31-AS1_ENST00000440874.1_RNA	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	5					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q5K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						TTCACAAACTGCCCACTGGCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	6											63.0	67.0	65.0					6																	30080570		1509	2708	4217	30188549	SO:0001583	missense	11074			AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.13C>A	6.37:g.30080570G>T	ENSP00000365924:p.Gln5Lys		30188549	A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	ENST00000376734.3	37	CCDS34374.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.110	-1.139129	0.01742	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.65178	-0.14;-0.14	3.96	-1.83	0.07833	Zinc finger, RING/FYVE/PHD-type (1);	2.060940	0.02976	N	0.144945	T	0.11367	0.0277	N	0.03967	-0.31	0.09310	N	1	B	0.19073	0.033	B	0.15870	0.014	T	0.02668	-1.1126	10	0.12766	T	0.61	.	3.347	0.07139	0.0813:0.2225:0.3578:0.3383	.	5	Q9BZY9	TRI31_HUMAN	K	5	ENSP00000365924:Q5K;ENSP00000444311:Q5K	ENSP00000365918:Q5K	Q	-	1	0	TRIM31	30188549	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.580000	0.02121	-0.966000	0.03587	-1.193000	0.01689	CAG		0.517	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2			Missense_Mutation
TRIM71	131405	hgsc.bcm.edu	37	3	32932169	32932169	+	Silent	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr3:32932169C>T	ENST00000383763.5	+	4	1536	c.1473C>T	c.(1471-1473)ggC>ggT	p.G491G		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	491					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G491G(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGGCCACAGGCGATGGCCTCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	3											45.0	49.0	48.0					3																	32932169		2030	4188	6218	32907173	SO:0001819	synonymous_variant	131405				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1473C>T	3.37:g.32932169C>T			32907173		Silent	SNP	ENST00000383763.5	37	CCDS43060.1	SNP	27	Baylor																																																																																				0.587	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		Silent
TROVE2	6738	hgsc.bcm.edu	37	1	193050603	193050603	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0793-01	TCGA-13-0793-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr1:193050603T>C	ENST00000367446.3	+	6	1406	c.1196T>C	c.(1195-1197)aTg>aCg	p.M399T	TROVE2_ENST00000432079.1_Missense_Mutation_p.M124T|TROVE2_ENST00000367444.3_Missense_Mutation_p.M399T|TROVE2_ENST00000416058.2_Missense_Mutation_p.M124T|TROVE2_ENST00000367441.1_Missense_Mutation_p.M399T|TROVE2_ENST00000400968.2_Missense_Mutation_p.M399T|TROVE2_ENST00000367443.1_Missense_Mutation_p.M399T|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367445.3_Missense_Mutation_p.M399T	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	399	VWFA-like domain. {ECO:0000250}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						GCTGCAGCAATGTGCATGGTG	0.353																																																0			1											90.0	80.0	83.0					1																	193050603		1863	4106	5969	191317226	SO:0001583	missense	6738			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.1196T>C	1.37:g.193050603T>C	ENSP00000356416:p.Met399Thr		191317226	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	37	CCDS1379.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.08	3.758674	0.69763	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	.	.	.	5.33	5.33	0.75918	.	0.076132	0.85682	D	0.000000	T	0.80481	0.4631	M	0.83483	2.645	0.50813	D	0.999898	D;D;D;D	0.71674	0.998;0.998;0.996;0.99	D;D;D;D	0.91635	0.999;0.999;0.994;0.992	T	0.82530	-0.0411	9	0.51188	T	0.08	-1.4377	15.5928	0.76550	0.0:0.0:0.0:1.0	.	399;399;399;399	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	T	399;124;399;399;399;399;399	.	ENSP00000356411:M399T	M	+	2	0	TROVE2	191317226	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.358000	0.73055	2.134000	0.65973	0.455000	0.32223	ATG		0.353	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600		Missense_Mutation
XPO7	23039	hgsc.bcm.edu	37	8	21856607	21856607	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr8:21856607C>T	ENST00000252512.9	+	23	2534	c.2434C>T	c.(2434-2436)Cgc>Tgc	p.R812C	XPO7_ENST00000434536.1_Missense_Mutation_p.R821C|XPO7_ENST00000433566.4_Missense_Mutation_p.R813C	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	812					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)	p.R812C(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CTCAGGCAATCGCATCCTGAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	8											174.0	164.0	167.0					8																	21856607		2013	4189	6202	21912553	SO:0001583	missense	23039			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.2434C>T	8.37:g.21856607C>T	ENSP00000252512:p.Arg812Cys		21912553	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	37	CCDS47818.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436565	0.62955	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.64085	-0.08;-0.08;-0.08	5.87	5.87	0.94306	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	L	0.58510	1.815	0.80722	D	1	B;B;B	0.29481	0.11;0.245;0.245	B;B;B	0.23852	0.032;0.049;0.049	T	0.54964	-0.8214	10	0.36615	T	0.2	-11.3613	14.6251	0.68616	0.1457:0.8543:0.0:0.0	.	813;821;812	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	C	821;812;813	ENSP00000404853:R821C;ENSP00000252512:R812C;ENSP00000410249:R813C	ENSP00000252512:R812C	R	+	1	0	XPO7	21912553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.930000	0.70104	2.779000	0.95612	0.655000	0.94253	CGC		0.478	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024		Missense_Mutation
ZSCAN31	64288	hgsc.bcm.edu	37	6	28294632	28294632	+	Splice_Site	SNP	C	C	T			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:28294632C>T	ENST00000414429.1	-	8	1436		c.e8-1		ZSCAN31_ENST00000481934.1_5'Flank|ZSCAN31_ENST00000439158.1_Splice_Site|ZSCAN31_ENST00000344279.6_Splice_Site|ZSCAN31_ENST00000446474.1_Splice_Site|ZSCAN31_ENST00000396838.2_Splice_Site			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)									CTTTCACCATCTGGAATAATA	0.348																																																1	Unknown(1)	ovary(1)	6											39.0	42.0	41.0					6																	28294632		2194	4289	6483	28402611	SO:0001630	splice_region_variant	64288				CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.533-1G>A	6.37:g.28294632C>T			28402611	Q6P178|Q8WWS5	Splice_Site_SNP	SNP	ENST00000414429.1	37	CCDS4649.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424037	0.62733	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000446474;ENST00000344279;ENST00000435857;ENST00000414431;ENST00000453745;ENST00000426434	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0127	0.36150	0.0:0.8981:0.0:0.1019	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF323	28402611	.	.	0.157000	0.22605	0.729000	0.41735	.	.	2.174000	0.68829	0.467000	0.42956	.		0.348	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346804.1	NM_030899	Intron	Splice_Site_SNP
MOG	4340	hgsc.bcm.edu	37	6	29640709	29640709	+	IGR	SNP	A	A	G			TCGA-13-0793-01	TCGA-13-0793-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr6:29640709A>G	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Silent_p.F373F|ZFP57_ENST00000376881.3_Silent_p.F373F|ZFP57_ENST00000488757.1_Silent_p.F393F	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F373F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						ATTTCTTGCTAAAAGTCAAAG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	6											307.0	333.0	324.0					6																	29640709		1256	2555	3811	29748688	SO:0001628	intergenic_variant	346171				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640709A>G			29748688	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	CCDS34370.1	SNP	13	Baylor																																																																																				0.502	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		Silent
ZNF592	9640	hgsc.bcm.edu	37	15	85342375	85342375	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0793-01	TCGA-13-0793-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0793-01	TCGA-13-0793-10	g.chr15:85342375C>A	ENST00000560079.2	+	9	3359	c.3071C>A	c.(3070-3072)aCc>aAc	p.T1024N	ZNF592_ENST00000299927.3_Missense_Mutation_p.T1024N	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1024					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1024N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCCTTCCACACCCCCAACAGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	15											254.0	230.0	238.0					15																	85342375		2203	4299	6502	83143379	SO:0001583	missense	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3071C>A	15.37:g.85342375C>A	ENSP00000452877:p.Thr1024Asn		83143379	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943187	0.53079	.	.	ENSG00000166716	ENST00000299927	T	0.53206	0.63	5.07	4.13	0.48395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.170486	0.53938	N	0.000057	T	0.30386	0.0763	N	0.13198	0.31	0.32130	N	0.586896	B	0.10296	0.003	B	0.09377	0.004	T	0.29274	-1.0017	10	0.37606	T	0.19	-19.2852	12.1911	0.54273	0.178:0.822:0.0:0.0	.	1024	Q92610	ZN592_HUMAN	N	1024	ENSP00000299927:T1024N	ENSP00000299927:T1024N	T	+	2	0	ZNF592	83143379	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.747000	0.62141	1.292000	0.44672	0.655000	0.94253	ACC		0.527	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		Missense_Mutation
