#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
TRIM21	6737	genome.wustl.edu	37	11	4409691	4409691	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr11:4409691C>G	ENST00000254436.7	-	4	686	c.574G>C	c.(574-576)Gaa>Caa	p.E192Q	TRIM21_ENST00000543625.1_Missense_Mutation_p.E192Q	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	192					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E192Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		CTCTGTTCTTCTTCAACCAGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											203.0	204.0	204.0					11																	4409691		1956	4180	6136	4366267	SO:0001583	missense	6737			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.574G>C	11.37:g.4409691C>G	ENSP00000254436:p.Glu192Gln		4366267	Q5XPV5|Q96RF8	Missense_Mutation	SNP	ENST00000254436.7	37	CCDS44525.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280609	0.59758	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.09538	2.97;2.97	4.2	4.2	0.49525	.	0.000000	0.50627	D	0.000102	T	0.32585	0.0834	M	0.85630	2.765	0.28348	N	0.921034	D	0.76494	0.999	D	0.63488	0.915	T	0.11591	-1.0581	10	0.66056	D	0.02	.	12.3522	0.55155	0.0:1.0:0.0:0.0	.	192	P19474	RO52_HUMAN	Q	192	ENSP00000254436:E192Q;ENSP00000444045:E192Q	ENSP00000254436:E192Q	E	-	1	0	TRIM21	4366267	0.984000	0.35163	0.979000	0.43373	0.502000	0.33828	2.627000	0.46469	2.612000	0.88384	0.655000	0.94253	GAA		0.517	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141		Missense_Mutation
PLGRKT	55848	genome.wustl.edu	37	9	5361832	5361832	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:5361832C>G	ENST00000223864.2	-	4	359	c.138G>C	c.(136-138)caG>caC	p.Q46H	PLGRKT_ENST00000482696.1_5'UTR	NM_018465.3	NP_060935.2	Q9HBL7	PLRKT_HUMAN	plasminogen receptor, C-terminal lysine transmembrane protein	46				Q -> R (in Ref. 2; AAF67643). {ECO:0000305}.	chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of plasminogen activation (GO:0010756)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)		p.Q46H(1)									ACCACGCAATCTGCATGGCCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	9											105.0	100.0	102.0					9																	5361832		2203	4300	6503	5351832	SO:0001583	missense	55848			AF225420	CCDS6463.1	9p24.1	2012-04-12	2012-04-12	2012-04-12	ENSG00000107020	ENSG00000107020			23633	protein-coding gene	gene with protein product	"""uncharacterized hematopoietic stem/progenitor cells protein MDS030"", ""plasminogen receptor with a C-terminal lysine"""		"""chromosome 9 open reading frame 46"""	C9orf46		12477932	Standard	NM_018465		Approved	MDS030, FLJ14688, AD025, Plg-RKT	uc003zjc.3	Q9HBL7	OTTHUMG00000019501	ENST00000223864.2:c.138G>C	9.37:g.5361832C>G	ENSP00000223864:p.Gln46His		5351832	B2R6W0|Q9NZ44	Missense_Mutation	SNP	ENST00000223864.2	37	CCDS6463.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018052	0.54576	.	.	ENSG00000107020	ENST00000223864	.	.	.	5.38	1.54	0.23209	.	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	M	0.86573	2.825	0.51233	D	0.999912	D	0.89917	1.0	D	0.77004	0.989	T	0.77310	-0.2635	9	0.72032	D	0.01	.	9.7155	0.40272	0.0:0.7173:0.0:0.2827	.	46	Q9HBL7	CI046_HUMAN	H	46	.	ENSP00000223864:Q46H	Q	-	3	2	C9orf46	5351832	1.000000	0.71417	0.986000	0.45419	0.605000	0.37080	1.703000	0.37846	0.020000	0.15106	-0.140000	0.14226	CAG		0.398	PLGRKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051626.1	NM_018465		Missense_Mutation
UBQLN3	50613	genome.wustl.edu	37	11	5530137	5530137	+	Missense_Mutation	SNP	G	G	A	rs201719446		TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr11:5530137G>A	ENST00000311659.4	-	2	799	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	218								p.R218W(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTGTCTGCCGCATAATTTCC	0.517																																					Ovarian(72;684 1260 12332 41642 52180)											1	Substitution - Missense(1)	ovary(1)	11											93.0	91.0	92.0					11																	5530137		2201	4297	6498	5486713	SO:0001583	missense	50613			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.652C>T	11.37:g.5530137G>A	ENSP00000347997:p.Arg218Trp		5486713	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	SNP	38	WashU	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	15.19	2.760103	0.49468	.	.	ENSG00000175520	ENST00000311659;ENST00000445998	T;T	0.67523	0.51;-0.27	5.53	3.61	0.41365	Heat shock chaperonin-binding (1);	0.000000	0.42053	D	0.000768	T	0.71651	0.3365	M	0.78223	2.4	0.48452	D	0.999653	P	0.52316	0.952	P	0.48304	0.573	T	0.75127	-0.3427	10	0.87932	D	0	-34.2063	11.9374	0.52880	0.0:0.0:0.5418:0.4582	.	218	Q9H347	UBQL3_HUMAN	W	218	ENSP00000347997:R218W;ENSP00000412561:R218W	ENSP00000347997:R218W	R	-	1	2	UBQLN3	5486713	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	0.881000	0.28173	0.761000	0.33130	-0.282000	0.10007	CGG		0.517	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		Missense_Mutation
ZNF12	7559	genome.wustl.edu	37	7	6736969	6736969	+	Splice_Site	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr7:6736969C>A	ENST00000405858.1	-	4	780		c.e4+1		ZNF12_ENST00000404360.1_Splice_Site|ZNF12_ENST00000342651.5_Splice_Site|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		CACTAACACACCTGGATAGCT	0.443																																																0			7											78.0	79.0	79.0					7																	6736969		2040	4220	6260	6703494	SO:0001630	splice_region_variant	7559			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.238+1G>T	7.37:g.6736969C>A			6703494	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Splice_Site_SNP	SNP	ENST00000405858.1	37	CCDS47538.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060394	0.55432	.	.	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476;ENST00000330442	.	.	.	4.12	3.24	0.37175	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8025	0.29183	0.0:0.8884:0.0:0.1116	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF12	6703494	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.643000	0.46604	1.336000	0.45506	0.585000	0.79938	.		0.443	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265	Intron	Splice_Site_SNP
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D|TP53_ENST00000455263.2_Missense_Mutation_p.G245D|TP53_ENST00000359597.4_Missense_Mutation_p.G245D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	17	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	7518272	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp		7518272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
MYH13	8735	genome.wustl.edu	37	17	10267759	10267759	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr17:10267759C>G	ENST00000418404.3	-	2	252	c.89G>C	c.(88-90)cGt>cCt	p.R30P	MYH13_ENST00000252172.4_Missense_Mutation_p.R30P			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	30					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R30P(1)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						ATCGAATGGACGATTTTGAGC	0.463																																																1	Substitution - Missense(1)	ovary(1)	17											121.0	113.0	115.0					17																	10267759		1924	4139	6063	10208484	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.89G>C	17.37:g.10267759C>G	ENSP00000404570:p.Arg30Pro		10208484	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829953	0.32329	.	.	ENSG00000006788	ENST00000252172	D	0.86030	-2.06	4.69	3.71	0.42584	.	.	.	.	.	D	0.86343	0.5910	L	0.46885	1.475	0.21499	N	0.999661	B	0.33073	0.396	P	0.45610	0.487	T	0.79293	-0.1863	9	0.46703	T	0.11	.	14.6872	0.69057	0.146:0.854:0.0:0.0	.	30	Q9UKX3	MYH13_HUMAN	P	30	ENSP00000252172:R30P	ENSP00000252172:R30P	R	-	2	0	MYH13	10208484	0.000000	0.05858	0.499000	0.27577	0.230000	0.25150	-0.252000	0.08806	1.322000	0.45245	0.655000	0.94253	CGT		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Missense_Mutation
MPDZ	8777	genome.wustl.edu	37	9	13119558	13119558	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:13119558C>G	ENST00000319217.7	-	39	5569	c.5322G>C	c.(5320-5322)atG>atC	p.M1774I	MPDZ_ENST00000447879.1_Missense_Mutation_p.M1741I|MPDZ_ENST00000541093.1_Missense_Mutation_p.M8I|MPDZ_ENST00000538841.1_Missense_Mutation_p.M633I|MPDZ_ENST00000536827.1_Missense_Mutation_p.M1741I|MPDZ_ENST00000546205.1_Missense_Mutation_p.M1788I|MPDZ_ENST00000381022.2_Missense_Mutation_p.M1774I|MPDZ_ENST00000541718.1_Missense_Mutation_p.M1774I|MPDZ_ENST00000381015.4_Missense_Mutation_p.M1774I	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1774	PDZ 11. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.M1774I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCCCATTCACCATTAATATCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											155.0	152.0	153.0					9																	13119558		1904	4136	6040	13109558	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5322G>C	9.37:g.13119558C>G	ENSP00000320006:p.Met1774Ile		13109558	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672799	0.29693	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000438511;ENST00000541093;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T;T;T;T	0.41758	0.99;1.69;1.69;0.99;1.69;0.99;0.99;1.69;0.99;0.99;0.99	6.03	4.16	0.48862	PDZ/DHR/GLGF (4);	0.339838	0.25138	N	0.032848	T	0.36413	0.0966	L	0.46157	1.445	0.36739	D	0.882119	B;B;B;B;B;B;B;B	0.22080	0.064;0.005;0.04;0.052;0.064;0.052;0.04;0.011	B;B;B;B;B;B;B;B	0.29440	0.077;0.063;0.102;0.046;0.077;0.075;0.063;0.063	T	0.33317	-0.9873	10	0.44086	T	0.13	.	8.1336	0.31041	0.1302:0.7264:0.0:0.1435	.	1741;633;479;1741;1654;1774;1774;467	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2;O75970;B3KRN5	.;.;.;.;.;.;MPDZ_HUMAN;.	I	1774;1774;1774;315;8;710;633;1741;1741;1774;1654;1788	ENSP00000320006:M1774I;ENSP00000439807:M1774I;ENSP00000370410:M1774I;ENSP00000415964:M315I;ENSP00000445259:M8I;ENSP00000444230:M710I;ENSP00000444717:M633I;ENSP00000444151:M1741I;ENSP00000415208:M1741I;ENSP00000370403:M1774I;ENSP00000446358:M1788I	ENSP00000320006:M1774I	M	-	3	0	MPDZ	13109558	0.443000	0.25641	0.775000	0.31657	0.365000	0.29674	-0.210000	0.09345	0.849000	0.35215	0.655000	0.94253	ATG		0.418	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		Missense_Mutation
PARP2	10038	genome.wustl.edu	37	14	20820412	20820412	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0893-01	TCGA-13-0893-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr14:20820412A>C	ENST00000250416.5	+	7	572	c.545A>C	c.(544-546)gAc>gCc	p.D182A	PARP2_ENST00000429687.3_Missense_Mutation_p.D169A|PARP2_ENST00000527915.1_Missense_Mutation_p.D182A	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	182					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D133A(1)		central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		AGATTCCTTGACAAAACGAAA	0.353								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																								1	Substitution - Missense(1)	ovary(1)	14											101.0	90.0	93.0					14																	20820412		1828	4088	5916	19890252	SO:0001583	missense	10038			AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.545A>C	14.37:g.20820412A>C	ENSP00000250416:p.Asp182Ala		19890252	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	ENST00000250416.5	37	CCDS41910.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	14.90	2.672421	0.47781	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.16324	2.35;2.35;2.35	5.53	5.53	0.82687	WGR domain (4);	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	M	0.74389	2.26	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.71870	0.921;0.975	T	0.30179	-0.9987	10	0.54805	T	0.06	-22.8827	14.635	0.68682	1.0:0.0:0.0:0.0	.	169;182	Q9UGN5-2;Q9UGN5	.;PARP2_HUMAN	A	169;182;182	ENSP00000392972:D169A;ENSP00000250416:D182A;ENSP00000432283:D182A	ENSP00000250416:D182A	D	+	2	0	PARP2	19890252	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.600000	0.82769	2.106000	0.64143	0.460000	0.39030	GAC		0.353	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2			Missense_Mutation
APOB	338	genome.wustl.edu	37	2	21260035	21260035	+	Silent	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:21260035C>G	ENST00000233242.1	-	6	757	c.630G>C	c.(628-630)ggG>ggC	p.G210G	APOB_ENST00000399256.4_Silent_p.G210G	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	210	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.G210G(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATCACACTGCCCCAGGTCTC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	2											165.0	132.0	143.0					2																	21260035		2203	4300	6503	21113540	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.630G>C	2.37:g.21260035C>G			21113540	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	26	WashU																																																																																				0.522	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Silent
C10orf113	387638	genome.wustl.edu	37	10	21414974	21414974	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0893-01	TCGA-13-0893-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr10:21414974T>A	ENST00000534331.1	-	2	296	c.246A>T	c.(244-246)caA>caT	p.Q82H	C10orf113_ENST00000529198.1_3'UTR|C10orf113_ENST00000377118.4_Missense_Mutation_p.Q72H|NEBL_ENST00000417816.2_Intron	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	82								p.Q72H(2)		endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TTGGCCAGCTTTGCAGCCTTC	0.607																																																2	Substitution - Missense(2)	ovary(2)	10											58.0	61.0	60.0					10																	21414974		2203	4300	6503	21454980	SO:0001583	missense	387638				CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.246A>T	10.37:g.21414974T>A	ENSP00000433646:p.Gln82His		21454980	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	37	CCDS31162.2	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	4.703	0.130778	0.08981	.	.	ENSG00000204683	ENST00000534331;ENST00000377118	T;T	0.37058	1.22;1.22	4.66	-2.05	0.07321	.	.	.	.	.	T	0.16342	0.0393	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.15870	0.014	T	0.22347	-1.0219	9	0.87932	D	0	1.9108	4.6323	0.12507	0.2022:0.4585:0.0:0.3394	.	82	Q5VZT2	CJ113_HUMAN	H	82;72	ENSP00000433646:Q82H;ENSP00000366322:Q72H	ENSP00000366322:Q72H	Q	-	3	2	C10orf113	21454980	0.815000	0.29118	0.030000	0.17652	0.171000	0.22731	0.153000	0.16323	-0.247000	0.09597	-0.467000	0.05162	CAA		0.607	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896		Missense_Mutation
ATXN2L	11273	genome.wustl.edu	37	16	28845928	28845928	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr16:28845928C>G	ENST00000336783.4	+	18	2514	c.2347C>G	c.(2347-2349)Ccc>Gcc	p.P783A	ATXN2L_ENST00000325215.6_Missense_Mutation_p.P783A|ATXN2L_ENST00000382686.4_Missense_Mutation_p.P783A|ATXN2L_ENST00000570200.1_Missense_Mutation_p.P783A|ATXN2L_ENST00000565845.1_3'UTR|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000395547.2_Missense_Mutation_p.P783A|ATXN2L_ENST00000564304.1_Missense_Mutation_p.P789A|ATXN2L_ENST00000340394.8_Missense_Mutation_p.P783A	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	783					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)	p.P783A(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GGCTGCCACGCCCTATTCTTC	0.677																																																1	Substitution - Missense(1)	ovary(1)	16											61.0	72.0	69.0					16																	28845928		2196	4298	6494	28753429	SO:0001583	missense	11273				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.2347C>G	16.37:g.28845928C>G	ENSP00000338718:p.Pro783Ala		28753429	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	CCDS10641.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	.	17.39	3.377142	0.61735	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.55234	0.55;0.63;0.65;0.54;0.53	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.52403	0.1732	L	0.54323	1.7	0.36198	D	0.850568	B;B;B;B;B;B;B	0.20988	0.05;0.03;0.03;0.05;0.05;0.03;0.05	B;B;B;B;B;B;B	0.22880	0.042;0.019;0.019;0.042;0.042;0.019;0.042	T	0.57883	-0.7734	10	0.52906	T	0.07	-10.4845	18.0694	0.89400	0.0:1.0:0.0:0.0	.	783;783;783;783;783;783;783	Q8WWM7-6;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;ATX2L_HUMAN;.;.;.;.	A	783	ENSP00000341459:P783A;ENSP00000378917:P783A;ENSP00000338718:P783A;ENSP00000372133:P783A;ENSP00000315650:P783A	ENSP00000315650:P783A	P	+	1	0	ATXN2L	28753429	0.994000	0.37717	0.968000	0.41197	0.928000	0.56348	3.844000	0.55873	2.552000	0.86080	0.563000	0.77884	CCC		0.677	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245		Missense_Mutation
SYNGAP1	8831	genome.wustl.edu	37	6	33411592	33411592	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr6:33411592G>T	ENST00000418600.2	+	15	3364	c.3263G>T	c.(3262-3264)aGc>aTc	p.S1088I	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.S1029I|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.S1088I|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1088					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.S1088I(1)|p.S1073I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CGGCCATCCAGCGGGAATCTA	0.682																																																2	Substitution - Missense(2)	ovary(2)	6											29.0	36.0	34.0					6																	33411592		2196	4296	6492	33519570	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3263G>T	6.37:g.33411592G>T	ENSP00000403636:p.Ser1088Ile		33519570	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544515	0.65198	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.13089	2.62;2.62;2.62	4.23	4.23	0.50019	.	1.098290	0.07057	N	0.833064	T	0.25717	0.0626	L	0.52905	1.665	0.46542	D	0.999093	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.81914	0.995;0.991;0.991	T	0.00717	-1.1596	10	0.87932	D	0	.	14.1653	0.65473	0.0:0.0:1.0:0.0	.	1088;1088;1088	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	I	1088;1088;1074;1029	ENSP00000293748:S1088I;ENSP00000403636:S1088I;ENSP00000412475:S1029I	ENSP00000293748:S1088I	S	+	2	0	SYNGAP1	33519570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.620000	0.83070	2.202000	0.70862	0.591000	0.81541	AGC		0.682	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		Missense_Mutation
CUL2	8453	genome.wustl.edu	37	10	35328011	35328011	+	Splice_Site	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr10:35328011C>T	ENST00000374748.1	-	10	1028		c.e10-1		CUL2_ENST00000537177.1_Splice_Site|CUL2_ENST00000602371.1_Splice_Site|CUL2_ENST00000374742.1_Splice_Site|CUL2_ENST00000374751.3_Splice_Site|CUL2_ENST00000374749.3_Splice_Site|CUL2_ENST00000374746.1_Splice_Site			Q13617	CUL2_HUMAN	cullin 2						cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)	p.?(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						TACCTAGAACCTATAAAAATA	0.308																																																1	Unknown(1)	ovary(1)	10											57.0	54.0	55.0					10																	35328011		2203	4293	6496	35368017	SO:0001630	splice_region_variant	8453			U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.715-1G>A	10.37:g.35328011C>T			35368017	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Splice_Site_SNP	SNP	ENST00000374748.1	37	CCDS7179.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067361	0.55539	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6183	0.95645	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUL2	35368017	1.000000	0.71417	0.997000	0.53966	0.386000	0.30323	7.818000	0.86416	2.707000	0.92482	0.557000	0.71058	.		0.308	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	Intron	Splice_Site_SNP
TESK1	7016	genome.wustl.edu	37	9	35606922	35606922	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:35606922C>G	ENST00000336395.5	+	4	729	c.479C>G	c.(478-480)gCc>gGc	p.A160G	MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_3'UTR	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.A160G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGGACATTGCCCGAGGCCTG	0.587																																																1	Substitution - Missense(1)	ovary(1)	9											43.0	39.0	40.0					9																	35606922		2203	4300	6503	35596922	SO:0001583	missense	7016			D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.479C>G	9.37:g.35606922C>G	ENSP00000338127:p.Ala160Gly		35596922	Q8IXZ8	Missense_Mutation	SNP	ENST00000336395.5	37	CCDS6580.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745738	0.89663	.	.	ENSG00000107140	ENST00000336395	T	0.41758	0.99	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44688	D	0.000425	T	0.70928	0.3280	M	0.88450	2.955	0.80722	D	1	D	0.69078	0.997	D	0.73708	0.981	T	0.77270	-0.2650	10	0.87932	D	0	-12.4027	18.1312	0.89602	0.0:1.0:0.0:0.0	.	160	Q15569	TESK1_HUMAN	G	160	ENSP00000338127:A160G	ENSP00000338127:A160G	A	+	2	0	TESK1	35596922	1.000000	0.71417	0.997000	0.53966	0.515000	0.34225	7.811000	0.86092	2.509000	0.84616	0.561000	0.74099	GCC		0.587	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285		Missense_Mutation
TSHZ3	57616	genome.wustl.edu	37	19	31768044	31768044	+	Silent	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr19:31768044C>T	ENST00000240587.4	-	2	2982	c.2655G>A	c.(2653-2655)tcG>tcA	p.S885S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	885					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S702S(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGGCGGGCGTCGACTCCTCAG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	19											43.0	41.0	41.0					19																	31768044		2203	4300	6503	36459884	SO:0001819	synonymous_variant	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2655G>A	19.37:g.31768044C>T			36459884	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2	SNP	31	WashU																																																																																				0.612	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		Silent
ANKRD30A	91074	genome.wustl.edu	37	10	37430803	37430803	+	Missense_Mutation	SNP	T	T	G	rs372199195		TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr10:37430803T>G	ENST00000602533.1	+	7	909	c.810T>G	c.(808-810)gaT>gaG	p.D270E	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.D270E|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.D270E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	326					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D270E(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAACACCTGATGAGGCTGCAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	10											61.0	63.0	62.0					10																	37430803		1879	4120	5999	37470809	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.810T>G	10.37:g.37430803T>G	ENSP00000473551:p.Asp270Glu		37470809	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	.	4.764	0.142081	0.09083	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.04454	3.62;3.62	0.609	-1.22	0.09494	.	.	.	.	.	T	0.04363	0.0120	L	0.46157	1.445	0.09310	N	1	P	0.38711	0.643	B	0.43360	0.417	T	0.29701	-1.0003	8	0.02654	T	1	.	.	.	.	.	326	Q9BXX3	AN30A_HUMAN	E	270	ENSP00000354432:D270E;ENSP00000363792:D270E	ENSP00000354432:D270E	D	+	3	2	ANKRD30A	37470809	0.122000	0.22280	0.004000	0.12327	0.004000	0.04260	-3.842000	0.00353	-1.148000	0.02847	-1.550000	0.00899	GAT		0.478	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		Missense_Mutation
FREM2	341640	genome.wustl.edu	37	13	39264383	39264383	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr13:39264383G>A	ENST00000280481.7	+	1	3118	c.2902G>A	c.(2902-2904)Gtt>Att	p.V968I		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	968					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V968I(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CACTGCCAATGTTATTAAGGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	13											80.0	83.0	82.0					13																	39264383		2203	4300	6503	38162383	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2902G>A	13.37:g.39264383G>A	ENSP00000280481:p.Val968Ile		38162383	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.693088	0.00731	.	.	ENSG00000150893	ENST00000280481	T	0.26223	1.75	5.59	0.576	0.17380	.	0.310908	0.34245	N	0.004127	T	0.16085	0.0387	L	0.41027	1.25	0.38726	D	0.953561	B	0.09022	0.002	B	0.12837	0.008	T	0.15009	-1.0452	10	0.20519	T	0.43	.	5.8465	0.18669	0.3929:0.125:0.4821:0.0	.	968	Q5SZK8	FREM2_HUMAN	I	968	ENSP00000280481:V968I	ENSP00000280481:V968I	V	+	1	0	FREM2	38162383	0.972000	0.33761	0.257000	0.24404	0.061000	0.15899	1.718000	0.38001	-0.221000	0.09973	-0.150000	0.13652	GTT		0.458	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
SOS1	6654	genome.wustl.edu	37	2	39213416	39213416	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:39213416G>T	ENST00000426016.1	-	24	3637	c.3551C>A	c.(3550-3552)cCt>cAt	p.P1184H	SOS1_ENST00000395038.2_Missense_Mutation_p.P1169H|SOS1_ENST00000402219.2_Missense_Mutation_p.P1184H			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1184					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P1184H(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GGGTTGCCTAGGAGGAATGGC	0.393									Noonan syndrome																																							1	Substitution - Missense(1)	ovary(1)	2											73.0	80.0	77.0					2																	39213416		2203	4300	6503	39066920	SO:0001583	missense	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3551C>A	2.37:g.39213416G>T	ENSP00000387784:p.Pro1184His		39066920	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542113	0.65198	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	D;D;D	0.84516	-1.52;-1.52;-1.86	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.90861	0.7129	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89481	0.3750	10	0.40728	T	0.16	.	19.559	0.95364	0.0:0.0:1.0:0.0	.	1184	Q07889	SOS1_HUMAN	H	1184;1184;901;1169	ENSP00000387784:P1184H;ENSP00000384675:P1184H;ENSP00000378479:P1169H	ENSP00000378479:P1169H	P	-	2	0	SOS1	39066920	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.554000	0.90689	2.706000	0.92434	0.650000	0.86243	CCT		0.393	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		Missense_Mutation
C7	730	genome.wustl.edu	37	5	40976934	40976934	+	Silent	SNP	C	C	T	rs563401809		TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr5:40976934C>T	ENST00000313164.9	+	16	2516	c.2157C>T	c.(2155-2157)taC>taT	p.Y719Y	C7_ENST00000494960.1_3'UTR	NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	719	Factor I module (FIM) 1.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.Y719Y(1)					Ovarian(839;0.0112)				AAATGCCCTACGAATGTGGGT	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		20321	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	5											111.0	111.0	111.0					5																	40976934		1933	4133	6066	41012691	SO:0001819	synonymous_variant	730			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2157C>T	5.37:g.40976934C>T			41012691	Q6P3T5|Q92489	Silent	SNP	ENST00000313164.9	37	CCDS47201.1	SNP	19	WashU																																																																																				0.383	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			Silent
GLI3	2737	genome.wustl.edu	37	7	42012031	42012031	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr7:42012031G>C	ENST00000395925.3	-	13	2092	c.2008C>G	c.(2008-2010)Cag>Gag	p.Q670E	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	670					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q670E(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGGGCTCCCTGAGTCGGTCGG	0.597									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																																							1	Substitution - Missense(1)	ovary(1)	7											111.0	113.0	112.0					7																	42012031		2203	4300	6503	41978556	SO:0001583	missense	2737	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2008C>G	7.37:g.42012031G>C	ENSP00000379258:p.Gln670Glu		41978556	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246245	0.22796	.	.	ENSG00000106571	ENST00000395925	T	0.12774	2.65	5.92	5.92	0.95590	.	0.062777	0.64402	D	0.000003	T	0.12902	0.0313	L	0.44542	1.39	0.80722	D	1	B	0.31435	0.323	B	0.27380	0.079	T	0.06110	-1.0845	10	0.05525	T	0.97	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	670	P10071	GLI3_HUMAN	E	670	ENSP00000379258:Q670E	ENSP00000379258:Q670E	Q	-	1	0	GLI3	41978556	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	5.475000	0.66787	2.804000	0.96469	0.655000	0.94253	CAG		0.597	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		Missense_Mutation
FAM183A	440585	genome.wustl.edu	37	1	43618548	43618548	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:43618548G>T	ENST00000335282.4	+	3	243	c.243G>T	c.(241-243)aaG>aaT	p.K81N	FAM183A_ENST00000410048.1_Missense_Mutation_p.K53N|FAM183A_ENST00000409337.1_Intron	NM_001101376.2	NP_001094846.2	A6NL82	F183A_HUMAN	family with sequence similarity 183, member A	81								p.K81N(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(3)	7						CAAGGAAGAAGTACCCAGAGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	77.0	77.0					1																	43618548		2018	4189	6207	43391135	SO:0001583	missense				AI192630, AI375550, AL139138	CCDS44126.1	1p34.2	2008-08-11			ENSG00000186973	ENSG00000186973			34347	protein-coding gene	gene with protein product						11181995	Standard	NM_001101376		Approved	LOC440585, hCG23177	uc009vwo.3	A6NL82	OTTHUMG00000007286	ENST00000335282.4:c.243G>T	1.37:g.43618548G>T	ENSP00000334415:p.Lys81Asn		43391135	B7ZBL8	Missense_Mutation	SNP	ENST00000335282.4	37	CCDS44126.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021536	0.54576	.	.	ENSG00000186973	ENST00000409706;ENST00000410048;ENST00000410025;ENST00000409396;ENST00000335282	.	.	.	4.91	1.32	0.21799	.	0.061220	0.64402	D	0.000010	T	0.70945	0.3282	M	0.82630	2.6	0.35187	D	0.773011	D	0.76494	0.999	D	0.64877	0.93	T	0.75306	-0.3364	9	0.87932	D	0	.	7.464	0.27312	0.7608:0.0:0.2392:0.0	.	81	A6NL82	F183A_HUMAN	N	81;53;29;81;81	.	ENSP00000334415:K81N	K	+	3	2	FAM183A	43391135	1.000000	0.71417	0.908000	0.35775	0.769000	0.43574	0.839000	0.27586	0.030000	0.15379	-0.258000	0.10820	AAG		0.517	FAM183A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019024.3	NM_001101376		Missense_Mutation
KRTAP10-11	386678	genome.wustl.edu	37	21	46066871	46066871	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr21:46066871T>C	ENST00000334670.8	+	1	541	c.496T>C	c.(496-498)Tct>Cct	p.S166P	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	166	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S166P(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						TGAGGATTCCTCTTCATGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	21											166.0	168.0	168.0					21																	46066871		2203	4300	6503	44891299	SO:0001583	missense	386678			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.496T>C	21.37:g.46066871T>C	ENSP00000334197:p.Ser166Pro		44891299	A2RRF9	Missense_Mutation	SNP	ENST00000334670.8	37	CCDS42962.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	t	0.050	-1.253128	0.01457	.	.	ENSG00000243489	ENST00000334670	T	0.00662	5.93	1.46	-0.348	0.12613	.	.	.	.	.	T	0.00724	0.0024	L	0.37850	1.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44314	-0.9336	9	0.31617	T	0.26	.	4.7313	0.12966	0.0:0.5325:0.0:0.4675	.	166	P60412	KR10B_HUMAN	P	166	ENSP00000334197:S166P	ENSP00000334197:S166P	S	+	1	0	KRTAP10-11	44891299	0.022000	0.18835	0.004000	0.12327	0.121000	0.20230	1.236000	0.32683	-0.099000	0.12263	0.374000	0.22700	TCT		0.622	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692		Missense_Mutation
SETD2	29072	genome.wustl.edu	37	3	47142987	47142987	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr3:47142987C>A	ENST00000409792.3	-	8	5018	c.4976G>T	c.(4975-4977)gGc>gTc	p.G1659V		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1659	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.G1156V(1)|p.G1659V(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TAACTCTGAGCCTGAAGGAAC	0.378			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	ovary(2)	3											167.0	168.0	168.0					3																	47142987		2203	4300	6503	47117991	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4976G>T	3.37:g.47142987C>A	ENSP00000386759:p.Gly1659Val		47117991	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	31	5.104348	0.94245	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.90261	-2.64	5.94	5.94	0.96194	SET domain (3);	0.000000	0.53938	D	0.000041	D	0.97820	0.9284	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98698	1.0699	10	0.87932	D	0	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	1659;1659	F2Z317;Q9BYW2	.;SETD2_HUMAN	V	1659	ENSP00000386759:G1659V	ENSP00000386759:G1659V	G	-	2	0	SETD2	47117991	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.735000	0.84939	2.820000	0.97059	0.650000	0.86243	GGC		0.378	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		Missense_Mutation
SLC5A9	200010	genome.wustl.edu	37	1	48697697	48697697	+	Silent	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:48697697C>A	ENST00000438567.2	+	7	823	c.771C>A	c.(769-771)acC>acA	p.T257T	SLC5A9_ENST00000236495.5_Silent_p.T282T|SLC5A9_ENST00000420136.2_Intron|RP5-1024N4.4_ENST00000606809.1_RNA|SLC5A9_ENST00000533824.1_Silent_p.T278T	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	257					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.T275T(1)		breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						TCCCCAACACCACCTGTCACC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											138.0	126.0	130.0					1																	48697697		2203	4300	6503	48470284	SO:0001819	synonymous_variant	200010			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.771C>A	1.37:g.48697697C>A			48470284	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Silent	SNP	ENST00000438567.2	37	CCDS30709.2	SNP	21	WashU																																																																																				0.607	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174		Silent
FAM21A	387680	genome.wustl.edu	37	10	51859751	51859751	+	Missense_Mutation	SNP	C	C	A	rs201610656	byFrequency	TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr10:51859751C>A	ENST00000282633.5	+	17	1607	c.1562C>A	c.(1561-1563)tCc>tAc	p.S521Y	FAM21A_ENST00000399339.2_Missense_Mutation_p.S433Y|FAM21A_ENST00000314664.7_Missense_Mutation_p.S521Y|FAM21A_ENST00000351071.6_Missense_Mutation_p.S521Y	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	521					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						ACCTTATCTTCCAGCAAAAAT	0.423																																																0			10											2.0	2.0	2.0					10																	51859751		1300	2814	4114	51529757	SO:0001583	missense	387680			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1562C>A	10.37:g.51859751C>A	ENSP00000282633:p.Ser521Tyr		51529757	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	c	4.405	0.074822	0.08485	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	4.32	4.32	0.51571	.	0.662706	0.15995	N	0.234623	T	0.57932	0.2087	M	0.67953	2.075	0.42549	P	0.00689799999999996	B;B;P;B;B	0.50528	0.001;0.001;0.936;0.005;0.001	B;B;P;B;B	0.48227	0.004;0.003;0.571;0.02;0.003	T	0.71258	-0.4646	8	0.51188	T	0.08	0.2567	12.3647	0.55222	0.0:1.0:0.0:0.0	.	521;521;433;521;415	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	Y	521;521;415;521;433	.	ENSP00000282633:S521Y	S	+	2	0	FAM21A	51529757	0.619000	0.27059	0.196000	0.23383	0.208000	0.24298	3.741000	0.55090	1.945000	0.56424	0.184000	0.17185	TCC		0.423	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751		Missense_Mutation
BCAS1	8537	genome.wustl.edu	37	20	52612476	52612476	+	Silent	SNP	A	A	G			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr20:52612476A>G	ENST00000395961.3	-	5	1003	c.837T>C	c.(835-837)gcT>gcC	p.A279A	BCAS1_ENST00000371440.3_Silent_p.A279A|BCAS1_ENST00000434986.2_5'UTR|BCAS1_ENST00000371435.2_Silent_p.A279A	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	279						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.A279A(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			TCTCTGCTATAGCTGCTGCCT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	20											109.0	101.0	103.0					20																	52612476		2203	4300	6503	52045883	SO:0001819	synonymous_variant	8537			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.837T>C	20.37:g.52612476A>G			52045883	A0AVG5|Q68CZ3	Silent	SNP	ENST00000395961.3	37	CCDS13444.1	SNP	15	WashU																																																																																				0.443	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657		Silent
SPTBN1	6711	genome.wustl.edu	37	2	54858068	54858068	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:54858068C>T	ENST00000356805.4	+	16	3165	c.2884C>T	c.(2884-2886)Ctc>Ttc	p.L962F	SPTBN1_ENST00000333896.5_Missense_Mutation_p.L949F	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	962					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.L962F(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAACTACCACCTCGAGTGCAA	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											56.0	49.0	52.0					2																	54858068		2203	4300	6503	54711572	SO:0001583	missense	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2884C>T	2.37:g.54858068C>T	ENSP00000349259:p.Leu962Phe		54711572	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281172	0.80692	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.50277	0.75;0.75	5.46	4.58	0.56647	.	0.062778	0.64402	N	0.000003	T	0.68091	0.2963	M	0.78801	2.425	0.58432	D	0.999995	P;D	0.59357	0.593;0.985	B;D	0.69142	0.288;0.962	T	0.73094	-0.4091	10	0.87932	D	0	.	14.2168	0.65797	0.0:0.9282:0.0:0.0718	.	949;962	Q01082-3;Q01082	.;SPTB2_HUMAN	F	962;949	ENSP00000349259:L962F;ENSP00000334156:L949F	ENSP00000334156:L949F	L	+	1	0	SPTBN1	54711572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	1.312000	0.45043	0.655000	0.94253	CTC		0.572	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			Missense_Mutation
ZNF280D	54816	genome.wustl.edu	37	15	56970892	56970892	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr15:56970892C>T	ENST00000267807.7	-	11	1348	c.1132G>A	c.(1132-1134)Gaa>Aaa	p.E378K	ZNF280D_ENST00000396245.1_Missense_Mutation_p.E82K|ZNF280D_ENST00000559000.1_Missense_Mutation_p.E365K|ZNF280D_ENST00000559237.1_Missense_Mutation_p.E365K	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E378K(1)		endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		TGTGTACTTTCGATGTGACAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	15											212.0	177.0	189.0					15																	56970892		2192	4292	6484	54758184	SO:0001583	missense	54816			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1132G>A	15.37:g.56970892C>T	ENSP00000267807:p.Glu378Lys		54758184	A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	ENST00000267807.7	37	CCDS32245.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020978	0.93462	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000260435;ENST00000396245	T;T	0.03358	3.96;4.45	5.37	5.37	0.77165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	2.773010	0.01749	N	0.029839	T	0.18425	0.0442	L	0.41632	1.29	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00651	-1.1626	10	0.87932	D	0	-21.1864	18.0841	0.89452	0.0:1.0:0.0:0.0	.	441;378	B4DHL1;Q6N043	.;Z280D_HUMAN	K	378;365;214;82	ENSP00000267807:E378K;ENSP00000379545:E82K	ENSP00000260435:E214K	E	-	1	0	ZNF280D	54758184	1.000000	0.71417	0.971000	0.41717	0.868000	0.49771	7.474000	0.81024	2.514000	0.84764	0.557000	0.71058	GAA		0.398	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418891.2	XM_370867		Missense_Mutation
TIMELESS	8914	genome.wustl.edu	37	12	56827333	56827333	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr12:56827333C>G	ENST00000553532.1	-	4	505	c.355G>C	c.(355-357)Gcc>Ccc	p.A119P	TIMELESS_ENST00000229201.4_Missense_Mutation_p.A119P|TIMELESS_ENST00000554616.1_Missense_Mutation_p.A119P					timeless circadian clock									p.A119P(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TCTTTGTAGGCCTGCAAATAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											106.0	111.0	109.0					12																	56827333		2203	4300	6503	55113600	SO:0001583	missense	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.355G>C	12.37:g.56827333C>G	ENSP00000450607:p.Ala119Pro		55113600		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862432	0.91511	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.66460	0.89;0.89;-0.21	5.42	5.42	0.78866	Timeless protein (1);	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.81243	-0.1021	10	0.62326	D	0.03	-13.2387	18.3784	0.90442	0.0:1.0:0.0:0.0	.	119;119	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	P	119	ENSP00000229201:A119P;ENSP00000450607:A119P;ENSP00000450848:A119P	ENSP00000229201:A119P	A	-	1	0	TIMELESS	55113600	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	3.906000	0.56340	2.712000	0.92718	0.650000	0.86243	GCC		0.483	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920		Missense_Mutation
DST	667	genome.wustl.edu	37	6	56499680	56499680	+	Silent	SNP	A	A	T	rs183601227		TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr6:56499680A>T	ENST00000361203.3	-	21	2632	c.2625T>A	c.(2623-2625)atT>atA	p.I875I	DST_ENST00000244364.6_Silent_p.I549I|DST_ENST00000446842.2_Silent_p.I549I|DST_ENST00000370754.5_Silent_p.I1053I|DST_ENST00000370769.4_Silent_p.I875I|DST_ENST00000518935.1_Silent_p.I549I|DST_ENST00000312431.6_Silent_p.I875I|DST_ENST00000370765.6_Silent_p.I549I|DST_ENST00000370788.2_Silent_p.I875I|DST_ENST00000421834.2_Silent_p.I875I			Q03001	DYST_HUMAN	dystonin	875					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.I549I(1)|p.I875I(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTTCAGTTGAATTATTGTTT	0.348																																																2	Substitution - coding silent(2)	ovary(2)	6											246.0	239.0	242.0					6																	56499680		2203	4300	6503	56607639	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2625T>A	6.37:g.56499680A>T			56607639	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37		SNP	9	WashU																																																																																				0.348	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Silent
NLRP12	91662	genome.wustl.edu	37	19	54313398	54313398	+	Silent	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr19:54313398G>A	ENST00000324134.6	-	3	1683	c.1515C>T	c.(1513-1515)aaC>aaT	p.N505N	NLRP12_ENST00000535162.1_Silent_p.N505N|NLRP12_ENST00000345770.5_Silent_p.N505N|NLRP12_ENST00000351894.4_Silent_p.N505N|NLRP12_ENST00000391773.1_Silent_p.N505N|NLRP12_ENST00000391775.3_Silent_p.N505N|NLRP12_ENST00000354278.3_Silent_p.N505N|NLRP12_ENST00000391772.1_Silent_p.N505N	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	505	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.N505N(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		ACCTCTCACAGTTGATGTCCT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	19											119.0	120.0	119.0					19																	54313398		2203	4300	6503	59005210	SO:0001819	synonymous_variant	91662			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1515C>T	19.37:g.54313398G>A			59005210	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	CCDS12864.1	SNP	36	WashU																																																																																				0.527	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		Silent
VPS13C	54832	genome.wustl.edu	37	15	62261606	62261606	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr15:62261606G>C	ENST00000261517.5	-	28	2876	c.2803C>G	c.(2803-2805)Cta>Gta	p.L935V	VPS13C_ENST00000395898.3_Missense_Mutation_p.L892V|VPS13C_ENST00000395896.4_Missense_Mutation_p.L935V|VPS13C_ENST00000249837.3_Missense_Mutation_p.L892V	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.L935V(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTAAATACTAGAATTGTATCT	0.299																																																1	Substitution - Missense(1)	ovary(1)	15											63.0	60.0	61.0					15																	62261606		2195	4281	6476	60048898	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2803C>G	15.37:g.62261606G>C	ENSP00000261517:p.Leu935Val		60048898		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408511	0.42715	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.16897	2.31;2.31;2.31	5.05	4.1	0.47936	.	0.102350	0.40064	N	0.001185	T	0.33294	0.0858	L	0.46947	1.48	0.49915	D	0.999837	D;D;D;P	0.89917	0.999;1.0;0.992;0.887	D;D;P;P	0.83275	0.959;0.996;0.89;0.684	T	0.02404	-1.1164	10	0.46703	T	0.11	.	12.9392	0.58333	0.0824:0.0:0.9176:0.0	.	892;935;892;935	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	V	892;935;935;935	ENSP00000249837:L892V;ENSP00000261517:L935V;ENSP00000379233:L935V	ENSP00000249837:L892V	L	-	1	2	VPS13C	60048898	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	1.975000	0.40569	1.196000	0.43129	0.561000	0.74099	CTA		0.299	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		Missense_Mutation
PRKCA	5578	genome.wustl.edu	37	17	64641582	64641582	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr17:64641582G>A	ENST00000413366.3	+	5	508	c.482G>A	c.(481-483)cGg>cAg	p.R161Q		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	161					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.R161Q(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AAGAGGGGGCGGATTTACCTA	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											154.0	137.0	143.0					17																	64641582		2203	4300	6503	62072044	SO:0001583	missense	5578				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.482G>A	17.37:g.64641582G>A	ENSP00000408695:p.Arg161Gln		62072044	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	CCDS11664.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.702229	0.96812	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T	0.39406	1.08	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	T	0.66228	0.2768	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.65443	0.935;0.933	T	0.65467	-0.6161	10	0.48119	T	0.1	.	19.6872	0.95984	0.0:0.0:1.0:0.0	.	161;72	P17252;Q59FI5	KPCA_HUMAN;.	Q	161;68	ENSP00000408695:R161Q	ENSP00000284384:R68Q	R	+	2	0	PRKCA	62072044	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	9.164000	0.94755	2.820000	0.97059	0.650000	0.86243	CGG		0.517	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			Missense_Mutation
ZNF549	256051	genome.wustl.edu	37	19	58049370	58049370	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr19:58049370T>A	ENST00000376233.3	+	4	1179	c.998T>A	c.(997-999)gTg>gAg	p.V333E	ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.V320E|ZNF549_ENST00000594943.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V320E(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGCCTTATGTGTGCAATGTA	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											101.0	98.0	99.0					19																	58049370		2203	4300	6503	62741182	SO:0001583	missense	256051			AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.998T>A	19.37:g.58049370T>A	ENSP00000365407:p.Val333Glu		62741182	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	37	CCDS56106.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.739407	0.00681	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.14391	2.51;2.51	2.92	1.89	0.25635	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02970	0.0088	N	0.01640	-0.785	0.09310	N	1	B;B	0.14805	0.011;0.003	B;B	0.16289	0.015;0.002	T	0.42224	-0.9464	9	0.02654	T	1	.	0.1233	0.00066	0.3398:0.1742:0.161:0.325	.	333;320	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	E	320;333	ENSP00000240719:V320E;ENSP00000365407:V333E	ENSP00000240719:V320E	V	+	2	0	ZNF549	62741182	0.000000	0.05858	0.088000	0.20740	0.810000	0.45777	-4.361000	0.00246	0.236000	0.21180	0.477000	0.44152	GTG		0.438	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263		Missense_Mutation
CCDC102B	79839	genome.wustl.edu	37	18	66678183	66678183	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr18:66678183C>T	ENST00000360242.5	+	7	1393	c.1276C>T	c.(1276-1278)Ctt>Ttt	p.L426F	CCDC102B_ENST00000319445.6_Missense_Mutation_p.L426F|CCDC102B_ENST00000584156.1_Missense_Mutation_p.L426F	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	426								p.L426F(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				ATTACTGAACCTTCAACATGC	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											63.0	60.0	61.0					18																	66678183		2203	4300	6503	64829163	SO:0001583	missense	79839			AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1276C>T	18.37:g.66678183C>T	ENSP00000353377:p.Leu426Phe		64829163	Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	CCDS11996.2	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870095	0.17322	.	.	ENSG00000150636	ENST00000319445;ENST00000360242	T;T	0.21734	1.99;1.99	5.4	3.54	0.40534	.	0.466449	0.18234	N	0.147474	T	0.21718	0.0523	M	0.67397	2.05	0.80722	D	1	B	0.32203	0.36	B	0.32022	0.139	T	0.02378	-1.1168	10	0.46703	T	0.11	-3.7455	6.9924	0.24763	0.0:0.729:0.172:0.0989	.	426	Q68D86	C102B_HUMAN	F	426	ENSP00000316237:L426F;ENSP00000353377:L426F	ENSP00000316237:L426F	L	+	1	0	CCDC102B	64829163	0.739000	0.28196	0.111000	0.21465	0.742000	0.42306	1.257000	0.32932	0.587000	0.29643	0.650000	0.86243	CTT		0.318	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781		Missense_Mutation
BAZ1B	9031	genome.wustl.edu	37	7	72877403	72877403	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr7:72877403T>C	ENST00000339594.4	-	12	3436	c.3098A>G	c.(3097-3099)cAt>cGt	p.H1033R	BAZ1B_ENST00000404251.1_Missense_Mutation_p.H1033R	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1033					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.H1033R(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCGTGCTAGATGAATAGAGTG	0.368																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)											1	Substitution - Missense(1)	ovary(1)	7											174.0	179.0	178.0					7																	72877403		2203	4300	6503	72515339	SO:0001583	missense	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.3098A>G	7.37:g.72877403T>C	ENSP00000342434:p.His1033Arg		72515339	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	37	CCDS5549.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664467	0.67700	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.58652	0.32;0.32	5.61	5.61	0.85477	.	0.047201	0.85682	D	0.000000	T	0.44350	0.1289	L	0.32530	0.975	0.50632	D	0.999887	P	0.42123	0.771	B	0.35727	0.209	T	0.37596	-0.9699	10	0.22706	T	0.39	-14.0452	14.9799	0.71303	0.0:0.0:0.0:1.0	.	1033	Q9UIG0	BAZ1B_HUMAN	R	1033	ENSP00000342434:H1033R;ENSP00000385442:H1033R	ENSP00000342434:H1033R	H	-	2	0	BAZ1B	72515339	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.444000	0.80532	2.145000	0.66743	0.482000	0.46254	CAT		0.368	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408		Missense_Mutation
MTHFD2L	441024	genome.wustl.edu	37	4	75040333	75040333	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr4:75040333G>T	ENST00000395759.2	+	2	281	c.254G>T	c.(253-255)aGt>aTt	p.S85I	MTHFD2L_ENST00000433372.1_5'UTR|MTHFD2L_ENST00000325278.6_Missense_Mutation_p.S27I|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.S27I	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	85					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)	p.S27I(1)		central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			CCTCACCTCAGTATAATTTTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	4											103.0	104.0	103.0					4																	75040333		2203	4300	6503	75259197	SO:0001583	missense	441024			BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.254G>T	4.37:g.75040333G>T	ENSP00000379108:p.Ser85Ile		75259197	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	CCDS47075.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558844	0.86231	.	.	ENSG00000163738	ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T	0.29655	1.99;1.56;1.57;1.99	5.48	5.48	0.80851	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.213853	0.56097	D	0.000022	T	0.50514	0.1620	L	0.58925	1.835	0.80722	D	1	D;B	0.57257	0.979;0.138	P;B	0.62560	0.904;0.086	T	0.47636	-0.9102	10	0.87932	D	0	-20.9146	16.8832	0.86069	0.0:0.0:1.0:0.0	.	85;27	Q9H903;Q9H903-3	MTD2L_HUMAN;.	I	85;27;27;27	ENSP00000379108:S85I;ENSP00000330982:S27I;ENSP00000352012:S27I;ENSP00000321984:S27I	ENSP00000321984:S27I	S	+	2	0	MTHFD2L	75259197	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	5.532000	0.67154	2.856000	0.98102	0.643000	0.83706	AGT		0.413	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346		Missense_Mutation
NARS2	79731	genome.wustl.edu	37	11	78277280	78277280	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr11:78277280C>G	ENST00000281038.5	-	4	786	c.411G>C	c.(409-411)gaG>gaC	p.E137D	NARS2_ENST00000528850.1_5'UTR	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	137					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)	p.E137D(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	GTCGCAGATACTCCAGAGGAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											84.0	82.0	83.0					11																	78277280		2200	4291	6491	77954928	SO:0001583	missense	79731			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.411G>C	11.37:g.78277280C>G	ENSP00000281038:p.Glu137Asp		77954928	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	14.20	2.463408	0.43736	.	.	ENSG00000137513	ENST00000281038;ENST00000529880	D;T	0.85955	-2.05;0.74	5.13	-2.27	0.06846	Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.050939	0.85682	D	0.000000	T	0.75243	0.3823	L	0.37800	1.135	0.80722	D	1	P	0.35628	0.513	B	0.35510	0.204	T	0.68205	-0.5470	10	0.72032	D	0.01	-16.3883	10.8438	0.46730	0.0:0.3508:0.0:0.6492	.	137	Q96I59	SYNM_HUMAN	D	137	ENSP00000281038:E137D;ENSP00000432240:E137D	ENSP00000281038:E137D	E	-	3	2	NARS2	77954928	0.945000	0.32115	0.661000	0.29709	0.356000	0.29392	0.014000	0.13333	-0.253000	0.09514	-0.136000	0.14681	GAG		0.368	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2	NM_024678		Missense_Mutation
PCSK5	5125	genome.wustl.edu	37	9	78804077	78804077	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:78804077G>T	ENST00000545128.1	+	19	2986	c.2448G>T	c.(2446-2448)caG>caT	p.Q816H	PCSK5_ENST00000376752.4_Missense_Mutation_p.Q816H	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	816	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.Q816H(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GATGCGTGCAGAGCTGTAGTA	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											128.0	108.0	115.0					9																	78804077		2203	4300	6503	77993897	SO:0001583	missense	5125				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2448G>T	9.37:g.78804077G>T	ENSP00000446280:p.Gln816His		77993897	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794715	0.31777	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376752;ENST00000424854;ENST00000455778	T;T;T;T	0.53423	0.62;1.53;1.47;0.93	5.7	2.81	0.32909	Growth factor, receptor (1);	0.211970	0.51477	D	0.000096	T	0.38321	0.1036	M	0.63169	1.94	0.28309	N	0.922742	P;B	0.39624	0.681;0.004	B;B	0.34779	0.189;0.012	T	0.30707	-0.9969	10	0.42905	T	0.14	-12.0223	6.4338	0.21811	0.1942:0.2472:0.5586:0.0	.	816;816	Q92824;Q92824-2	PCSK5_HUMAN;.	H	816;519;816;489;35	ENSP00000446280:Q816H;ENSP00000365943:Q816H;ENSP00000411654:Q489H;ENSP00000407239:Q35H	ENSP00000365943:Q816H	Q	+	3	2	PCSK5	77993897	0.997000	0.39634	0.997000	0.53966	0.994000	0.84299	0.639000	0.24690	0.327000	0.23409	0.561000	0.74099	CAG		0.478	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
ADAMTSL3	57188	genome.wustl.edu	37	15	84488784	84488784	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr15:84488784C>G	ENST00000286744.5	+	6	809	c.585C>G	c.(583-585)atC>atG	p.I195M	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.I195M	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	195						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.I195M(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACATGTGTATCAGTGGCATCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	15											143.0	113.0	123.0					15																	84488784		2203	4300	6503	82279788	SO:0001583	missense	57188			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.585C>G	15.37:g.84488784C>G	ENSP00000286744:p.Ile195Met		82279788	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702449	0.68501	.	.	ENSG00000156218	ENST00000286744	T	0.03553	3.89	5.6	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.18635	0.0447	M	0.87381	2.88	0.43930	D	0.996586	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.00666	-1.1619	10	0.87932	D	0	.	10.1072	0.42541	0.1282:0.7499:0.0:0.1218	.	195;195	P82987-2;P82987	.;ATL3_HUMAN	M	195	ENSP00000286744:I195M	ENSP00000286744:I195M	I	+	3	3	ADAMTSL3	82279788	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	2.366000	0.44204	1.292000	0.44672	0.655000	0.94253	ATC		0.488	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		Missense_Mutation
SEMA3D	223117	genome.wustl.edu	37	7	84651726	84651726	+	Silent	SNP	A	A	G			TCGA-13-0893-01	TCGA-13-0893-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr7:84651726A>G	ENST00000284136.6	-	11	1438	c.1395T>C	c.(1393-1395)gaT>gaC	p.D465D	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	465	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.D465D(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						GAAACATTACATCGTACTGGC	0.363																																					Ovarian(63;442 1191 17318 29975 31528)											1	Substitution - coding silent(1)	ovary(1)	7											221.0	198.0	206.0					7																	84651726		2203	4300	6503	84489662	SO:0001819	synonymous_variant	223117			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1395T>C	7.37:g.84651726A>G			84489662	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	37	CCDS34676.1	SNP	8	WashU																																																																																				0.363	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		Silent
COL11A1	1301	genome.wustl.edu	37	1	103491420	103491420	+	Intron	SNP	T	T	A			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:103491420T>A	ENST00000370096.3	-	7	1210				COL11A1_ENST00000353414.4_Intron|COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000358392.2_Missense_Mutation_p.E290V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.E290V(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGAAAATTTTTCAGATTTGGG	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	140.0	137.0					1																	103491420		2202	4299	6501	103264008	SO:0001627	intron_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.898-251A>T	1.37:g.103491420T>A			103264008	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587864	0.66105	.	.	ENSG00000060718	ENST00000358392;ENST00000427239	T;T	0.71579	-0.58;-0.51	5.35	5.35	0.76521	.	0.703483	0.13226	N	0.403996	T	0.60856	0.2301	M	0.62723	1.935	0.80722	D	1	P	0.48503	0.911	P	0.44561	0.453	T	0.60250	-0.7300	10	0.29301	T	0.29	.	13.9636	0.64196	0.0:0.0:0.0:1.0	.	290	P12107-2	.	V	290	ENSP00000351163:E290V;ENSP00000408640:E290V	ENSP00000351163:E290V	E	-	2	0	COL11A1	103264008	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.374000	0.66167	2.042000	0.60477	0.519000	0.50382	GAA		0.343	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		Missense_Mutation
RNF20	56254	genome.wustl.edu	37	9	104313974	104313974	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:104313974G>C	ENST00000389120.3	+	11	1371	c.1281G>C	c.(1279-1281)gaG>gaC	p.E427D	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	427					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E427D(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		AGCGAGATGAGGTTAGTCTTC	0.358																																																1	Substitution - Missense(1)	ovary(1)	9											82.0	80.0	81.0					9																	104313974		2203	4300	6503	103353795	SO:0001583	missense	56254			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1281G>C	9.37:g.104313974G>C	ENSP00000373772:p.Glu427Asp		103353795	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448402	0.43429	.	.	ENSG00000155827	ENST00000389120	T	0.46451	0.87	6.16	-0.779	0.10973	.	0.000000	0.85682	D	0.000000	T	0.58694	0.2140	M	0.80982	2.52	0.58432	D	0.999995	D	0.58970	0.984	D	0.68192	0.956	T	0.58470	-0.7631	10	0.26408	T	0.33	-27.9843	12.1773	0.54192	0.5609:0.0:0.4391:0.0	.	427	Q5VTR2	BRE1A_HUMAN	D	427	ENSP00000373772:E427D	ENSP00000373772:E427D	E	+	3	2	RNF20	103353795	0.991000	0.36638	0.996000	0.52242	0.976000	0.68499	0.236000	0.17967	-0.050000	0.13356	-0.781000	0.03364	GAG		0.358	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		Missense_Mutation
AHNAK2	113146	genome.wustl.edu	37	14	105420201	105420201	+	Silent	SNP	A	A	C			TCGA-13-0893-01	TCGA-13-0893-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr14:105420201A>C	ENST00000333244.5	-	7	1706	c.1587T>G	c.(1585-1587)ggT>ggG	p.G529G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	529						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCACCTCCTCACCCTTCAGGC	0.567																																																0			14											125.0	133.0	130.0					14																	105420201		2020	4169	6189	104491246	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1587T>G	14.37:g.105420201A>C			104491246	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	6	WashU																																																																																				0.567	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
IGHG2	3501	genome.wustl.edu	37	14	106109723	106109723	+	RNA	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr14:106109723C>A	ENST00000390545.2	-	0	797							P01859	IGHG2_HUMAN	immunoglobulin heavy constant gamma 2 (G2m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										AGTTGTTCTCCGGCTGCCCAT	0.602																																																0			14											152.0	158.0	156.0					14																	106109723		2000	4160	6160	105180768			0			J00230		14q32.33	2012-10-02			ENSG00000211893	ENSG00000211893		"""Immunoglobulins / IGH locus"""	5526	other	immunoglobulin gene		147110					Standard	NG_001019		Approved			P01859	OTTHUMG00000152482		14.37:g.106109723C>A			105180768	A6NE66	Nonsense_Mutation	SNP	ENST00000390545.2	37		SNP	23	WashU																																																																																				0.602	IGHG2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene	OTTHUMT00000326391.1	NG_001019		Nonsense_Mutation
IGHV1-46	28465	genome.wustl.edu	37	14	106967143	106967143	+	RNA	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr14:106967143C>T	ENST00000390622.2	-	0	560									immunoglobulin heavy variable 1-46																		CATGGTGACTCTGCCCTGGAA	0.562																																																0			14											191.0	187.0	188.0					14																	106967143		2096	4234	6330	106038188			0			X92343		14q32.33	2012-02-08			ENSG00000211962	ENSG00000211962		"""Immunoglobulins / IGH locus"""	5554	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151963		14.37:g.106967143C>T			106038188		Missense_Mutation	SNP	ENST00000390622.2	37		SNP	32	WashU																																																																																				0.562	IGHV1-46-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000324609.1	NG_001019		Missense_Mutation
ST6GAL2	84620	genome.wustl.edu	37	2	107460242	107460242	+	Silent	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:107460242G>A	ENST00000409382.3	-	2	802	c.192C>T	c.(190-192)gcC>gcT	p.A64A	ST6GAL2_ENST00000409087.3_Silent_p.A64A|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Silent_p.A64A	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	64					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.A64A(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GCTCATGTGCGGCGCCCATGA	0.716																																																1	Substitution - coding silent(1)	ovary(1)	2											14.0	17.0	16.0					2																	107460242		2178	4265	6443	106826674	SO:0001819	synonymous_variant	84620			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.192C>T	2.37:g.107460242G>A			106826674	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	37	CCDS2073.1	SNP	39	WashU																																																																																				0.716	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		Silent
ARPC3	10094	genome.wustl.edu	37	12	110878193	110878193	+	Splice_Site	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr12:110878193G>T	ENST00000228825.7	-	3	253	c.107C>A	c.(106-108)aCa>aAa	p.T36K	ARPC3_ENST00000471641.1_5'Flank|RP11-478C19.2_ENST00000550231.1_RNA	NM_001278556.1|NM_005719.2	NP_001265485.1|NP_005710.1	O15145	ARPC3_HUMAN	actin related protein 2/3 complex, subunit 3, 21kDa	36					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)	p.T36K(1)		lung(1)|ovary(1)	2						TGTATCTTTTGCTAAGCAGGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											65.0	63.0	63.0					12																	110878193		2203	4300	6503	109362576	SO:0001630	splice_region_variant	10094			AF006086	CCDS9146.1	12q24	2011-07-06	2002-08-29		ENSG00000111229	ENSG00000111229		"""Actin related protein 2/3 complex subunits"""	706	protein-coding gene	gene with protein product		604225	"""actin related protein 2/3 complex, subunit 3 (21 kD)"""			9230079, 9359840	Standard	NM_001278556		Approved	p21-Arc, ARC21	uc001tqq.3	O15145	OTTHUMG00000134333	ENST00000228825.7:c.107-1C>A	12.37:g.110878193G>T			109362576	O00554	Missense_Mutation	SNP	ENST00000228825.7	37	CCDS9146.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809815	0.31961	.	.	ENSG00000111229	ENST00000228825;ENST00000392683;ENST00000426440;ENST00000547365	.	.	.	5.99	5.99	0.97316	.	0.096084	0.64402	D	0.000001	T	0.67534	0.2903	L	0.59436	1.845	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.62950	-0.6745	9	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	36	O15145	ARPC3_HUMAN	K	36;36;36;28	.	ENSP00000228825:T36K	T	-	2	0	ARPC3	109362576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.882000	0.75589	2.840000	0.97914	0.655000	0.94253	ACA		0.348	ARPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259487.2		Missense_Mutation	Missense_Mutation
TMEM74	157753	genome.wustl.edu	37	8	109796471	109796471	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr8:109796471G>T	ENST00000297459.3	-	2	1035	c.857C>A	c.(856-858)aCg>aAg	p.T286K	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	286					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.T286K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GTTTTCATTCGTGCTGGTTTT	0.443																																																1	Substitution - Missense(1)	ovary(1)	8											87.0	84.0	85.0					8																	109796471		2203	4300	6503	109865647	SO:0001583	missense	157753			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.857C>A	8.37:g.109796471G>T	ENSP00000297459:p.Thr286Lys		109865647		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	8.929	0.962965	0.18583	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.96	0.702	0.18110	.	1.099310	0.06758	N	0.781274	T	0.46367	0.1389	L	0.36672	1.1	0.09310	N	1	B	0.32071	0.355	B	0.31946	0.138	T	0.51529	-0.8694	9	0.48119	T	0.1	1.172	21.061	0.99945	0.0:0.6621:0.3379:0.0	.	286	Q96NL1	TMM74_HUMAN	K	286	.	ENSP00000297459:T286K	T	-	2	0	TMEM74	109865647	0.239000	0.23836	0.001000	0.08648	0.291000	0.27294	2.646000	0.46630	-0.149000	0.11215	0.655000	0.94253	ACG		0.443	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015		Missense_Mutation
SLC16A4	9122	genome.wustl.edu	37	1	110924345	110924345	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:110924345G>A	ENST00000369779.4	-	4	542	c.293C>T	c.(292-294)aCt>aTt	p.T98I	SLC16A4_ENST00000541986.1_Missense_Mutation_p.T36I|SLC16A4_ENST00000497687.1_Intron|SLC16A4_ENST00000437429.2_Intron|SLC16A4_ENST00000472422.2_Intron|LAMTOR5-AS1_ENST00000590413.1_RNA|SLC16A4_ENST00000369781.4_Missense_Mutation_p.T98I	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	98					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)	p.T98I(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	ATATCCACCAGTAACAACGAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											109.0	101.0	104.0					1																	110924345		2203	4300	6503	110725868	SO:0001583	missense	9122			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.293C>T	1.37:g.110924345G>A	ENSP00000358794:p.Thr98Ile		110725868	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	ENST00000369779.4	37	CCDS823.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426784	0.43020	.	.	ENSG00000168679	ENST00000369779;ENST00000369781;ENST00000541986	T;T;T	0.56611	0.45;0.45;0.45	4.96	3.08	0.35506	Major facilitator superfamily domain, general substrate transporter (1);	0.755149	0.13366	N	0.393306	T	0.34424	0.0897	L	0.55481	1.735	0.40995	D	0.98488	B;B;B;B	0.26602	0.093;0.111;0.019;0.154	B;B;B;B	0.34590	0.124;0.186;0.102;0.079	T	0.33727	-0.9857	10	0.59425	D	0.04	.	8.1864	0.31341	0.0852:0.3707:0.5442:0.0	.	36;98;98;98	B4DJ67;Q53FH9;Q8WU09;O15374	.;.;.;MOT5_HUMAN	I	98;98;36	ENSP00000358794:T98I;ENSP00000358796:T98I;ENSP00000446087:T36I	ENSP00000358794:T98I	T	-	2	0	SLC16A4	110725868	0.116000	0.22171	0.166000	0.22797	0.991000	0.79684	2.500000	0.45381	0.795000	0.33922	0.655000	0.94253	ACT		0.428	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696		Missense_Mutation
ZCCHC16	340595	genome.wustl.edu	37	X	111698393	111698393	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chrX:111698393C>T	ENST00000340433.2	+	1	667	c.437C>T	c.(436-438)cCt>cTt	p.P146L		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	146							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P146L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						GAAATCAATCCTCTGATGAAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											83.0	79.0	81.0					X																	111698393		2203	4300	6503	111585049	SO:0001583	missense	340595			AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.437C>T	X.37:g.111698393C>T	ENSP00000340590:p.Pro146Leu		111585049	B2RPG1	Missense_Mutation	SNP	ENST00000340433.2	37	CCDS35369.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.651875	0.00785	.	.	ENSG00000187823	ENST00000340433	T	0.30448	1.53	4.12	1.3	0.21679	.	1.081410	0.07229	N	0.862202	T	0.18425	0.0442	N	0.17082	0.46	0.09310	N	1	B	0.10296	0.003	B	0.16722	0.016	T	0.30327	-0.9982	10	0.42905	T	0.14	-0.3401	4.1987	0.10455	0.1566:0.5941:0.1507:0.0986	.	146	Q6ZR62	ZCH16_HUMAN	L	146	ENSP00000340590:P146L	ENSP00000340590:P146L	P	+	2	0	ZCCHC16	111585049	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.066000	0.03454	-0.073000	0.12842	-1.225000	0.01585	CCT		0.418	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356964.1	NM_001004308		Missense_Mutation
C1orf162	128346	genome.wustl.edu	37	1	112020639	112020639	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:112020639C>T	ENST00000343534.5	+	6	612	c.362C>T	c.(361-363)gCc>gTc	p.A121V	C1orf162_ENST00000369718.3_Missense_Mutation_p.A96V|C1orf162_ENST00000464591.1_3'UTR	NM_174896.2	NP_777556.1	Q8NEQ5	CA162_HUMAN	chromosome 1 open reading frame 162	121						integral component of membrane (GO:0016021)		p.A121V(1)		NS(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5		all_cancers(81;0.00116)|all_epithelial(167;0.000761)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0236)|Colorectal(144;0.0286)|all cancers(265;0.0572)|Epithelial(280;0.0862)|COAD - Colon adenocarcinoma(174;0.112)|LUSC - Lung squamous cell carcinoma(189;0.134)		CTTACCTATGCCAGCACAACT	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	98.0	99.0					1																	112020639		2203	4300	6503	111822162	SO:0001583	missense	128346			BC017973	CCDS837.1, CCDS72837.1	1p13.2	2008-02-05			ENSG00000143110	ENSG00000143110			28344	protein-coding gene	gene with protein product						12477932	Standard	XM_005270475		Approved	MGC24133	uc001ebe.3	Q8NEQ5	OTTHUMG00000011750	ENST00000343534.5:c.362C>T	1.37:g.112020639C>T	ENSP00000344218:p.Ala121Val		111822162	Q5QNZ1	Missense_Mutation	SNP	ENST00000343534.5	37	CCDS837.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589791	0.66105	.	.	ENSG00000143110	ENST00000343534;ENST00000369718	T;T	0.59772	0.24;0.25	5.11	4.15	0.48705	.	0.000000	0.44688	D	0.000423	T	0.53238	0.1784	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.72338	0.977	T	0.45804	-0.9236	10	0.87932	D	0	-10.5295	11.5922	0.50951	0.0:0.8212:0.1788:0.0	.	121	Q8NEQ5	CA162_HUMAN	V	121;96	ENSP00000344218:A121V;ENSP00000358732:A96V	ENSP00000344218:A121V	A	+	2	0	C1orf162	111822162	0.052000	0.20516	0.192000	0.23308	0.011000	0.07611	0.626000	0.24492	2.651000	0.90000	0.655000	0.94253	GCC		0.443	C1orf162-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032471.1	NM_174896		Missense_Mutation
ANAPC1	64682	genome.wustl.edu	37	2	112529959	112529959	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:112529959G>C	ENST00000341068.3	-	47	6450	c.5678C>G	c.(5677-5679)tCt>tGt	p.S1893C	MIR4771-1_ENST00000577758.1_RNA	NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1893					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						AGCTGGCACAGAGTGGTAGAC	0.517																																																0			2											41.0	39.0	39.0					2																	112529959		2203	4294	6497	112246430	SO:0001583	missense	64682			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.5678C>G	2.37:g.112529959G>C	ENSP00000339109:p.Ser1893Cys		112246430	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	37	CCDS2093.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172202	0.78452	.	.	ENSG00000153107	ENST00000341068	.	.	.	4.27	4.27	0.50696	.	0.351548	0.18799	N	0.130834	T	0.66752	0.2821	L	0.34521	1.04	0.58432	D	0.999996	D	0.76494	0.999	D	0.70716	0.97	T	0.70234	-0.4928	9	0.59425	D	0.04	-5.0882	16.6794	0.85288	0.0:0.0:1.0:0.0	.	1893	Q9H1A4	APC1_HUMAN	C	1893	.	ENSP00000339109:S1893C	S	-	2	0	ANAPC1	112246430	1.000000	0.71417	0.906000	0.35671	0.973000	0.67179	8.184000	0.89702	1.907000	0.55213	0.561000	0.74099	TCT		0.517	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662		Missense_Mutation
COL14A1	7373	genome.wustl.edu	37	8	121237330	121237330	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr8:121237330G>T	ENST00000297848.3	+	15	2011	c.1741G>T	c.(1741-1743)Gaa>Taa	p.E581*	COL14A1_ENST00000309791.4_Nonsense_Mutation_p.E581*|COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Nonsense_Mutation_p.E486*	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.E581*(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTGACAGGTTGAAGTCGATCC	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	8											122.0	117.0	118.0					8																	121237330		2203	4300	6503	121306511	SO:0001587	stop_gained	7373				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1741G>T	8.37:g.121237330G>T	ENSP00000297848:p.Glu581*		121306511		Nonsense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.689335	0.96784	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	.	.	.	5.39	5.39	0.77823	.	0.299357	0.35739	N	0.003015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	17.9201	0.88963	0.0:0.0:1.0:0.0	.	.	.	.	X	581;581;486;394	.	ENSP00000247781:E486X	E	+	1	0	COL14A1	121306511	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.864000	0.87037	2.517000	0.84864	0.561000	0.74099	GAA		0.388	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		Nonsense_Mutation
OR8B3	390271	genome.wustl.edu	37	11	124266883	124266883	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr11:124266883C>T	ENST00000354597.3	-	1	381	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122H(1)		kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GGCCACATAGCGATCATATGC	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											74.0	63.0	67.0					11																	124266883		2201	4299	6500	123772093	SO:0001583	missense	390271			AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.365G>A	11.37:g.124266883C>T	ENSP00000346611:p.Arg122His		123772093	Q6IFQ8|Q8NGH1	Missense_Mutation	SNP	ENST00000354597.3	37	CCDS31709.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	N	14.29	2.490020	0.44249	.	.	ENSG00000196661	ENST00000354597	T	0.77489	-1.1	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.103551	0.43919	D	0.000518	T	0.79610	0.4475	M	0.84683	2.71	0.47276	D	0.999371	P	0.46277	0.875	B	0.39904	0.313	D	0.86071	0.1538	10	0.87932	D	0	.	15.8757	0.79159	0.0:1.0:0.0:0.0	.	122	Q8NGG8	OR8B3_HUMAN	H	122	ENSP00000346611:R122H	ENSP00000346611:R122H	R	-	2	0	OR8B3	123772093	0.674000	0.27549	1.000000	0.80357	0.194000	0.23727	5.429000	0.66495	2.237000	0.73441	0.637000	0.83480	CGC		0.408	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387291.1	NM_001005467		Missense_Mutation
OR1L6	392390	genome.wustl.edu	37	9	125512888	125512888	+	Silent	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr9:125512888G>A	ENST00000373684.1	+	1	870	c.870G>A	c.(868-870)ggG>ggA	p.G290G	OR1L6_ENST00000304720.2_Silent_p.G254G			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G290G(1)		breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						TTTTCTATGGGAGTATTATTT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	9											109.0	92.0	98.0					9																	125512888		2203	4300	6503	124552709	SO:0001819	synonymous_variant	392390				CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.870G>A	9.37:g.125512888G>A			124552709	Q6IFM8|Q96R80	Silent	SNP	ENST00000373684.1	37		SNP	41	WashU																																																																																				0.512	OR1L6-201	KNOWN	basic	protein_coding	protein_coding				Silent
FER1L6	654463	genome.wustl.edu	37	8	124989778	124989778	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0893-01	TCGA-13-0893-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr8:124989778T>G	ENST00000522917.1	+	10	1198	c.992T>G	c.(991-993)aTg>aGg	p.M331R	FER1L6_ENST00000399018.1_Missense_Mutation_p.M331R	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	331	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.M331R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAAGGCAGCATGAATGACGTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	8											142.0	142.0	142.0					8																	124989778		2028	4187	6215	125058959	SO:0001583	missense	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.992T>G	8.37:g.124989778T>G	ENSP00000428280:p.Met331Arg		125058959		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016268	0.75161	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.09073	3.02;3.02	5.53	5.53	0.82687	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.056598	0.64402	U	0.000002	T	0.19005	0.0456	M	0.66939	2.045	0.80722	D	1	P	0.48016	0.904	P	0.50490	0.642	T	0.00516	-1.1694	10	0.40728	T	0.16	.	15.6745	0.77303	0.0:0.0:0.0:1.0	.	331	Q2WGJ9	FR1L6_HUMAN	R	331	ENSP00000428280:M331R;ENSP00000381982:M331R	ENSP00000381982:M331R	M	+	2	0	FER1L6	125058959	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	7.997000	0.88414	2.109000	0.64355	0.459000	0.35465	ATG		0.473	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		Missense_Mutation
NTM	50863	genome.wustl.edu	37	11	132184608	132184608	+	Intron	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr11:132184608G>T	ENST00000374786.1	+	6	1413				NTM_ENST00000474900.1_Intron|NTM_ENST00000539799.1_Intron|NTM_ENST00000427481.2_Intron|NTM_ENST00000374784.1_Silent_p.V315V|NTM_ENST00000374791.3_Intron|NTM_ENST00000425719.2_Intron	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTGAGACTGTGCTCTGAGCTG	0.562																																																0			11											63.0	55.0	58.0					11																	132184608		2201	4297	6498	131689818	SO:0001627	intron_variant	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.934+11G>T	11.37:g.132184608G>T			131689818	A0MTT2|Q6UXJ3|Q86VJ9	Silent	SNP	ENST00000374786.1	37	CCDS8491.1	SNP	46	WashU																																																																																				0.562	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		Silent
ANKHD1	54882	genome.wustl.edu	37	5	139917093	139917093	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr5:139917093G>A	ENST00000360839.2	+	31	7301	c.7147G>A	c.(7147-7149)Gca>Aca	p.A2383T	ANKHD1_ENST00000297183.6_Missense_Mutation_p.A2383T|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.A2383T|ANKHD1_ENST00000544120.1_Missense_Mutation_p.A707T	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2383						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.A2383T(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGTCTGTTGCACAAGCCCC	0.542																																																2	Substitution - Missense(2)	ovary(2)	5											108.0	98.0	101.0					5																	139917093		2203	4300	6503	139897277	SO:0001583	missense	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7147G>A	5.37:g.139917093G>A	ENSP00000354085:p.Ala2383Thr		139897277	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	SNP	46	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.78|12.78	2.040586|2.040586	0.35989|0.35989	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000544120;ENST00000532219;ENST00000437495|ENST00000435794;ENST00000432301	T;T;T;T;T;T;T|.	0.66280|.	-0.09;-0.2;1.92;1.91;1.46;-0.2;0.86|.	6.08|6.08	0.675|0.675	0.17952|0.17952	.|.	0.376195|.	0.29676|.	N|.	0.011494|.	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.03115|0.03115	-0.41|-0.41	0.23831|0.23831	N|N	0.996727|0.996727	B;B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.04013|.	0.0;0.001;0.001;0.0;0.0;0.001|.	T|T	0.31392|0.31392	-0.9945|-0.9945	10|5	0.19590|.	T|.	0.45|.	.|.	4.5191|4.5191	0.11950|0.11950	0.5535:0.0:0.2788:0.1677|0.5535:0.0:0.2788:0.1677	.|.	707;830;707;2400;2383;2383|.	Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;.;ANKH1_HUMAN|.	T|Y	2383;2383;2400;1056;922;707;2383;411|873;774	ENSP00000354085:A2383T;ENSP00000297183:A2383T;ENSP00000393204:A1056T;ENSP00000390034:A922T;ENSP00000437687:A707T;ENSP00000432016:A2383T;ENSP00000396882:A411T|.	ENSP00000396882:A411T|.	A|C	+|+	1|2	0|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139897277|139897277	0.985000|0.985000	0.35326|0.35326	0.918000|0.918000	0.36340|0.36340	0.993000|0.993000	0.82548|0.82548	2.430000|2.430000	0.44766|0.44766	0.168000|0.168000	0.19655|0.19655	0.591000|0.591000	0.81541|0.81541	GCA|TGC		0.542	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747		Missense_Mutation
OR6V1	346517	genome.wustl.edu	37	7	142750168	142750168	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr7:142750168C>A	ENST00000418316.1	+	1	752	c.731C>A	c.(730-732)aCa>aAa	p.T244K		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T244K(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					TCTCACCTCACACTGGTCTTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											124.0	128.0	127.0					7																	142750168		2058	4203	6261	142460290	SO:0001583	missense	346517				CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.731C>A	7.37:g.142750168C>A	ENSP00000396085:p.Thr244Lys		142460290	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	37	CCDS47728.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084105	0.55861	.	.	ENSG00000225781	ENST00000418316	T	0.39229	1.09	4.72	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.70002	0.3174	H	0.95679	3.705	0.18873	N	0.999982	D	0.67145	0.996	D	0.68765	0.96	T	0.62464	-0.6849	9	0.87932	D	0	.	7.027	0.24946	0.0:0.7987:0.0:0.2013	.	244	Q8N148	OR6V1_HUMAN	K	244	ENSP00000396085:T244K	ENSP00000396085:T244K	T	+	2	0	OR6V1	142460290	0.005000	0.15991	0.004000	0.12327	0.974000	0.67602	0.869000	0.27996	1.203000	0.43233	0.655000	0.94253	ACA		0.547	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1			Missense_Mutation
CYP11B1	1584	genome.wustl.edu	37	8	143961072	143961072	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0893-01	TCGA-13-0893-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr8:143961072A>T	ENST00000292427.4	-	1	190	c.158T>A	c.(157-159)cTg>cAg	p.L53Q	CYP11B1_ENST00000517471.1_Missense_Mutation_p.L53Q|CYP11B1_ENST00000377675.3_Missense_Mutation_p.L53Q	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	53					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.L53Q(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CCAGATCTGCAGCAGCCTCAG	0.637									Familial Hyperaldosteronism type I																																							1	Substitution - Missense(1)	ovary(1)	8											69.0	64.0	66.0					8																	143961072		2203	4300	6503	143958074	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.158T>A	8.37:g.143961072A>T	ENSP00000292427:p.Leu53Gln		143958074	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980827	0.53827	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.80824	-0.59;2.42;-1.42	2.96	1.77	0.24775	.	0.309935	0.18092	N	0.151973	D	0.85890	0.5802	M	0.76328	2.33	0.32940	D	0.518255	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.971;0.994;0.992	D	0.84390	0.0554	10	0.56958	D	0.05	.	5.0885	0.14696	0.8439:0.0:0.1561:0.0	.	53;53;53	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	Q	53	ENSP00000292427:L53Q;ENSP00000428043:L53Q;ENSP00000366903:L53Q	ENSP00000292427:L53Q	L	-	2	0	CYP11B1	143958074	0.994000	0.37717	0.311000	0.25182	0.893000	0.52053	1.845000	0.39279	0.317000	0.23160	0.254000	0.18369	CTG		0.637	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			Missense_Mutation
P2RY13	53829	genome.wustl.edu	37	3	151045909	151045909	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0893-01	TCGA-13-0893-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr3:151045909A>G	ENST00000325602.5	-	2	954	c.935T>C	c.(934-936)aTg>aCg	p.M312T	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	312					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.M291T(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			TAAGGGATCCATACAAATGTT	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											118.0	117.0	117.0					3																	151045909		2203	4300	6503	152528599	SO:0001583	missense	53829			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.935T>C	3.37:g.151045909A>G	ENSP00000320376:p.Met312Thr		152528599	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	ENST00000325602.5	37	CCDS3158.2	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814832	0.70912	.	.	ENSG00000181631	ENST00000325602	T	0.27720	1.65	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.046599	0.85682	D	0.000000	T	0.50086	0.1595	L	0.54323	1.7	0.52099	D	0.999949	D	0.63046	0.992	D	0.64877	0.93	T	0.51426	-0.8707	10	0.87932	D	0	-38.8247	15.8697	0.79101	1.0:0.0:0.0:0.0	.	312	Q9BPV8	P2Y13_HUMAN	T	312	ENSP00000320376:M312T	ENSP00000320376:M312T	M	-	2	0	P2RY13	152528599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.929000	0.92859	2.152000	0.67230	0.533000	0.62120	ATG		0.353	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341468.1	NM_023914		Missense_Mutation
MED12L	116931	genome.wustl.edu	37	3	151105747	151105747	+	Silent	SNP	G	G	A	rs530265514		TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr3:151105747G>A	ENST00000474524.1	+	35	5171	c.5133G>A	c.(5131-5133)ctG>ctA	p.L1711L	MED12L_ENST00000273432.4_Silent_p.L1571L	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1711						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACCTCCTGCTGTATCACACAC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17613	0.0		0.0	False		,,,				2504	0.001															0			3											123.0	95.0	105.0					3																	151105747		2203	4300	6503	152588437	SO:0001819	synonymous_variant	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5133G>A	3.37:g.151105747G>A			152588437	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1	SNP	48	WashU																																																																																				0.582	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		Silent
SMG5	23381	genome.wustl.edu	37	1	156233315	156233315	+	Silent	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:156233315G>A	ENST00000361813.5	-	13	2046	c.1902C>T	c.(1900-1902)cgC>cgT	p.R634R	SMG5_ENST00000368267.5_Intron|SMG5_ENST00000489907.2_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	634					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.R634R(1)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TCCGACAGGAGCGTCCACTGG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											94.0	84.0	88.0					1																	156233315		2203	4300	6503	154499939	SO:0001819	synonymous_variant	23381			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1902C>T	1.37:g.156233315G>A			154499939	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Silent	SNP	ENST00000361813.5	37	CCDS1137.1	SNP	34	WashU																																																																																				0.562	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		Silent
CNKSR3	154043	genome.wustl.edu	37	6	154743698	154743698	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr6:154743698G>T	ENST00000607772.1	-	9	1431	c.887C>A	c.(886-888)tCt>tAt	p.S296Y	CNKSR3_ENST00000433165.2_Missense_Mutation_p.S121Y|CNKSR3_ENST00000479339.1_Missense_Mutation_p.S216Y	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	296					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.S296Y(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		AAAGTTGAAAGACCCGGTGGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											110.0	118.0	115.0					6																	154743698		2203	4300	6503	154785390	SO:0001583	missense	154043			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.887C>A	6.37:g.154743698G>T	ENSP00000475915:p.Ser296Tyr		154785390	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	16.58	3.164297	0.57476	.	.	ENSG00000153721	ENST00000367209;ENST00000367213;ENST00000433165;ENST00000479339;ENST00000424998;ENST00000454664	T;T;T;T	0.49720	1.38;0.79;0.8;0.77	5.66	5.66	0.87406	PDZ/DHR/GLGF (1);	0.444046	0.24206	N	0.040571	T	0.31575	0.0801	L	0.36672	1.1	0.28003	N	0.935209	P	0.40875	0.731	B	0.43360	0.417	T	0.28073	-1.0055	10	0.66056	D	0.02	.	15.2608	0.73621	0.0:0.1397:0.8603:0.0	.	296	Q6P9H4	CNKR3_HUMAN	Y	71;296;121;216;58;121	ENSP00000356182:S296Y;ENSP00000414185:S121Y;ENSP00000418975:S216Y;ENSP00000406740:S121Y	ENSP00000356178:S71Y	S	-	2	0	CNKSR3	154785390	1.000000	0.71417	0.158000	0.22627	0.536000	0.34869	5.237000	0.65360	2.656000	0.90262	0.655000	0.94253	TCT		0.473	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515		Missense_Mutation
RGS4	5999	genome.wustl.edu	37	1	163043354	163043354	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:163043354T>A	ENST00000367909.6	+	4	660	c.320T>A	c.(319-321)cTa>cAa	p.L107Q	RGS4_ENST00000527809.1_Missense_Mutation_p.L89Q|RGS4_ENST00000421743.2_Missense_Mutation_p.L204Q|RGS4_ENST00000367908.4_Intron|RGS4_ENST00000367906.3_Missense_Mutation_p.L89Q|RGS4_ENST00000531057.1_Missense_Mutation_p.L107Q|RGS4_ENST00000491263.1_3'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	107	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.L107Q(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CCATCTAAACTAAGTCCCAAG	0.358																																					Ovarian(76;1257 1738 3039 6086)											1	Substitution - Missense(1)	ovary(1)	1											100.0	92.0	95.0					1																	163043354		2203	4300	6503	161309978	SO:0001583	missense	5999			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.320T>A	1.37:g.163043354T>A	ENSP00000356885:p.Leu107Gln		161309978	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	CCDS1243.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072974	0.76415	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000527809;ENST00000367906;ENST00000528938	T;T;T;T;T;T	0.02345	4.33;4.33;4.33;4.33;4.33;4.33	4.99	3.84	0.44239	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.143577	0.44688	D	0.000429	T	0.06781	0.0173	M	0.74546	2.27	0.45791	D	0.998672	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.983	T	0.02766	-1.1113	9	0.87932	D	0	.	10.1069	0.42539	0.0:0.0:0.1688:0.8312	.	107;204	P49798;A7XA59	RGS4_HUMAN;.	Q	204;107;107;89;89;89	ENSP00000397181:L204Q;ENSP00000356885:L107Q;ENSP00000436106:L107Q;ENSP00000433261:L89Q;ENSP00000356882:L89Q;ENSP00000432194:L89Q	ENSP00000356882:L89Q	L	+	2	0	RGS4	161309978	1.000000	0.71417	0.576000	0.28549	0.999000	0.98932	7.691000	0.84191	0.894000	0.36317	0.528000	0.53228	CTA		0.358	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		Missense_Mutation
RCSD1	92241	genome.wustl.edu	37	1	167659343	167659343	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:167659343A>T	ENST00000367854.3	+	4	587	c.256A>T	c.(256-258)Att>Ttt	p.I86F	RCSD1_ENST00000537350.1_Missense_Mutation_p.I56F	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	86					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)	p.I86F(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CTCGCCTCTGATTGAGAAGCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											136.0	123.0	127.0					1																	167659343		2203	4300	6503	165925967	SO:0001583	missense	92241			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.256A>T	1.37:g.167659343A>T	ENSP00000356828:p.Ile86Phe		165925967	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	25.6	4.657781	0.88154	.	.	ENSG00000198771	ENST00000367854;ENST00000537350	T;T	0.65364	-0.15;-0.13	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.72914	0.3520	M	0.67700	2.07	0.40428	D	0.979914	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.76498	-0.2937	9	0.62326	D	0.03	-12.029	16.0681	0.80903	1.0:0.0:0.0:0.0	.	56;86	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	F	86;56	ENSP00000356828:I86F;ENSP00000439409:I56F	ENSP00000356828:I86F	I	+	1	0	RCSD1	165925967	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.963000	0.70372	2.188000	0.69820	0.528000	0.53228	ATT		0.423	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862		Missense_Mutation
XIRP2	129446	genome.wustl.edu	37	2	168107681	168107681	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:168107681A>G	ENST00000409195.1	+	9	9868	c.9779A>G	c.(9778-9780)gAg>gGg	p.E3260G	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E3260G|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.E3038G|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3085					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E3260G(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GACGCTCAAGAGGAAATCAGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											67.0	63.0	64.0					2																	168107681		1902	4130	6032	167815927	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9779A>G	2.37:g.168107681A>G	ENSP00000386840:p.Glu3260Gly		167815927	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	9.602	1.128976	0.21041	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.05382	3.48;3.48;3.45	5.61	4.45	0.53987	.	0.050567	0.85682	N	0.000000	T	0.07369	0.0186	L	0.45137	1.4	0.58432	D	0.999999	B;B;P	0.41041	0.022;0.037;0.736	B;B;B	0.38500	0.018;0.039;0.275	T	0.13442	-1.0509	10	0.87932	D	0	-10.5571	10.9768	0.47472	0.9251:0.0:0.0749:0.0	.	3085;3085;3038	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	G	3260;3260;3038;674	ENSP00000386840:E3260G;ENSP00000295237:E3260G;ENSP00000387255:E3038G	ENSP00000295237:E3260G	E	+	2	0	XIRP2	167815927	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	3.819000	0.55686	1.058000	0.40530	0.377000	0.23210	GAG		0.418	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		Missense_Mutation
RC3H1	149041	genome.wustl.edu	37	1	173953671	173953671	+	Silent	SNP	T	T	C			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:173953671T>C	ENST00000367696.2	-	3	669	c.318A>G	c.(316-318)ttA>ttG	p.L106L	RC3H1_ENST00000258349.4_Silent_p.L106L|RC3H1_ENST00000367694.2_Silent_p.L106L			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	106					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L106L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						AGTACAATGCTAATTCTTCTA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	1											121.0	100.0	107.0					1																	173953671		2203	4300	6503	172220294	SO:0001819	synonymous_variant	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.318A>G	1.37:g.173953671T>C			172220294	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Silent	SNP	ENST00000367696.2	37	CCDS30940.1	SNP	53	WashU																																																																																				0.383	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		Silent
HRH2	3274	genome.wustl.edu	37	5	175110476	175110476	+	Silent	SNP	G	G	C			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr5:175110476G>C	ENST00000231683.2	+	1	2013	c.240G>C	c.(238-240)ctG>ctC	p.L80L	HRH2_ENST00000377291.2_Silent_p.L80L	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	80					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.L80L(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	TCTACCAGCTGTCCTGCAAGT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	5											124.0	95.0	105.0					5																	175110476		2203	4300	6503	175043082	SO:0001819	synonymous_variant	3274				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.240G>C	5.37:g.175110476G>C			175043082	B5BUP7|Q14464|Q7Z5R9	Silent	SNP	ENST00000231683.2	37	CCDS4395.1	SNP	48	WashU																																																																																				0.547	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1			Silent
CHN1	1123	genome.wustl.edu	37	2	175779838	175779838	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:175779838A>T	ENST00000409900.3	-	5	521	c.208T>A	c.(208-210)Tac>Aac	p.Y70N	CHN1_ENST00000409156.3_Missense_Mutation_p.Y70N|CHN1_ENST00000488080.1_5'UTR	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	70	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.Y70N(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			CGGATGAGGTAGCTCCCCTCA	0.483			T	TAF15	extraskeletal myxoid chondrosarcoma																																		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	1	Substitution - Missense(1)	ovary(1)	2											36.0	37.0	37.0					2																	175779838		1914	4124	6038	175488084	SO:0001583	missense	1123				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.208T>A	2.37:g.175779838A>T	ENSP00000386741:p.Tyr70Asn		175488084	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	ENST00000409900.3	37	CCDS46455.1	SNP	15	WashU	.	.	.	.	.	.	.	.	.	.	A	29.5	5.008288	0.93346	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	T;T	0.68181	-0.31;-0.31	5.72	5.72	0.89469	SH2 motif (4);	0.054538	0.85682	D	0.000000	D	0.86192	0.5874	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89676	0.3887	10	0.87932	D	0	.	15.1216	0.72447	1.0:0.0:0.0:0.0	.	70;70	B4DV19;P15882	.;CHIN_HUMAN	N	70	ENSP00000386741:Y70N;ENSP00000386470:Y70N	ENSP00000386470:Y70N	Y	-	1	0	CHN1	175488084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.629000	0.90983	2.311000	0.77944	0.533000	0.62120	TAC		0.483	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1	NM_001822		Missense_Mutation
UIMC1	51720	genome.wustl.edu	37	5	176409537	176409537	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0893-01	TCGA-13-0893-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr5:176409537G>T	ENST00000377227.4	-	2	212	c.80C>A	c.(79-81)tCt>tAt	p.S27Y	UIMC1_ENST00000511320.1_Missense_Mutation_p.S27Y|UIMC1_ENST00000506128.1_Missense_Mutation_p.S27Y|UIMC1_ENST00000377219.2_Missense_Mutation_p.S27Y			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	27	Necessary for transcriptional repression.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.S27Y(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACACTGACAGAACTGGTAGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	5											209.0	187.0	194.0					5																	176409537		2203	4300	6503	176342143	SO:0001583	missense	51720			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.80C>A	5.37:g.176409537G>T	ENSP00000366434:p.Ser27Tyr		176342143	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	CCDS4408.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	6.856	0.527258	0.13066	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000506128;ENST00000509236;ENST00000507513;ENST00000428382	T;T;T;T;T;T;T	0.59364	1.38;1.38;1.38;1.38;1.38;1.38;0.27	4.81	0.774	0.18521	.	0.528883	0.17338	N	0.177858	T	0.52948	0.1766	L	0.44542	1.39	0.09310	N	1	D;B;B	0.59767	0.986;0.003;0.003	P;B;B	0.54100	0.742;0.003;0.005	T	0.43940	-0.9360	10	0.59425	D	0.04	0.3385	2.9782	0.05945	0.0847:0.2866:0.3346:0.294	.	27;27;27	Q96RL1-5;Q96RL1;D6RCF3	.;UIMC1_HUMAN;.	Y	27	ENSP00000366434:S27Y;ENSP00000366425:S27Y;ENSP00000421926:S27Y;ENSP00000427480:S27Y;ENSP00000423885:S27Y;ENSP00000425163:S27Y;ENSP00000423534:S27Y	ENSP00000366425:S27Y	S	-	2	0	UIMC1	176342143	0.001000	0.12720	0.081000	0.20488	0.123000	0.20343	0.785000	0.26830	0.154000	0.19237	-0.182000	0.12963	TCT		0.423	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179440589	179440589	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:179440589T>C	ENST00000591111.1	-	276	65571	c.65347A>G	c.(65347-65349)Aaa>Gaa	p.K21783E	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K14484E|TTN_ENST00000460472.2_Missense_Mutation_p.K14359E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K14551E|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K20856E|TTN-AS1_ENST00000592630.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K23424E			Q8WZ42	TITIN_HUMAN	titin	21783	Ig-like 114.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K14359E(1)|p.K20854E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGCCACTTTTCTTCCCAGCC	0.468																																																2	Substitution - Missense(2)	ovary(2)	2											105.0	115.0	112.0					2																	179440589		2017	4199	6216	179148835	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65347A>G	2.37:g.179440589T>C	ENSP00000465570:p.Lys21783Glu		179148835	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	14.67	2.603810	0.46423	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.76	5.76	0.90799	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75206	0.3818	L	0.49350	1.555	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.77523	-0.2556	9	0.87932	D	0	.	16.0659	0.80870	0.0:0.0:0.0:1.0	.	14359;14484;14551;21783	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	20856;14359;14551;14484;14357	ENSP00000343764:K20856E;ENSP00000434586:K14359E;ENSP00000340554:K14551E;ENSP00000352154:K14484E	ENSP00000340554:K14551E	K	-	1	0	TTN	179148835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.289000	0.72696	2.209000	0.71365	0.533000	0.62120	AAA		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
NEUROD1	4760	genome.wustl.edu	37	2	182543473	182543473	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0893-01	TCGA-13-0893-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:182543473T>A	ENST00000295108.3	-	2	572	c.115A>T	c.(115-117)Aag>Tag	p.K39*	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	39					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.K39*(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TCGTCCTCCTTCTTGTCTGCC	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	2											119.0	93.0	102.0					2																	182543473		2203	4300	6503	182251718	SO:0001587	stop_gained	4760			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.115A>T	2.37:g.182543473T>A	ENSP00000295108:p.Lys39*		182251718	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Nonsense_Mutation	SNP	ENST00000295108.3	37	CCDS2283.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	40	8.289589	0.98745	.	.	ENSG00000162992	ENST00000295108	.	.	.	5.37	5.37	0.77165	.	0.102483	0.41500	D	0.000879	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8009	13.3837	0.60783	0.0:0.0:0.0:1.0	.	.	.	.	X	39	.	ENSP00000295108:K39X	K	-	1	0	NEUROD1	182251718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.587000	0.82613	2.251000	0.74343	0.528000	0.53228	AAG		0.592	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		Nonsense_Mutation
DUSP19	142679	genome.wustl.edu	37	2	183948278	183948278	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:183948278A>G	ENST00000354221.4	+	2	444	c.269A>G	c.(268-270)aAt>aGt	p.N90S	AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.N90S	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	90					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.N90S(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						CTGAAAAAGAATAAGGTAAAA	0.299																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	98.0	97.0					2																	183948278		2202	4298	6500	183656523	SO:0001583	missense	142679			AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.269A>G	2.37:g.183948278A>G	ENSP00000346160:p.Asn90Ser		183656523	B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	CCDS2289.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	12.70	2.015708	0.35606	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	D;T	0.85171	-1.95;0.11	5.24	4.07	0.47477	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.580643	0.19616	N	0.110020	T	0.78842	0.4347	L	0.46614	1.455	0.22975	N	0.998489	B;B	0.15141	0.011;0.012	B;B	0.25759	0.012;0.063	T	0.58994	-0.7537	10	0.08179	T	0.78	.	11.4451	0.50118	0.8649:0.0:0.0:0.1351	.	90;90	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	S	90	ENSP00000343905:N90S;ENSP00000346160:N90S	ENSP00000343905:N90S	N	+	2	0	DUSP19	183656523	0.981000	0.34729	1.000000	0.80357	0.938000	0.57974	4.042000	0.57347	0.814000	0.34374	0.482000	0.46254	AAT		0.299	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			Missense_Mutation
FAM126B	285172	genome.wustl.edu	37	2	201846547	201846547	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr2:201846547C>A	ENST00000418596.3	-	12	1226	c.1039G>T	c.(1039-1041)Gca>Tca	p.A347S	AC005037.3_ENST00000332935.6_RNA|AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	347						intracellular (GO:0005622)		p.A347S(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						CCTTCATCTGCATCATTCAGG	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											79.0	78.0	78.0					2																	201846547		2203	4300	6503	201554792	SO:0001583	missense	285172			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.1039G>T	2.37:g.201846547C>A	ENSP00000393667:p.Ala347Ser		201554792	B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	ENST00000418596.3	37	CCDS2335.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130755	0.37630	.	.	ENSG00000155744	ENST00000418596	T	0.77489	-1.1	5.86	5.86	0.93980	.	0.053051	0.85682	D	0.000000	T	0.61924	0.2386	N	0.14661	0.345	0.54753	D	0.999981	P;B	0.42735	0.788;0.39	B;B	0.36464	0.225;0.142	T	0.62539	-0.6833	10	0.09084	T	0.74	-16.2935	20.2019	0.98263	0.0:1.0:0.0:0.0	.	153;347	B3KUG1;Q8IXS8	.;F126B_HUMAN	S	347	ENSP00000393667:A347S	ENSP00000393667:A347S	A	-	1	0	FAM126B	201554792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.875000	0.69660	2.776000	0.95493	0.655000	0.94253	GCA		0.448	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256285.3	NM_173822		Missense_Mutation
RYR2	6262	genome.wustl.edu	37	1	237863644	237863644	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr1:237863644C>A	ENST00000366574.2	+	65	9561	c.9244C>A	c.(9244-9246)Cac>Aac	p.H3082N	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.H3066N|RYR2_ENST00000360064.6_Missense_Mutation_p.H3080N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3082					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.H3080N(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAGTTCACTCACACCCGAAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											46.0	46.0	46.0					1																	237863644		1926	4134	6060	235930267	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9244C>A	1.37:g.237863644C>A	ENSP00000355533:p.His3082Asn		235930267	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682263	0.88542	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	D;D;D	0.96685	-4.09;-4.06;-4.08	4.97	4.97	0.65823	.	0.000000	0.64402	U	0.000007	D	0.94804	0.8322	M	0.64404	1.975	0.80722	D	1	P	0.45827	0.867	B	0.37451	0.25	D	0.95482	0.8561	10	0.62326	D	0.03	.	18.6031	0.91256	0.0:1.0:0.0:0.0	.	3082	Q92736	RYR2_HUMAN	N	3082;3080;3066;37;77	ENSP00000355533:H3082N;ENSP00000353174:H3080N;ENSP00000443798:H3066N	ENSP00000353174:H3080N	H	+	1	0	RYR2	235930267	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.449000	0.82847	0.557000	0.71058	CAC		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
C16orf45	89927	genome.wustl.edu	37	16	15609245	15609255	+	Frame_Shift_Del	DEL	CGGGAAGTCTT	CGGGAAGTCTT	-			TCGA-13-0893-01	TCGA-13-0893-10	CGGGAAGTCTT	CGGGAAGTCTT	CGGGAAGTCTT	-	CGGGAAGTCTT	CGGGAAGTCTT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr16:15609245_15609255delCGGGAAGTCTT	ENST00000300006.4	+	2	549_559	c.190_200delCGGGAAGTCTT	c.(190-201)cgggaagtcttgfs	p.REVL64fs	C16orf45_ENST00000452191.2_Frame_Shift_Del_p.REVL47fs|C16orf45_ENST00000566490.1_Frame_Shift_Del_p.REVL64fs|C16orf45_ENST00000561692.1_Frame_Shift_Del_p.REVL16fs	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	64								p.R64fs*6(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						TCAGCGTCTCCGGGAAGTCTTGGTCCGCCGG	0.512																																																1	Deletion - Frameshift(1)	ovary(1)	16																																								15516756	SO:0001589	frameshift_variant	89927			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.190_200delCGGGAAGTCTT	16.37:g.15609245_15609255delCGGGAAGTCTT	ENSP00000300006:p.Arg64fs		15516746	O00223|O75769|Q8IZ36|Q96H25	Frame_Shift_Del	DEL	ENST00000300006.4	37	CCDS10561.1	DEL	23	WashU																																																																																				0.512	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201		Frame_Shift_Del
KIAA0195	9772	genome.wustl.edu	37	17	73486828	73486828	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr17:73486828G>A	ENST00000314256.7	+	11	1511	c.1117G>A	c.(1117-1119)Gtc>Atc	p.V373I	KIAA0195_ENST00000579208.1_Missense_Mutation_p.V24I|KIAA0195_ENST00000375248.5_Missense_Mutation_p.V383I	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	373						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.V373I(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TACGGAGGCTGTCTCCTCTCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											94.0	79.0	84.0					17																	73486828		2203	4300	6503	70998423	SO:0001583	missense	9772				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1117G>A	17.37:g.73486828G>A	ENSP00000313885:p.Val373Ile		70998423	O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	CCDS32732.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	9.953	1.220615	0.22457	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.46819	0.86;0.86	5.7	3.64	0.41730	.	0.125529	0.53938	D	0.000060	T	0.38268	0.1034	L	0.50333	1.59	0.48040	D	0.999578	P;B;B	0.51791	0.948;0.05;0.148	B;B;B	0.40940	0.344;0.049;0.061	T	0.11251	-1.0595	10	0.23302	T	0.38	-24.7942	10.213	0.43152	0.0771:0.1356:0.7873:0.0	.	383;383;373	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	I	373;383	ENSP00000313885:V373I;ENSP00000364397:V383I	ENSP00000313885:V373I	V	+	1	0	KIAA0195	70998423	1.000000	0.71417	0.759000	0.31340	0.016000	0.09150	5.900000	0.69853	0.693000	0.31634	-0.302000	0.09304	GTC		0.562	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		Missense_Mutation
MED26	9441	genome.wustl.edu	37	19	16687873	16687873	+	Silent	SNP	C	C	A			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr19:16687873C>A	ENST00000263390.3	-	3	1030	c.768G>T	c.(766-768)gtG>gtT	p.V256V	CTC-429P9.4_ENST00000593962.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Silent_p.V264V	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	256	Pro-rich.				gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)	p.V256V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						GAGTCTCGTCCACCCTGTCCA	0.677																																																1	Substitution - coding silent(1)	ovary(1)	19											30.0	32.0	31.0					19																	16687873		2203	4300	6503	16548873	SO:0001819	synonymous_variant	9441			AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.768G>T	19.37:g.16687873C>A			16548873	A1A4S3|Q0VGB6	Silent	SNP	ENST00000263390.3	37	CCDS12347.1	SNP	21	WashU																																																																																				0.677	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1	NM_004831		Silent
TGM6	343641	genome.wustl.edu	37	20	2397927	2397927	+	Silent	SNP	C	C	T			TCGA-13-0893-01	TCGA-13-0893-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr20:2397927C>T	ENST00000202625.2	+	10	1447	c.1386C>T	c.(1384-1386)ttC>ttT	p.F462F	TGM6_ENST00000381423.1_Silent_p.F462F	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	462					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.F462F(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	ACAGGCTGTTCGGCGTGGAAG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											34.0	30.0	31.0					20																	2397927		2201	4299	6500	2345927	SO:0001819	synonymous_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1386C>T	20.37:g.2397927C>T			2345927	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	37	CCDS13025.1	SNP	31	WashU																																																																																				0.627	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		Silent
FOXS1	2307	genome.wustl.edu	37	20	30432788	30432788	+	Silent	SNP	A	A	T			TCGA-13-0893-01	TCGA-13-0893-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr20:30432788A>T	ENST00000375978.3	-	1	632	c.558T>A	c.(556-558)ccT>ccA	p.P186P		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	186					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P186P(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						TGGGTGGCCGAGGCCTGCCAT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	20											48.0	44.0	46.0					20																	30432788		2203	4300	6503	29896449	SO:0001819	synonymous_variant	2307			AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.558T>A	20.37:g.30432788A>T			29896449	Q96D28	Silent	SNP	ENST00000375978.3	37	CCDS13192.1	SNP	11	WashU																																																																																				0.632	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118		Silent
WDR48	57599	genome.wustl.edu	37	3	39093555	39093555	+	Silent	SNP	G	G	A			TCGA-13-0893-01	TCGA-13-0893-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0893-01	TCGA-13-0893-10	g.chr3:39093555G>A	ENST00000302313.5	+	1	67	c.39G>A	c.(37-39)agG>agA	p.R13R	WDR48_ENST00000418020.1_5'UTR|WDR48_ENST00000396258.3_5'UTR|WDR48_ENST00000544962.1_Silent_p.R13R	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	13					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)		p.R13R(1)		breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CAGGGCGGAGGAAAGTGCAGG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	64.0	65.0					3																	39093555		2203	4300	6503	39068559	SO:0001819	synonymous_variant	57599			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.39G>A	3.37:g.39093555G>A			39068559	B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Silent	SNP	ENST00000302313.5	37	CCDS33738.1	SNP	41	WashU																																																																																				0.667	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342529.1	NM_020839		Silent
