#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
OR51A4	401666	genome.wustl.edu	37	11	4967682	4967682	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr11:4967682C>A	ENST00000380373.2	-	1	674	c.649G>T	c.(649-651)Gtg>Ttg	p.V217L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V217L(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGTAAGACACAGCAATGAGA	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											75.0	67.0	69.0					11																	4967682		2201	4294	6495	4924258	SO:0001583	missense	401666			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.649G>T	11.37:g.4967682C>A	ENSP00000369731:p.Val217Leu		4924258		Missense_Mutation	SNP	ENST00000380373.2	37	CCDS31367.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.175997	0.00312	.	.	ENSG00000205497	ENST00000380373	T	0.38240	1.15	3.44	-3.12	0.05282	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17492	0.0420	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.38585	-0.9654	9	0.02654	T	1	.	10.1718	0.42915	0.0:0.3966:0.0:0.6034	.	217	Q8NGJ6	O51A4_HUMAN	L	217	ENSP00000369731:V217L	ENSP00000369731:V217L	V	-	1	0	OR51A4	4924258	0.000000	0.05858	0.000000	0.03702	0.502000	0.33828	-2.840000	0.00738	-0.616000	0.05671	0.479000	0.44913	GTG		0.428	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		Missense_Mutation
EMR1	2015	genome.wustl.edu	37	19	6926553	6926553	+	Silent	SNP	G	G	A	rs150705433		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:6926553G>A	ENST00000312053.4	+	16	2200	c.2163G>A	c.(2161-2163)ccG>ccA	p.P721P	EMR1_ENST00000381407.5_Silent_p.P580P|EMR1_ENST00000450315.3_Silent_p.P544P|EMR1_ENST00000250572.8_Silent_p.P656P|EMR1_ENST00000381404.4_Silent_p.P669P	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	721					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.P721P(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					ATGGGCTGCCGATGCTGGTGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	19						G		1,4405	2.1+/-5.4	0,1,2202	187.0	154.0	165.0		2163	0.3	0.0	19	dbSNP_134	165	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EMR1	NM_001974.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		721/887	6926553	2,13004	2203	4300	6503	6877553	SO:0001819	synonymous_variant	2015			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2163G>A	19.37:g.6926553G>A			6877553	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	ENST00000312053.4	37	CCDS12175.1	SNP	37	WashU																																																																																				0.512	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			Silent
TP53	7157	genome.wustl.edu	37	17	7578535	7578535	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0800-01	TCGA-13-0800-10	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr17:7578535T>A	ENST00000269305.4	-	5	584	c.395A>T	c.(394-396)aAg>aTg	p.K132M	TP53_ENST00000413465.2_Missense_Mutation_p.K132M|TP53_ENST00000359597.4_Missense_Mutation_p.K132M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.K132M|TP53_ENST00000455263.2_Missense_Mutation_p.K132M|TP53_ENST00000420246.2_Missense_Mutation_p.K132M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132R(42)|p.K132M(10)|p.0?(8)|p.K132T(7)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K39R(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132W(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.K39T(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAAACATCTTGTTGAGGGC	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	90	Substitution - Missense(64)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(5)	lung(15)|ovary(12)|large_intestine(11)|central_nervous_system(8)|oesophagus(7)|breast(5)|bone(5)|upper_aerodigestive_tract(4)|biliary_tract(4)|urinary_tract(4)|haematopoietic_and_lymphoid_tissue(3)|adrenal_gland(2)|kidney(2)|prostate(2)|liver(2)|stomach(1)|endometrium(1)|skin(1)|pancreas(1)	17											46.0	47.0	47.0					17																	7578535		2203	4300	6503	7519260	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.395A>T	17.37:g.7578535T>A	ENSP00000269305:p.Lys132Met		7519260	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	19.25	3.791136	0.70452	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	5.48	4.41	0.53225	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	M	0.87547	2.89	0.80722	D	1	D;D;D;D;D;P;D	0.89917	0.989;0.99;0.999;1.0;0.992;0.908;1.0	D;P;D;D;D;P;D	0.97110	0.952;0.875;0.997;0.998;0.923;0.837;1.0	D	0.97314	0.9939	10	0.87932	D	0	-14.0777	9.8103	0.40820	0.0:0.082:0.0:0.918	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132M;ENSP00000352610:K132M;ENSP00000269305:K132M;ENSP00000398846:K132M;ENSP00000391127:K132M;ENSP00000391478:K132M;ENSP00000423862:K39M;ENSP00000424104:K132M	ENSP00000269305:K132M	K	-	2	0	TP53	7519260	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	7.993000	0.88291	1.020000	0.39573	-0.256000	0.11100	AAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
PNPLA6	10908	genome.wustl.edu	37	19	7614842	7614842	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:7614842G>A	ENST00000221249.6	+	17	1972	c.1541G>A	c.(1540-1542)cGc>cAc	p.R514H	PNPLA6_ENST00000450331.3_Missense_Mutation_p.R514H|PNPLA6_ENST00000545201.2_Missense_Mutation_p.R488H|PNPLA6_ENST00000594864.1_3'UTR|PNPLA6_ENST00000414982.3_Missense_Mutation_p.R562H|PNPLA6_ENST00000600737.1_Missense_Mutation_p.R553H	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	553					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)	p.R514H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GTGTACCAGCGCATGATCGAC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											98.0	80.0	86.0					19																	7614842		2203	4300	6503	7520842	SO:0001583	missense	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.1541G>A	19.37:g.7614842G>A	ENSP00000221249:p.Arg514His		7520842	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.086627	0.94100	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.17	5.17	0.71159	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.058070	0.64402	D	0.000003	D	0.95159	0.8431	M	0.73598	2.24	0.58432	D	0.999994	D;D;D;D	0.65815	0.991;0.989;0.995;0.989	P;P;P;P	0.61940	0.896;0.832;0.873;0.832	D	0.95137	0.8260	10	0.52906	T	0.07	.	16.1907	0.81987	0.0:0.0:1.0:0.0	.	553;488;553;514	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	H	514;488;562;514	ENSP00000221249:R514H;ENSP00000443323:R488H;ENSP00000407509:R562H;ENSP00000394348:R514H	ENSP00000221249:R514H	R	+	2	0	PNPLA6	7520842	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.637000	0.74304	2.410000	0.81850	0.555000	0.69702	CGC		0.642	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702		Missense_Mutation
C19orf57	79173	genome.wustl.edu	37	19	14006340	14006340	+	Silent	SNP	T	T	G			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:14006340T>G	ENST00000586783.1	-	2	50	c.51A>C	c.(49-51)ccA>ccC	p.P17P	C19orf57_ENST00000591586.1_Silent_p.P17P|C19orf57_ENST00000454313.1_Silent_p.P17P|C19orf57_ENST00000346736.2_Silent_p.P17P			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	17					multicellular organismal development (GO:0007275)			p.P17P(1)		breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TTAGGGGTTTTGGAGGACAGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	19											140.0	149.0	146.0					19																	14006340		2203	4300	6503	13867340	SO:0001819	synonymous_variant	79173			BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.51A>C	19.37:g.14006340T>G			13867340	Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	37		SNP	63	WashU																																																																																				0.542	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323		Silent
NBAS	51594	genome.wustl.edu	37	2	15564502	15564502	+	Silent	SNP	C	C	G			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr2:15564502C>G	ENST00000281513.5	-	23	2539	c.2514G>C	c.(2512-2514)acG>acC	p.T838T	NBAS_ENST00000441750.1_Silent_p.T838T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	838					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.T838T(2)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CCTTCTCCACCGTAAGCTGGG	0.478																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	2											198.0	151.0	167.0					2																	15564502		2203	4300	6503	15481953	SO:0001819	synonymous_variant	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2514G>C	2.37:g.15564502C>G			15481953	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	0.242	-1.012616	0.02095	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.37	-10.7	0.00240	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.41538	-0.9503	4	.	.	.	.	3.2258	0.06731	0.1351:0.2405:0.3765:0.2479	.	.	.	.	P	6	.	.	R	-	2	0	NBAS	15481953	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-2.646000	0.00860	-1.959000	0.01018	-1.224000	0.01588	CGG		0.478	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		Silent
SPEN	23013	genome.wustl.edu	37	1	16200828	16200828	+	Intron	SNP	T	T	C			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:16200828T>C	ENST00000375759.3	+	2	608				SPEN_ENST00000471538.1_3'UTR	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGGGAAGTTATGTTCACAATT	0.408																																																0			1											131.0	132.0	132.0					1																	16200828		876	1991	2867	16073415	SO:0001627	intron_variant	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.404+1197T>C	1.37:g.16200828T>C			16073415	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	CCDS164.1	SNP	51	WashU																																																																																				0.408	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		Silent
ZNF493	284443	genome.wustl.edu	37	19	21607383	21607383	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:21607383C>A	ENST00000355504.4	+	2	1804	c.1538C>A	c.(1537-1539)tCc>tAc	p.S513Y	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.S641Y	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S513Y(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TTTAAGCGGTCCTCACACCTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	19											43.0	48.0	46.0					19																	21607383		2199	4292	6491	21399223	SO:0001583	missense	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1538C>A	19.37:g.21607383C>A	ENSP00000347691:p.Ser513Tyr		21399223	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	N	0.011	-1.702619	0.00719	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.07908	3.15;3.15	0.361	-0.721	0.11189	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03348	0.0097	N	0.17800	0.525	0.09310	N	1	P;B	0.41475	0.751;0.322	B;B	0.31869	0.137;0.072	T	0.30909	-0.9962	9	0.32370	T	0.25	.	0.7662	0.01016	0.1929:0.2315:0.3603:0.2154	.	513;641	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	Y	641;513	ENSP00000376110:S641Y;ENSP00000347691:S513Y	ENSP00000347691:S513Y	S	+	2	0	ZNF493	21399223	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.673000	0.01951	-1.959000	0.01018	-2.013000	0.00436	TCC		0.373	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910		Missense_Mutation
HERC2	8924	genome.wustl.edu	37	15	28437274	28437274	+	Missense_Mutation	SNP	G	G	C	rs543946257		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr15:28437274G>C	ENST00000261609.7	-	53	8392	c.8284C>G	c.(8284-8286)Cgt>Ggt	p.R2762G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R2762G(3)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTCCAGAACGGCCACAAAAT	0.493											OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17962	0.0		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	ovary(1)|NS(1)|central_nervous_system(1)	15											97.0	96.0	96.0					15																	28437274		2203	4300	6503	26110869	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8284C>G	15.37:g.28437274G>C	ENSP00000261609:p.Arg2762Gly	801	26110869		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874685	0.72180	.	.	ENSG00000128731	ENST00000261609	T	0.62788	0.0	5.67	5.67	0.87782	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.054132	0.85682	D	0.000000	T	0.77157	0.4089	L	0.53249	1.67	0.80722	D	1	D;D	0.69078	0.997;0.987	D;D	0.76071	0.987;0.953	T	0.77861	-0.2430	10	0.72032	D	0.01	.	19.7646	0.96335	0.0:0.0:1.0:0.0	.	229;2762	A8KAQ8;O95714	.;HERC2_HUMAN	G	2762	ENSP00000261609:R2762G	ENSP00000261609:R2762G	R	-	1	0	HERC2	26110869	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.808000	0.99193	2.675000	0.91044	0.471000	0.43371	CGT		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Missense_Mutation
DMD	1756	genome.wustl.edu	37	X	32663206	32663206	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:32663206C>T	ENST00000357033.4	-	10	1230	c.1024G>A	c.(1024-1026)Gac>Aac	p.D342N	DMD_ENST00000288447.4_Missense_Mutation_p.D334N|DMD_ENST00000378677.2_Missense_Mutation_p.D338N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	342					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D337N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGATAACGGTCCAGGTTTACT	0.393																																																1	Substitution - Missense(1)	ovary(1)	X											194.0	167.0	176.0					X																	32663206		2202	4300	6502	32573127	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1024G>A	X.37:g.32663206C>T	ENSP00000354923:p.Asp342Asn		32573127	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653567	0.88056	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.50548	0.74;0.74;0.74	5.67	5.67	0.87782	.	0.000000	0.38720	U	0.001592	T	0.63768	0.2539	L	0.60455	1.87	0.80722	D	1	P;P;P;P;P	0.52170	0.939;0.939;0.925;0.951;0.939	P;P;P;P;P	0.58660	0.795;0.795;0.621;0.843;0.739	T	0.64935	-0.6290	10	0.66056	D	0.02	.	19.0236	0.92923	0.0:1.0:0.0:0.0	.	338;334;334;342;338	B1AK23;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	N	334;338;342;342;219;334	ENSP00000367948:D338N;ENSP00000354923:D342N;ENSP00000288447:D334N	ENSP00000288447:D334N	D	-	1	0	DMD	32573127	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.783000	0.68982	2.527000	0.85204	0.600000	0.82982	GAC		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Missense_Mutation
RPN2	6185	genome.wustl.edu	37	20	35862472	35862472	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr20:35862472C>T	ENST00000237530.6	+	15	2038	c.1727C>T	c.(1726-1728)aCg>aTg	p.T576M	RPN2_ENST00000373622.5_Missense_Mutation_p.T544M|RPN2_ENST00000470352.1_3'UTR	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	576					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)	p.T576M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GCTCCTAGCACGATTATATTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	20											141.0	119.0	126.0					20																	35862472		2203	4300	6503	35295886	SO:0001583	missense	6185			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1727C>T	20.37:g.35862472C>T	ENSP00000237530:p.Thr576Met		35295886	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	ENST00000237530.6	37	CCDS13291.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342897	0.82022	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000397161;ENST00000373623;ENST00000437329	T;T;T	0.50548	0.74;0.74;0.74	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.67249	0.2873	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.66172	-0.5990	10	0.44086	T	0.13	-8.9984	16.4462	0.83935	0.0:1.0:0.0:0.0	.	544;576	Q5JYR6;P04844	.;RPN2_HUMAN	M	576;544;83;100;83	ENSP00000237530:T576M;ENSP00000362724:T544M;ENSP00000409580:T83M	ENSP00000237530:T576M	T	+	2	0	RPN2	35295886	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.269000	0.65542	2.735000	0.93741	0.655000	0.94253	ACG		0.448	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951		Missense_Mutation
TGM2	7052	genome.wustl.edu	37	20	36779362	36779362	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr20:36779362G>A	ENST00000361475.2	-	4	704	c.531C>T	c.(529-531)aaC>aaT	p.N177N	TGM2_ENST00000536701.1_Silent_p.N96N|TGM2_ENST00000536724.1_Silent_p.N117N	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	177					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.N177N(1)		endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	TCCAAGGTATGTTCTTGATGA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	20											164.0	151.0	156.0					20																	36779362		2203	4300	6503	36212776	SO:0001819	synonymous_variant	7052			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.531C>T	20.37:g.36779362G>A			36212776	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Silent	SNP	ENST00000361475.2	37	CCDS13302.1	SNP	48	WashU																																																																																				0.587	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951		Silent
CEP89	84902	genome.wustl.edu	37	19	33424370	33424370	+	Silent	SNP	C	C	T	rs138753622		TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:33424370C>T	ENST00000305768.5	-	8	961	c.873G>A	c.(871-873)gcG>gcA	p.A291A	CEP89_ENST00000590597.2_Silent_p.A291A	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	291					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.A291A(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CCTGTGACGACGCCTTCTCAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	19						C		1,4405	2.1+/-5.4	0,1,2202	209.0	189.0	196.0		873	-10.2	0.0	19	dbSNP_134	196	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	CEP89	NM_032816.3		0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461		291/784	33424370	6,13000	2203	4300	6503	38116210	SO:0001819	synonymous_variant	84902			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.873G>A	19.37:g.33424370C>T			38116210	B9EGA6|Q8N5J8	Silent	SNP	ENST00000305768.5	37	CCDS32987.1	SNP	19	WashU																																																																																				0.383	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		Silent
DNAH8	1769	genome.wustl.edu	37	6	38877311	38877311	+	Silent	SNP	T	T	C			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr6:38877311T>C	ENST00000359357.3	+	63	9134	c.8880T>C	c.(8878-8880)cgT>cgC	p.R2960R	DNAH8_ENST00000449981.2_Silent_p.R3177R|DNAH8_ENST00000441566.1_Silent_p.R2924R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2960	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2960R(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGAAGTTCCGTGCCCGTTCTT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	6											143.0	132.0	136.0					6																	38877311		2203	4300	6503	38985289	SO:0001819	synonymous_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8880T>C	6.37:g.38877311T>C			38985289	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37		SNP	59	WashU																																																																																				0.478	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		Silent
PTPRT	11122	genome.wustl.edu	37	20	41306562	41306562	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr20:41306562C>A	ENST00000373187.1	-	7	1096	c.1097G>T	c.(1096-1098)gGt>gTt	p.G366V	PTPRT_ENST00000373201.1_Missense_Mutation_p.G366V|PTPRT_ENST00000373193.3_Missense_Mutation_p.G366V|PTPRT_ENST00000356100.2_Missense_Mutation_p.G366V|PTPRT_ENST00000373184.1_Missense_Mutation_p.G366V|PTPRT_ENST00000373190.1_Missense_Mutation_p.G366V|PTPRT_ENST00000373198.4_Missense_Mutation_p.G366V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	366	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.G366V(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ACCCCCCTCACCTGGTCGTGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											97.0	97.0	97.0					20																	41306562		1941	4140	6081	40739976	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1097G>T	20.37:g.41306562C>A	ENSP00000362283:p.Gly366Val		40739976	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546741	0.86022	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	5.42	5.42	0.78866	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94771	0.8312	M	0.87180	2.865	0.80722	D	1	D;D	0.56968	0.973;0.978	P;P	0.60473	0.802;0.875	D	0.95237	0.8348	10	0.87932	D	0	.	19.1814	0.93625	0.0:1.0:0.0:0.0	.	366;366	O14522-1;O14522	.;PTPRT_HUMAN	V	366	ENSP00000362286:G366V;ENSP00000362283:G366V;ENSP00000362289:G366V;ENSP00000348408:G366V;ENSP00000362294:G366V;ENSP00000362280:G366V;ENSP00000362297:G366V	ENSP00000348408:G366V	G	-	2	0	PTPRT	40739976	1.000000	0.71417	0.974000	0.42286	0.793000	0.44817	7.776000	0.85560	2.705000	0.92388	0.655000	0.94253	GGT		0.562	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Missense_Mutation
TOX2	84969	genome.wustl.edu	37	20	42693489	42693489	+	Intron	SNP	G	G	A	rs142800786		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr20:42693489G>A	ENST00000358131.5	+	6	1114				TOX2_ENST00000341197.4_Missense_Mutation_p.V318I|TOX2_ENST00000372999.1_Missense_Mutation_p.V276I|TOX2_ENST00000423191.2_Missense_Mutation_p.V276I|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2						female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V276I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			GGCTAGCCTCGTCTCCAAGGT	0.577																																																1	Substitution - Missense(1)	ovary(1)	20						G	ILE/VAL,ILE/VAL,ILE/VAL,	1,4405	2.1+/-5.4	0,1,2202	77.0	73.0	74.0		826,952,826,	5.6	1.0	20	dbSNP_134	74	0,8600		0,0,4300	no	missense,missense,missense,intron	TOX2	NM_001098796.1,NM_001098797.1,NM_032883.2,NM_001098798.1	29,29,29,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,	276/465,318/507,276/465,	42693489	1,13005	2203	4300	6503	42126903	SO:0001627	intron_variant	84969			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.907-863G>A	20.37:g.42693489G>A			42126903	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	37	CCDS42875.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.160960	0.94727	2.27E-4	0.0	ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000435864	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.57	5.57	0.84162	.	0.938103	0.08996	N	0.863695	T	0.63977	0.2557	L	0.52206	1.635	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.76071	0.969;0.987;0.959	T	0.57900	-0.7731	10	0.72032	D	0.01	.	18.1263	0.89586	0.0:0.0:1.0:0.0	.	196;318;276	B4DQV8;G3XAC7;E1P5X0	.;.;.	I	318;276;276;196	ENSP00000344724:V318I;ENSP00000390278:V276I;ENSP00000362090:V276I;ENSP00000396777:V196I	ENSP00000344724:V318I	V	+	1	0	TOX2	42126903	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	9.476000	0.97823	2.620000	0.88729	0.563000	0.77884	GTC		0.577	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			Missense_Mutation
BMS1	9790	genome.wustl.edu	37	10	43325850	43325850	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0800-01	TCGA-13-0800-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr10:43325850C>G	ENST00000374518.5	+	22	3661	c.3598C>G	c.(3598-3600)Cgc>Ggc	p.R1200G	RNU6-885P_ENST00000516607.1_RNA	NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1200					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.R1200G(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GGCCGTCATACGCGAGCCTCA	0.512																																																1	Substitution - Missense(1)	ovary(1)	10											54.0	55.0	55.0					10																	43325850		2203	4300	6503	42645856	SO:0001583	missense	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3598C>G	10.37:g.43325850C>G	ENSP00000363642:p.Arg1200Gly		42645856	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029545	0.54790	.	.	ENSG00000165733	ENST00000374518	T	0.25749	1.78	4.78	-1.25	0.09405	.	0.068390	0.53938	D	0.000048	T	0.30103	0.0754	M	0.80183	2.485	0.32229	N	0.57424	P	0.52577	0.954	P	0.45681	0.49	T	0.49818	-0.8899	10	0.25106	T	0.35	.	10.9474	0.47308	0.6134:0.2948:0.0918:0.0	.	1200	Q14692	BMS1_HUMAN	G	1200	ENSP00000363642:R1200G	ENSP00000363642:R1200G	R	+	1	0	BMS1	42645856	0.988000	0.35896	0.828000	0.32881	0.873000	0.50193	1.471000	0.35365	-0.095000	0.12351	0.306000	0.20318	CGC		0.512	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		Missense_Mutation
SLC28A2	9153	genome.wustl.edu	37	15	45555371	45555371	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr15:45555371G>C	ENST00000347644.3	+	5	440	c.375G>C	c.(373-375)aaG>aaC	p.K125N	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	125					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.K125N(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	TTTTGAAAAAGCTCCTGGGCA	0.458																																					NSCLC(92;493 1501 26361 28917 47116)											1	Substitution - Missense(1)	ovary(1)	15											92.0	89.0	90.0					15																	45555371		2198	4298	6496	43342663	SO:0001583	missense	9153			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.375G>C	15.37:g.45555371G>C	ENSP00000315006:p.Lys125Asn		43342663	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	ENST00000347644.3	37	CCDS10121.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	12.49	1.952903	0.34471	.	.	ENSG00000137860	ENST00000347644	T	0.79845	-1.31	5.92	0.661	0.17874	.	0.603852	0.19398	N	0.115249	T	0.72128	0.3422	M	0.66939	2.045	0.09310	N	0.999999	B	0.22800	0.075	B	0.20184	0.028	T	0.57189	-0.7854	10	0.28530	T	0.3	-3.0678	4.4795	0.11760	0.415:0.0:0.4401:0.1449	.	125	O43868	S28A2_HUMAN	N	125	ENSP00000315006:K125N	ENSP00000315006:K125N	K	+	3	2	SLC28A2	43342663	0.794000	0.28838	0.004000	0.12327	0.008000	0.06430	1.131000	0.31406	-0.116000	0.11893	-0.142000	0.14014	AAG		0.458	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212		Missense_Mutation
PRR15L	79170	genome.wustl.edu	37	17	46030313	46030313	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr17:46030313G>C	ENST00000300557.2	-	2	538	c.288C>G	c.(286-288)caC>caG	p.H96Q	RP11-6N17.9_ENST00000582262.1_RNA	NM_024320.3	NP_077296.1	Q9BU68	PR15L_HUMAN	proline rich 15-like	96								p.H96Q(1)		NS(1)|cervix(1)|ovary(1)|pancreas(1)	4						GTCCTTCCTCGTGATCATCAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											156.0	121.0	133.0					17																	46030313		2203	4300	6503	43385312	SO:0001583	missense	79170			BC002865	CCDS11523.1	17q21.32	2009-11-11	2009-11-11	2009-11-11		ENSG00000167183			28149	protein-coding gene	gene with protein product			"""ATPase family, AAA domain containing 4"""	ATAD4			Standard	NM_024320		Approved	MGC11242	uc002imp.4	Q9BU68		ENST00000300557.2:c.288C>G	17.37:g.46030313G>C	ENSP00000300557:p.His96Gln		43385312	D3DTU0	Missense_Mutation	SNP	ENST00000300557.2	37	CCDS11523.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	0.047	-1.263394	0.01445	.	.	ENSG00000167183	ENST00000300557	.	.	.	5.58	-3.0	0.05480	.	1.558370	0.03307	N	0.189986	T	0.18425	0.0442	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08086	-1.0739	9	0.13108	T	0.6	-4.1372	0.214	0.00159	0.2414:0.1834:0.2545:0.3207	.	96	Q9BU68	PR15L_HUMAN	Q	96	.	ENSP00000300557:H96Q	H	-	3	2	PRR15L	43385312	0.010000	0.17322	0.035000	0.18076	0.064000	0.16182	0.026000	0.13599	-0.242000	0.09667	-0.839000	0.03059	CAC		0.557	PRR15L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441413.1	NM_024320		Missense_Mutation
HECW1	23072	genome.wustl.edu	37	7	43591887	43591887	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr7:43591887G>A	ENST00000395891.2	+	28	5067	c.4462G>A	c.(4462-4464)Gcg>Acg	p.A1488T	HECW1_ENST00000453890.1_Missense_Mutation_p.A1454T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1488	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A1467T(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGCTGGCACCGCGGAAATCGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	7											121.0	126.0	124.0					7																	43591887		2034	4183	6217	43558412	SO:0001583	missense	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4462G>A	7.37:g.43591887G>A	ENSP00000379228:p.Ala1488Thr		43558412	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.723071	0.96847	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.41400	1.0;1.0	5.81	5.81	0.92471	HECT (4);	0.050915	0.85682	D	0.000000	T	0.53753	0.1816	L	0.42744	1.35	0.80722	D	1	D;D	0.58970	0.984;0.973	P;P	0.55087	0.615;0.768	T	0.53711	-0.8400	10	0.87932	D	0	.	20.0628	0.97684	0.0:0.0:1.0:0.0	.	1454;1488	B4DH42;Q76N89	.;HECW1_HUMAN	T	1488;1454;1488	ENSP00000379228:A1488T;ENSP00000407774:A1454T	ENSP00000265522:A1488T	A	+	1	0	HECW1	43558412	1.000000	0.71417	0.607000	0.28956	0.960000	0.62799	9.414000	0.97362	2.745000	0.94114	0.655000	0.94253	GCG		0.532	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		Missense_Mutation
CYP2A7P1	1550	genome.wustl.edu	37	19	41533097	41533097	+	IGR	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:41533097C>T								CYP2B6 (8794 upstream) : CYP2A13 (61279 downstream)														p.D85N(1)									TTGACGGCATCATGTCCGCAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19																																								46224937	SO:0001628	intergenic_variant																																19.37:g.41533097C>T			46224937		Missense_Mutation	SNP		37		SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	c	17.12	3.307989	0.60305	.	.	ENSG00000213908	ENST00000301171	.	.	.	3.62	2.45	0.29901	.	0.444427	0.23300	U	0.049695	T	0.57330	0.2046	.	.	.	0.09310	N	1.0	.	.	.	.	.	.	T	0.70568	-0.4836	5	0.62326	D	0.03	.	10.1351	0.42701	0.0:0.5566:0.4433:0.0	.	.	.	.	N	81	.	ENSP00000301171:D81N	D	-	1	0	CYP2A7P1	46224937	0.074000	0.21230	0.008000	0.14137	0.006000	0.05464	0.895000	0.28363	1.705000	0.51264	0.411000	0.27672	GAT	0	0.632									Missense_Mutation
CYP2A7P1	1550	genome.wustl.edu	37	19	41533544	41533544	+	IGR	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:41533544C>T								CYP2B6 (9241 upstream) : CYP2A13 (60832 downstream)														p.K28K(1)									TCCCCCTGCTCTTCCTCTGCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	19																																								46225384	SO:0001628	intergenic_variant																																19.37:g.41533544C>T			46225384		Silent	SNP		37		SNP	32	WashU																																																																																			0	0.547									Silent
ZNF674	641339	genome.wustl.edu	37	X	46360298	46360298	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0800-01	TCGA-13-0800-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:46360298A>T	ENST00000523374.1	-	6	936	c.726T>A	c.(724-726)caT>caA	p.H242Q	ZNF674_ENST00000414387.2_Missense_Mutation_p.H236Q|ZNF674_ENST00000518795.1_5'Flank	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H242Q(1)		breast(2)	2						GAGTTCTTTGATGTACAACTA	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											12.0	10.0	11.0					X																	46360298		1811	3991	5802	46245242	SO:0001583	missense	641339			AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.726T>A	X.37:g.46360298A>T	ENSP00000429148:p.His242Gln		46245242	B4DHE2|E9PHQ4	Missense_Mutation	SNP	ENST00000523374.1	37	CCDS48099.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	13.68	2.308900	0.40895	.	.	ENSG00000251192	ENST00000523374;ENST00000414387	D;D	0.86865	-2.18;-2.18	2.13	-0.356	0.12583	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94152	0.8124	H	0.96518	3.835	0.21802	N	0.999532	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84814	0.0792	9	0.87932	D	0	.	5.6916	0.17833	0.4645:0.0:0.5355:0.0	.	236;242	E9PHQ4;Q2M3X9	.;ZN674_HUMAN	Q	242;236	ENSP00000429148:H242Q;ENSP00000428248:H236Q	ENSP00000428248:H236Q	H	-	3	2	ZNF674	46245242	0.199000	0.23386	0.920000	0.36463	0.787000	0.44495	0.087000	0.14958	-0.156000	0.11079	0.430000	0.28490	CAT		0.423	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891		Missense_Mutation
LARP4	113251	genome.wustl.edu	37	12	50860751	50860751	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr12:50860751C>T	ENST00000398473.2	+	13	1505	c.1393C>T	c.(1393-1395)Cct>Tct	p.P465S	LARP4_ENST00000429001.3_Missense_Mutation_p.P471S|LARP4_ENST00000518444.1_Missense_Mutation_p.P464S|LARP4_ENST00000347328.5_Missense_Mutation_p.P394S|LARP4_ENST00000293618.8_Missense_Mutation_p.P394S	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	465					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.P465S(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						GAGACCTCATCCTTCAACAGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	12											119.0	108.0	112.0					12																	50860751		1854	4100	5954	49147018	SO:0001583	missense	113251			AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1393C>T	12.37:g.50860751C>T	ENSP00000381490:p.Pro465Ser		49147018	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	6.088	0.384462	0.11524	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	4.99	1.87	0.25490	.	0.165332	0.53938	N	0.000043	T	0.19406	0.0466	L	0.34521	1.04	0.49051	D	0.999746	B;B;B;B;B;B	0.16802	0.009;0.002;0.001;0.006;0.009;0.019	B;B;B;B;B;B	0.23419	0.033;0.046;0.009;0.012;0.04;0.023	T	0.17531	-1.0366	10	0.02654	T	1	.	4.7231	0.12927	0.1478:0.5917:0.0:0.2605	.	366;464;394;394;465;471	Q71RC2-2;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;LARP4_HUMAN;.	S	394;471;465;464;366;394	ENSP00000293618:P394S;ENSP00000415464:P471S;ENSP00000381490:P465S;ENSP00000429077:P464S;ENSP00000340901:P394S	ENSP00000293618:P394S	P	+	1	0	LARP4	49147018	0.763000	0.28462	0.736000	0.30914	0.687000	0.40016	1.360000	0.34125	0.248000	0.21435	0.455000	0.32223	CCT		0.393	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879		Missense_Mutation
CEACAM16	388551	genome.wustl.edu	37	19	45202714	45202714	+	Intron	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:45202714G>C	ENST00000587331.1	+	1	119				CTB-171A8.1_ENST00000590796.1_RNA|CEACAM16_ENST00000405314.2_5'Flank	NM_001039213.2	NP_001034302.2	Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16						sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)		p.L61F(3)		endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				ttttTTTTTTGAGATGGAGTT	0.478																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	19											46.0	55.0	52.0					19																	45202714		960	2101	3061	49894554	SO:0001627	intron_variant	388551				CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000587331.1:c.-97+175G>C	19.37:g.45202714G>C			49894554	A7LI12	Missense_Mutation	SNP	ENST00000587331.1	37	CCDS54278.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	4.204	0.036659	0.08148	.	.	ENSG00000213892	ENST00000396750	.	.	.	.	.	.	.	.	.	.	.	T	0.28599	0.0708	.	.	.	0.20307	N	0.999915	B	0.02656	0.0	B	0.01281	0.0	T	0.26643	-1.0097	5	0.66056	D	0.02	.	.	.	.	.	55	Q2WEN9	CEA16_HUMAN	F	61	.	ENSP00000379974:L61F	L	+	3	2	CEACAM16	49894554	0.103000	0.21917	0.322000	0.25334	0.206000	0.24218	0.170000	0.16663	0.119000	0.18210	0.121000	0.15741	TTG		0.478	CEACAM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322986.2	XM_371177		Missense_Mutation
ITGA7	3679	genome.wustl.edu	37	12	56086982	56086982	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr12:56086982G>A	ENST00000555728.1	-	21	2815	c.2787C>T	c.(2785-2787)ggC>ggT	p.G929G	ITGA7_ENST00000257880.7_Silent_p.G929G|ITGA7_ENST00000347027.6_Silent_p.G879G|ITGA7_ENST00000257879.6_Silent_p.G885G|ITGA7_ENST00000394229.2_Silent_p.G885G|ITGA7_ENST00000452168.2_Silent_p.G792G|ITGA7_ENST00000553804.1_Silent_p.G889G|ITGA7_ENST00000394230.2_Silent_p.G889G			Q13683	ITA7_HUMAN	integrin, alpha 7	929					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.G885G(2)|p.G889G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCCCCTGCCCGCCCTCCAGCT	0.602																																																3	Substitution - coding silent(3)	lung(2)|ovary(1)	12											57.0	59.0	58.0					12																	56086982		2203	4300	6503	54373249	SO:0001819	synonymous_variant	3679				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2787C>T	12.37:g.56086982G>A			54373249	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	ENST00000555728.1	37		SNP	38	WashU																																																																																				0.602	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206		Silent
MYBPC2	4606	genome.wustl.edu	37	19	50939920	50939920	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:50939920G>A	ENST00000357701.5	+	5	443	c.392G>A	c.(391-393)cGt>cAt	p.R131H		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	131	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R131H(1)		breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CTGGGGGACCGTGGGTATTAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											105.0	104.0	104.0					19																	50939920		2040	4164	6204	55631732	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.392G>A	19.37:g.50939920G>A	ENSP00000350332:p.Arg131His		55631732	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	.	13.99	2.402999	0.42613	.	.	ENSG00000086967	ENST00000357701	T	0.67345	-0.26	3.24	3.24	0.37175	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.480353	0.14618	U	0.308594	T	0.61515	0.2353	L	0.54323	1.7	0.26891	N	0.967327	P	0.39964	0.697	B	0.41374	0.355	T	0.58978	-0.7540	10	0.66056	D	0.02	.	8.4179	0.32683	0.1163:0.0:0.8837:0.0	.	131	Q14324	MYPC2_HUMAN	H	131	ENSP00000350332:R131H	ENSP00000350332:R131H	R	+	2	0	MYBPC2	55631732	0.993000	0.37304	0.979000	0.43373	0.554000	0.35429	2.350000	0.44063	2.142000	0.66516	0.450000	0.29827	CGT		0.627	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519347	52519347	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519347G>A	ENST00000270649.6	-	5	2048	c.1504C>T	c.(1504-1506)Cag>Tag	p.Q502*	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGAATTCTCTGATGGGTAATG	0.418																																																0			19											153.0	145.0	148.0					19																	52519347		2203	4300	6503	57211159	SO:0001587	stop_gained	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1504C>T	19.37:g.52519347G>A	ENSP00000270649:p.Gln502*		57211159	Q494T8|Q8TCF4|Q9BSN8	Nonsense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	40	7.996602	0.98602	.	.	ENSG00000142556	ENST00000270649	.	.	.	3.45	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	7.976	0.30155	0.1177:0.0:0.8823:0.0	.	.	.	.	X	502	.	ENSP00000270649:Q502X	Q	-	1	0	ZNF614	57211159	0.000000	0.05858	0.955000	0.39395	0.961000	0.63080	0.174000	0.16743	1.747000	0.51819	0.563000	0.77884	CAG		0.418	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Nonsense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519422	52519422	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519422G>A	ENST00000270649.6	-	5	1973	c.1429C>T	c.(1429-1431)Cat>Tat	p.H477Y	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTTCCTGTATGACATCTCTCA	0.413																																																0			19											150.0	137.0	142.0					19																	52519422		2203	4300	6503	57211234	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1429C>T	19.37:g.52519422G>A	ENSP00000270649:p.His477Tyr		57211234	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	19.14	3.768905	0.69878	.	.	ENSG00000142556	ENST00000270649	T	0.67523	-0.27	3.45	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84871	0.5568	M	0.94063	3.49	0.30839	N	0.735851	D	0.76494	0.999	D	0.79108	0.992	D	0.84162	0.0429	9	0.87932	D	0	.	11.9382	0.52886	0.0:0.0:1.0:0.0	.	477	Q8N883	ZN614_HUMAN	Y	477	ENSP00000270649:H477Y	ENSP00000270649:H477Y	H	-	1	0	ZNF614	57211234	1.000000	0.71417	0.165000	0.22776	0.988000	0.76386	8.012000	0.88631	1.747000	0.51819	0.563000	0.77884	CAT		0.413	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519695	52519695	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519695G>C	ENST00000270649.6	-	5	1700	c.1156C>G	c.(1156-1158)Ctc>Gtc	p.L386V	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGTACAATGAGATTGCTCTTC	0.448																																																0			19											155.0	142.0	147.0					19																	52519695		2203	4300	6503	57211507	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1156C>G	19.37:g.52519695G>C	ENSP00000270649:p.Leu386Val		57211507	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363096	0.41902	.	.	ENSG00000142556	ENST00000270649	T	0.52983	0.64	3.49	3.49	0.39957	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65595	0.2706	M	0.63428	1.95	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.56661	-0.7942	9	0.87932	D	0	.	13.9319	0.64001	0.0:0.0:1.0:0.0	.	386	Q8N883	ZN614_HUMAN	V	386	ENSP00000270649:L386V	ENSP00000270649:L386V	L	-	1	0	ZNF614	57211507	0.972000	0.33761	0.038000	0.18304	0.948000	0.59901	2.145000	0.42207	1.770000	0.52166	0.563000	0.77884	CTC		0.448	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519779	52519779	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519779G>C	ENST00000270649.6	-	5	1616	c.1072C>G	c.(1072-1074)Ctt>Gtt	p.L358V	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGTACAACAAGATAGCGCTTC	0.438																																																0			19											132.0	122.0	126.0					19																	52519779		2203	4300	6503	57211591	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1072C>G	19.37:g.52519779G>C	ENSP00000270649:p.Leu358Val		57211591	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608403	0.28623	.	.	ENSG00000142556	ENST00000270649	T	0.52983	0.64	3.8	3.8	0.43715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.70692	0.3253	M	0.83384	2.64	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.62562	-0.6828	9	0.59425	D	0.04	.	14.6203	0.68579	0.0:0.0:1.0:0.0	.	358	Q8N883	ZN614_HUMAN	V	358	ENSP00000270649:L358V	ENSP00000270649:L358V	L	-	1	0	ZNF614	57211591	0.998000	0.40836	0.616000	0.29078	0.993000	0.82548	2.893000	0.48633	1.940000	0.56252	0.655000	0.94253	CTT		0.438	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52520435	52520435	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52520435G>C	ENST00000270649.6	-	5	960	c.416C>G	c.(415-417)tCa>tGa	p.S139*	ZNF614_ENST00000356322.6_Nonsense_Mutation_p.S139*	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S139*(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACTTAAACTTGATTTCAAATT	0.328																																																1	Substitution - Nonsense(1)	ovary(1)	19											90.0	85.0	87.0					19																	52520435		2203	4299	6502	57212247	SO:0001587	stop_gained	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.416C>G	19.37:g.52520435G>C	ENSP00000270649:p.Ser139*		57212247	Q494T8|Q8TCF4|Q9BSN8	Nonsense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.859516	0.97036	.	.	ENSG00000142556	ENST00000356322;ENST00000270649	.	.	.	3.53	1.24	0.21308	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	5.5131	0.16892	0.1185:0.0:0.6808:0.2006	.	.	.	.	X	139	.	ENSP00000270649:S139X	S	-	2	0	ZNF614	57212247	0.053000	0.20554	0.016000	0.15963	0.303000	0.27691	1.765000	0.38481	1.798000	0.52647	0.591000	0.81541	TCA		0.328	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Nonsense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52520559	52520559	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52520559G>A	ENST00000270649.6	-	5	836	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L	ZNF614_ENST00000356322.6_Silent_p.L98L	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACGCTCTTCAGAAGTCTTTGG	0.378																																																0			19											61.0	59.0	60.0					19																	52520559		2203	4300	6503	57212371	SO:0001819	synonymous_variant	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.292C>T	19.37:g.52520559G>A			57212371	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	33	WashU																																																																																				0.378	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Silent
TCIRG1	10312	genome.wustl.edu	37	11	67815137	67815137	+	Silent	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr11:67815137C>A	ENST00000265686.3	+	12	1437	c.1329C>A	c.(1327-1329)ggC>ggA	p.G443G	TCIRG1_ENST00000532635.1_Silent_p.G227G	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	443					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.G443G(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TCTTCAGGGGCCGCTACCTGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	11											82.0	92.0	89.0					11																	67815137		2200	4294	6494	67571713	SO:0001819	synonymous_variant	10312			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1329C>A	11.37:g.67815137C>A			67571713	O75877|Q8WVC5	Silent	SNP	ENST00000265686.3	37	CCDS8177.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	9.257	1.042259	0.19748	.	.	ENSG00000110719	ENST00000529364	.	.	.	4.03	-0.137	0.13469	.	.	.	.	.	T	0.41880	0.1178	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21586	-1.0241	4	.	.	.	-29.1321	1.8833	0.03232	0.1457:0.3826:0.2856:0.1862	.	.	.	.	D	247	.	.	A	+	2	0	TCIRG1	67571713	0.406000	0.25344	0.923000	0.36655	0.945000	0.59286	-0.154000	0.10130	-0.219000	0.10003	0.462000	0.41574	GCC		0.637	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		Silent
ARR3	407	genome.wustl.edu	37	X	69502164	69502164	+	IGR	SNP	A	A	G			TCGA-13-0800-01	TCGA-13-0800-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:69502164A>G	ENST00000307959.8	+	0	1292				RAB41_ENST00000276066.4_Missense_Mutation_p.K33E|RAB41_ENST00000374473.2_Missense_Mutation_p.K33E	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)						endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)		p.K33E(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						GTGCAAATCTAAACTCTTATT	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	79.0	86.0					X																	69502164		2203	4300	6503	69418889	SO:0001628	intergenic_variant	347517				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768		X.37:g.69502164A>G			69418889	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	ENST00000307959.8	37	CCDS14399.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	16.79	3.219792	0.58560	.	.	ENSG00000147127	ENST00000374473;ENST00000276066	D;D	0.85861	-2.04;-2.04	4.54	1.99	0.26369	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000060	D	0.93706	0.7989	H	0.97962	4.115	0.09310	N	0.999999	D;D	0.76494	0.997;0.999	D;D	0.83275	0.911;0.996	D	0.85435	0.1151	10	0.87932	D	0	.	5.0074	0.14295	0.743:0.0:0.0936:0.1633	.	33;33	Q5JT25-2;Q5JT25	.;RAB41_HUMAN	E	33	ENSP00000363597:K33E;ENSP00000276066:K33E	ENSP00000276066:K33E	K	+	1	0	RAB41	69418889	1.000000	0.71417	0.000000	0.03702	0.009000	0.06853	3.145000	0.50623	0.172000	0.19760	0.486000	0.48141	AAA		0.557	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312		Missense_Mutation
LGR5	8549	genome.wustl.edu	37	12	71977930	71977930	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr12:71977930C>A	ENST00000266674.5	+	18	2451	c.2140C>A	c.(2140-2142)Cct>Act	p.P714T	LGR5_ENST00000540815.2_Missense_Mutation_p.P690T|LGR5_ENST00000536515.1_Missense_Mutation_p.P642T|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	714					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.P714T(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TCTCTGCCTGCCTTTGCCTTT	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	119.0	121.0					12																	71977930		2203	4300	6503	70264197	SO:0001583	missense	8549			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2140C>A	12.37:g.71977930C>A	ENSP00000266674:p.Pro714Thr		70264197	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	CCDS9000.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	16.85	3.235595	0.58886	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	D;D;D	0.87334	-2.24;-2.24;-2.24	5.85	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	D	0.94046	0.8092	M	0.85462	2.755	0.52501	D	0.999956	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.987	D	0.94979	0.8124	10	0.87932	D	0	.	17.078	0.86591	0.0:0.8732:0.1268:0.0	.	690;714	O75473-2;O75473	.;LGR5_HUMAN	T	714;714;642;690	ENSP00000266674:P714T;ENSP00000443033:P642T;ENSP00000441035:P690T	ENSP00000266674:P714T	P	+	1	0	LGR5	70264197	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	6.063000	0.71162	1.461000	0.47929	0.655000	0.94253	CCT		0.562	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		Missense_Mutation
LLGL2	3993	genome.wustl.edu	37	17	73555350	73555350	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr17:73555350C>G	ENST00000392550.3	+	6	506	c.389C>G	c.(388-390)aCa>aGa	p.T130R	LLGL2_ENST00000375227.4_Missense_Mutation_p.T130R|LLGL2_ENST00000578363.1_Missense_Mutation_p.T130R|LLGL2_ENST00000577200.1_Missense_Mutation_p.T130R|LLGL2_ENST00000167462.5_Missense_Mutation_p.T130R	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	130					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)	p.T130R(1)		NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCCAGTGCCACACAGATCACC	0.632																																																1	Substitution - Missense(1)	ovary(1)	17											59.0	45.0	50.0					17																	73555350		2203	4300	6503	71066945	SO:0001583	missense	3993			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.389C>G	17.37:g.73555350C>G	ENSP00000376333:p.Thr130Arg		71066945	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	13.32	2.203175	0.38905	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000375227;ENST00000545227	T;T;D	0.95980	3.39;3.51;-3.87	5.05	5.05	0.67936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.97526	0.9190	M	0.73962	2.25	0.58432	D	0.999999	D;D;P;D;D	0.89917	0.999;1.0;0.869;0.992;0.999	D;D;P;P;D	0.91635	0.997;0.999;0.731;0.805;0.986	D	0.97936	1.0323	10	0.56958	D	0.05	-0.0239	18.4142	0.90563	0.0:1.0:0.0:0.0	.	119;119;130;130;130	B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3;Q6P1M3-3	.;.;.;L2GL2_HUMAN;.	R	130;130;130;119	ENSP00000167462:T130R;ENSP00000376333:T130R;ENSP00000364375:T130R	ENSP00000167462:T130R	T	+	2	0	LLGL2	71066945	1.000000	0.71417	0.992000	0.48379	0.645000	0.38454	7.170000	0.77587	2.353000	0.79882	0.462000	0.41574	ACA		0.632	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524		Missense_Mutation
TPI1P1	729708	genome.wustl.edu	37	1	77165736	77165736	+	IGR	SNP	G	G	A	rs147974289	byFrequency	TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:77165736G>A								RP5-1102E8.3 (62712 upstream) : AC104458.1 (18088 downstream)																							AAAGACTGCAGAGCCACGTGG	0.547													G|||	9	0.00179712	0.0	0.0	5008	,	,		18289	0.0089		0.0	False		,,,				2504	0.0															0			1																																								76938324	SO:0001628	intergenic_variant	729708																															1.37:g.77165736G>A			76938324		Missense_Mutation	SNP		37		SNP	33	WashU																																																																																			0	0.547									Missense_Mutation
HTR1F	3355	genome.wustl.edu	37	3	88040208	88040208	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr3:88040208C>A	ENST00000319595.4	+	1	363	c.309C>A	c.(307-309)gaC>gaA	p.D103E		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	103	Agonist binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.D103E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TGAGTGTTGACATTACCTGCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											99.0	83.0	88.0					3																	88040208		2203	4300	6503	88122898	SO:0001583	missense	3355			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.309C>A	3.37:g.88040208C>A	ENSP00000322924:p.Asp103Glu		88122898		Missense_Mutation	SNP	ENST00000319595.4	37	CCDS2920.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	15.29	2.791184	0.50102	.	.	ENSG00000179097	ENST00000319595	T	0.37584	1.19	5.31	-2.12	0.07165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61375	0.2342	H	0.94183	3.505	0.40800	D	0.983334	D	0.89917	1.0	D	0.91635	0.999	T	0.61078	-0.7135	10	0.87932	D	0	.	5.9511	0.19246	0.1188:0.4447:0.0:0.4365	.	103	P30939	5HT1F_HUMAN	E	103	ENSP00000322924:D103E	ENSP00000322924:D103E	D	+	3	2	HTR1F	88122898	0.995000	0.38212	0.969000	0.41365	0.794000	0.44872	0.521000	0.22893	-0.504000	0.06577	-1.266000	0.01441	GAC		0.483	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		Missense_Mutation
DCT	1638	genome.wustl.edu	37	13	95131316	95131316	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr13:95131316C>G	ENST00000377028.5	-	1	607	c.194G>C	c.(193-195)cGa>cCa	p.R65P	DCT_ENST00000446125.1_Missense_Mutation_p.R65P	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	65					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)	p.R65P(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TGTGTCGGCTCGCACCTCTGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	13											78.0	68.0	71.0					13																	95131316		2203	4300	6503	93929317	SO:0001583	missense	1638			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.194G>C	13.37:g.95131316C>G	ENSP00000366227:p.Arg65Pro		93929317	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	6.713	0.500280	0.12762	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.83755	-1.76;-1.76	5.22	-2.14	0.07123	.	0.707775	0.14462	N	0.318087	T	0.62514	0.2434	N	0.16790	0.44	0.09310	N	1	B;B	0.24920	0.114;0.095	B;B	0.28465	0.09;0.025	T	0.49523	-0.8931	10	0.29301	T	0.29	-0.0317	1.1692	0.01822	0.2044:0.2127:0.1061:0.4767	.	65;65	Q09GT4;P40126	.;TYRP2_HUMAN	P	65	ENSP00000366227:R65P;ENSP00000392762:R65P	ENSP00000366227:R65P	R	-	2	0	DCT	93929317	0.001000	0.12720	0.003000	0.11579	0.513000	0.34164	-0.107000	0.10873	-0.567000	0.06046	-1.068000	0.02270	CGA		0.602	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			Missense_Mutation
MUC17	140453	genome.wustl.edu	37	7	100676761	100676761	+	Silent	SNP	T	T	C			TCGA-13-0800-01	TCGA-13-0800-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr7:100676761T>C	ENST00000306151.4	+	3	2128	c.2064T>C	c.(2062-2064)acT>acC	p.T688T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	688	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T688T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGGAAGCACTCCATTAACAA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	7											335.0	337.0	337.0					7																	100676761		2203	4300	6503	100463481	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2064T>C	7.37:g.100676761T>C			100463481	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	54	WashU																																																																																				0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
AHNAK2	113146	genome.wustl.edu	37	14	105412703	105412703	+	Missense_Mutation	SNP	C	C	G	rs192951700	byFrequency	TCGA-13-0800-01	TCGA-13-0800-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr14:105412703C>G	ENST00000333244.5	-	7	9204	c.9085G>C	c.(9085-9087)Gag>Cag	p.E3029Q	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3029						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E3029Q(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGGGGGGCTCAATGCTGATG	0.647													.|||	81	0.0161741	0.0008	0.0	5008	,	,		17310	0.0595		0.0	False		,,,				2504	0.0204															1	Substitution - Missense(1)	ovary(1)	14											137.0	144.0	142.0					14																	105412703		1979	4144	6123	104483748	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9085G>C	14.37:g.105412703C>G	ENSP00000353114:p.Glu3029Gln		104483748	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	29	WashU	21	0.009615384615384616	3	0.006097560975609756	2	0.0055248618784530384	15	0.026223776223776224	1	0.0013192612137203166	N	0.070	-1.204107	0.01581	.	.	ENSG00000185567	ENST00000333244	T	0.00642	6.02	4.24	-0.247	0.13019	.	.	.	.	.	T	0.00144	0.0004	N	0.05554	-0.025	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38824	-0.9643	9	0.15499	T	0.54	.	5.0968	0.14737	0.0791:0.3162:0.4257:0.179	.	3029	Q8IVF2	AHNK2_HUMAN	Q	3029	ENSP00000353114:E3029Q	ENSP00000353114:E3029Q	E	-	1	0	AHNAK2	104483748	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.294000	0.00523	-0.043000	0.13513	-0.332000	0.08345	GAG		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Missense_Mutation
FKTN	2218	genome.wustl.edu	37	9	108377632	108377632	+	Missense_Mutation	SNP	C	C	T	rs137951613		TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr9:108377632C>T	ENST00000223528.2	+	7	978	c.854C>T	c.(853-855)gCg>gTg	p.A285V	FKTN_ENST00000540160.1_Intron|FKTN_ENST00000448551.2_Missense_Mutation_p.A285V|FKTN_ENST00000357998.5_Missense_Mutation_p.A285V|FKTN_ENST00000602661.1_Missense_Mutation_p.A285V	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin	285					muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)	p.A285V(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						CAACTAGCAGCGAAAACATTA	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		18291	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											140.0	129.0	133.0					9																	108377632		2203	4300	6503	107417453	SO:0001583	missense	2218				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.854C>T	9.37:g.108377632C>T	ENSP00000223528:p.Ala285Val		107417453	B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Missense_Mutation	SNP	ENST00000223528.2	37	CCDS6766.1	SNP	27	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.22	3.334380	0.60853	.	.	ENSG00000106692	ENST00000223528;ENST00000357998	D;D	0.90844	-2.4;-2.74	6.05	6.05	0.98169	.	0.160384	0.56097	D	0.000035	D	0.86514	0.5951	L	0.48362	1.52	0.80722	D	1	B;B	0.31968	0.349;0.297	B;B	0.18263	0.021;0.015	T	0.83101	-0.0128	10	0.17369	T	0.5	-26.3904	19.5894	0.95501	0.0:1.0:0.0:0.0	.	285;285	B4DUX9;O75072	.;FKTN_HUMAN	V	285	ENSP00000223528:A285V;ENSP00000350687:A285V	ENSP00000223528:A285V	A	+	2	0	FKTN	107417453	0.999000	0.42202	1.000000	0.80357	0.976000	0.68499	4.158000	0.58150	2.878000	0.98634	0.650000	0.86243	GCG		0.393	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053505.1	NM_006731		Missense_Mutation
Unknown	0	genome.wustl.edu	37	X	115882798	115882798	+	IGR	SNP	C	C	G			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:115882798C>G								RP11-232D9.3 (54642 upstream) : RNU6-1323P (102008 downstream)																							tcttatttggcatctttcctt	0.358																																																0			X																																								115766826	SO:0001628	intergenic_variant	653155																															X.37:g.115882798C>G			115766826		Missense_Mutation	SNP		37		SNP	25	WashU																																																																																			0	0.358									Missense_Mutation
FRK	2444	genome.wustl.edu	37	6	116263645	116263645	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr6:116263645G>A	ENST00000606080.1	-	8	1896	c.1450C>T	c.(1450-1452)Cgt>Tgt	p.R484C	FRK_ENST00000538210.1_Missense_Mutation_p.R342C	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	484	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.R484C(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AGTTTCCAACGCAGTGTCTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	135.0	137.0					6																	116263645		2203	4300	6503	116370338	SO:0001583	missense	2444			U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1450C>T	6.37:g.116263645G>A	ENSP00000476145:p.Arg484Cys		116370338	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	6.964	0.547745	0.13312	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.34859	1.34;1.34	5.59	2.85	0.33270	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.644681	0.14692	N	0.304140	T	0.08537	0.0212	L	0.39085	1.19	0.31608	N	0.65184	P	0.40534	0.72	B	0.21708	0.036	T	0.10660	-1.0620	10	0.87932	D	0	.	5.7366	0.18069	0.1968:0.0:0.5656:0.2376	.	484	P42685	FRK_HUMAN	C	484;342	ENSP00000357615:R484C;ENSP00000443075:R342C	ENSP00000357615:R484C	R	-	1	0	FRK	116370338	0.998000	0.40836	0.414000	0.26521	0.183000	0.23260	2.698000	0.47068	0.318000	0.23185	-0.282000	0.10007	CGT		0.383	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031		Missense_Mutation
CFTR	1080	genome.wustl.edu	37	7	117171002	117171002	+	Missense_Mutation	SNP	C	C	A	rs397508516|rs397508520		TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr7:117171002C>A	ENST00000003084.6	+	4	455	c.323C>A	c.(322-324)tCc>tAc	p.S108Y	CFTR_ENST00000454343.1_Missense_Mutation_p.S108Y	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	108	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.S108Y(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	ATCATAGCTTCCTATGACCCG	0.418									Cystic Fibrosis																																							1	Substitution - Missense(1)	ovary(1)	7	GRCh37	CM950236	CFTR	M							92.0	84.0	87.0					7																	117171002		2203	4300	6503	116958238	SO:0001583	missense	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.323C>A	7.37:g.117171002C>A	ENSP00000003084:p.Ser108Tyr		116958238	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039265	0.93630	.	.	ENSG00000001626	ENST00000446805;ENST00000003084;ENST00000454343;ENST00000426809	D;D;D;D	0.99730	-6.56;-2.65;-2.65;-2.9	5.73	5.73	0.89815	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98950	0.9643	N	0.11201	0.11	0.80722	D	1	D	0.56035	0.974	D	0.69142	0.962	D	0.96562	0.9416	10	0.02654	T	1	-10.9954	20.263	0.98456	0.0:1.0:0.0:0.0	.	108	P13569	CFTR_HUMAN	Y	27;108;108;108	ENSP00000417012:S27Y;ENSP00000003084:S108Y;ENSP00000403677:S108Y;ENSP00000389119:S108Y	ENSP00000003084:S108Y	S	+	2	0	CFTR	116958238	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.445000	0.80570	2.868000	0.98415	0.555000	0.69702	TCC		0.418	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492		Missense_Mutation
HINFP	25988	genome.wustl.edu	37	11	119001461	119001461	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr11:119001461G>C	ENST00000350777.2	+	3	271	c.208G>C	c.(208-210)Gaa>Caa	p.E70Q	HINFP_ENST00000527354.1_3'UTR|HINFP_ENST00000527410.1_Missense_Mutation_p.E70Q	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	70					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.E70Q(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTTGTGGCAGGAATGTGGCTT	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											109.0	105.0	107.0					11																	119001461		2200	4295	6495	118506671	SO:0001583	missense	25988			AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.208G>C	11.37:g.119001461G>C	ENSP00000318085:p.Glu70Gln		118506671	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	ENST00000350777.2	37	CCDS8414.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865096	0.71949	.	.	ENSG00000172273	ENST00000350777;ENST00000529988;ENST00000527410;ENST00000532312	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.93	5.02	0.67125	Zinc finger, C2H2-like (1);	0.133138	0.64402	D	0.000002	T	0.43055	0.1230	L	0.54323	1.7	0.41241	D	0.986647	P;P	0.51933	0.949;0.791	P;B	0.48454	0.578;0.419	T	0.36359	-0.9751	10	0.41790	T	0.15	-16.3439	15.3251	0.74154	0.0668:0.0:0.9332:0.0	.	70;70	B4DTN3;Q9BQA5	.;HINFP_HUMAN	Q	70	ENSP00000318085:E70Q;ENSP00000431468:E70Q;ENSP00000436815:E70Q;ENSP00000434574:E70Q	ENSP00000318085:E70Q	E	+	1	0	HINFP	118506671	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.507000	0.81676	1.528000	0.49103	0.655000	0.94253	GAA		0.507	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388201.2	NM_015517		Missense_Mutation
AIFM1	9131	genome.wustl.edu	37	X	129271123	129271123	+	Silent	SNP	G	G	C	rs371944474		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:129271123G>C	ENST00000287295.3	-	10	1235	c.1005C>G	c.(1003-1005)ccC>ccG	p.P335P	AIFM1_ENST00000440263.1_5'UTR|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000346424.2_Silent_p.P48P|AIFM1_ENST00000319908.3_Silent_p.P331P|AIFM1_ENST00000460436.2_5'UTR	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	335	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.P331P(1)|p.P335P(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	TTCCTTTCTCGGGGAAGAGTT	0.468																																																2	Substitution - coding silent(2)	ovary(2)	X											161.0	134.0	143.0					X																	129271123		2203	4300	6503	129098804	SO:0001819	synonymous_variant	9131			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1005C>G	X.37:g.129271123G>C			129098804	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Silent	SNP	ENST00000287295.3	37	CCDS14618.1	SNP	39	WashU																																																																																				0.468	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			Silent
RBMX	27316	genome.wustl.edu	37	X	135957727	135957727	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chrX:135957727T>C	ENST00000320676.7	-	6	713	c.559A>G	c.(559-561)Aga>Gga	p.R187G	RBMX_ENST00000570135.1_Missense_Mutation_p.R52G|RBMX_ENST00000565438.1_Missense_Mutation_p.R59G|RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000431446.3_Silent_p.E78E|RBMX_ENST00000562646.1_Missense_Mutation_p.R187G	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	187	Necessary for the association to nascent RNAPII transcripts and nuclear localization.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R187G(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TAACTATCTCTTCCACGTGAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	61.0	62.0					X																	135957727		2203	4300	6503	135785393	SO:0001583	missense	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.559A>G	X.37:g.135957727T>C	ENSP00000359645:p.Arg187Gly		135785393	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	.	17.02	3.280819	0.59758	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.78481	-1.18	5.6	5.6	0.85130	RBM1CTR (1);	0.000000	0.85682	U	0.000000	D	0.86222	0.5881	.	.	.	0.58432	D	0.999991	B;D	0.63046	0.205;0.992	B;P	0.62885	0.143;0.908	D	0.86667	0.1908	8	.	.	.	.	14.9902	0.71381	0.0:0.0:0.0:1.0	.	187;174	P38159;Q8N8Y7	HNRPG_HUMAN;.	G	187;174	ENSP00000359645:R187G	.	R	-	1	2	RBMX	135785393	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.667000	0.54547	1.990000	0.58119	0.486000	0.48141	AGA		0.383	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139		Missense_Mutation
COL22A1	169044	genome.wustl.edu	37	8	139658913	139658913	+	Missense_Mutation	SNP	G	G	A	rs200450282		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr8:139658913G>A	ENST00000303045.6	-	47	3906	c.3460C>T	c.(3460-3462)Cct>Tct	p.P1154S	COL22A1_ENST00000435777.1_Missense_Mutation_p.P1134S|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1154	Collagen-like 10.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P1154S(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGCCTGGAGGCCCAGCCTCT	0.498										HNSCC(7;0.00092)																																						1	Substitution - Missense(1)	ovary(1)	8											25.0	25.0	25.0					8																	139658913		2203	4295	6498	139728095	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3460C>T	8.37:g.139658913G>A	ENSP00000303153:p.Pro1154Ser		139728095	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	0.648	-0.810720	0.02798	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.96992	-4.2;-4.2	5.45	2.44	0.29823	.	0.427444	0.19785	N	0.106138	D	0.93200	0.7834	M	0.69463	2.115	0.09310	N	0.999999	B;B	0.09022	0.002;0.002	B;B	0.13407	0.003;0.009	T	0.80320	-0.1432	10	0.09843	T	0.71	.	8.7306	0.34496	0.0814:0.2871:0.6315:0.0	.	1134;1154	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	1154;1134;847	ENSP00000303153:P1154S;ENSP00000387655:P1134S	ENSP00000303153:P1154S	P	-	1	0	COL22A1	139728095	0.566000	0.26618	0.038000	0.18304	0.012000	0.07955	1.129000	0.31381	0.751000	0.32900	0.650000	0.86243	CCT		0.498	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Missense_Mutation
SLC25A2	83884	genome.wustl.edu	37	5	140683317	140683317	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr5:140683317G>A	ENST00000239451.4	-	1	295	c.116C>T	c.(115-117)aCg>aTg	p.T39M		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	39					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.T39M(1)		breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	GTCAGGGAACGTCTGCATCTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	5											87.0	84.0	85.0					5																	140683317		2203	4300	6503	140663501	SO:0001583	missense	83884			AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.116C>T	5.37:g.140683317G>A	ENSP00000239451:p.Thr39Met		140663501	Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	ENST00000239451.4	37	CCDS4258.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299583	0.40694	.	.	ENSG00000120329	ENST00000239451	T	0.79352	-1.26	3.84	2.04	0.26737	Mitochondrial carrier domain (2);	0.056319	0.64402	U	0.000001	D	0.86062	0.5843	M	0.83483	2.645	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	D	0.85218	0.1025	10	0.87932	D	0	-17.4561	8.3767	0.32447	0.2018:0.0:0.7982:0.0	.	39	Q9BXI2	ORNT2_HUMAN	M	39	ENSP00000239451:T39M	ENSP00000239451:T39M	T	-	2	0	SLC25A2	140663501	1.000000	0.71417	0.990000	0.47175	0.080000	0.17528	8.676000	0.91199	0.608000	0.30000	-0.237000	0.12165	ACG		0.612	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947		Missense_Mutation
ATR	545	genome.wustl.edu	37	3	142180841	142180841	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr3:142180841T>A	ENST00000350721.4	-	42	7254	c.7133A>T	c.(7132-7134)gAa>gTa	p.E2378V	ATR_ENST00000383101.3_Missense_Mutation_p.E2314V	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2378	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E2378V(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GTTCACCCATTCAATAATCCC	0.338								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	3											148.0	154.0	152.0					3																	142180841		2203	4298	6501	143663531	SO:0001583	missense	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.7133A>T	3.37:g.142180841T>A	ENSP00000343741:p.Glu2378Val		143663531	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	SNP	62	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.9|26.9	4.778121|4.778121	0.90195|0.90195	.|.	.|.	ENSG00000175054|ENSG00000175054	ENST00000350721;ENST00000383101|ENST00000513291	D;D|.	0.86366|.	-2.11;-2.11|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.88937|.	0.6573|.	H|H	0.98276|0.98276	4.19|4.19	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|.	0.93213|.	0.6602|.	10|.	0.87932|.	D|.	0|.	-21.3298|-21.3298	15.6078|15.6078	0.76689|0.76689	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2378|.	Q13535|.	ATR_HUMAN|.	V|C	2378;2314|224	ENSP00000343741:E2378V;ENSP00000372581:E2314V|.	ENSP00000343741:E2378V|.	E|X	-|-	2|3	0|0	ATR|ATR	143663531|143663531	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.997000|7.997000	0.88414|0.88414	2.156000|2.156000	0.67533|0.67533	0.533000|0.533000	0.62120|0.62120	GAA|TGA		0.338	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184		Missense_Mutation
PI4KB	5298	genome.wustl.edu	37	1	151288458	151288458	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0800-01	TCGA-13-0800-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:151288458A>C	ENST00000368873.1	-	2	668	c.500T>G	c.(499-501)tTt>tGt	p.F167C	PI4KB_ENST00000271657.5_Missense_Mutation_p.F179C|PI4KB_ENST00000368872.1_Missense_Mutation_p.F167C|PI4KB_ENST00000368875.2_Missense_Mutation_p.F179C|PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000368874.4_Missense_Mutation_p.F167C			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	167	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.F179C(1)		breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTCGTTGCGAAAGCAGAAGAG	0.478																																					Colon(154;765 1838 9854 28443 37492)											1	Substitution - Missense(1)	ovary(1)	1											92.0	87.0	89.0					1																	151288458		2203	4300	6503	149555082	SO:0001583	missense	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.500T>G	1.37:g.151288458A>C	ENSP00000357867:p.Phe167Cys		149555082	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	19.22	3.786043	0.70337	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872;ENST00000438243	T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.59972	0.2233	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.948;0.991	T	0.66031	-0.6024	10	0.87932	D	0	-11.0401	13.6345	0.62215	1.0:0.0:0.0:0.0	.	167;167;167	E9PIH4;Q9UBF8;Q9UBF8-2	.;PI4KB_HUMAN;.	C	167;179;179;167;167;167	ENSP00000357868:F167C;ENSP00000357869:F179C;ENSP00000271657:F179C;ENSP00000357867:F167C;ENSP00000357866:F167C;ENSP00000394719:F167C	ENSP00000271657:F179C	F	-	2	0	PI4KB	149555082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.036000	0.93758	2.082000	0.62665	0.533000	0.62120	TTT		0.478	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651		Missense_Mutation
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	3											61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		180418785	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			Missense_Mutation
NUAK2	81788	genome.wustl.edu	37	1	205273313	205273313	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:205273313G>A	ENST00000367157.3	-	7	1278	c.1152C>T	c.(1150-1152)gcC>gcT	p.A384A		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.A384A(1)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGAGAGACTGGGCCATGTCAT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											93.0	85.0	88.0					1																	205273313		2203	4300	6503	203539936	SO:0001819	synonymous_variant	81788			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1152C>T	1.37:g.205273313G>A			203539936		Silent	SNP	ENST00000367157.3	37	CCDS1453.1	SNP	43	WashU																																																																																				0.587	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952		Silent
SERPINE2	5270	genome.wustl.edu	37	2	224862979	224862979	+	Missense_Mutation	SNP	C	C	T	rs549448679		TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr2:224862979C>T	ENST00000258405.4	-	3	582	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	SERPINE2_ENST00000409840.3_Missense_Mutation_p.V114M|SERPINE2_ENST00000447280.2_Missense_Mutation_p.V126M|SERPINE2_ENST00000409304.1_Missense_Mutation_p.V114M	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	114					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V114M(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTAACAAACACGGCGTTAGCC	0.403													C|||	1	0.000199681	0.0	0.0	5008	,	,		19580	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											113.0	111.0	112.0					2																	224862979		2203	4300	6503	224571223	SO:0001583	missense	5270			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.340G>A	2.37:g.224862979C>T	ENSP00000258405:p.Val114Met		224571223	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	CCDS2460.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699060	0.30142	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.75	3.49	0.39957	Serpin domain (3);	0.216774	0.48286	N	0.000197	T	0.78027	0.4219	L	0.35593	1.075	0.50813	D	0.999895	B;B	0.29162	0.235;0.235	B;B	0.29353	0.101;0.064	T	0.77153	-0.2692	10	0.56958	D	0.05	.	12.5874	0.56424	0.0:0.8305:0.0:0.1695	.	126;114	B4DIF2;P07093	.;GDN_HUMAN	M	114;114;114;126;114	ENSP00000386412:V114M;ENSP00000258405:V114M;ENSP00000386969:V114M;ENSP00000415786:V126M;ENSP00000408452:V114M	ENSP00000258405:V114M	V	-	1	0	SERPINE2	224571223	0.268000	0.24133	0.854000	0.33618	0.874000	0.50279	0.720000	0.25896	1.309000	0.44985	0.650000	0.86243	GTG		0.403	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216		Missense_Mutation
ANKMY1	51281	genome.wustl.edu	37	2	241463718	241463718	+	Silent	SNP	C	C	T			TCGA-13-0800-01	TCGA-13-0800-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr2:241463718C>T	ENST00000272972.3	-	7	1363	c.1149G>A	c.(1147-1149)gtG>gtA	p.V383V	ANKMY1_ENST00000401804.1_Silent_p.V472V|ANKMY1_ENST00000391987.1_Silent_p.V383V|ANKMY1_ENST00000373320.4_Silent_p.V153V|ANKMY1_ENST00000361678.4_Silent_p.V242V|ANKMY1_ENST00000405002.1_Silent_p.V153V|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000536462.1_Silent_p.V195V|ANKMY1_ENST00000405523.3_Silent_p.V242V|ANKMY1_ENST00000403283.1_Silent_p.V321V|ANKMY1_ENST00000373318.2_Silent_p.V242V	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	383							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AAGGCACGTTCACCTCATAGT	0.527																																																0			2											60.0	61.0	61.0					2																	241463718		2203	4300	6503	241112391	SO:0001819	synonymous_variant	51281			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1149G>A	2.37:g.241463718C>T			241112391	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1	SNP	29	WashU																																																																																				0.527	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844		Silent
KIAA1324	57535	genome.wustl.edu	37	1	109656260	109656260	+	5'Flank	SNP	C	C	A			TCGA-13-0800-01	TCGA-13-0800-10	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:109656260C>A	ENST00000369939.3	+	0	0				C1orf194_ENST00000369948.3_5'Flank|C1orf194_ENST00000369949.4_Missense_Mutation_p.A14S|C1orf194_ENST00000369945.3_5'Flank|KIAA1324_ENST00000529753.1_5'Flank	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324						cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.A14S(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CGTACTGGGGCCTCTTCCAGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	136.0	136.0					1																	109656260		1568	3582	5150	109457783	SO:0001631	upstream_gene_variant	127003			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725		1.37:g.109656260C>A	Exception_encountered		109457783	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	ENST00000369939.3	37	CCDS794.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	7.399	0.632391	0.14322	.	.	ENSG00000179902	ENST00000369949	.	.	.	3.28	1.25	0.21368	.	.	.	.	.	T	0.10895	0.0266	.	.	.	0.20307	N	0.999916	D	0.58268	0.982	P	0.52554	0.702	T	0.06770	-1.0808	7	0.05351	T	0.99	.	9.0617	0.36438	0.0:0.5533:0.4467:0.0	.	14	Q5T5A4-2	.	S	14	.	ENSP00000358965:A14S	A	-	1	0	C1orf194	109457783	0.030000	0.19436	0.009000	0.14445	0.039000	0.13416	0.873000	0.28052	0.356000	0.24157	0.561000	0.74099	GCC		0.542	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775		Missense_Mutation
LMNA	4000	genome.wustl.edu	37	1	156104308	156104308	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0800-01	TCGA-13-0800-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr1:156104308A>G	ENST00000368300.4	+	3	840	c.628A>G	c.(628-630)Atc>Gtc	p.I210V	LMNA_ENST00000448611.2_Missense_Mutation_p.I98V|LMNA_ENST00000392353.3_Missense_Mutation_p.I129V|LMNA_ENST00000368297.1_Missense_Mutation_p.I129V|LMNA_ENST00000473598.2_Missense_Mutation_p.I111V|LMNA_ENST00000368301.2_Missense_Mutation_p.I210V|LMNA_ENST00000347559.2_Missense_Mutation_p.I210V|LMNA_ENST00000361308.4_Missense_Mutation_p.I210V|LMNA_ENST00000368299.3_Missense_Mutation_p.I210V	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	210	Coil 1B.|Rod.		I -> S (in CMD1A; dramatically aberrant localization with almost no nuclear rim staining and increased formation of intranuclear foci). {ECO:0000269|PubMed:20160190}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)	p.I210V(1)		NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					CCAGAAGAACATCTACAGTGA	0.582									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																																							1	Substitution - Missense(1)	ovary(1)	1											79.0	73.0	75.0					1																	156104308		2203	4300	6503	154370932	SO:0001583	missense	4000	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.628A>G	1.37:g.156104308A>G	ENSP00000357283:p.Ile210Val		154370932	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	ENST00000368300.4	37	CCDS1129.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	6.526	0.465322	0.12402	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355;ENST00000448611;ENST00000368297;ENST00000504687;ENST00000473598;ENST00000392353	D;D;D;D;D;D;D;D;D;D	0.88277	-2.36;-1.62;-2.36;-2.36;-2.36;-1.62;-1.62;-1.62;-1.62;-1.62	5.44	5.44	0.79542	Filament (1);	0.000000	0.64402	D	0.000018	T	0.69278	0.3093	N	0.11756	0.17	0.53005	D	0.99996	B;B;B;B;B;B;B	0.29085	0.127;0.116;0.226;0.232;0.116;0.037;0.095	B;B;B;B;B;B;B	0.32393	0.124;0.07;0.124;0.145;0.07;0.042;0.042	T	0.69602	-0.5101	9	.	.	.	.	13.4511	0.61172	1.0:0.0:0.0:0.0	.	98;210;111;129;210;210;210	E7EUI9;Q6UYC3;D6RAQ3;Q5TCI8;P02545;P02545-3;P02545-2	.;.;.;.;LMNA_HUMAN;.;.	V	210;210;210;210;210;210;210;98;129;127;111;129	ENSP00000357284:I210V;ENSP00000292304:I210V;ENSP00000355292:I210V;ENSP00000357283:I210V;ENSP00000357282:I210V;ENSP00000395597:I98V;ENSP00000357280:I129V;ENSP00000426535:I127V;ENSP00000421821:I111V;ENSP00000376164:I129V	.	I	+	1	0	LMNA	154370932	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	3.586000	0.53950	2.059000	0.61396	0.379000	0.24179	ATC		0.582	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519263	52519263	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519263G>A	ENST00000270649.6	-	5	2132	c.1588C>T	c.(1588-1590)Caa>Taa	p.Q530*	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGCGTTCTTTGATGTACATTG	0.428																																																0			19											150.0	137.0	141.0					19																	52519263		2203	4300	6503	57211075	SO:0001587	stop_gained	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1588C>T	19.37:g.52519263G>A	ENSP00000270649:p.Gln530*		57211075	Q494T8|Q8TCF4|Q9BSN8	Nonsense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	38	6.922168	0.97936	.	.	ENSG00000142556	ENST00000270649	.	.	.	3.56	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	14.1002	0.65049	0.0:0.0:1.0:0.0	.	.	.	.	X	530	.	ENSP00000270649:Q530X	Q	-	1	0	ZNF614	57211075	0.001000	0.12720	1.000000	0.80357	0.416000	0.31233	0.868000	0.27982	1.809000	0.52856	0.563000	0.77884	CAA		0.428	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Nonsense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519273	52519273	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519273G>A	ENST00000270649.6	-	5	2122	c.1578C>T	c.(1576-1578)ctC>ctT	p.L526L	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	526					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GATGTACATTGAGTACTGACT	0.418																																																0			19											151.0	137.0	142.0					19																	52519273		2203	4300	6503	57211085	SO:0001819	synonymous_variant	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1578C>T	19.37:g.52519273G>A			57211085	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU																																																																																				0.418	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Silent
ZNF614	80110	genome.wustl.edu	37	19	52519611	52519611	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519611G>A	ENST00000270649.6	-	5	1784	c.1240C>T	c.(1240-1242)Ctc>Ttc	p.L414F	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGTATAACGAGAGTGCGTTTG	0.428																																																0			19											174.0	169.0	171.0					19																	52519611		2203	4300	6503	57211423	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1240C>T	19.37:g.52519611G>A	ENSP00000270649:p.Leu414Phe		57211423	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777852	0.49786	.	.	ENSG00000142556	ENST00000270649	T	0.52057	0.68	3.5	1.17	0.20885	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61476	0.2350	L	0.55990	1.75	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53528	-0.8426	9	0.66056	D	0.02	.	11.6422	0.51240	0.0:0.346:0.654:0.0	.	414	Q8N883	ZN614_HUMAN	F	414	ENSP00000270649:L414F	ENSP00000270649:L414F	L	-	1	0	ZNF614	57211423	1.000000	0.71417	0.001000	0.08648	0.920000	0.55202	2.860000	0.48372	0.140000	0.18849	0.563000	0.77884	CTC		0.428	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519621	52519621	+	Silent	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519621G>C	ENST00000270649.6	-	5	1774	c.1230C>G	c.(1228-1230)gtC>gtG	p.V410V	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GAGTGCGTTTGACAGTGAAGC	0.423																																																0			19											175.0	169.0	171.0					19																	52519621		2203	4300	6503	57211433	SO:0001819	synonymous_variant	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1230C>G	19.37:g.52519621G>C			57211433	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU																																																																																				0.423	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Silent
ZNF614	80110	genome.wustl.edu	37	19	52519627	52519627	+	Silent	SNP	G	G	A			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519627G>A	ENST00000270649.6	-	5	1768	c.1224C>T	c.(1222-1224)ttC>ttT	p.F408F	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTTTGACAGTGAAGCCTTTTC	0.433																																																0			19											175.0	168.0	171.0					19																	52519627		2203	4300	6503	57211439	SO:0001819	synonymous_variant	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1224C>T	19.37:g.52519627G>A			57211439	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU																																																																																				0.433	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Silent
ZNF614	80110	genome.wustl.edu	37	19	52519842	52519842	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519842G>C	ENST00000270649.6	-	5	1553	c.1009C>G	c.(1009-1011)Cat>Gat	p.H337D	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TCCCCTGTATGAGTTCGCTGA	0.433																																																0			19											128.0	119.0	122.0					19																	52519842		2203	4300	6503	57211654	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1009C>G	19.37:g.52519842G>C	ENSP00000270649:p.His337Asp		57211654	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094509	0.76870	.	.	ENSG00000142556	ENST00000270649	T	0.67698	-0.28	3.8	3.8	0.43715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85044	0.5607	M	0.92784	3.345	0.36723	D	0.881274	D	0.76494	0.999	D	0.87578	0.998	D	0.91235	0.5017	9	0.87932	D	0	.	14.6203	0.68579	0.0:0.0:1.0:0.0	.	337	Q8N883	ZN614_HUMAN	D	337	ENSP00000270649:H337D	ENSP00000270649:H337D	H	-	1	0	ZNF614	57211654	1.000000	0.71417	0.899000	0.35326	0.997000	0.91878	6.630000	0.74272	1.940000	0.56252	0.655000	0.94253	CAT		0.433	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52519861	52519861	+	Silent	SNP	G	G	C			TCGA-13-0800-01	TCGA-13-0800-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr19:52519861G>C	ENST00000270649.6	-	5	1534	c.990C>G	c.(988-990)ctC>ctG	p.L330L	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GATGTACAATGAGATTGCTCT	0.423																																																0			19											138.0	126.0	130.0					19																	52519861		2203	4300	6503	57211673	SO:0001819	synonymous_variant	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.990C>G	19.37:g.52519861G>C			57211673	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	45	WashU																																																																																				0.423	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Silent
CALCR	799	genome.wustl.edu	37	7	93055878	93055878	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0800-01	TCGA-13-0800-10	T	T	T	A	T	T	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0800-01	TCGA-13-0800-10	g.chr7:93055878T>A	ENST00000394441.1	-	13	1530	c.1215A>T	c.(1213-1215)caA>caT	p.Q405H	CALCR_ENST00000360249.4_Missense_Mutation_p.Q421H|CALCR_ENST00000359558.2_Missense_Mutation_p.Q439H|CALCR_ENST00000426151.1_Missense_Mutation_p.Q405H|CALCR_ENST00000421592.1_Missense_Mutation_p.Q421H	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	439					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.Q405H(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	ATTGGGCCCATTGGCGCTTCA	0.537																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	7											37.0	42.0	40.0					7																	93055878		2203	4300	6503	92893814	SO:0001583	missense	799			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1215A>T	7.37:g.93055878T>A	ENSP00000377959:p.Gln405His		92893814	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	7.541	0.660737	0.14645	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	4.92	-9.85	0.00476	.	.	.	.	.	T	0.20414	0.0491	L	0.42487	1.325	0.29390	N	0.862675	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.06232	-1.0838	9	0.17369	T	0.5	.	6.0794	0.19933	0.0835:0.5985:0.1808:0.1371	.	439;405	F5H605;A4D1G6	.;.	H	439;421;421;405;405	ENSP00000352561:Q439H;ENSP00000353385:Q421H;ENSP00000399552:Q421H;ENSP00000377959:Q405H;ENSP00000389295:Q405H	ENSP00000352561:Q439H	Q	-	3	2	CALCR	92893814	0.000000	0.05858	0.024000	0.17045	0.251000	0.25915	-4.644000	0.00204	-2.760000	0.00370	-0.334000	0.08254	CAA		0.537	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742		Missense_Mutation
